#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA8	10351	genome.wustl.edu	37	17	66871764	66871764	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:66871764C>T	ENST00000269080.2	-	34	4498	c.4361G>A	c.(4360-4362)gGg>gAg	p.G1454E	ABCA8_ENST00000586539.1_Missense_Mutation_p.G1494E|ABCA8_ENST00000430352.2_Missense_Mutation_p.G1494E	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1454	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CCTCAACCTCCCAGATACCAT	0.557																																						dbGAP											0													91.0	73.0	79.0					17																	66871764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4361G>A	17.37:g.66871764C>T	ENSP00000269080:p.Gly1454Glu		A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G1494E	ENST00000269080.2	37	c.4481	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769265	0.69992	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.99815	-6.9;-6.9	4.36	4.36	0.52297	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.49305	D	0.000155	D	0.99880	0.9943	H	0.96269	3.795	0.58432	D	0.999999	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.79108	0.983;0.992;0.988	D	0.96240	0.9175	10	0.87932	D	0	.	16.4175	0.83746	0.0:1.0:0.0:0.0	.	1494;1494;1454	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	E	1454;1494	ENSP00000269080:G1454E;ENSP00000402814:G1494E	ENSP00000269080:G1454E	G	-	2	0	ABCA8	64383359	1.000000	0.71417	0.739000	0.30968	0.490000	0.33462	7.276000	0.78559	2.441000	0.82636	0.650000	0.86243	GGG	ABCA8	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000141338		0.557	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	106	0.00	0	C	NM_007168		66871764	66871764	-1	no_errors	ENST00000430352	ensembl	human	known	69_37n	missense	71	51.70	76	SNP	1.000	T
ADAMTS9	56999	genome.wustl.edu	37	3	64666906	64666906	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:64666906G>C	ENST00000498707.1	-	3	992	c.650C>G	c.(649-651)tCa>tGa	p.S217*	ADAMTS9_ENST00000459780.1_Nonsense_Mutation_p.S217*|ADAMTS9_ENST00000295903.4_Nonsense_Mutation_p.S217*	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	217					glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CCTTCCTGTTGAGGGCTCTCT	0.458																																						dbGAP											0													149.0	134.0	139.0					3																	64666906		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.650C>G	3.37:g.64666906G>C	ENSP00000418735:p.Ser217*		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Nonsense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.S217*	ENST00000498707.1	37	c.650	CCDS2903.1	3	.	.	.	.	.	.	.	.	.	.	G	38	7.044140	0.98025	.	.	ENSG00000163638	ENST00000295903;ENST00000498707;ENST00000459780	.	.	.	6.04	4.21	0.49690	.	0.435248	0.23265	N	0.050096	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	12.2085	0.54365	0.065:0.1196:0.8155:0.0	.	.	.	.	X	217	.	ENSP00000295903:S217X	S	-	2	0	ADAMTS9	64641946	0.343000	0.24818	0.008000	0.14137	0.118000	0.20060	3.364000	0.52328	1.528000	0.49103	0.561000	0.74099	TCA	ADAMTS9	-	NULL	ENSG00000163638		0.458	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	HGNC	protein_coding	OTTHUMT00000351891.1	55	0.00	0	G			64666906	64666906	-1	no_errors	ENST00000498707	ensembl	human	known	69_37n	nonsense	9	60.87	14	SNP	0.015	C
ADCY4	196883	genome.wustl.edu	37	14	24793371	24793371	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:24793371C>A	ENST00000310677.4	-	17	2056	c.1943G>T	c.(1942-1944)tGg>tTg	p.W648L	ADCY4_ENST00000554068.2_Missense_Mutation_p.W648L|ADCY4_ENST00000418030.2_Missense_Mutation_p.W648L|ADCY4_ENST00000396747.3_Missense_Mutation_p.W341L	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	648					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		TGCAGGCAGCCAGTGCAGCAT	0.612																																						dbGAP											0													63.0	63.0	63.0					14																	24793371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.1943G>T	14.37:g.24793371C>A	ENSP00000312126:p.Trp648Leu		B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.W648L	ENST00000310677.4	37	c.1943	CCDS9627.1	14	.	.	.	.	.	.	.	.	.	.	C	17.29	3.351582	0.61183	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030;ENST00000396747	T;T;T;T	0.79554	-0.97;-0.97;-0.97;-1.28	4.93	4.93	0.64822	.	0.000000	0.43260	D	0.000586	T	0.76256	0.3962	L	0.57536	1.79	0.47037	D	0.999297	B	0.17667	0.023	B	0.14023	0.01	T	0.70510	-0.4852	10	0.16420	T	0.52	.	15.6732	0.77295	0.0:1.0:0.0:0.0	.	648	Q8NFM4	ADCY4_HUMAN	L	648;648;648;341	ENSP00000312126:W648L;ENSP00000452250:W648L;ENSP00000393177:W648L;ENSP00000379971:W341L	ENSP00000312126:W648L	W	-	2	0	ADCY4	23863211	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.760000	0.47581	2.569000	0.86673	0.563000	0.77884	TGG	ADCY4	-	NULL	ENSG00000129467		0.612	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY4	HGNC	protein_coding	OTTHUMT00000073200.4	82	0.00	0	C			24793371	24793371	-1	no_errors	ENST00000310677	ensembl	human	known	69_37n	missense	24	40.00	16	SNP	1.000	A
AHRR	57491	genome.wustl.edu	37	5	413494	413494	+	Silent	SNP	A	A	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr5:413494A>G	ENST00000505113.1	+	5	443	c.399A>G	c.(397-399)gaA>gaG	p.E133E	AHRR_ENST00000316418.5_Silent_p.E133E|AHRR_ENST00000512529.1_5'UTR	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	133	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			TGAGTGCAGAAGGGACGATAT	0.403																																						dbGAP											0													151.0	135.0	140.0					5																	413494		1898	4107	6005	-	-	-	SO:0001819	synonymous_variant	0			AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.399A>G	5.37:g.413494A>G			A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pfscan_PAS,pfscan_HLH_DNA-bd	p.E133	ENST00000505113.1	37	c.399	CCDS56355.1	5																																																																																			AHRR	-	pfam_PAS_fold,smart_PAS,pfscan_PAS	ENSG00000063438		0.403	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AHRR	HGNC	protein_coding	OTTHUMT00000367720.1	58	0.00	0	A	NM_020731		413494	413494	+1	no_errors	ENST00000316418	ensembl	human	known	69_37n	silent	18	28.00	7	SNP	1.000	G
AK4	205	genome.wustl.edu	37	1	65656509	65656509	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:65656509G>A	ENST00000327299.7	+	2	467	c.262G>A	c.(262-264)Gat>Aat	p.D88N	AK4_ENST00000470888.2_3'UTR|AK4_ENST00000546702.1_Missense_Mutation_p.D36N|AK4_ENST00000395334.2_Missense_Mutation_p.D88N|AK4_ENST00000545314.1_Missense_Mutation_p.D88N	NM_013410.3	NP_037542.1			adenylate kinase 4											breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	9						CTGGCTCCTTGATGGTGAGTT	0.443																																						dbGAP											0													61.0	57.0	58.0					1																	65656509		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025926	CCDS629.1	1p31.3	2012-10-02	2010-06-15	2010-06-15	ENSG00000162433	ENSG00000162433	2.7.4.3	"""Adenylate kinases"""	363	protein-coding gene	gene with protein product		103030	"""adenylate kinase 3"", ""adenylate kinase 3-like 1"""	AK3, AK3L1		11485571	Standard	NM_203464		Approved		uc001dby.3	P27144	OTTHUMG00000009033	ENST00000327299.7:c.262G>A	1.37:g.65656509G>A	ENSP00000322175:p.Asp88Asn			Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_Adenylate_kinase_lid-dom,superfamily_Adenylate_kinase_lid-dom,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	p.D88N	ENST00000327299.7	37	c.262	CCDS629.1	1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.615981	0.46631	.	.	ENSG00000162433	ENST00000545314;ENST00000546702;ENST00000395334;ENST00000327299	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.11	4.2	0.49525	.	0.212897	0.47852	D	0.000208	T	0.75620	0.3874	H	0.97783	4.075	0.48762	D	0.999702	D	0.76494	0.999	D	0.66847	0.947	D	0.83469	0.0058	10	0.87932	D	0	-18.0934	10.813	0.46557	0.0886:0.0:0.9114:0.0	.	88	P27144	KAD4_HUMAN	N	88;36;88;88	ENSP00000445912:D88N;ENSP00000448458:D36N;ENSP00000378743:D88N;ENSP00000322175:D88N	ENSP00000322175:D88N	D	+	1	0	AK4	65429097	1.000000	0.71417	0.190000	0.23270	0.069000	0.16628	4.497000	0.60367	1.394000	0.46624	0.557000	0.71058	GAT	AK4	-	pfam_Adenylate_kin,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	ENSG00000162433		0.443	AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK4	HGNC	protein_coding	OTTHUMT00000025040.2	106	0.00	0	G	NM_013410		65656509	65656509	+1	no_errors	ENST00000327299	ensembl	human	known	69_37n	missense	98	28.78	40	SNP	0.517	A
ALDH1A3	220	genome.wustl.edu	37	15	101447358	101447358	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr15:101447358C>G	ENST00000329841.5	+	11	1798	c.1266C>G	c.(1264-1266)ttC>ttG	p.F422L	ALDH1A3_ENST00000346623.6_Missense_Mutation_p.F315L|RP11-66B24.4_ENST00000560351.1_RNA	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	422					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	TACTGAAGTTCAAAAGTATCG	0.423																																						dbGAP											0													126.0	114.0	118.0					15																	101447358		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.1266C>G	15.37:g.101447358C>G	ENSP00000332256:p.Phe422Leu		Q6NT64	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.F422L	ENST00000329841.5	37	c.1266	CCDS10389.1	15	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955090	0.53293	.	.	ENSG00000184254	ENST00000329841;ENST00000346623	T	0.79033	-1.23	4.27	3.34	0.38264	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.102971	0.64402	N	0.000002	D	0.88577	0.6474	H	0.98178	4.165	0.51233	D	0.999913	P;B	0.36199	0.543;0.003	P;B	0.47102	0.537;0.012	D	0.88924	0.3368	10	0.87932	D	0	.	9.6313	0.39780	0.0:0.827:0.0:0.173	.	326;422	Q7Z3A2;P47895	.;AL1A3_HUMAN	L	422;326	ENSP00000332256:F422L	ENSP00000332256:F422L	F	+	3	2	ALDH1A3	99264881	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	0.812000	0.27211	0.871000	0.35750	0.650000	0.86243	TTC	ALDH1A3	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000184254		0.423	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A3	HGNC	protein_coding	OTTHUMT00000313620.2	181	0.00	0	C			101447358	101447358	+1	no_errors	ENST00000329841	ensembl	human	known	69_37n	missense	96	32.17	46	SNP	1.000	G
CARF	79800	genome.wustl.edu	37	2	203848276	203848276	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:203848276G>C	ENST00000402905.3	+	16	2428	c.2107G>C	c.(2107-2109)Gaa>Caa	p.E703Q	CARF_ENST00000320443.8_Missense_Mutation_p.E703Q|CARF_ENST00000428585.1_Missense_Mutation_p.E627Q|CARF_ENST00000438828.2_Missense_Mutation_p.E703Q|CARF_ENST00000545262.1_Missense_Mutation_p.E627Q|CARF_ENST00000545253.1_Missense_Mutation_p.E615Q|WDR12_ENST00000477723.1_Intron|CARF_ENST00000414439.1_Missense_Mutation_p.E601Q	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	703					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGTTAAACAAGAACCCAAAGA	0.308																																						dbGAP											0													85.0	82.0	83.0					2																	203848276		1803	4075	5878	-	-	-	SO:0001583	missense	0			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.2107G>C	2.37:g.203848276G>C	ENSP00000384006:p.Glu703Gln		B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	NULL	p.E703Q	ENST00000402905.3	37	c.2107	CCDS42801.1	2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138423	0.77775	.	.	ENSG00000138380	ENST00000402905;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000320443;ENST00000438828	.	.	.	5.02	5.02	0.67125	.	0.000000	0.64402	D	0.000006	T	0.75744	0.3891	M	0.64997	1.995	0.39296	D	0.964825	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68943	0.961;0.961;0.961	T	0.78961	-0.1997	9	0.59425	D	0.04	-18.2663	15.855	0.78972	0.0:0.0:1.0:0.0	.	615;627;703	B4DIA7;G3V1K7;Q8N187	.;.;AL2S8_HUMAN	Q	703;601;627;615;627;703;703	.	ENSP00000316224:E703Q	E	+	1	0	ALS2CR8	203556521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.604000	0.67626	2.488000	0.83962	0.650000	0.86243	GAA	ALS2CR8	-	NULL	ENSG00000138380		0.308	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CR8	HGNC	protein_coding	OTTHUMT00000335768.5	127	0.00	0	G	NM_001104586		203848276	203848276	+1	no_errors	ENST00000320443	ensembl	human	known	69_37n	missense	271	25.89	95	SNP	1.000	C
AMY2A	279	genome.wustl.edu	37	1	104161640	104161640	+	Silent	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:104161640T>C	ENST00000414303.2	+	3	487	c.423T>C	c.(421-423)ttT>ttC	p.F141F		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	141					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	GTAGGGACTTTCCAGCAGTCC	0.403																																						dbGAP											0													6.0	6.0	6.0					1																	104161640		1570	3269	4839	-	-	-	SO:0001819	synonymous_variant	0			BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.423T>C	1.37:g.104161640T>C			B9EJG1|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,prints_Alpha_amylase	p.S140P	ENST00000414303.2	37	c.418	CCDS783.1	1	.	.	.	.	.	.	.	.	.	.	t	0.850	-0.738917	0.03088	.	.	ENSG00000243480	ENST00000423678	.	.	.	2.77	1.61	0.23674	.	.	.	.	.	T	0.38268	0.1034	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22417	-1.0217	4	.	.	.	.	5.8577	0.18728	0.0:0.3739:0.0:0.626	.	.	.	.	P	140	.	.	S	+	1	0	AMY2A	103963163	0.977000	0.34250	0.652000	0.29579	0.223000	0.24884	0.121000	0.15667	0.299000	0.22661	0.254000	0.18369	TCC	AMY2A	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000243480		0.403	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2A	HGNC	protein_coding	OTTHUMT00000030315.1	106	0.00	0	T	NM_000699		104161640	104161640	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000423678	ensembl	human	putative	69_37n	missense	84	53.80	99	SNP	1.000	C
ANKRD17	26057	genome.wustl.edu	37	4	74014637	74014637	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr4:74014637A>G	ENST00000358602.4	-	8	1576	c.1460T>C	c.(1459-1461)aTt>aCt	p.I487T	ANKRD17_ENST00000509867.2_Missense_Mutation_p.I374T|ANKRD17_ENST00000514252.1_5'UTR|ANKRD17_ENST00000330838.6_Missense_Mutation_p.I487T	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	487					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCCTCTTTCAATAAGTAAAGC	0.463																																						dbGAP											0													90.0	76.0	81.0					4																	74014637		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.1460T>C	4.37:g.74014637A>G	ENSP00000351416:p.Ile487Thr		E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.I487T	ENST00000358602.4	37	c.1460	CCDS34004.1	4	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524281	0.85600	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.69561	-0.41;-0.41;-0.41	5.28	5.28	0.74379	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000004	T	0.81922	0.4925	M	0.77712	2.385	0.43014	D	0.99455	D;D;D;D;D	0.89917	0.99;0.998;1.0;0.999;0.998	D;D;D;D;D	0.87578	0.985;0.986;0.998;0.996;0.992	D	0.84767	0.0765	10	0.72032	D	0.01	.	15.5103	0.75776	1.0:0.0:0.0:0.0	.	72;487;487;487;374	B4DR08;O75179-2;G5E964;O75179;E7EUV3	.;.;.;ANR17_HUMAN;.	T	487;487;487;374;487	ENSP00000351416:I487T;ENSP00000332265:I487T;ENSP00000427151:I374T	ENSP00000332265:I487T	I	-	2	0	ANKRD17	74233501	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.115000	0.64714	0.482000	0.46254	ATT	ANKRD17	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000132466		0.463	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD17	HGNC	protein_coding	OTTHUMT00000362475.1	59	0.00	0	A	NM_032217		74014637	74014637	-1	no_errors	ENST00000358602	ensembl	human	known	69_37n	missense	70	30.00	30	SNP	1.000	G
ANKRD35	148741	genome.wustl.edu	37	1	145562092	145562092	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:145562092G>C	ENST00000355594.4	+	10	1867	c.1780G>C	c.(1780-1782)Gag>Cag	p.E594Q		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	594										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGCTCGAGGAGAGCCTCTAGG	0.572																																					Melanoma(9;127 754 22988 51047)	dbGAP											0													36.0	48.0	44.0					1																	145562092		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1780G>C	1.37:g.145562092G>C	ENSP00000347802:p.Glu594Gln		A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E594Q	ENST00000355594.4	37	c.1780	CCDS919.1	1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.253992	0.22965	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.50001	0.76	4.87	3.95	0.45737	.	0.136874	0.33005	N	0.005394	T	0.21307	0.0513	L	0.38838	1.175	0.80722	D	1	B	0.14805	0.011	B	0.10450	0.005	T	0.07462	-1.0771	10	0.41790	T	0.15	-14.5457	11.0492	0.47876	0.0:0.1876:0.8124:0.0	.	594	Q8N283	ANR35_HUMAN	Q	503;594	ENSP00000347802:E594Q	ENSP00000347802:E594Q	E	+	1	0	ANKRD35	144273449	0.746000	0.28272	0.930000	0.37139	0.516000	0.34256	1.582000	0.36568	1.261000	0.44149	0.655000	0.94253	GAG	ANKRD35	-	NULL	ENSG00000198483		0.572	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	HGNC	protein_coding	OTTHUMT00000038515.1	61	0.00	0	G	NM_144698		145562092	145562092	+1	no_errors	ENST00000355594	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	0.903	C
ANLN	54443	genome.wustl.edu	37	7	36465627	36465627	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:36465627A>T	ENST00000265748.2	+	19	2973	c.2752A>T	c.(2752-2754)Agc>Tgc	p.S918C	ANLN_ENST00000396068.2_Missense_Mutation_p.S881C	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	918	Localization to the cleavage furrow.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						TTTTTAGAAAAGCAACATTCA	0.269																																						dbGAP											0													30.0	36.0	34.0					7																	36465627		2192	4276	6468	-	-	-	SO:0001583	missense	0			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.2752A>T	7.37:g.36465627A>T	ENSP00000265748:p.Ser918Cys		Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S918C	ENST00000265748.2	37	c.2752	CCDS5447.1	7	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	18.38|18.38|18.38	3.612302|3.612302|3.612302	0.66672|0.66672|0.66672	.|.|.	.|.|.	ENSG00000011426|ENSG00000011426|ENSG00000011426	ENST00000428612|ENST00000446635;ENST00000457743|ENST00000265748;ENST00000396068	.|T;T|T;T	.|0.55234|0.15017	.|0.53;0.81|2.46;2.5	4.87|4.87|4.87	4.87|4.87|4.87	0.63330|0.63330|0.63330	.|.|.	.|.|0.254621	.|.|0.45867	.|.|D	.|.|0.000331	T|T|T	0.39036|0.39036|0.39036	0.1063|0.1063|0.1063	M|M|M	0.61703|0.61703|0.61703	1.905|1.905|1.905	0.58432|0.58432|0.58432	D|D|D	0.999996|0.999996|0.999996	.|.|D;D;D;D	.|.|0.89917	.|.|1.0;1.0;1.0;1.0	.|.|D;D;D;D	.|.|0.91635	.|.|0.999;0.986;0.976;0.986	T|T|T	0.20806|0.20806|0.20806	-1.0264|-1.0264|-1.0264	6|7|10	0.56958|0.72032|0.87932	D|D|D	0.05|0.01|0	-13.6648|-13.6648|-13.6648	14.0977|14.0977|14.0977	0.65034|0.65034|0.65034	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|.|795;880;881;918	.|.|B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.|.|.;.;.;ANLN_HUMAN	M|N|C	82|271;121|918;881	.|ENSP00000400777:K271N;ENSP00000399553:K121N|ENSP00000265748:S918C;ENSP00000379380:S881C	ENSP00000413522:K82M|ENSP00000400777:K271N|ENSP00000265748:S918C	K|K|S	+|+|+	2|3|1	0|2|0	ANLN|ANLN|ANLN	36432152|36432152|36432152	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.660000|0.660000|0.660000	0.38997|0.38997|0.38997	3.241000|3.241000|3.241000	0.51376|0.51376|0.51376	2.167000|2.167000|2.167000	0.68274|0.68274|0.68274	0.528000|0.528000|0.528000	0.53228|0.53228|0.53228	AAG|AAA|AGC	ANLN	-	NULL	ENSG00000011426		0.269	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	HGNC	protein_coding	OTTHUMT00000218582.3	75	0.00	0	A	NM_018685		36465627	36465627	+1	no_errors	ENST00000265748	ensembl	human	known	69_37n	missense	87	17.14	18	SNP	1.000	T
APBA1	320	genome.wustl.edu	37	9	72055953	72055953	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:72055953C>G	ENST00000265381.4	-	11	2482	c.2260G>C	c.(2260-2262)Gac>Cac	p.D754H		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	754	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						TAGCGAAGGTCTGGTCTTCTG	0.438																																						dbGAP											0													164.0	146.0	152.0					9																	72055953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.2260G>C	9.37:g.72055953C>G	ENSP00000265381:p.Asp754His		O14914|O60570|Q5VYR8	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.D754H	ENST00000265381.4	37	c.2260	CCDS6630.1	9	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004906	0.74932	.	.	ENSG00000107282	ENST00000265381	T	0.46819	0.86	5.91	5.91	0.95273	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.63070	0.2480	L	0.39326	1.205	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57516	-0.7798	10	0.39692	T	0.17	-25.3812	20.2985	0.98592	0.0:1.0:0.0:0.0	.	754	Q02410	APBA1_HUMAN	H	754	ENSP00000265381:D754H	ENSP00000265381:D754H	D	-	1	0	APBA1	71245773	1.000000	0.71417	0.985000	0.45067	0.991000	0.79684	7.711000	0.84669	2.793000	0.96121	0.655000	0.94253	GAC	APBA1	-	pfam_PDZ,superfamily_PDZ,pfscan_PDZ	ENSG00000107282		0.438	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	HGNC	protein_coding	OTTHUMT00000052589.2	254	0.00	0	C	NM_001163		72055953	72055953	-1	no_errors	ENST00000265381	ensembl	human	known	69_37n	missense	138	31.37	64	SNP	1.000	G
ARHGAP1	392	genome.wustl.edu	37	11	46717591	46717591	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr11:46717591G>A	ENST00000311956.4	-	2	164	c.67C>T	c.(67-69)Ctg>Ttg	p.L23L		NM_004308.3	NP_004299.1	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	23					positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	Rac GTPase activator activity (GO:0030675)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		GCCAGCTTCAGCTGGTTCAGA	0.587																																						dbGAP											0													76.0	59.0	65.0					11																	46717591		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			BC018118	CCDS7922.1	11p11.2	2006-04-11			ENSG00000175220	ENSG00000175220		"""Rho GTPase activating proteins"""	673	protein-coding gene	gene with protein product		602732				8288572	Standard	NM_004308		Approved	RhoGAP, p50rhoGAP, CDC42GAP, Cdc42GAP	uc001ndd.4	Q07960	OTTHUMG00000166567	ENST00000311956.4:c.67C>T	11.37:g.46717591G>A			D3DQQ6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_CRAL-TRIO_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CRAL-TRIO_dom,smart_RhoGAP_dom,pfscan_CRAL-TRIO_dom,pfscan_RhoGAP_dom	p.A20V	ENST00000311956.4	37	c.59	CCDS7922.1	11	.	.	.	.	.	.	.	.	.	.	G	10.39	1.337306	0.24253	.	.	ENSG00000175220	ENST00000528837	.	.	.	5.2	4.27	0.50696	.	.	.	.	.	T	0.63908	0.2551	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62305	-0.6882	4	.	.	.	.	12.8261	0.57721	0.0803:0.0:0.9197:0.0	.	.	.	.	V	20	.	.	A	-	2	0	ARHGAP1	46674167	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.525000	0.67110	1.179000	0.42884	0.555000	0.69702	GCT	ARHGAP1	-	NULL	ENSG00000175220		0.587	ARHGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP1	HGNC	protein_coding	OTTHUMT00000390472.1	29	0.00	0	G	NM_004308		46717591	46717591	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000528837	ensembl	human	novel	69_37n	missense	11	38.89	7	SNP	1.000	A
ARPC2	10109	genome.wustl.edu	37	2	219103560	219103560	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:219103560G>A	ENST00000295685.10	+	5	703	c.442G>A	c.(442-444)Gat>Aat	p.D148N	ARPC2_ENST00000315717.5_Missense_Mutation_p.D148N|ARPC2_ENST00000477992.1_3'UTR	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa	148					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCATTATAGGGATGATGAGAC	0.423																																						dbGAP											0													70.0	67.0	68.0					2																	219103560		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.442G>A	2.37:g.219103560G>A	ENSP00000295685:p.Asp148Asn		Q92801|Q9P1D4	Missense_Mutation	SNP	pfam_P34-arc	p.D148N	ENST00000295685.10	37	c.442	CCDS2410.1	2	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703586	0.48412	.	.	ENSG00000163466	ENST00000315717;ENST00000295685	.	.	.	5.65	5.65	0.86999	.	0.043486	0.85682	D	0.000000	T	0.65439	0.2691	L	0.56199	1.76	0.80722	D	1	B	0.10296	0.003	B	0.15484	0.013	T	0.58064	-0.7702	9	0.35671	T	0.21	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	148	O15144	ARPC2_HUMAN	N	148	.	ENSP00000295685:D148N	D	+	1	0	ARPC2	218811805	1.000000	0.71417	1.000000	0.80357	0.147000	0.21601	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	GAT	ARPC2	-	pfam_P34-arc	ENSG00000163466		0.423	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC2	HGNC	protein_coding	OTTHUMT00000256777.2	89	0.00	0	G	NM_005731		219103560	219103560	+1	no_errors	ENST00000295685	ensembl	human	known	69_37n	missense	66	42.61	49	SNP	1.000	A
ATF6	22926	genome.wustl.edu	37	1	161789606	161789606	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:161789606G>C	ENST00000367942.3	+	8	1160	c.1093G>C	c.(1093-1095)Gag>Cag	p.E365Q		NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	365	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	AGTTGTGTCAGAGGTAAGTGT	0.388																																						dbGAP											0													58.0	57.0	57.0					1																	161789606		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.1093G>C	1.37:g.161789606G>C	ENSP00000356919:p.Glu365Gln		O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.E365Q	ENST00000367942.3	37	c.1093	CCDS1235.1	1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.463003	0.63513	.	.	ENSG00000118217	ENST00000367942	T	0.56444	0.46	5.19	5.19	0.71726	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	T	0.57417	0.2052	M	0.64170	1.965	0.54753	D	0.999986	D;P	0.53462	0.96;0.568	P;B	0.61397	0.888;0.289	T	0.53301	-0.8458	9	0.24483	T	0.36	-19.6036	16.2232	0.82269	0.0:0.0:1.0:0.0	.	365;366	P18850;Q59H30	ATF6A_HUMAN;.	Q	365	ENSP00000356919:E365Q	ENSP00000356919:E365Q	E	+	1	0	ATF6	160056230	1.000000	0.71417	0.970000	0.41538	0.148000	0.21650	6.652000	0.74377	2.408000	0.81797	0.650000	0.86243	GAG	ATF6	-	pfam_bZIP_1,smart_bZIP,pfscan_bZIP	ENSG00000118217		0.388	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF6	HGNC	protein_coding	OTTHUMT00000060304.2	103	0.00	0	G	NM_007348		161789606	161789606	+1	no_errors	ENST00000367942	ensembl	human	known	69_37n	missense	199	24.91	66	SNP	0.999	C
ATG4D	84971	genome.wustl.edu	37	19	10655730	10655730	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:10655730C>A	ENST00000309469.4	+	3	590	c.417C>A	c.(415-417)gaC>gaA	p.D139E	ATG4D_ENST00000540862.1_5'UTR	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	139					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TGACCTCGGACTGTGGCTGGG	0.637																																						dbGAP											0													95.0	101.0	99.0					19																	10655730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.417C>A	19.37:g.10655730C>A	ENSP00000311318:p.Asp139Glu		Q969K0	Missense_Mutation	SNP	pfam_Peptidase_C54	p.D139E	ENST00000309469.4	37	c.417	CCDS12241.1	19	.	.	.	.	.	.	.	.	.	.	C	18.40	3.615268	0.66672	.	.	ENSG00000130734	ENST00000309469	T	0.76839	-1.05	4.84	2.7	0.31948	.	0.000000	0.85682	D	0.000000	D	0.89539	0.6744	H	0.94734	3.575	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.994	D;D;D	0.74348	0.983;0.943;0.972	D	0.89334	0.3649	10	0.87932	D	0	-33.237	9.8624	0.41123	0.0:0.8271:0.0:0.1729	.	76;162;139	B4DGM8;B7ZAY9;Q86TL0	.;.;ATG4D_HUMAN	E	139	ENSP00000311318:D139E	ENSP00000311318:D139E	D	+	3	2	ATG4D	10516730	1.000000	0.71417	0.998000	0.56505	0.200000	0.23975	3.010000	0.49559	0.451000	0.26802	0.643000	0.83706	GAC	ATG4D	-	pfam_Peptidase_C54	ENSG00000130734		0.637	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4D	HGNC	protein_coding	OTTHUMT00000452022.1	101	0.98	1	C	NM_032885		10655730	10655730	+1	no_errors	ENST00000309469	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	1.000	A
ATP12A	479	genome.wustl.edu	37	13	25274963	25274963	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr13:25274963C>T	ENST00000381946.3	+	13	1951	c.1784C>T	c.(1783-1785)aCc>aTc	p.T595I	RNY1P7_ENST00000384743.1_RNA|ATP12A_ENST00000218548.6_Missense_Mutation_p.T601I			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	595					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AACTTTCCGACCTCCAACCTC	0.493																																					Pancreas(156;1582 1935 18898 22665 26498)	dbGAP											0													160.0	144.0	149.0					13																	25274963		2203	4300	6503	-	-	-	SO:0001583	missense	0			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1784C>T	13.37:g.25274963C>T	ENSP00000371372:p.Thr595Ile		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.T601I	ENST00000381946.3	37	c.1802	CCDS31948.1	13	.	.	.	.	.	.	.	.	.	.	C	11.28	1.593354	0.28357	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	T;T	0.78816	-1.21;-1.21	6.17	4.46	0.54185	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.069887	0.64402	D	0.000014	T	0.68100	0.2964	N	0.11313	0.125	0.44241	D	0.997082	P;P	0.42785	0.679;0.79	P;P	0.52823	0.607;0.71	T	0.62248	-0.6894	10	0.15952	T	0.53	.	9.8685	0.41160	0.1394:0.7884:0.0:0.0722	.	601;595	P54707-2;P54707	.;AT12A_HUMAN	I	601;595	ENSP00000218548:T601I;ENSP00000371372:T595I	ENSP00000218548:T601I	T	+	2	0	ATP12A	24172963	0.819000	0.29175	0.422000	0.26621	0.115000	0.19883	1.705000	0.37867	0.940000	0.37473	0.655000	0.94253	ACC	ATP12A	-	pfam_Dehalogen-like_hydro,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000075673		0.493	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	HGNC	protein_coding	OTTHUMT00000044199.1	114	0.00	0	C	NM_001676		25274963	25274963	+1	no_errors	ENST00000218548	ensembl	human	known	69_37n	missense	39	44.29	31	SNP	0.922	T
ATP1A4	480	genome.wustl.edu	37	1	160123015	160123015	+	Splice_Site	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:160123015G>T	ENST00000368081.4	+	2	678		c.e2+1			NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide						ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			Cctgacaaaggtgagtaagaa	0.532																																						dbGAP											0													86.0	76.0	80.0					1																	160123015		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.207+1G>T	1.37:g.160123015G>T			Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Splice_Site	SNP	-	e2+1	ENST00000368081.4	37	c.207+1	CCDS1197.1	1																																																																																			ATP1A4	-	-	ENSG00000132681		0.532	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	191	0.00	0	G	NM_144699	Intron	160123015	160123015	+1	no_errors	ENST00000368081	ensembl	human	known	69_37n	splice_site	157	26.29	56	SNP	1.000	T
ATP2A3	489	genome.wustl.edu	37	17	3846793	3846793	+	Silent	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:3846793C>T	ENST00000352011.3	-	11	1365	c.1311G>A	c.(1309-1311)gtG>gtA	p.V437V	ATP2A3_ENST00000397041.3_Silent_p.V437V|ATP2A3_ENST00000309890.7_Silent_p.V437V|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000397043.3_Silent_p.V437V|ATP2A3_ENST00000359983.3_Silent_p.V437V|ATP2A3_ENST00000397035.3_Silent_p.V437V			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	437					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		TGGCCTCTCCCACCTTCTCAT	0.642																																					GBM(32;29 774 15719 37967)	dbGAP											0													143.0	128.0	133.0					17																	3846793		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.1311G>A	17.37:g.3846793C>T			A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.V437	ENST00000352011.3	37	c.1311	CCDS11041.1	17																																																																																			ATP2A3	-	superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Ca-transp	ENSG00000074370		0.642	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	ATP2A3	HGNC	protein_coding	OTTHUMT00000438401.1	187	0.00	0	C	NM_174953		3846793	3846793	-1	no_errors	ENST00000359983	ensembl	human	known	69_37n	silent	17	57.14	24	SNP	1.000	T
ATP6V1G2	534	genome.wustl.edu	37	6	31513277	31513277	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:31513277G>A	ENST00000303892.5	-	3	549	c.265C>T	c.(265-267)Cag>Tag	p.Q89*	ATP6V1G2-DDX39B_ENST00000475917.1_Intron|NFKBIL1_ENST00000376145.4_5'Flank|ATP6V1G2_ENST00000483251.1_Nonsense_Mutation_p.Q48*|DDX39B-AS1_ENST00000420520.1_RNA|ATP6V1G2-DDX39B_ENST00000376185.1_Intron|ATP6V1G2_ENST00000483170.1_5'UTR|NFKBIL1_ENST00000376148.4_5'Flank|ATP6V1G2_ENST00000376151.4_Nonsense_Mutation_p.Q49*|DDX39B-AS1_ENST00000416684.1_RNA	NM_130463.3|NM_138282.2	NP_569730.1|NP_612139.1	O95670	VATG2_HUMAN	ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2	89					cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			breast(1)|large_intestine(2)|lung(1)|prostate(1)	5						CGGTTTCTCTGCTGGGAGCTC	0.657																																						dbGAP											0													50.0	46.0	47.0					6																	31513277		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Y14768	CCDS4698.1, CCDS4699.1, CCDS56413.1	6p21.3	2011-03-29	2006-01-13	2002-05-10	ENSG00000213760	ENSG00000213760		"""ATPases / V-type"""	862	protein-coding gene	gene with protein product		606853	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"", ""ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2"""	ATP6G, ATP6G2		10202016	Standard	NM_138282		Approved	Vma10, NG38, Em:AC004181.3	uc003nua.3	O95670	OTTHUMG00000166618	ENST00000303892.5:c.265C>T	6.37:g.31513277G>A	ENSP00000302194:p.Gln89*		B5MEF0|Q2L6F8|Q5HYU8|Q5RJ63	Nonsense_Mutation	SNP	pfam_V-ATPase_G,tigrfam_V-ATPase_G	p.Q89*	ENST00000303892.5	37	c.265	CCDS4698.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.634172	0.97722	.	.	ENSG00000213760	ENST00000376151;ENST00000303892;ENST00000483251;ENST00000415099	.	.	.	4.81	4.81	0.61882	.	0.108681	0.42172	U	0.000755	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-10.1587	11.1568	0.48493	0.0:0.1861:0.8139:0.0	.	.	.	.	X	49;89;48;129	.	ENSP00000302194:Q89X	Q	-	1	0	ATP6V1G2	31621256	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.203000	0.51075	2.492000	0.84095	0.655000	0.94253	CAG	ATP6V1G2	-	pfam_V-ATPase_G,tigrfam_V-ATPase_G	ENSG00000213760		0.657	ATP6V1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1G2	HGNC	protein_coding	OTTHUMT00000076399.3	82	0.00	0	G	NM_130463		31513277	31513277	-1	no_errors	ENST00000303892	ensembl	human	known	69_37n	nonsense	17	76.39	55	SNP	1.000	A
ATRX	546	genome.wustl.edu	37	X	76938062	76938062	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chrX:76938062C>G	ENST00000373344.5	-	9	2900	c.2686G>C	c.(2686-2688)Gat>Cat	p.D896H	ATRX_ENST00000395603.3_Missense_Mutation_p.D858H|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	896					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GTGTCTTTATCAACTGTGCCT	0.428			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															dbGAP		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											216.0	203.0	207.0					X																	76938062		2203	4296	6499	-	-	-	SO:0001583	missense	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2686G>C	X.37:g.76938062C>G	ENSP00000362441:p.Asp896His		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D896H	ENST00000373344.5	37	c.2686	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	11.00	1.510602	0.27036	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	D;D	0.92545	-3.06;-3.05	5.79	2.92	0.33932	.	0.390390	0.26518	N	0.023931	D	0.89996	0.6877	L	0.43152	1.355	0.41654	D	0.989148	P;P;B;P	0.46512	0.624;0.879;0.374;0.624	B;P;B;B	0.51385	0.347;0.668;0.277;0.347	D	0.87198	0.2239	10	0.62326	D	0.03	-0.1843	5.3475	0.16018	0.2755:0.5637:0.0:0.1608	.	896;828;858;896	A4LAA3;P46100-6;P46100-4;P46100	.;.;.;ATRX_HUMAN	H	896;858;823	ENSP00000362441:D896H;ENSP00000378967:D858H	ENSP00000362441:D896H	D	-	1	0	ATRX	76824718	0.362000	0.24980	0.329000	0.25429	0.914000	0.54420	0.876000	0.28092	0.530000	0.28619	0.513000	0.50165	GAT	ATRX	-	NULL	ENSG00000085224		0.428	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	456	0.00	0	C	NM_000489		76938062	76938062	-1	no_errors	ENST00000373344	ensembl	human	known	69_37n	missense	566	33.41	284	SNP	0.639	G
AVIL	10677	genome.wustl.edu	37	12	58204166	58204166	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:58204166C>G	ENST00000257861.3	-	6	1157	c.727G>C	c.(727-729)Gat>Cat	p.D243H	AVIL_ENST00000537081.1_Missense_Mutation_p.D236H	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	243	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TGCTTCTGATCTATGATCTCA	0.522																																						dbGAP											0													119.0	108.0	111.0					12																	58204166		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.727G>C	12.37:g.58204166C>G	ENSP00000257861:p.Asp243His		B2RAU7|Q2NKM9	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,prints_Gelsolin,pfscan_Villin_headpiece	p.D243H	ENST00000257861.3	37	c.727	CCDS8959.1	12	.	.	.	.	.	.	.	.	.	.	C	18.26	3.585114	0.66105	.	.	ENSG00000135407	ENST00000537081;ENST00000257861	T;T	0.34859	1.34;1.34	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.42223	0.1193	L	0.58428	1.81	0.80722	D	1	B;B	0.28820	0.221;0.224	B;B	0.34301	0.162;0.179	T	0.40021	-0.9585	10	0.66056	D	0.02	-13.4226	17.6213	0.88082	0.0:1.0:0.0:0.0	.	236;243	O75366-2;O75366	.;AVIL_HUMAN	H	236;243	ENSP00000443207:D236H;ENSP00000257861:D243H	ENSP00000257861:D243H	D	-	1	0	AVIL	56490433	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.778000	0.68940	2.704000	0.92352	0.655000	0.94253	GAT	AVIL	-	NULL	ENSG00000135407		0.522	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1	113	0.00	0	C	NM_006576		58204166	58204166	-1	no_errors	ENST00000257861	ensembl	human	known	69_37n	missense	81	32.50	39	SNP	1.000	G
ATXN2	6311	genome.wustl.edu	37	12	111908004	111908004	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:111908004C>T	ENST00000377617.3	-	20	3385	c.3224G>A	c.(3223-3225)aGa>aAa	p.R1075K	ATXN2_ENST00000535949.1_Missense_Mutation_p.R786K|ATXN2_ENST00000608853.1_Missense_Mutation_p.R915K|ATXN2_ENST00000389153.4_Missense_Mutation_p.R812K|ATXN2_ENST00000542287.2_Missense_Mutation_p.R810K|ATXN2_ENST00000550104.1_3'UTR	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	1075	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						TGCCATCATTCTAGCATTACC	0.448																																						dbGAP											0													199.0	160.0	173.0					12																	111908004		2203	4300	6503	-	-	-	SO:0001583	missense	0			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.3224G>A	12.37:g.111908004C>T	ENSP00000366843:p.Arg1075Lys		A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.R1075K	ENST00000377617.3	37	c.3224	CCDS31902.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.606853	0.96626	.	.	ENSG00000204842	ENST00000389154;ENST00000389153;ENST00000377617;ENST00000482777;ENST00000542287;ENST00000535949	T	0.78595	-1.19	5.46	5.46	0.80206	.	0.044587	0.85682	D	0.000000	D	0.84037	0.5384	L	0.50333	1.59	0.80722	D	1	P;D;P;D;D	0.67145	0.865;0.983;0.882;0.996;0.99	P;P;B;P;P	0.61533	0.479;0.621;0.428;0.89;0.789	T	0.81786	-0.0773	10	0.35671	T	0.21	-11.02	19.6784	0.95946	0.0:1.0:0.0:0.0	.	94;1075;786;810;812	Q99700-3;Q99700;Q24JQ7;F8VQP2;F8WB06	.;ATX2_HUMAN;.;.;.	K	130;812;1075;94;810;786	ENSP00000366843:R1075K	ENSP00000366843:R1075K	R	-	2	0	ATXN2	110392387	1.000000	0.71417	0.759000	0.31340	0.994000	0.84299	7.356000	0.79445	2.724000	0.93272	0.585000	0.79938	AGA	ATXN2	-	NULL	ENSG00000204842		0.448	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	148	0.00	0	C	NM_002973		111908004	111908004	-1	no_errors	ENST00000377617	ensembl	human	known	69_37n	missense	54	58.78	77	SNP	0.981	T
BCAS1	8537	genome.wustl.edu	37	20	52574001	52574001	+	Silent	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr20:52574001T>C	ENST00000395961.3	-	10	1552	c.1386A>G	c.(1384-1386)gaA>gaG	p.E462E	BCAS1_ENST00000434986.2_Intron|BCAS1_ENST00000371440.3_Intron|BCAS1_ENST00000371435.2_Intron	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	462						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			CATTTATTTCTTCTGAGTGGG	0.438																																						dbGAP											0													234.0	192.0	206.0					20																	52574001		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.1386A>G	20.37:g.52574001T>C			A0AVG5|Q68CZ3	Missense_Mutation	SNP	NULL	p.K125R	ENST00000395961.3	37	c.374	CCDS13444.1	20	.	.	.	.	.	.	.	.	.	.	T	9.891	1.204303	0.22205	.	.	ENSG00000064787	ENST00000422805	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	T	0.69922	0.3165	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69304	-0.5180	4	.	.	.	.	13.4339	0.61073	0.0:0.0:0.0:1.0	.	.	.	.	R	125	.	.	K	-	2	0	BCAS1	52007408	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.425000	0.44723	2.106000	0.64143	0.459000	0.35465	AAG	BCAS1	-	NULL	ENSG00000064787		0.438	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAS1	HGNC	protein_coding	OTTHUMT00000079766.2	132	0.00	0	T	NM_003657		52574001	52574001	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000422805	ensembl	human	putative	69_37n	missense	116	49.57	114	SNP	1.000	C
BICD2	23299	genome.wustl.edu	37	9	95480926	95480926	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:95480926C>A	ENST00000375512.3	-	5	2068	c.2001G>T	c.(1999-2001)aaG>aaT	p.K667N	BICD2_ENST00000356884.6_Missense_Mutation_p.K667N	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	667	Interacts with RAB6A. {ECO:0000250}.				cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTTCCTTGTCCTTGTCCACGG	0.627																																						dbGAP											0													217.0	194.0	202.0					9																	95480926		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.2001G>T	9.37:g.95480926C>A	ENSP00000364662:p.Lys667Asn		O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc	p.K667N	ENST00000375512.3	37	c.2001	CCDS6700.1	9	.	.	.	.	.	.	.	.	.	.	C	16.10	3.026439	0.54683	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.48522	0.81;0.81	5.39	0.926	0.19430	.	0.093818	0.64402	D	0.000001	T	0.59500	0.2198	M	0.73217	2.22	0.41391	D	0.987614	D;D	0.65815	0.993;0.995	P;D	0.65443	0.892;0.935	T	0.57866	-0.7737	10	0.48119	T	0.1	-56.772	8.215	0.31505	0.0:0.599:0.0:0.401	.	667;667	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	N	667	ENSP00000349351:K667N;ENSP00000364662:K667N	ENSP00000349351:K667N	K	-	3	2	BICD2	94520747	0.881000	0.30235	1.000000	0.80357	0.722000	0.41435	0.162000	0.16501	0.358000	0.24211	-0.254000	0.11334	AAG	BICD2	-	pfam_Bicaudal-D_microtubule-assoc	ENSG00000185963		0.627	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BICD2	HGNC	protein_coding	OTTHUMT00000055508.1	63	0.00	0	C	NM_015250		95480926	95480926	-1	no_errors	ENST00000356884	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	0.991	A
BPIFB1	92747	genome.wustl.edu	37	20	31876560	31876560	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr20:31876560G>T	ENST00000253354.1	+	3	290	c.129G>T	c.(127-129)gaG>gaT	p.E43D		NM_033197.2	NP_149974.2	Q8TDL5	BPIB1_HUMAN	BPI fold containing family B, member 1	43					innate immune response in mucosa (GO:0002227)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										TGACACAGGAGCTGAAGGACC	0.652																																						dbGAP											0													47.0	48.0	48.0					20																	31876560		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008429	CCDS13218.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000125999	ENSG00000125999		"""BPI fold containing"""	16108	protein-coding gene	gene with protein product	"""von Ebner minor salivary gland protein"""		"""chromosome 20 open reading frame 114"""	C20orf114		11971875, 21787333	Standard	NM_033197		Approved	dJ1187J4.1, MGC14597, bA49G10.6, LPLUNC1, VEMSGP	uc002wyw.1	Q8TDL5	OTTHUMG00000032252	ENST00000253354.1:c.129G>T	20.37:g.31876560G>T	ENSP00000253354:p.Glu43Asp		A8K2H8|Q5QP43|Q6UWY1|Q6ZRU7|Q96HK6|Q9BQP8|Q9BWZ6|Q9H4V6	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,pirsf_PLUNC_long_form	p.E43D	ENST00000253354.1	37	c.129	CCDS13218.1	20	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777130	0.49786	.	.	ENSG00000125999	ENST00000423645;ENST00000253354	T;T	0.34859	1.34;3.9	5.45	1.57	0.23409	.	0.949428	0.08833	N	0.887002	T	0.32406	0.0828	L	0.47716	1.5	0.21782	N	0.999545	P;P	0.43231	0.801;0.801	P;P	0.46419	0.516;0.516	T	0.18999	-1.0319	10	0.17832	T	0.49	-5.0787	3.5753	0.07932	0.2923:0.198:0.5097:0.0	.	43;43	B2R7Z6;Q8TDL5	.;BPIB1_HUMAN	D	43	ENSP00000390471:E43D;ENSP00000253354:E43D	ENSP00000253354:E43D	E	+	3	2	BPIFB1	31340221	0.474000	0.25886	0.746000	0.31095	0.027000	0.11550	0.343000	0.19944	0.645000	0.30675	0.655000	0.94253	GAG	BPIFB1	-	smart_Lipid-bd_serum_glycop_N,pirsf_PLUNC_long_form	ENSG00000125999		0.652	BPIFB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB1	HGNC	protein_coding	OTTHUMT00000106499.2	50	0.00	0	G	NM_033197		31876560	31876560	+1	no_errors	ENST00000253354	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	0.739	T
BRCA2	675	genome.wustl.edu	37	13	32932067	32932067	+	Splice_Site	SNP	G	G	A	rs81002809		TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr13:32932067G>A	ENST00000380152.3	+	16	8038		c.e16+1		BRCA2_ENST00000544455.1_Splice_Site			P51587	BRCA2_HUMAN	breast cancer 2, early onset						brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AATTTTATAGGTACTCTATGC	0.378			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													89.0	90.0	89.0					13																	32932067		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.7805+1G>A	13.37:g.32932067G>A			O00183|O15008|Q13879|Q5TBJ7	Splice_Site	SNP	-	e15+1	ENST00000380152.3	37	c.7805+1	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518041	0.85495	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6275	0.91346	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BRCA2	31830067	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	9.198000	0.94994	2.399000	0.81585	0.591000	0.81541	.	BRCA2	-	-	ENSG00000139618		0.378	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	146	0.00	0	G	NM_000059	Intron	32932067	32932067	+1	no_errors	ENST00000380152	ensembl	human	known	69_37n	splice_site	70	54.78	86	SNP	1.000	A
C10orf120	399814	genome.wustl.edu	37	10	124457369	124457369	+	Silent	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr10:124457369T>C	ENST00000329446.4	-	3	919	c.888A>G	c.(886-888)ctA>ctG	p.L296L		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	296										endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				CCTGATTCATTAGCATTAAGT	0.458																																						dbGAP											0													152.0	146.0	148.0					10																	124457369		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.888A>G	10.37:g.124457369T>C			B2RU17	Silent	SNP	NULL	p.L296	ENST00000329446.4	37	c.888	CCDS31302.1	10																																																																																			C10orf120	-	NULL	ENSG00000183559		0.458	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf120	HGNC	protein_coding	OTTHUMT00000050803.1	191	0.00	0	T	NM_001010912		124457369	124457369	-1	no_errors	ENST00000329446	ensembl	human	known	69_37n	silent	112	39.13	72	SNP	0.123	C
C12orf4	57102	genome.wustl.edu	37	12	4627964	4627967	+	Frame_Shift_Del	DEL	CTAA	CTAA	-			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	CTAA	CTAA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:4627964_4627967delCTAA	ENST00000261250.3	-	7	895_898	c.808_811delTTAG	c.(808-813)ttagaafs	p.LE270fs	C12orf4_ENST00000545746.1_Frame_Shift_Del_p.LE270fs	NM_020374.2	NP_065107.1	Q9NQ89	CL004_HUMAN	chromosome 12 open reading frame 4	270										NS(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		AAACTTTCTTCTAACTTTCTCTGT	0.26																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ272205	CCDS8528.1	12p13.3	2012-08-10			ENSG00000047621	ENSG00000047621			1184	protein-coding gene	gene with protein product							Standard	NM_020374		Approved		uc001qms.3	Q9NQ89	OTTHUMG00000168258	ENST00000261250.3:c.808_811delTTAG	12.37:g.4627964_4627967delCTAA	ENSP00000261250:p.Leu270fs		D3DUQ8|Q6MZH5	Frame_Shift_Del	DEL	pfam_DUF2362	p.L270fs	ENST00000261250.3	37	c.811_808	CCDS8528.1	12																																																																																			C12orf4	-	pfam_DUF2362	ENSG00000047621		0.260	C12orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf4	HGNC	protein_coding	OTTHUMT00000398992.1	83	0.00	0	CTAA	NM_020374		4627964	4627967	-1	no_errors	ENST00000261250	ensembl	human	known	69_37n	frame_shift_del	79	38.93	51	DEL	1.000:1.000:1.000:1.000	-
C12orf50	160419	genome.wustl.edu	37	12	88383052	88383052	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:88383052G>C	ENST00000298699.2	-	8	869	c.689C>G	c.(688-690)tCa>tGa	p.S230*	C12orf50_ENST00000550553.1_Nonsense_Mutation_p.S230*	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	230										NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						TTTAGTATTTGAACATTTTGA	0.318																																						dbGAP											0													49.0	48.0	48.0					12																	88383052		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.689C>G	12.37:g.88383052G>C	ENSP00000298699:p.Ser230*		Q6P674	Nonsense_Mutation	SNP	NULL	p.S230*	ENST00000298699.2	37	c.689	CCDS9031.1	12	.	.	.	.	.	.	.	.	.	.	G	38	6.700154	0.97772	.	.	ENSG00000165805	ENST00000298699;ENST00000550553;ENST00000551944	.	.	.	5.15	4.26	0.50523	.	0.711818	0.12654	N	0.450203	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.9311	0.47217	0.0893:0.0:0.9107:0.0	.	.	.	.	X	230;230;284	.	ENSP00000298699:S230X	S	-	2	0	C12orf50	86907183	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	4.028000	0.57246	1.190000	0.43042	0.558000	0.71614	TCA	C12orf50	-	NULL	ENSG00000165805		0.318	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf50	HGNC	protein_coding	OTTHUMT00000406328.1	82	0.00	0	G	NM_152589		88383052	88383052	-1	no_errors	ENST00000298699	ensembl	human	known	69_37n	nonsense	51	45.16	42	SNP	1.000	C
C16orf93	90835	genome.wustl.edu	37	16	30770365	30770365	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:30770365A>T	ENST00000543610.1	-	8	1746	c.785T>A	c.(784-786)cTa>cAa	p.L262Q	C16orf93_ENST00000541260.1_Missense_Mutation_p.L327Q|RNF40_ENST00000324685.6_5'Flank|PHKG2_ENST00000563588.1_3'UTR|PHKG2_ENST00000424889.3_Intron	NM_001014979.2	NP_001014979.2	A1A4V9	CP093_HUMAN	chromosome 16 open reading frame 93	262										breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)	11						CACTGTCTCTAGTTCCTCTTT	0.572																																						dbGAP											0													210.0	192.0	198.0					16																	30770365		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC042548	CCDS32434.1, CCDS32434.2, CCDS55993.1	16p11.2	2012-10-10			ENSG00000196118	ENSG00000196118			28078	protein-coding gene	gene with protein product							Standard	NM_001195620		Approved	MGC104706	uc002dzm.3	A1A4V9	OTTHUMG00000167926	ENST00000543610.1:c.785T>A	16.37:g.30770365A>T	ENSP00000437532:p.Leu262Gln		A1A4V8|F5GX13|Q569G2	Missense_Mutation	SNP	NULL	p.L262Q	ENST00000543610.1	37	c.785	CCDS32434.2	16	.	.	.	.	.	.	.	.	.	.	A	7.717	0.696417	0.15106	.	.	ENSG00000196118	ENST00000354963;ENST00000543610	.	.	.	4.86	-4.28	0.03732	.	0.749305	0.11339	N	0.574280	T	0.12646	0.0307	N	0.14661	0.345	0.09310	N	0.999999	P;P;B	0.43094	0.799;0.662;0.062	B;B;B	0.40009	0.281;0.316;0.094	T	0.27191	-1.0081	9	0.13470	T	0.59	-0.3116	5.8601	0.18743	0.5768:0.0:0.2829:0.1403	.	225;34;262	A1A4V9-2;A1A4V9-3;A1A4V9	.;.;CP093_HUMAN	Q	225;262	.	ENSP00000347050:L225Q	L	-	2	0	C16orf93	30677866	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.259000	0.08721	-0.873000	0.04032	0.533000	0.62120	CTA	C16orf93	-	NULL	ENSG00000196118		0.572	C16orf93-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf93	HGNC	protein_coding	OTTHUMT00000397089.1	156	0.00	0	A	NM_001014979		30770365	30770365	-1	no_errors	ENST00000543610	ensembl	human	known	69_37n	missense	40	38.46	25	SNP	0.000	T
C17orf47	284083	genome.wustl.edu	37	17	56620129	56620129	+	Silent	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:56620129C>T	ENST00000321691.3	-	1	1600	c.1419G>A	c.(1417-1419)ctG>ctA	p.L473L	SEPT4_ENST00000412945.3_5'Flank|SEPT4_ENST00000457347.2_5'Flank|RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	473										NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCTGGAACTTCAGATCCTCAC	0.493																																						dbGAP											0													208.0	219.0	215.0					17																	56620129		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.1419G>A	17.37:g.56620129C>T			Q8N821	Silent	SNP	NULL	p.L473	ENST00000321691.3	37	c.1419	CCDS32691.1	17																																																																																			C17orf47	-	NULL	ENSG00000181013		0.493	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf47	HGNC	protein_coding	OTTHUMT00000445443.1	165	0.60	1	C	NM_001038704		56620129	56620129	-1	no_errors	ENST00000321691	ensembl	human	known	69_37n	silent	167	12.04	23	SNP	0.000	T
C2orf71	388939	genome.wustl.edu	37	2	29294161	29294162	+	Frame_Shift_Ins	INS	-	-	G	rs113376827		TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:29294161_29294162insG	ENST00000331664.5	-	1	2965_2966	c.2966_2967insC	c.(2965-2967)cctfs	p.P989fs		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	989					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TTCTGCCCACAGGGGGGCTTCT	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.2967dupC	2.37:g.29294167_29294167dupG	ENSP00000332809:p.Pro989fs			Frame_Shift_Ins	INS	NULL	p.V990fs	ENST00000331664.5	37	c.2967_2966	CCDS42669.1	2																																																																																			C2orf71	-	NULL	ENSG00000179270		0.639	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	25	0.00	0	-	NM_001029883		29294161	29294162	-1	no_errors	ENST00000331664	ensembl	human	novel	69_37n	frame_shift_ins	17	15.00	3	INS	0.000:0.000	G
C5	727	genome.wustl.edu	37	9	123777517	123777517	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:123777517G>A	ENST00000223642.1	-	16	2048	c.2019C>T	c.(2017-2019)ctC>ctT	p.L673L		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	673					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TTCTTGGCCTGAGAATTTCTT	0.294																																						dbGAP											0													144.0	134.0	137.0					9																	123777517		2202	4296	6498	-	-	-	SO:0001819	synonymous_variant	0			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.2019C>T	9.37:g.123777517G>A			Q14CJ0|Q27I61	Silent	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.L673	ENST00000223642.1	37	c.2019	CCDS6826.1	9																																																																																			C5	-	NULL	ENSG00000106804		0.294	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	HGNC	protein_coding	OTTHUMT00000053844.1	31	0.00	0	G	NM_001735		123777517	123777517	-1	no_errors	ENST00000223642	ensembl	human	known	69_37n	silent	70	37.50	42	SNP	1.000	A
C5orf28	64417	genome.wustl.edu	37	5	43446514	43446514	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr5:43446514G>T	ENST00000500337.2	-	5	789	c.458C>A	c.(457-459)aCt>aAt	p.T153N	C5orf28_ENST00000512085.1_Missense_Mutation_p.T153N|C5orf28_ENST00000537319.1_Missense_Mutation_p.T22N|C5orf28_ENST00000510130.1_Missense_Mutation_p.T51N|C5orf28_ENST00000511525.1_5'UTR|C5orf28_ENST00000397080.3_Missense_Mutation_p.T153N			Q0VDI3	CE028_HUMAN	chromosome 5 open reading frame 28	153						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(5)	9	Lung NSC(6;2.07e-05)					ATGATGTGAAGTCCAGGATAT	0.408																																						dbGAP											0													116.0	107.0	110.0					5																	43446514		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025310	CCDS3945.1	5p12	2011-01-25			ENSG00000151881	ENSG00000151881			26139	protein-coding gene	gene with protein product						12477932	Standard	NM_022483		Approved	FLJ21657	uc003jny.3	Q0VDI3	OTTHUMG00000131150	ENST00000500337.2:c.458C>A	5.37:g.43446514G>T	ENSP00000426067:p.Thr153Asn		B2RDA6|Q9H6Z2	Missense_Mutation	SNP	NULL	p.T153N	ENST00000500337.2	37	c.458	CCDS3945.1	5	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534342	0.64972	.	.	ENSG00000151881	ENST00000500337;ENST00000537319;ENST00000397080;ENST00000512085;ENST00000510130;ENST00000506860	.	.	.	5.95	5.06	0.68205	.	0.191246	0.56097	D	0.000027	T	0.67702	0.2921	M	0.77820	2.39	0.50171	D	0.999855	P	0.37276	0.589	B	0.39258	0.295	T	0.72290	-0.4337	9	0.66056	D	0.02	-19.9074	17.05	0.86516	0.0:0.1271:0.8729:0.0	.	153	Q0VDI3	CE028_HUMAN	N	153;22;153;153;51;153	.	ENSP00000380270:T153N	T	-	2	0	C5orf28	43482271	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.459000	0.60102	1.466000	0.48025	0.655000	0.94253	ACT	C5orf28	-	NULL	ENSG00000151881		0.408	C5orf28-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C5orf28	HGNC	protein_coding	OTTHUMT00000368003.1	283	0.00	0	G	NM_022483		43446514	43446514	-1	no_errors	ENST00000397080	ensembl	human	known	69_37n	missense	417	17.10	86	SNP	1.000	T
CACNG4	27092	genome.wustl.edu	37	17	65026915	65026915	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:65026915C>A	ENST00000262138.3	+	4	781	c.779C>A	c.(778-780)cCc>cAc	p.P260H	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	260					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GACGTGTCGCCCATGGGCCTG	0.652																																						dbGAP											0													46.0	45.0	45.0					17																	65026915		2203	4300	6503	-	-	-	SO:0001583	missense	0			AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.779C>A	17.37:g.65026915C>A	ENSP00000262138:p.Pro260His		B2RCK0	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_g4su,prints_VDCC_gsu,prints_Claudin	p.P260H	ENST00000262138.3	37	c.779	CCDS11667.1	17	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342002	0.61073	.	.	ENSG00000075461	ENST00000262138	T	0.58652	0.32	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.77110	0.4082	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80111	-0.1519	10	0.87932	D	0	-10.884	18.7131	0.91666	0.0:1.0:0.0:0.0	.	260	Q9UBN1	CCG4_HUMAN	H	260	ENSP00000262138:P260H	ENSP00000262138:P260H	P	+	2	0	CACNG4	62457377	1.000000	0.71417	0.912000	0.35992	0.541000	0.35023	7.371000	0.79600	2.427000	0.82271	0.650000	0.86243	CCC	CACNG4	-	NULL	ENSG00000075461		0.652	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG4	HGNC	protein_coding	OTTHUMT00000447036.1	268	0.00	0	C	NM_014405		65026915	65026915	+1	no_errors	ENST00000262138	ensembl	human	known	69_37n	missense	150	22.16	43	SNP	0.953	A
CALCRL	10203	genome.wustl.edu	37	2	188216646	188216646	+	Splice_Site	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:188216646C>A	ENST00000409998.1	-	15	1952		c.e15+1		CALCRL_ENST00000410068.1_Splice_Site|AC007319.1_ENST00000453517.1_RNA|AC007319.1_ENST00000412276.1_RNA|CALCRL_ENST00000392370.3_Splice_Site			Q16602	CALRL_HUMAN	calcitonin receptor-like						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)			endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			AATTATCATACCTCTCCATTA	0.279																																						dbGAP											0													45.0	46.0	46.0					2																	188216646		2195	4293	6488	-	-	-	SO:0001630	splice_region_variant	0			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.1170+1G>T	2.37:g.188216646C>A			A8K6G5|A8KAD3|Q53S02|Q53TS5	Splice_Site	SNP	-	e11+1	ENST00000409998.1	37	c.1170+1	CCDS2293.1	2	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771134	0.69992	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0689	0.64849	0.1513:0.8487:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CALCRL	187924891	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.623000	0.37008	2.717000	0.92951	0.650000	0.86243	.	CALCRL	-	-	ENSG00000064989		0.279	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CALCRL	HGNC	protein_coding	OTTHUMT00000334648.1	73	0.00	0	C	NM_005795	Intron	188216646	188216646	-1	no_errors	ENST00000392370	ensembl	human	known	69_37n	splice_site	105	50.00	105	SNP	1.000	A
CCBL2	56267	genome.wustl.edu	37	1	89430521	89430521	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:89430521C>G	ENST00000260508.4	-	5	781	c.444G>C	c.(442-444)gaG>gaC	p.E148D	CCBL2_ENST00000370491.3_Missense_Mutation_p.E114D|CCBL2_ENST00000370485.2_Missense_Mutation_p.E148D|CCBL2_ENST00000446900.2_5'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	148					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		CTTCATCTCCCTCATCAATTA	0.303																																						dbGAP											0													84.0	78.0	80.0					1																	89430521		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.444G>C	1.37:g.89430521C>G	ENSP00000260508:p.Glu148Asp		B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.E148D	ENST00000260508.4	37	c.444	CCDS30766.1	1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075178	0.36566	.	.	ENSG00000137944	ENST00000370491;ENST00000260508;ENST00000370485;ENST00000370486	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.43	1.41	0.22369	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.261256	0.42548	D	0.000700	T	0.19644	0.0472	L	0.60067	1.865	0.32081	N	0.593142	B	0.14438	0.01	B	0.15484	0.013	T	0.11494	-1.0585	10	0.54805	T	0.06	-35.2963	9.4766	0.38875	0.0:0.5498:0.0:0.4502	.	148	Q6YP21	KAT3_HUMAN	D	114;148;148;148	ENSP00000359522:E114D;ENSP00000260508:E148D;ENSP00000359516:E148D;ENSP00000359517:E148D	ENSP00000260508:E148D	E	-	3	2	CCBL2	89203109	0.132000	0.22450	0.991000	0.47740	0.994000	0.84299	-0.634000	0.05477	0.425000	0.26087	0.585000	0.79938	GAG	CCBL2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000137944		0.303	CCBL2-004	KNOWN	basic|CCDS	protein_coding	CCBL2	HGNC	protein_coding	OTTHUMT00000029300.3	126	0.00	0	C	NM_001008661		89430521	89430521	-1	no_errors	ENST00000260508	ensembl	human	known	69_37n	missense	66	52.52	73	SNP	0.998	G
CASQ1	844	genome.wustl.edu	37	1	160165757	160165757	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:160165757C>G	ENST00000368078.3	+	6	918	c.722C>G	c.(721-723)aCc>aGc	p.T241S	CASQ1_ENST00000467691.1_5'Flank|CASQ1_ENST00000368079.3_Missense_Mutation_p.T235S			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	241					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGCCTGTGACCATCCCAGAC	0.567																																						dbGAP											0													95.0	95.0	95.0					1																	160165757		2203	4300	6503	-	-	-	SO:0001583	missense	0			S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.722C>G	1.37:g.160165757C>G	ENSP00000357057:p.Thr241Ser		B1AKZ2|B2R863|Q8TBW7	Missense_Mutation	SNP	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	p.T241S	ENST00000368078.3	37	c.722	CCDS1198.2	1	.	.	.	.	.	.	.	.	.	.	C	13.56	2.273903	0.40194	.	.	ENSG00000143318	ENST00000368079;ENST00000368078;ENST00000441151	T;T	0.75050	-0.9;-0.9	4.82	4.82	0.62117	Thioredoxin-like fold (2);	0.106561	0.64402	D	0.000005	T	0.61073	0.2318	M	0.66939	2.045	0.38575	D	0.950052	P	0.42993	0.797	B	0.34824	0.19	T	0.66606	-0.5881	10	0.33940	T	0.23	.	17.1903	0.86877	0.0:1.0:0.0:0.0	.	241	P31415	CASQ1_HUMAN	S	235;241;156	ENSP00000357058:T235S;ENSP00000357057:T241S	ENSP00000357057:T241S	T	+	2	0	CASQ1	158432381	0.998000	0.40836	1.000000	0.80357	0.971000	0.66376	1.147000	0.31602	2.660000	0.90430	0.555000	0.69702	ACC	CASQ1	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	ENSG00000143318		0.567	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ1	HGNC	protein_coding	OTTHUMT00000077412.1	131	0.00	0	C	NM_001231		160165757	160165757	+1	no_errors	ENST00000368078	ensembl	human	known	69_37n	missense	63	52.27	69	SNP	1.000	G
DRC1	92749	genome.wustl.edu	37	2	26678039	26678039	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:26678039A>C	ENST00000288710.2	+	16	2178	c.2104A>C	c.(2104-2106)Agt>Cgt	p.S702R		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	702			S -> I (in dbSNP:rs3172008).		axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.S702C(1)									GCTGGAAAACAGTTCTCTGGA	0.582																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											86.0	99.0	95.0					2																	26678039		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.2104A>C	2.37:g.26678039A>C	ENSP00000288710:p.Ser702Arg		A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	NULL	p.S702R	ENST00000288710.2	37	c.2104	CCDS1723.1	2	.	.	.	.	.	.	.	.	.	.	A	10.60	1.395487	0.25205	.	.	ENSG00000157856	ENST00000288710	T	0.45276	0.9	5.38	-10.8	0.00216	.	2.656320	0.00907	N	0.002436	T	0.25827	0.0629	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.06041	-1.0849	10	0.31617	T	0.26	8.668	9.6101	0.39657	0.2055:0.2933:0.5011:0.0	.	702	Q96MC2	CC164_HUMAN	R	702	ENSP00000288710:S702R	ENSP00000288710:S702R	S	+	1	0	CCDC164	26531543	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-2.198000	0.01239	-2.452000	0.00542	-0.408000	0.06270	AGT	CCDC164	-	NULL	ENSG00000157856		0.582	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC164	HGNC	protein_coding	OTTHUMT00000246862.1	64	0.00	0	A	NM_145038		26678039	26678039	+1	no_errors	ENST00000288710	ensembl	human	known	69_37n	missense	38	33.33	19	SNP	0.000	C
CCDC80	151887	genome.wustl.edu	37	3	112357028	112357028	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:112357028C>A	ENST00000206423.3	-	2	2678	c.1725G>T	c.(1723-1725)aaG>aaT	p.K575N	CCDC80_ENST00000439685.2_Missense_Mutation_p.K575N|CCDC80_ENST00000475181.1_5'Flank	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	575	Lys-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						cttgcttgctctttttctcag	0.398																																						dbGAP											0													173.0	150.0	158.0					3																	112357028		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1725G>T	3.37:g.112357028C>A	ENSP00000206423:p.Lys575Asn		D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	NULL	p.K575N	ENST00000206423.3	37	c.1725	CCDS2968.1	3	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158227	0.57368	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.51325	0.71;0.71	5.78	4.9	0.64082	.	0.479244	0.25807	N	0.028168	T	0.32585	0.0834	N	0.24115	0.695	0.38966	D	0.958646	B;B;B	0.18166	0.026;0.015;0.004	B;B;B	0.22601	0.04;0.018;0.008	T	0.22836	-1.0205	10	0.66056	D	0.02	-19.58	6.9113	0.24336	0.0:0.6786:0.1435:0.1779	.	586;575;575	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	N	575;575;203	ENSP00000206423:K575N;ENSP00000411814:K575N	ENSP00000206423:K575N	K	-	3	2	CCDC80	113839718	0.942000	0.31987	0.999000	0.59377	0.993000	0.82548	0.827000	0.27421	1.433000	0.47394	0.555000	0.69702	AAG	CCDC80	-	NULL	ENSG00000091986		0.398	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	HGNC	protein_coding	OTTHUMT00000354219.1	211	0.00	0	C	NM_199511		112357028	112357028	-1	no_errors	ENST00000206423	ensembl	human	known	69_37n	missense	219	51.01	228	SNP	0.991	A
CD244	51744	genome.wustl.edu	37	1	160811287	160811287	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:160811287G>T	ENST00000368033.3	-	3	465	c.383C>A	c.(382-384)tCt>tAt	p.S128Y	CD244_ENST00000368034.4_Intron|CD244_ENST00000368032.2_Intron|CD244_ENST00000322302.7_Intron|CD244_ENST00000481677.1_5'Flank			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	128				ESLLPDK -> GMAMCPM (in Ref. 10; AAK50015). {ECO:0000305}.	blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TGGAAGCAGAGATTCTGATCA	0.488																																						dbGAP											0													45.0	49.0	48.0					1																	160811287		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.383C>A	1.37:g.160811287G>T	ENSP00000357012:p.Ser128Tyr		Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Missense_Mutation	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like	p.S128Y	ENST00000368033.3	37	c.383	CCDS53399.1	1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261023	0.59431	.	.	ENSG00000122223	ENST00000368033	T	0.37915	1.17	4.89	4.89	0.63831	.	0.256266	0.20750	U	0.086366	T	0.33760	0.0874	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	T	0.04053	-1.0981	9	.	.	.	-5.597	13.9264	0.63966	0.0:0.0:1.0:0.0	.	128	Q9BZW8	CD244_HUMAN	Y	128	ENSP00000357012:S128Y	.	S	-	2	0	CD244	159077911	0.998000	0.40836	0.999000	0.59377	0.937000	0.57800	1.044000	0.30329	2.431000	0.82371	0.655000	0.94253	TCT	CD244	-	NULL	ENSG00000122223		0.488	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1	108	0.92	1	G	NM_016382		160811287	160811287	-1	no_errors	ENST00000368033	ensembl	human	known	69_37n	missense	152	29.82	65	SNP	1.000	T
CEACAM21	90273	genome.wustl.edu	37	19	42085717	42085717	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:42085717C>T	ENST00000401445.2	+	3	462	c.436C>T	c.(436-438)Cag>Tag	p.Q146*	CEACAM21_ENST00000187608.9_Nonsense_Mutation_p.Q146*|CEACAM21_ENST00000482870.2_3'UTR|CEACAM21_ENST00000407170.2_Nonsense_Mutation_p.Q18*			Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 21	146						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	13						GTCAGTGGCTCAGCCCTCCAT	0.507																																						dbGAP											0													60.0	65.0	63.0					19																	42085717		2103	4239	6342	-	-	-	SO:0001587	stop_gained	0			AK023602	CCDS46086.1, CCDS46087.1, CCDS74373.1	19q13.2	2013-01-29			ENSG00000007129	ENSG00000007129		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28834	protein-coding gene	gene with protein product						12477932	Standard	XM_005278397		Approved	R29124_1, FLJ13540	uc002ore.4	Q3KPI0	OTTHUMG00000151062	ENST00000401445.2:c.436C>T	19.37:g.42085717C>T	ENSP00000385739:p.Gln146*		B7WNQ6|O75296|Q6UY47|Q96ER7	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q146*	ENST00000401445.2	37	c.436	CCDS46086.1	19	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313215	0.81358	.	.	ENSG00000007129	ENST00000407170;ENST00000187608;ENST00000401445	.	.	.	3.09	-4.06	0.03986	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.7469	0.08551	0.5802:0.2318:0.0:0.1879	.	.	.	.	X	18;146;146	.	ENSP00000187608:Q146X	Q	+	1	0	CEACAM21	46777557	0.000000	0.05858	0.000000	0.03702	0.859000	0.49053	-2.047000	0.01408	-0.377000	0.07930	0.385000	0.25706	CAG	CEACAM21	-	NULL	ENSG00000007129		0.507	CEACAM21-005	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	CEACAM21	HGNC	protein_coding	OTTHUMT00000321140.1	206	0.00	0	C	NM_033543		42085717	42085717	+1	no_errors	ENST00000401445	ensembl	human	known	69_37n	nonsense	44	57.28	59	SNP	0.000	T
CHD1L	9557	genome.wustl.edu	37	1	146757043	146757043	+	Missense_Mutation	SNP	C	C	T	rs200997862		TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:146757043C>T	ENST00000369258.4	+	17	1917	c.1897C>T	c.(1897-1899)Cgg>Tgg	p.R633W	CHD1L_ENST00000369259.3_Missense_Mutation_p.R429W|CHD1L_ENST00000361293.5_Missense_Mutation_p.R352W|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000431239.1_Missense_Mutation_p.R539W	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	633					ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					CAAAAGGAAGCGGGTTCTGAG	0.488																																						dbGAP											0													147.0	152.0	151.0					1																	146757043		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1897C>T	1.37:g.146757043C>T	ENSP00000358262:p.Arg633Trp		A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_A1pp,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R633W	ENST00000369258.4	37	c.1897	CCDS927.1	1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459340	0.43634	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	D;T;D;D	0.89746	-2.56;-1.39;-2.43;-1.55	5.82	4.88	0.63580	.	0.426012	0.24965	N	0.034191	D	0.88250	0.6386	L	0.43152	1.355	0.27264	N	0.958544	D;D;D	0.89917	1.0;0.996;0.992	D;P;P	0.72075	0.976;0.738;0.513	D	0.83575	0.0114	10	0.66056	D	0.02	.	11.876	0.52548	0.1809:0.8191:0.0:0.0	.	539;429;633	Q86WJ1-2;Q86WJ1-3;Q86WJ1	.;.;CHD1L_HUMAN	W	539;429;633;352	ENSP00000389031:R539W;ENSP00000358263:R429W;ENSP00000358262:R633W;ENSP00000355100:R352W	ENSP00000355100:R352W	R	+	1	2	CHD1L	145223667	0.988000	0.35896	0.852000	0.33557	0.030000	0.12068	2.771000	0.47670	1.413000	0.46997	0.650000	0.86243	CGG	CHD1L	-	NULL	ENSG00000131778		0.488	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	465	0.21	1	C	NM_004284		146757043	146757043	+1	no_errors	ENST00000369258	ensembl	human	known	69_37n	missense	598	23.57	186	SNP	0.936	T
CHML	1122	genome.wustl.edu	37	1	241797530	241797530	+	Silent	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:241797530T>C	ENST00000366553.1	-	1	1702	c.1539A>G	c.(1537-1539)tcA>tcG	p.S513S	OPN3_ENST00000366554.2_Intron|OPN3_ENST00000331838.5_Intron|OPN3_ENST00000469376.1_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	513					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TTTTAGAAGATGAACATGTCA	0.408																																						dbGAP											0													84.0	79.0	80.0					1																	241797530		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1539A>G	1.37:g.241797530T>C			B2RAB9|Q17RE0|Q9H1Y4	Silent	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.S513	ENST00000366553.1	37	c.1539	CCDS31073.1	1																																																																																			CHML	-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk	ENSG00000203668		0.408	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1	151	0.00	0	T	NM_001821		241797530	241797530	-1	no_errors	ENST00000366553	ensembl	human	known	69_37n	silent	113	41.15	79	SNP	0.019	C
CILP	8483	genome.wustl.edu	37	15	65497689	65497689	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr15:65497689C>G	ENST00000261883.4	-	5	706	c.540G>C	c.(538-540)gaG>gaC	p.E180D		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	180	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GCGACACCATCTCTGCCAAGC	0.622																																						dbGAP											0													107.0	85.0	92.0					15																	65497689		2201	4299	6500	-	-	-	SO:0001583	missense	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.540G>C	15.37:g.65497689C>G	ENSP00000261883:p.Glu180Asp		B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.E180D	ENST00000261883.4	37	c.540	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	C	10.55	1.382127	0.24944	.	.	ENSG00000138615	ENST00000261883	T	0.54071	0.59	5.56	5.56	0.83823	.	0.485574	0.24861	N	0.035017	T	0.38480	0.1042	N	0.17800	0.525	0.29744	N	0.836874	B	0.02656	0.0	B	0.09377	0.004	T	0.20505	-1.0273	10	0.26408	T	0.33	-19.8875	15.0207	0.71630	0.1424:0.8575:0.0:0.0	.	180	O75339	CILP1_HUMAN	D	180	ENSP00000261883:E180D	ENSP00000261883:E180D	E	-	3	2	CILP	63284742	0.883000	0.30277	0.967000	0.41034	0.508000	0.34012	1.640000	0.37186	2.635000	0.89317	0.650000	0.86243	GAG	CILP	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000138615		0.622	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	86	0.00	0	C	NM_003613		65497689	65497689	-1	no_errors	ENST00000261883	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.990	G
CITED2	10370	genome.wustl.edu	37	6	139694322	139694322	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:139694322C>T	ENST00000367651.2	-	2	975	c.760G>A	c.(760-762)Gat>Aat	p.D254N	CITED2_ENST00000536159.1_Missense_Mutation_p.D254N|CITED2_ENST00000537332.1_Missense_Mutation_p.D254N	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	254	Asp/Glu-rich (acidic).				adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		GTCATAAAATCAAACTCGTTT	0.502																																					NSCLC(98;1219 1550 33720 43229 49330)	dbGAP											0													71.0	75.0	74.0					6																	139694322		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.760G>A	6.37:g.139694322C>T	ENSP00000356623:p.Asp254Asn		O95426|Q5VTF4	Missense_Mutation	SNP	pfam_CITED	p.D254N	ENST00000367651.2	37	c.760	CCDS5195.1	6	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368658	0.82463	.	.	ENSG00000164442	ENST00000367651;ENST00000536159;ENST00000537332;ENST00000392312	T;T;T	0.81163	-1.46;-1.46;-1.46	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000001	D	0.84790	0.5550	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82384	-0.0484	9	.	.	.	-2.6512	19.7705	0.96361	0.0:1.0:0.0:0.0	.	254	Q99967	CITE2_HUMAN	N	254;254;254;198	ENSP00000356623:D254N;ENSP00000442831:D254N;ENSP00000444198:D254N	.	D	-	1	0	CITED2	139736015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.416000	0.80143	2.669000	0.90835	0.655000	0.94253	GAT	CITED2	-	pfam_CITED	ENSG00000164442		0.502	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CITED2	HGNC	protein_coding	OTTHUMT00000042463.1	126	0.00	0	C			139694322	139694322	-1	no_errors	ENST00000367651	ensembl	human	known	69_37n	missense	55	11.29	7	SNP	1.000	T
CLMN	79789	genome.wustl.edu	37	14	95677072	95677072	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:95677072G>A	ENST00000298912.4	-	7	866	c.753C>T	c.(751-753)ttC>ttT	p.F251F		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	251	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		GTGCGATGCTGAAAGCCTTCT	0.498																																						dbGAP											0													141.0	136.0	137.0					14																	95677072		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.753C>T	14.37:g.95677072G>A			B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Silent	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.F251	ENST00000298912.4	37	c.753	CCDS9933.1	14																																																																																			CLMN	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000165959		0.498	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2	204	0.00	0	G			95677072	95677072	-1	no_errors	ENST00000298912	ensembl	human	known	69_37n	silent	172	11.79	23	SNP	0.995	A
CR2	1380	genome.wustl.edu	37	1	207644373	207644373	+	Silent	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:207644373C>G	ENST00000367058.3	+	8	1623	c.1434C>G	c.(1432-1434)ctC>ctG	p.L478L	CR2_ENST00000458541.2_Silent_p.L478L|CR2_ENST00000367059.3_Silent_p.L478L|CR2_ENST00000367057.3_Silent_p.L478L	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	478	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						GAAGGCAACTCTTGACAAAAC	0.418																																						dbGAP											0													173.0	164.0	167.0					1																	207644373		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1434C>G	1.37:g.207644373C>G			C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.L478	ENST00000367058.3	37	c.1434	CCDS1478.1	1																																																																																			CR2	-	superfamily_Complement_control_module,pfscan_Sushi_SCR_CCP	ENSG00000117322		0.418	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	HGNC	protein_coding	OTTHUMT00000088274.1	279	0.00	0	C	NM_001877		207644373	207644373	+1	no_errors	ENST00000367057	ensembl	human	known	69_37n	silent	330	21.80	92	SNP	0.133	G
CSMD1	64478	genome.wustl.edu	37	8	3889446	3889446	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr8:3889446G>A	ENST00000520002.1	-	4	1146	c.591C>T	c.(589-591)ttC>ttT	p.F197F	CSMD1_ENST00000537824.1_Silent_p.F197F|CSMD1_ENST00000539096.1_Silent_p.F197F|CSMD1_ENST00000602723.1_Silent_p.F197F|CSMD1_ENST00000400186.3_Silent_p.F197F|CSMD1_ENST00000542608.1_Silent_p.F197F|CSMD1_ENST00000602557.1_Silent_p.F197F			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	197	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGGGAGCTGGGAAGTCCCACG	0.547																																						dbGAP											0													78.0	83.0	82.0					8																	3889446		2060	4208	6268	-	-	-	SO:0001819	synonymous_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.591C>T	8.37:g.3889446G>A			Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.F197	ENST00000520002.1	37	c.591		8																																																																																			CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.547	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	49	0.00	0	G	NM_033225		3889446	3889446	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	silent	33	34.62	18	SNP	1.000	A
CSPP1	79848	genome.wustl.edu	37	8	68074106	68074106	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr8:68074106C>G	ENST00000262210.5	+	20	2615	c.2584C>G	c.(2584-2586)Caa>Gaa	p.Q862E	CSPP1_ENST00000412460.1_Missense_Mutation_p.Q517E|CSPP1_ENST00000521168.1_3'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	897					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AAGCAAACTCCAAAGACCTCC	0.358																																						dbGAP											0													188.0	186.0	186.0					8																	68074106		1866	4104	5970	-	-	-	SO:0001583	missense	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2584C>G	8.37:g.68074106C>G	ENSP00000262210:p.Gln862Glu		A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	NULL	p.Q862E	ENST00000262210.5	37	c.2584	CCDS43744.1	8	.	.	.	.	.	.	.	.	.	.	C	11.16	1.557178	0.27827	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.30182	1.54;1.56;1.56	5.42	5.42	0.78866	.	0.473633	0.22518	N	0.059020	T	0.27765	0.0683	L	0.48362	1.52	0.26366	N	0.97697	B;B;B	0.19583	0.037;0.013;0.013	B;B;B	0.15870	0.014;0.011;0.011	T	0.08889	-1.0700	10	0.19590	T	0.45	-12.5762	14.8846	0.70557	0.0:0.8174:0.1826:0.0	.	517;862;897	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;CSPP1_HUMAN	E	862;897;517;517	ENSP00000262210:Q862E;ENSP00000415782:Q517E;ENSP00000430092:Q517E	ENSP00000262210:Q862E	Q	+	1	0	CSPP1	68236660	0.997000	0.39634	0.964000	0.40570	0.981000	0.71138	3.337000	0.52120	2.820000	0.97059	0.650000	0.86243	CAA	CSPP1	-	NULL	ENSG00000104218		0.358	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	128	0.00	0	C	NM_024790		68074106	68074106	+1	no_errors	ENST00000262210	ensembl	human	known	69_37n	missense	108	25.17	37	SNP	0.962	G
CYP2C18	1562	genome.wustl.edu	37	10	96443636	96443636	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr10:96443636G>A	ENST00000285979.6	+	1	259	c.60G>A	c.(58-60)tgG>tgA	p.W20*	CYP2C18_ENST00000339022.5_Nonsense_Mutation_p.W20*	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	20					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	TTTCACTCTGGAGGCAGAGCT	0.507																																						dbGAP											0													111.0	96.0	101.0					10																	96443636		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.60G>A	10.37:g.96443636G>A	ENSP00000285979:p.Trp20*		B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.W20*	ENST00000285979.6	37	c.60	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	g	36	5.712978	0.96830	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	.	.	.	3.64	3.64	0.41730	.	0.074537	0.64402	U	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.185	0.59675	0.0:0.0:1.0:0.0	.	.	.	.	X	20	.	ENSP00000285979:W20X	W	+	3	0	CYP2C18	96433626	1.000000	0.71417	0.784000	0.31847	0.020000	0.10135	3.577000	0.53885	2.014000	0.59158	0.455000	0.32223	TGG	CYP2C18	-	NULL	ENSG00000108242		0.507	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	HGNC	protein_coding	OTTHUMT00000049486.1	146	0.00	0	G	NM_000772		96443636	96443636	+1	no_errors	ENST00000285979	ensembl	human	known	69_37n	nonsense	144	15.29	26	SNP	0.927	A
DAB1	1600	genome.wustl.edu	37	1	57537961	57537961	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:57537961G>T	ENST00000371231.1	-	4	467	c.433C>A	c.(433-435)Cag>Aag	p.Q145K	DAB1_ENST00000439789.2_Intron|DAB1_ENST00000420954.2_Missense_Mutation_p.Q145K|DAB1_ENST00000371230.1_Missense_Mutation_p.Q145K|DAB1_ENST00000371236.2_Missense_Mutation_p.Q145K|DAB1_ENST00000414851.2_Missense_Mutation_p.Q145K|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371234.4_Missense_Mutation_p.Q145K			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	145	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CTCACCGCCTGGGCTGTTTTT	0.488																																						dbGAP											0													116.0	113.0	114.0					1																	57537961		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.433C>A	1.37:g.57537961G>T	ENSP00000360275:p.Gln145Lys		A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.Q145K	ENST00000371231.1	37	c.433		1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797179	0.90538	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000371231;ENST00000332102;ENST00000371230	T;T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2;0.2	6.17	6.17	0.99709	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.55545	0.1927	N	0.17901	0.54	0.80722	D	1	D;B;B;B	0.53745	0.962;0.099;0.045;0.095	P;B;B;B	0.53490	0.727;0.163;0.101;0.133	T	0.42649	-0.9439	10	0.09338	T	0.73	-26.3363	20.8794	0.99867	0.0:0.0:1.0:0.0	.	145;145;145;145	O75553-4;O75553;O75553-6;O75553-5	.;DAB1_HUMAN;.;.	K	145	ENSP00000360280:Q145K;ENSP00000360278:Q145K;ENSP00000395296:Q145K;ENSP00000387581:Q145K;ENSP00000360275:Q145K;ENSP00000329120:Q145K;ENSP00000360274:Q145K	ENSP00000329120:Q145K	Q	-	1	0	DAB1	57310549	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CAG	DAB1	-	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	ENSG00000173406		0.488	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1	143	0.00	0	G	NM_021080		57537961	57537961	-1	no_errors	ENST00000371231	ensembl	human	known	69_37n	missense	138	31.86	65	SNP	1.000	T
DEC1	50514	genome.wustl.edu	37	9	118164403	118164403	+	Nonstop_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:118164403G>C	ENST00000374016.1	+	8	731	c.212G>C	c.(211-213)tGa>tCa	p.*71S		NM_017418.2	NP_059114.1	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1	0					negative regulation of cell proliferation (GO:0008285)					kidney(1)|large_intestine(1)|ovary(1)	3						ccagcagattgaatgtaagtg	0.373																																						dbGAP											0													76.0	73.0	74.0					9																	118164403		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			AB022761	CCDS6812.1	9q32	2008-02-05			ENSG00000173077	ENSG00000173077			23658	protein-coding gene	gene with protein product		604767				8603412, 10612805	Standard	NM_017418		Approved	CTS9	uc004bjk.1	Q9P2X7	OTTHUMG00000020549	ENST00000374016.1:c.212G>C	9.37:g.118164403G>C	ENSP00000363128:p.*71Serext*2			Nonstop_Mutation	SNP	NULL	p.*71S	ENST00000374016.1	37	c.212	CCDS6812.1	9	.	.	.	.	.	.	.	.	.	.	G	2.814	-0.246274	0.05906	.	.	ENSG00000173077	ENST00000374016	.	.	.	4.46	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.2988	0.21101	0.8864:0.0:0.1136:0.0	.	.	.	.	S	71	.	.	X	+	2	2	DEC1	117204224	0.153000	0.22777	0.982000	0.44146	0.117000	0.20001	0.760000	0.26475	1.046000	0.40249	-0.312000	0.09012	TGA	DEC1	-	NULL	ENSG00000173077		0.373	DEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEC1	HGNC	protein_coding	OTTHUMT00000053791.1	170	0.00	0	G	NM_017418		118164403	118164403	+1	no_errors	ENST00000374016	ensembl	human	known	69_37n	nonstop	152	34.76	81	SNP	0.991	C
DGKE	8526	genome.wustl.edu	37	17	54926210	54926210	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:54926210G>C	ENST00000284061.3	+	6	1222	c.1042G>C	c.(1042-1044)Gat>Cat	p.D348H		NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	348	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					AATTAAACTAGATCGGTAAGT	0.383																																						dbGAP											0													119.0	116.0	117.0					17																	54926210		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.1042G>C	17.37:g.54926210G>C	ENSP00000284061:p.Asp348His		Q8TBM4|Q9UKQ3	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.D348H	ENST00000284061.3	37	c.1042	CCDS11590.1	17	.	.	.	.	.	.	.	.	.	.	G	27.4	4.825792	0.90955	.	.	ENSG00000153933	ENST00000284061	T	0.61040	0.14	5.59	5.59	0.84812	Diacylglycerol kinase, catalytic domain (3);	0.090430	0.85682	D	0.000000	D	0.84206	0.5421	H	0.95645	3.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88582	0.3137	10	0.87932	D	0	.	19.5907	0.95509	0.0:0.0:1.0:0.0	.	348;348	A1L4Q0;P52429	.;DGKE_HUMAN	H	348	ENSP00000284061:D348H	ENSP00000284061:D348H	D	+	1	0	DGKE	52281209	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	9.019000	0.93662	2.642000	0.89623	0.563000	0.77884	GAT	DGKE	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000153933		0.383	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKE	HGNC	protein_coding	OTTHUMT00000440601.1	74	0.00	0	G	NM_003647		54926210	54926210	+1	no_errors	ENST00000284061	ensembl	human	known	69_37n	missense	99	50.00	100	SNP	1.000	C
DMD	1756	genome.wustl.edu	37	X	32482764	32482764	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chrX:32482764T>C	ENST00000357033.4	-	24	3421	c.3215A>G	c.(3214-3216)aAg>aGg	p.K1072R	DMD_ENST00000378677.2_Missense_Mutation_p.K1068R	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1072					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCATTCCTCCTTCAGAAAAAC	0.373																																						dbGAP											0													138.0	111.0	120.0					X																	32482764		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3215A>G	X.37:g.32482764T>C	ENSP00000354923:p.Lys1072Arg		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.K1072R	ENST00000357033.4	37	c.3215	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	T	10.40	1.340602	0.24339	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.51325	0.71;0.71	4.8	3.59	0.41128	.	0.205092	0.22483	U	0.059468	T	0.44244	0.1284	L	0.51422	1.61	0.80722	D	1	B;P;P	0.39424	0.403;0.673;0.458	B;B;B	0.42738	0.221;0.396;0.328	T	0.13602	-1.0503	10	0.23891	T	0.37	.	10.9704	0.47436	0.0:0.0:0.1548:0.8452	.	1064;1072;1068	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	R	1064;1068;1072;1072;949	ENSP00000367948:K1068R;ENSP00000354923:K1072R	ENSP00000354923:K1072R	K	-	2	0	DMD	32392685	1.000000	0.71417	0.971000	0.41717	0.989000	0.77384	5.096000	0.64535	0.580000	0.29522	0.376000	0.23039	AAG	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	384	0.00	0	T	NM_004006		32482764	32482764	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	362	34.24	189	SNP	0.997	C
DOK4	55715	genome.wustl.edu	37	16	57507913	57507913	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:57507913G>T	ENST00000340099.4	-	7	1009	c.638C>A	c.(637-639)aCa>aAa	p.T213K	DOK4_ENST00000561918.1_5'Flank|DOK4_ENST00000566936.1_Missense_Mutation_p.T213K|DOK4_ENST00000569548.1_Missense_Mutation_p.T213K	NM_018110.3	NP_060580.2	Q8TEW6	DOK4_HUMAN	docking protein 4	213	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	6						CCCCTCTTGTGTCTGGAAGGT	0.572																																						dbGAP											0													94.0	84.0	87.0					16																	57507913		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC003541	CCDS10783.1	16q13	2013-01-10			ENSG00000125170	ENSG00000125170		"""Pleckstrin homology (PH) domain containing"""	19868	protein-coding gene	gene with protein product		608333				10493829	Standard	NM_018110		Approved	FLJ10488	uc002elv.4	Q8TEW6	OTTHUMG00000133460	ENST00000340099.4:c.638C>A	16.37:g.57507913G>T	ENSP00000344277:p.Thr213Lys		O75209|Q9BTP2|Q9NVV3	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.T213K	ENST00000340099.4	37	c.638	CCDS10783.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.270976	0.95429	.	.	ENSG00000125170	ENST00000340099	T	0.79845	-1.31	5.42	5.42	0.78866	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.91195	0.7226	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.92271	0.5825	10	0.66056	D	0.02	-13.8615	18.2125	0.89874	0.0:0.0:1.0:0.0	.	213;213	Q8TEW6;B2RD67	DOK4_HUMAN;.	K	213	ENSP00000344277:T213K	ENSP00000344277:T213K	T	-	2	0	DOK4	56065414	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.827000	0.99397	2.539000	0.85634	0.561000	0.74099	ACA	DOK4	-	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	ENSG00000125170		0.572	DOK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK4	HGNC	protein_coding	OTTHUMT00000257335.3	107	0.00	0	G			57507913	57507913	-1	no_errors	ENST00000340099	ensembl	human	known	69_37n	missense	16	45.16	14	SNP	1.000	T
ECE2	9718	genome.wustl.edu	37	3	184003335	184003335	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:184003335G>T	ENST00000402825.3	+	10	1572	c.1572G>T	c.(1570-1572)gaG>gaT	p.E524D	ECE2_ENST00000357474.5_Missense_Mutation_p.E452D|ECE2_ENST00000404464.3_Missense_Mutation_p.E406D|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000359140.4_Missense_Mutation_p.E377D	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	524	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GACGCTTTGAGTCTGCACAAG	0.488																																						dbGAP											0													123.0	116.0	118.0					3																	184003335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1572G>T	3.37:g.184003335G>T	ENSP00000384223:p.Glu524Asp		A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.E524D	ENST00000402825.3	37	c.1572	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	G	19.81	3.895848	0.72639	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74	4.14	2.33	0.28932	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	T	0.72819	0.3508	L	0.33137	0.985	0.54753	D	0.999987	P;P;P;B;P;P;D	0.54964	0.727;0.884;0.884;0.067;0.859;0.859;0.969	P;P;P;B;P;P;P	0.60012	0.593;0.777;0.777;0.039;0.669;0.669;0.867	T	0.67059	-0.5766	10	0.31617	T	0.26	-21.9332	8.9266	0.35643	0.1884:0.0:0.8116:0.0	.	126;377;395;406;452;377;524	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	D	524;377;406;452;398	ENSP00000384223:E524D;ENSP00000352052:E377D;ENSP00000385846:E406D;ENSP00000350066:E452D;ENSP00000398444:E398D	ENSP00000350066:E452D	E	+	3	2	ECE2	185486029	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	4.031000	0.57267	0.406000	0.25560	0.467000	0.42956	GAG	ECE2	-	pfam_Peptidase_M13_N	ENSG00000145194		0.488	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	145	0.00	0	G	NM_014693		184003335	184003335	+1	no_errors	ENST00000402825	ensembl	human	known	69_37n	missense	83	20.19	21	SNP	0.998	T
ELF1	1997	genome.wustl.edu	37	13	41533123	41533124	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr13:41533123_41533124insA	ENST00000239882.3	-	3	415_416	c.101_102insT	c.(100-102)gtafs	p.V34fs	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Frame_Shift_Ins_p.V34fs	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	34					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		GTTCCACAATTACGGCAGGAAA	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.102dupT	13.37:g.41533124_41533124dupA	ENSP00000239882:p.Val34fs		B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Frame_Shift_Ins	INS	pfam_TF_Elf_N,pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.I35fs	ENST00000239882.3	37	c.102_101	CCDS9374.1	13																																																																																			ELF1	-	pfam_TF_Elf_N	ENSG00000120690		0.421	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF1	HGNC	protein_coding	OTTHUMT00000044654.3	109	0.00	0	-	NM_172373		41533123	41533124	-1	no_errors	ENST00000239882	ensembl	human	known	69_37n	frame_shift_ins	20	57.45	27	INS	0.628:0.970	A
ERO1L	30001	genome.wustl.edu	37	14	53150583	53150583	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:53150583T>C	ENST00000395686.3	-	2	380	c.157A>G	c.(157-159)Att>Gtt	p.I53V		NM_014584.1	NP_055399.1	Q96HE7	ERO1A_HUMAN	ERO1-like (S. cerevisiae)	53					4-hydroxyproline metabolic process (GO:0019471)|brown fat cell differentiation (GO:0050873)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum unfolded protein response (GO:0030968)|extracellular matrix organization (GO:0030198)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to temperature stimulus (GO:0009266)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)		ERO1L/FERMT2(2)	breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12	Breast(41;0.226)					AATCTATCAATGGTTTCAACA	0.289																																						dbGAP											0													58.0	59.0	59.0					14																	53150583		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF081886	CCDS9709.1	14q22.1	2010-10-06	2001-11-28		ENSG00000197930	ENSG00000197930			13280	protein-coding gene	gene with protein product		615435	"""ERO1 (S. cerevisiae)-like"""			10671517	Standard	NM_014584		Approved	ERO1A, ERO1-alpha	uc001wzv.3	Q96HE7	OTTHUMG00000140301	ENST00000395686.3:c.157A>G	14.37:g.53150583T>C	ENSP00000379042:p.Ile53Val		A8K9X4|A8MYW1|Q7LD45|Q9P1Q9|Q9UKV6	Missense_Mutation	SNP	pfam_ER_oxidoreductin-1,superfamily_ER_oxidoreductin-1,pirsf_ER_oxidoreductin-1	p.I53V	ENST00000395686.3	37	c.157	CCDS9709.1	14	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268922	0.40095	.	.	ENSG00000197930	ENST00000395686	T	0.47528	0.84	5.54	4.39	0.52855	.	0.049943	0.85682	N	0.000000	T	0.32763	0.0840	L	0.35723	1.085	0.80722	D	1	B	0.30146	0.27	B	0.31101	0.124	T	0.10132	-1.0643	10	0.02654	T	1	-12.5605	11.3434	0.49546	0.0:0.072:0.0:0.928	.	53	Q96HE7	ERO1A_HUMAN	V	53	ENSP00000379042:I53V	ENSP00000379042:I53V	I	-	1	0	ERO1L	52220333	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	5.647000	0.67923	1.045000	0.40225	0.533000	0.62120	ATT	ERO1L	-	superfamily_ER_oxidoreductin-1,pirsf_ER_oxidoreductin-1	ENSG00000197930		0.289	ERO1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERO1L	HGNC	protein_coding	OTTHUMT00000276892.1	75	0.00	0	T	NM_014584		53150583	53150583	-1	no_errors	ENST00000395686	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	1.000	C
EXTL3	2137	genome.wustl.edu	37	8	28575722	28575722	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr8:28575722A>G	ENST00000220562.4	+	3	3048	c.2146A>G	c.(2146-2148)Atg>Gtg	p.M716V	EXTL3_ENST00000523149.1_Missense_Mutation_p.M332V|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	716					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CGTCCCCATCATGGTAATAGA	0.463																																						dbGAP											0													85.0	86.0	86.0					8																	28575722		2203	4300	6503	-	-	-	SO:0001583	missense	0			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2146A>G	8.37:g.28575722A>G	ENSP00000220562:p.Met716Val		D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.M716V	ENST00000220562.4	37	c.2146	CCDS6070.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.707|4.707	0.131423|0.131423	0.08981|0.08981	.|.	.|.	ENSG00000012232|ENSG00000012232	ENST00000521473|ENST00000523149;ENST00000220562	.|T;T	.|0.75260	.|-0.92;-0.92	5.91|5.91	4.77|4.77	0.60923|0.60923	.|EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	.|0.054815	.|0.85682	.|D	.|0.000000	T|T	0.37433|0.37433	0.1003|0.1003	N|N	0.00436|0.00436	-1.5|-1.5	0.45183|0.45183	D|D	0.998195|0.998195	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.38585|0.38585	-0.9654|-0.9654	5|10	.|0.24483	.|T	.|0.36	-39.709|-39.709	7.6271|7.6271	0.28218|0.28218	0.7937:0.0:0.2063:0.0|0.7937:0.0:0.2063:0.0	.|.	.|716	.|O43909	.|EXTL3_HUMAN	R|V	49|332;716	.|ENSP00000428691:M332V;ENSP00000220562:M716V	.|ENSP00000220562:M716V	H|M	+|+	2|1	0|0	EXTL3|EXTL3	28631641|28631641	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.938000|0.938000	0.57974|0.57974	3.304000|3.304000	0.51866|0.51866	2.263000|2.263000	0.75096|0.75096	0.379000|0.379000	0.24179|0.24179	CAT|ATG	EXTL3	-	pfam_HexNAc_Trfase_a	ENSG00000012232		0.463	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXTL3	HGNC	protein_coding	OTTHUMT00000219987.3	144	0.00	0	A	NM_001440		28575722	28575722	+1	no_errors	ENST00000220562	ensembl	human	known	69_37n	missense	75	34.78	40	SNP	1.000	G
FAM155A	728215	genome.wustl.edu	37	13	108518300	108518300	+	Silent	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr13:108518300G>C	ENST00000375915.2	-	1	783	c.645C>G	c.(643-645)ctC>ctG	p.L215L		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	215						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						ACAAGTTCCAGAGCGGAGTGG	0.582																																						dbGAP											0													82.0	93.0	89.0					13																	108518300		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.645C>G	13.37:g.108518300G>C			B2RUV1|B7Z334	Silent	SNP	NULL	p.L215	ENST00000375915.2	37	c.645	CCDS32006.1	13																																																																																			FAM155A	-	NULL	ENSG00000204442		0.582	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	70	0.00	0	G	NM_001080396		108518300	108518300	-1	no_errors	ENST00000375915	ensembl	human	known	69_37n	silent	35	27.08	13	SNP	0.969	C
FAM184A	79632	genome.wustl.edu	37	6	119297156	119297156	+	Silent	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:119297156G>T	ENST00000338891.7	-	12	2952	c.2509C>A	c.(2509-2511)Cgg>Agg	p.R837R	FAM184A_ENST00000368475.4_Silent_p.R717R|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000521531.1_Silent_p.R837R|FAM184A_ENST00000352896.5_Silent_p.R717R	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	837						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TGATTATGCCGTAACAAATCA	0.378																																						dbGAP											0													95.0	89.0	90.0					6																	119297156		1876	4114	5990	-	-	-	SO:0001819	synonymous_variant	0			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2509C>A	6.37:g.119297156G>T			B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Nonsense_Mutation	SNP	NULL	p.Y91*	ENST00000338891.7	37	c.273	CCDS43499.1	6																																																																																			FAM184A	-	NULL	ENSG00000111879		0.378	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184A	HGNC	protein_coding	OTTHUMT00000042009.3	48	0.00	0	G	NM_024581		119297156	119297156	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000475529	ensembl	human	known	69_37n	nonsense	42	64.71	77	SNP	0.995	T
FAM208B	54906	genome.wustl.edu	37	10	5789922	5789922	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr10:5789922C>G	ENST00000328090.5	+	15	5163	c.4538C>G	c.(4537-4539)tCt>tGt	p.S1513C		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1513																	GAGGGTTTATCTTTCTCAGGA	0.453																																						dbGAP											0													66.0	66.0	66.0					10																	5789922		1935	4145	6080	-	-	-	SO:0001583	missense	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.4538C>G	10.37:g.5789922C>G	ENSP00000328426:p.Ser1513Cys		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.S1513C	ENST00000328090.5	37	c.4538	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	C	9.276	1.046797	0.19748	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.05382	3.45	4.76	2.42	0.29668	.	0.381501	0.22834	N	0.055061	T	0.13586	0.0329	L	0.59436	1.845	0.09310	N	1	D	0.76494	0.999	P	0.61328	0.887	T	0.04522	-1.0945	10	0.49607	T	0.09	.	5.0104	0.14310	0.0:0.6648:0.0:0.3352	.	1513	Q5VWN6	F208B_HUMAN	C	1513;708	ENSP00000328426:S1513C	ENSP00000328426:S1513C	S	+	2	0	C10orf18	5829928	0.023000	0.18921	0.004000	0.12327	0.060000	0.15804	0.389000	0.20751	0.975000	0.38392	0.655000	0.94253	TCT	FAM208B	-	NULL	ENSG00000108021		0.453	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	116	0.00	0	C	NM_017782		5789922	5789922	+1	no_errors	ENST00000328090	ensembl	human	known	69_37n	missense	129	26.70	47	SNP	0.011	G
FAM21C	253725	genome.wustl.edu	37	10	46265023	46265023	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr10:46265023G>A	ENST00000336378.4	+	20	2108	c.1990G>A	c.(1990-1992)Gag>Aag	p.E664K	FAM21C_ENST00000540872.1_Missense_Mutation_p.E666K|FAM21C_ENST00000374362.2_Missense_Mutation_p.E666K|FAM21C_ENST00000359860.4_Missense_Mutation_p.E608K|FAM21C_ENST00000537517.1_Missense_Mutation_p.E642K	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	664					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CAGTCTCTTTGAGGAAGACAA	0.493																																						dbGAP											0													252.0	232.0	238.0					10																	46265023		1883	4107	5990	-	-	-	SO:0001583	missense	0				CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1990G>A	10.37:g.46265023G>A	ENSP00000337541:p.Glu664Lys		B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	NULL	p.E666K	ENST00000336378.4	37	c.1996		10	.	.	.	.	.	.	.	.	.	.	G	18.75	3.691431	0.68271	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.29	3.29	0.37713	.	0.060572	0.64402	D	0.000002	T	0.72661	0.3488	M	0.79123	2.44	0.35546	D	0.803423	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.999;0.999;0.998	T	0.79581	-0.1744	9	0.51188	T	0.08	-22.2485	10.2223	0.43205	0.0:0.0:1.0:0.0	.	642;666;664;609	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	K	664;666;642;666;666;608;578	.	ENSP00000337541:E664K	E	+	1	0	FAM21C	45585029	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	4.592000	0.61027	1.836000	0.53414	0.549000	0.68633	GAG	FAM21C	-	NULL	ENSG00000172661		0.493	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	FAM21C	HGNC	protein_coding		347	0.00	0	G			46265023	46265023	+1	no_errors	ENST00000374362	ensembl	human	known	69_37n	missense	119	60.20	180	SNP	1.000	A
FAM27L	284123	genome.wustl.edu	37	17	21826274	21826274	+	lincRNA	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:21826274C>A	ENST00000426869.3	+	0	457					NR_028336.1		Q8N5T8	FA27L_HUMAN	family with sequence similarity 27-like											central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (53;0.11)|BRCA - Breast invasive adenocarcinoma(1;0.00463)		GAGATGGCAACAAGCCCTGTC	0.547																																						dbGAP											0													60.0	67.0	65.0					17																	21826274		2026	4174	6200	-	-	-			0			BC031617		17p11.2	2014-01-28				ENSG00000178130			32410	protein-coding gene	gene with protein product							Standard	NR_028336		Approved	MGC35151	uc002gyz.4	Q8N5T8			17.37:g.21826274C>A				RNA	SNP	-	NULL	ENST00000426869.3	37	NULL		17	.	.	.	.	.	.	.	.	.	.	C	1.437	-0.568680	0.03910	.	.	ENSG00000178130	ENST00000426869	.	.	.	0.158	0.158	0.14942	.	.	.	.	.	T	0.40015	0.1100	.	.	.	0.22199	N	0.999298	.	.	.	.	.	.	T	0.48364	-0.9042	3	0.30078	T	0.28	.	.	.	.	.	.	.	.	K	85	.	ENSP00000388448:Q85K	Q	+	1	0	FAM27L	21750401	0.006000	0.16342	0.011000	0.14972	0.011000	0.07611	0.172000	0.16704	0.202000	0.20498	0.205000	0.17691	CAA	FAM27L	-	-	ENSG00000178130		0.547	FAM27L-001	KNOWN	basic	lincRNA	FAM27L	HGNC	lincRNA	OTTHUMT00000389059.2	52	0.00	0	C	NM_203392		21826274	21826274	+1	no_errors	ENST00000426869	ensembl	human	known	69_37n	rna	31	39.22	20	SNP	0.012	A
FOXR2	139628	genome.wustl.edu	37	X	55650719	55650719	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chrX:55650719G>T	ENST00000339140.3	+	1	887	c.575G>T	c.(574-576)aGg>aTg	p.R192M		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	192					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						TCCTGGCAAAGGCCCCCTCTC	0.498																																						dbGAP											0													68.0	64.0	65.0					X																	55650719		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.575G>T	X.37:g.55650719G>T	ENSP00000427329:p.Arg192Met			Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R192M	ENST00000339140.3	37	c.575	CCDS35308.1	X	.	.	.	.	.	.	.	.	.	.	G	11.00	1.509656	0.27036	.	.	ENSG00000189299	ENST00000339140	D	0.96885	-4.16	3.02	1.22	0.21188	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.072824	0.56097	D	0.000035	D	0.97225	0.9093	M	0.86502	2.82	0.20196	N	0.99993	D	0.69078	0.997	D	0.63381	0.914	D	0.92153	0.5730	10	0.54805	T	0.06	.	6.5223	0.22283	0.2715:0.0:0.7285:0.0	.	192	Q6PJQ5	FOXR2_HUMAN	M	192	ENSP00000427329:R192M	ENSP00000427329:R192M	R	+	2	0	FOXR2	55667444	0.383000	0.25156	0.000000	0.03702	0.008000	0.06430	4.139000	0.58024	0.193000	0.20303	0.600000	0.82982	AGG	FOXR2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000189299		0.498	FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXR2	HGNC	protein_coding	OTTHUMT00000056877.2	187	0.00	0	G	NM_198451		55650719	55650719	+1	no_errors	ENST00000339140	ensembl	human	known	69_37n	missense	128	40.47	87	SNP	0.003	T
FOXO4	4303	genome.wustl.edu	37	X	70321379	70321379	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chrX:70321379G>A	ENST00000374259.3	+	2	1631	c.1299G>A	c.(1297-1299)atG>atA	p.M433I	FOXO4_ENST00000341558.3_Missense_Mutation_p.M378I	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	433					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					CCCTTTCTATGATAGCACCAC	0.622																																						dbGAP											0													61.0	60.0	61.0					X																	70321379		1940	4126	6066	-	-	-	SO:0001583	missense	0				CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.1299G>A	X.37:g.70321379G>A	ENSP00000363377:p.Met433Ile		B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.M433I	ENST00000374259.3	37	c.1299	CCDS43969.1	X	.	.	.	.	.	.	.	.	.	.	G	4.199	0.035703	0.08148	.	.	ENSG00000184481	ENST00000374259;ENST00000341558	D;D	0.96200	-3.94;-3.94	4.88	2.05	0.26809	.	0.742732	0.12720	N	0.444795	D	0.88926	0.6570	N	0.25647	0.755	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.75975	-0.3128	10	0.22109	T	0.4	-52.5888	4.8043	0.13312	0.2958:0.1984:0.5058:0.0	.	378;433	P98177-2;P98177	.;FOXO4_HUMAN	I	433;378	ENSP00000363377:M433I;ENSP00000342209:M378I	ENSP00000342209:M378I	M	+	3	0	FOXO4	70238104	0.000000	0.05858	0.041000	0.18516	0.892000	0.51952	0.174000	0.16743	0.078000	0.16900	0.600000	0.82982	ATG	FOXO4	-	NULL	ENSG00000184481		0.622	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXO4	HGNC	protein_coding	OTTHUMT00000057115.1	190	0.00	0	G	NM_005938		70321379	70321379	+1	no_errors	ENST00000374259	ensembl	human	known	69_37n	missense	91	28.35	36	SNP	0.035	A
G6PC2	57818	genome.wustl.edu	37	2	169761050	169761050	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:169761050G>T	ENST00000375363.3	+	3	456	c.364G>T	c.(364-366)Gtc>Ttc	p.V122F	SPC25_ENST00000472216.2_Intron|G6PC2_ENST00000461586.1_3'UTR|G6PC2_ENST00000429379.2_Missense_Mutation_p.V122F|G6PC2_ENST00000421979.1_Intron	NM_021176.2	NP_066999.1	Q9NQR9	G6PC2_HUMAN	glucose-6-phosphatase, catalytic, 2	122					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)			breast(1)|endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	13						CGCATCCTGTGTCTGGTATGT	0.463																																						dbGAP											0													252.0	230.0	237.0					2																	169761050		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF283575	CCDS2230.1, CCDS46443.1	2q24-q31	2008-02-05			ENSG00000152254	ENSG00000152254			28906	protein-coding gene	gene with protein product	"""islet specific glucose 6 phosphatase catalytic subunit related protein"""	608058				10078553, 10078554	Standard	NM_021176		Approved	IGRP	uc002uem.3	Q9NQR9	OTTHUMG00000132182	ENST00000375363.3:c.364G>T	2.37:g.169761050G>T	ENSP00000364512:p.Val122Phe		E9PAX2|Q6AHZ0	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase,pirsf_Glucose-6-phosphatase	p.V122F	ENST00000375363.3	37	c.364	CCDS2230.1	2	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991506	0.35131	.	.	ENSG00000152254	ENST00000375363;ENST00000429379	T;T	0.73897	-0.79;-0.79	5.78	5.78	0.91487	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.64402	D	0.000003	D	0.83727	0.5317	L	0.52011	1.625	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75484	0.981;0.986	T	0.80779	-0.1230	9	.	.	.	-21.5118	20.3681	0.98887	0.0:0.0:1.0:0.0	.	122;122	E9PAX2;Q9NQR9	.;G6PC2_HUMAN	F	122	ENSP00000364512:V122F;ENSP00000396939:V122F	.	V	+	1	0	G6PC2	169469296	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	7.312000	0.78968	2.890000	0.99128	0.655000	0.94253	GTC	G6PC2	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase,pirsf_Glucose-6-phosphatase	ENSG00000152254		0.463	G6PC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G6PC2	HGNC	protein_coding	OTTHUMT00000255234.2	277	0.00	0	G	NM_021176		169761050	169761050	+1	no_errors	ENST00000375363	ensembl	human	known	69_37n	missense	78	73.83	220	SNP	1.000	T
GABBR2	9568	genome.wustl.edu	37	9	101148012	101148012	+	Silent	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:101148012G>T	ENST00000259455.2	-	11	2031	c.1572C>A	c.(1570-1572)atC>atA	p.I524I		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	524					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TCCCTCCAAGGATGATAAGGT	0.383																																						dbGAP											0													160.0	145.0	150.0					9																	101148012		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.1572C>A	9.37:g.101148012G>T			O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.I524	ENST00000259455.2	37	c.1572	CCDS6736.1	9																																																																																			GABBR2	-	pfam_GPCR_3_C,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_GPCR_3_C	ENSG00000136928		0.383	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	HGNC	protein_coding	OTTHUMT00000053373.1	86	0.00	0	G			101148012	101148012	-1	no_errors	ENST00000259455	ensembl	human	known	69_37n	silent	63	41.28	45	SNP	1.000	T
GJB3	2707	genome.wustl.edu	37	1	35250839	35250839	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:35250839C>T	ENST00000373366.2	+	2	1091	c.476C>T	c.(475-477)cCg>cTg	p.P159L	GJB3_ENST00000373362.3_Missense_Mutation_p.P159L|RP1-34M23.5_ENST00000542839.1_RNA	NM_024009.2	NP_076872.1	O75712	CXB3_HUMAN	gap junction protein, beta 3, 31kDa	159					cell communication (GO:0007154)|in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|sensory perception of sound (GO:0007605)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	connexon complex (GO:0005922)|cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|prostate(3)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				TTCAATATGCCGCGCCTGGTG	0.552																																						dbGAP											0													161.0	172.0	168.0					1																	35250839		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012918	CCDS384.1	1p34	2008-05-14	2007-01-16		ENSG00000188910	ENSG00000188910		"""Ion channels / Gap junction proteins (connexins)"""	4285	protein-coding gene	gene with protein product	"""connexin 31"""	603324	"""gap junction protein, beta 3, 31kD (connexin 31)"", ""gap junction protein, beta 3, 31kDa (connexin 31)"", ""erythrokeratodermia variabilis"""	DFNA2, EKV		9843210, 9704026	Standard	NM_024009		Approved	CX31	uc001bxy.3	O75712	OTTHUMG00000004051	ENST00000373366.2:c.476C>T	1.37:g.35250839C>T	ENSP00000362464:p.Pro159Leu		B2R790|Q2TAZ8	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin31	p.P159L	ENST00000373366.2	37	c.476	CCDS384.1	1	.	.	.	.	.	.	.	.	.	.	c	14.31	2.497158	0.44352	.	.	ENSG00000188910	ENST00000373366;ENST00000373362;ENST00000543647	D;D	0.95756	-3.8;-3.8	5.31	5.31	0.75309	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.97402	0.9150	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97250	0.9897	10	0.49607	T	0.09	.	13.3088	0.60368	0.0:0.9217:0.0:0.0783	.	159	O75712	CXB3_HUMAN	L	159;159;143	ENSP00000362464:P159L;ENSP00000362460:P159L	ENSP00000362460:P159L	P	+	2	0	GJB3	35023426	1.000000	0.71417	0.961000	0.40146	0.009000	0.06853	4.913000	0.63341	2.484000	0.83849	0.556000	0.70494	CCG	GJB3	-	pfam_Connexin_CCC	ENSG00000188910		0.552	GJB3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GJB3	HGNC	protein_coding	OTTHUMT00000011559.1	155	0.00	0	C	NM_024009		35250839	35250839	+1	no_errors	ENST00000373362	ensembl	human	known	69_37n	missense	32	50.75	34	SNP	0.999	T
GP2	2813	genome.wustl.edu	37	16	20329728	20329728	+	Silent	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:20329728C>G	ENST00000381362.4	-	8	1117	c.1041G>C	c.(1039-1041)ggG>ggC	p.G347G	GP2_ENST00000381360.5_Silent_p.G200G|GP2_ENST00000341642.5_Silent_p.G197G|GP2_ENST00000302555.5_Silent_p.G344G|GP2_ENST00000573897.1_5'UTR	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	347	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						ACTCTCCATTCCCGTCCACAC	0.473																																						dbGAP											0													235.0	203.0	214.0					16																	20329728		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.1041G>C	16.37:g.20329728C>G			A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.G347	ENST00000381362.4	37	c.1041	CCDS42128.1	16																																																																																			GP2	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	ENSG00000169347		0.473	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GP2	HGNC	protein_coding	OTTHUMT00000436920.1	545	0.00	0	C	NM_016295		20329728	20329728	-1	no_errors	ENST00000381362	ensembl	human	known	69_37n	silent	324	32.57	157	SNP	0.089	G
GPATCH8	23131	genome.wustl.edu	37	17	42478549	42478549	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:42478549C>T	ENST00000591680.1	-	8	926	c.896G>A	c.(895-897)gGa>gAa	p.G299E	GPATCH8_ENST00000434000.1_Missense_Mutation_p.G221E	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	299							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		AAATGACACTCCCAATTTTTG	0.473																																						dbGAP											0													144.0	161.0	155.0					17																	42478549		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.896G>A	17.37:g.42478549C>T	ENSP00000467556:p.Gly299Glu		B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_Znf_C2H2_jaz,smart_G_patch_dom,pfscan_Znf_C2H2,pfscan_G_patch_dom	p.G299E	ENST00000591680.1	37	c.896	CCDS32666.1	17	.	.	.	.	.	.	.	.	.	.	C	17.08	3.298152	0.60086	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.26518	1.73	5.65	5.65	0.86999	.	0.056776	0.64402	D	0.000001	T	0.52306	0.1726	M	0.71206	2.165	0.54753	D	0.999985	D	0.76494	0.999	D	0.66716	0.946	T	0.53272	-0.8462	10	0.87932	D	0	-16.712	19.724	0.96154	0.0:1.0:0.0:0.0	.	299	Q9UKJ3	GPTC8_HUMAN	E	299;221	ENSP00000395016:G221E	ENSP00000335486:G299E	G	-	2	0	GPATCH8	39834075	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.625000	0.83145	2.654000	0.90174	0.557000	0.71058	GGA	GPATCH8	-	NULL	ENSG00000186566		0.473	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH8	HGNC	protein_coding	OTTHUMT00000457797.1	286	0.00	0	C	NM_001002909		42478549	42478549	-1	no_errors	ENST00000591680	ensembl	human	known	69_37n	missense	124	56.34	160	SNP	1.000	T
GPRC6A	222545	genome.wustl.edu	37	6	117130607	117130607	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:117130607G>C	ENST00000310357.3	-	2	389	c.368C>G	c.(367-369)tCc>tGc	p.S123C	GPRC6A_ENST00000530250.1_Missense_Mutation_p.S123C|GPRC6A_ENST00000368549.3_Missense_Mutation_p.S123C	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	123					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		AGTTTCTCTGGAGCAGTTGAA	0.438																																						dbGAP											0													90.0	85.0	87.0					6																	117130607		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.368C>G	6.37:g.117130607G>C	ENSP00000309493:p.Ser123Cys		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_vmron_rcpt_2	p.S123C	ENST00000310357.3	37	c.368	CCDS5112.1	6	.	.	.	.	.	.	.	.	.	.	G	14.72	2.618773	0.46736	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.82344	-1.6;-1.6;-1.6	4.81	4.81	0.61882	Extracellular ligand-binding receptor (1);	0.415790	0.19717	N	0.107670	T	0.81044	0.4741	N	0.24115	0.695	0.20764	N	0.999851	D;B;D	0.76494	0.997;0.023;0.999	P;B;D	0.66716	0.843;0.054;0.946	T	0.77109	-0.2709	10	0.62326	D	0.03	.	18.0766	0.89428	0.0:0.0:1.0:0.0	.	123;123;123	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	C	123	ENSP00000309493:S123C;ENSP00000357537:S123C;ENSP00000433465:S123C	ENSP00000309493:S123C	S	-	2	0	GPRC6A	117237300	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	8.688000	0.91260	2.491000	0.84063	0.650000	0.86243	TCC	GPRC6A	-	pfam_ANF_lig-bd_rcpt	ENSG00000173612		0.438	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	HGNC	protein_coding	OTTHUMT00000041966.2	132	0.00	0	G			117130607	117130607	-1	no_errors	ENST00000310357	ensembl	human	known	69_37n	missense	61	71.63	154	SNP	0.736	C
GSTT1	2952	genome.wustl.edu	37	22	24384222	24384222	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr22:24384222C>G	ENST00000248935.5	-	1	62	c.10G>C	c.(10-12)Gag>Cag	p.E4Q	GSTT1_ENST00000439996.2_5'UTR	NM_000853.2	NP_000844.2	P30711	GSTT1_HUMAN		4	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)|skin(1)	6					Carboplatin(DB00958)|Cisplatin(DB00515)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)	AGGTACAGCTCCAGGCCCATA	0.597									Myelodysplasia and Acute Myeloid Leukemia (AML), Familial																													dbGAP											0													68.0	63.0	65.0					22																	24384222		1700	3600	5300	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Familial Myelodysplastic syndrome (late-onset), Familial AML, Familial Monocytic Leukemia, Familial Monosomy 7 and AML																												ENST00000248935.5:c.10G>C	22.37:g.24384222C>G	ENSP00000248935:p.Glu4Gln		O00226|Q5TZY2|Q6IC69|Q969K8|Q96IY3	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.E4Q	ENST00000248935.5	37	c.10	CCDS13822.1	22	.	.	.	.	.	.	.	.	.	.	.	23.4	4.414920	0.83449	.	.	ENSG00000184674	ENST00000248935;ENST00000382792;ENST00000452369;ENST00000417870;ENST00000447865	T;T;T	0.62788	0.0;0.0;0.0	5.31	3.1	0.35709	Glutathione S-transferase, N-terminal (1);Thioredoxin-like fold (2);	1.681620	0.03230	N	0.178862	T	0.51295	0.1666	L	0.45422	1.42	0.80722	D	1	P	0.36010	0.532	B	0.24541	0.054	T	0.63699	-0.6578	10	0.72032	D	0.01	-29.856	6.2724	0.20961	0.0:0.7128:0.1891:0.0982	.	4	P30711	GSTT1_HUMAN	Q	4	ENSP00000248935:E4Q;ENSP00000406003:E4Q;ENSP00000397362:E4Q	ENSP00000248935:E4Q	E	-	1	0	GSTT1	22714222	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	3.674000	0.54598	2.679000	0.91253	0.551000	0.68910	GAG	GSTT1	-	superfamily_Thioredoxin-like_fold	ENSG00000184674		0.597	GSTT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTT1	HGNC	protein_coding	OTTHUMT00000320184.2	39	0.00	0	C			24384222	24384222	-1	no_errors	ENST00000248935	ensembl	human	known	69_37n	missense	5	66.67	10	SNP	1.000	G
GYS2	2998	genome.wustl.edu	37	12	21733378	21733378	+	Silent	SNP	A	A	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:21733378A>G	ENST00000261195.2	-	2	455	c.201T>C	c.(199-201)ggT>ggC	p.G67G		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	67					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CAAAATATGGACCTATCAGAA	0.408																																					Colon(149;9 1820 3690 10544 50424)	dbGAP											0													214.0	200.0	205.0					12																	21733378		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.201T>C	12.37:g.21733378A>G			A0AVD8	Silent	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1	p.G67	ENST00000261195.2	37	c.201	CCDS8690.1	12																																																																																			GYS2	-	pfam_Glycogen_synth	ENSG00000111713		0.408	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS2	HGNC	protein_coding	OTTHUMT00000402396.1	216	0.00	0	A	NM_021957		21733378	21733378	-1	no_errors	ENST00000261195	ensembl	human	known	69_37n	silent	152	35.04	82	SNP	0.741	G
GZMA	3001	genome.wustl.edu	37	5	54403622	54403622	+	Splice_Site	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr5:54403622G>A	ENST00000274306.6	+	3	251	c.216G>A	c.(214-216)ttG>ttA	p.L72L		NM_006144.3	NP_006135	P12544	GRAA_HUMAN	granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)	72	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			NL -> IP (in Ref. 5; no nucleotide entry). {ECO:0000305}.	apoptotic process (GO:0006915)|cytolysis (GO:0019835)|immune response (GO:0006955)|negative regulation of DNA binding (GO:0043392)|negative regulation of endodeoxyribonuclease activity (GO:0032078)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of apoptotic process (GO:0043065)|proteolysis involved in cellular protein catabolic process (GO:0051603)	extracellular region (GO:0005576)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	25		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CTGTTCTCAGGAACAAAAGGT	0.388																																						dbGAP											0													103.0	99.0	101.0					5																	54403622		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS3965.1	5q11-q12	2008-07-18			ENSG00000145649	ENSG00000145649			4708	protein-coding gene	gene with protein product	"""CTL tryptase"", ""Granzyme A (Cytotoxic T-lymphocyte-associated serine esterase-3; Hanukah factor serine protease)"""	140050		HFSP, CTLA3		3262682, 3533635	Standard	NM_006144		Approved		uc003jpm.3	P12544	OTTHUMG00000097011	ENST00000274306.6:c.216-1G>A	5.37:g.54403622G>A			A4PHN1|Q6IB36	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.L72	ENST00000274306.6	37	c.216	CCDS3965.1	5																																																																																			GZMA	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000145649		0.388	GZMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMA	HGNC	protein_coding	OTTHUMT00000214100.2	186	0.00	0	G	NM_006144	Silent	54403622	54403622	+1	no_errors	ENST00000274306	ensembl	human	known	69_37n	silent	190	34.59	101	SNP	0.294	A
HERC2	8924	genome.wustl.edu	37	15	28478454	28478454	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr15:28478454C>A	ENST00000261609.7	-	30	4621	c.4513G>T	c.(4513-4515)Gtc>Ttc	p.V1505F		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGAGCGCAGACCTCCTTGTAA	0.393																																						dbGAP											0													12.0	17.0	16.0					15																	28478454		1857	4056	5913	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.4513G>T	15.37:g.28478454C>A	ENSP00000261609:p.Val1505Phe			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.V1505F	ENST00000261609.7	37	c.4513	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	26.5	4.746235	0.89663	.	.	ENSG00000128731	ENST00000261609	T	0.56103	0.48	4.13	4.13	0.48395	.	0.068333	0.56097	D	0.000023	T	0.71022	0.3291	M	0.71036	2.16	0.80722	D	1	D	0.61697	0.99	D	0.70487	0.969	T	0.76211	-0.3042	10	0.87932	D	0	.	16.9572	0.86262	0.0:1.0:0.0:0.0	.	1505	O95714	HERC2_HUMAN	F	1505	ENSP00000261609:V1505F	ENSP00000261609:V1505F	V	-	1	0	HERC2	26152049	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	7.320000	0.79064	2.298000	0.77334	0.650000	0.86243	GTC	HERC2	-	NULL	ENSG00000128731		0.393	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	183	0.00	0	C	NM_004667		28478454	28478454	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	80	54.80	97	SNP	1.000	A
HMCN1	83872	genome.wustl.edu	37	1	186024717	186024717	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:186024717A>G	ENST00000271588.4	+	45	7284	c.7055A>G	c.(7054-7056)aAc>aGc	p.N2352S	HMCN1_ENST00000367492.2_Missense_Mutation_p.N2352S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2352	Ig-like C2-type 21.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGCTGAAGAACATTCATGTA	0.433																																						dbGAP											0													155.0	134.0	141.0					1																	186024717		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7055A>G	1.37:g.186024717A>G	ENSP00000271588:p.Asn2352Ser		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.N2352S	ENST00000271588.4	37	c.7055	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	A	1.007	-0.689246	0.03328	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.73258	-0.73;-0.73	5.5	3.18	0.36537	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.349316	0.36444	N	0.002600	T	0.47985	0.1475	N	0.16066	0.365	0.22639	N	0.998909	B	0.19817	0.039	B	0.21151	0.033	T	0.25882	-1.0119	10	0.09084	T	0.74	.	9.7577	0.40513	0.7977:0.0:0.2023:0.0	.	2352	Q96RW7	HMCN1_HUMAN	S	2352	ENSP00000271588:N2352S;ENSP00000356462:N2352S	ENSP00000271588:N2352S	N	+	2	0	HMCN1	184291340	0.981000	0.34729	0.439000	0.26833	0.670000	0.39368	2.735000	0.47377	0.369000	0.24510	-1.167000	0.01749	AAC	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000143341		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	412	0.24	1	A	NM_031935		186024717	186024717	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	295	46.27	254	SNP	0.425	G
HSPA13	6782	genome.wustl.edu	37	21	15745987	15745987	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr21:15745987C>G	ENST00000285667.3	-	5	1434	c.1367G>C	c.(1366-1368)aGt>aCt	p.S456T	HSPA13_ENST00000544452.1_Missense_Mutation_p.S248T	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	456						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						TTCTAAAGCACTGACTTGGAG	0.428																																						dbGAP											0													50.0	50.0	50.0					21																	15745987		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.1367G>C	21.37:g.15745987C>G	ENSP00000285667:p.Ser456Thr		B2R616|Q8NE40	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.S456T	ENST00000285667.3	37	c.1367	CCDS13567.1	21	.	.	.	.	.	.	.	.	.	.	C	21.5	4.151348	0.78001	.	.	ENSG00000155304	ENST00000285667;ENST00000544452	T;T	0.10288	4.72;2.89	5.65	4.77	0.60923	.	0.144833	0.85682	D	0.000000	T	0.16171	0.0389	L	0.52364	1.645	0.80722	D	1	P	0.47253	0.892	P	0.45753	0.492	T	0.00998	-1.1486	10	0.62326	D	0.03	-10.2744	15.0193	0.71617	0.0:0.9316:0.0:0.0684	.	456	P48723	HSP13_HUMAN	T	456;248	ENSP00000285667:S456T;ENSP00000441986:S248T	ENSP00000285667:S456T	S	-	2	0	HSPA13	14667858	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.730000	0.84881	1.534000	0.49203	0.655000	0.94253	AGT	HSPA13	-	NULL	ENSG00000155304		0.428	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA13	HGNC	protein_coding	OTTHUMT00000157815.1	106	0.00	0	C			15745987	15745987	-1	no_errors	ENST00000285667	ensembl	human	known	69_37n	missense	128	45.76	108	SNP	1.000	G
IGFBP3	3486	genome.wustl.edu	37	7	45956971	45956971	+	Silent	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:45956971C>T	ENST00000275521.6	-	2	604	c.471G>A	c.(469-471)acG>acA	p.T157T	IGFBP3_ENST00000465642.1_5'UTR|IGFBP3_ENST00000381083.4_Silent_p.T163T|IGFBP3_ENST00000381086.5_Silent_p.T60T	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	157	Ser/Thr-rich.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)			large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	ACACCCGGTGCGTGCTGGAGA	0.532											OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													83.0	78.0	80.0					7																	45956971		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.471G>A	7.37:g.45956971C>T		935	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Missense_Mutation	SNP	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP-3,prints_IGFBP_1-6_chordata	p.A19T	ENST00000275521.6	37	c.55	CCDS5505.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.024|1.024	-0.683933|-0.683933	0.03353|0.03353	.|.	.|.	ENSG00000146674|ENSG00000146674	ENST00000417621|ENST00000428530	.|.	.|.	.|.	5.55|5.55	-11.1|-11.1	0.00147|0.00147	.|.	.|.	.|.	.|.	.|.	T|T	0.23171|0.23171	0.0560|0.0560	.|.	.|.	.|.	0.33665|0.33665	D|D	0.610138|0.610138	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.15723|0.15723	-1.0427|-1.0427	4|4	.|.	.|.	.|.	-22.697|-22.697	0.7072|0.7072	0.00918|0.00918	0.2919:0.2138:0.3066:0.1877|0.2919:0.2138:0.3066:0.1877	.|.	.|.	.|.	.|.	T|H	19|9	.|.	.|.	A|R	-|-	1|2	0|0	IGFBP3|IGFBP3	45923496|45923496	0.002000|0.002000	0.14202|0.14202	0.023000|0.023000	0.16930|0.16930	0.052000|0.052000	0.14988|0.14988	-2.446000|-2.446000	0.01010|0.01010	-1.749000|-1.749000	0.01330|0.01330	-0.290000|-0.290000	0.09829|0.09829	GCA|CGC	IGFBP3	-	NULL	ENSG00000146674		0.532	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGFBP3	HGNC	protein_coding	OTTHUMT00000251356.3	94	0.00	0	C	NM_001013398		45956971	45956971	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000417621	ensembl	human	known	69_37n	missense	13	50.00	13	SNP	0.004	T
ITPR3	3710	genome.wustl.edu	37	6	33663498	33663498	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:33663498C>T	ENST00000374316.5	+	59	9017	c.7957C>T	c.(7957-7959)Cag>Tag	p.Q2653*	ITPR3_ENST00000605930.1_Nonsense_Mutation_p.Q2653*|SBP1_ENST00000594414.1_5'Flank|MIR3934_ENST00000579806.1_RNA			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2653					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GATGACGGAGCAGCGGAAACG	0.607																																						dbGAP											0													136.0	119.0	125.0					6																	33663498		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.7957C>T	6.37:g.33663498C>T	ENSP00000363435:p.Gln2653*		Q14649|Q5TAQ2	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,pfscan_MIR_motif,prints_InsP3_rcpt-bd	p.Q2653*	ENST00000374316.5	37	c.7957	CCDS4783.1	6	.	.	.	.	.	.	.	.	.	.	C	53	21.285158	0.99939	.	.	ENSG00000096433	ENST00000374316	.	.	.	5.28	5.28	0.74379	.	0.060301	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-34.9467	18.9124	0.92491	0.0:1.0:0.0:0.0	.	.	.	.	X	2653	.	ENSP00000363435:Q2653X	Q	+	1	0	ITPR3	33771476	1.000000	0.71417	0.994000	0.49952	0.972000	0.66771	6.938000	0.75904	2.490000	0.84030	0.561000	0.74099	CAG	ITPR3	-	NULL	ENSG00000096433		0.607	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	HGNC	protein_coding	OTTHUMT00000040204.2	77	0.00	0	C	NM_002224		33663498	33663498	+1	no_errors	ENST00000374316	ensembl	human	known	69_37n	nonsense	11	69.44	25	SNP	1.000	T
ITSN2	50618	genome.wustl.edu	37	2	24531579	24531579	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:24531579C>A	ENST00000355123.4	-	8	1143	c.700G>T	c.(700-702)Ggg>Tgg	p.G234W	ITSN2_ENST00000406921.3_Missense_Mutation_p.G234W|ITSN2_ENST00000407704.1_5'Flank|ITSN2_ENST00000361999.3_Missense_Mutation_p.G234W	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	234					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTGAGGTCCCAGTCTTGGGT	0.338																																						dbGAP											0													90.0	91.0	90.0					2																	24531579		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.700G>T	2.37:g.24531579C>A	ENSP00000347244:p.Gly234Trp		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.G234W	ENST00000355123.4	37	c.700	CCDS1710.2	2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013608	0.75161	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	5.21	5.21	0.72293	.	0.225088	0.22024	U	0.065693	T	0.47691	0.1459	L	0.42245	1.32	0.41458	D	0.988026	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;D	0.79784	0.993;0.993;0.993;0.971	T	0.44877	-0.9299	10	0.87932	D	0	.	14.4018	0.67053	0.0:0.9267:0.0:0.0733	.	234;234;234;234	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	W	234;234;234;258;234;259	ENSP00000354561:G234W;ENSP00000347244:G234W;ENSP00000370250:G234W;ENSP00000384499:G234W;ENSP00000391224:G259W	ENSP00000347244:G234W	G	-	1	0	ITSN2	24385083	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.062000	0.49971	2.607000	0.88179	0.462000	0.41574	GGG	ITSN2	-	NULL	ENSG00000198399		0.338	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	47	0.00	0	C	NM_006277		24531579	24531579	-1	no_errors	ENST00000355123	ensembl	human	known	69_37n	missense	83	35.16	45	SNP	1.000	A
JAK2	3717	genome.wustl.edu	37	9	5044448	5044448	+	Nonsense_Mutation	SNP	T	T	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:5044448T>G	ENST00000381652.3	+	5	890	c.396T>G	c.(394-396)taT>taG	p.Y132*	JAK2_ENST00000544510.1_De_novo_Start_OutOfFrame|JAK2_ENST00000539801.1_Nonsense_Mutation_p.Y132*	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	132	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	ACAGAGCCTATCGGCATGGAA	0.378		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																													dbGAP		Dom	yes		9	9p24	3717	Janus kinase 2		L	0													142.0	131.0	135.0					9																	5044448		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database			CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.396T>G	9.37:g.5044448T>G	ENSP00000371067:p.Tyr132*		O14636|O75297	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak2,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y132*	ENST00000381652.3	37	c.396	CCDS6457.1	9	.	.	.	.	.	.	.	.	.	.	T	38	6.978932	0.97979	.	.	ENSG00000096968	ENST00000539801;ENST00000381652	.	.	.	5.35	0.297	0.15762	.	0.114616	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.157	10.4338	0.44424	0.0:0.3295:0.0:0.6705	.	.	.	.	X	132	.	ENSP00000371067:Y132X	Y	+	3	2	JAK2	5034448	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	0.646000	0.24797	0.079000	0.16929	0.533000	0.62120	TAT	JAK2	-	smart_Band_41_domain,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,prints_Tyr_kinase_non-rcpt_Jak2	ENSG00000096968		0.378	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK2	HGNC	protein_coding	OTTHUMT00000051609.1	90	0.00	0	T			5044448	5044448	+1	no_errors	ENST00000381652	ensembl	human	known	69_37n	nonsense	10	68.57	24	SNP	0.997	G
KAT7	11143	genome.wustl.edu	37	17	47903439	47903439	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:47903439C>T	ENST00000259021.4	+	13	1838	c.1558C>T	c.(1558-1560)Cgc>Tgc	p.R520C	KAT7_ENST00000435742.2_Missense_Mutation_p.R334C|KAT7_ENST00000513980.1_3'UTR|KAT7_ENST00000503935.2_Missense_Mutation_p.R364C|KAT7_ENST00000510819.1_Missense_Mutation_p.R351C|KAT7_ENST00000424009.2_Missense_Mutation_p.R490C|KAT7_ENST00000509773.1_Missense_Mutation_p.R410C|KAT7_ENST00000454930.2_Missense_Mutation_p.R381C	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	520	MYST-type HAT.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TATAAGCTATCGCAGTTACTG	0.423																																						dbGAP											0													108.0	107.0	107.0					17																	47903439		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.1558C>T	17.37:g.47903439C>T	ENSP00000259021:p.Arg520Cys		B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.R520C	ENST00000259021.4	37	c.1558	CCDS11554.1	17	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168781	0.78339	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009;ENST00000503935;ENST00000435742	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.89636	0.6772	H	0.96460	3.825	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;0.999	D	0.92477	0.5990	9	0.87932	D	0	-13.5307	18.7204	0.91691	0.0:1.0:0.0:0.0	.	483;351;410;381;520	B4DGY4;B4DFE0;B4DFB4;E7ER15;O95251	.;.;.;.;KAT7_HUMAN	C	520;381;410;351;490;364;334	.	ENSP00000259021:R520C	R	+	1	0	KAT7	45258438	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.830000	0.48136	2.756000	0.94617	0.561000	0.74099	CGC	KAT7	-	pfam_MOZ_SAS,superfamily_Acyl_CoA_acyltransferase	ENSG00000136504		0.423	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	HGNC	protein_coding	OTTHUMT00000366032.1	220	0.00	0	C	NM_007067		47903439	47903439	+1	no_errors	ENST00000259021	ensembl	human	known	69_37n	missense	298	28.37	118	SNP	1.000	T
KCND2	3751	genome.wustl.edu	37	7	119915782	119915782	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:119915782G>A	ENST00000331113.4	+	1	2061	c.1096G>A	c.(1096-1098)Gtc>Atc	p.V366I		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	366					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GTATACCATCGTCACCATGAC	0.507																																						dbGAP											0													103.0	92.0	96.0					7																	119915782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1096G>A	7.37:g.119915782G>A	ENSP00000333496:p.Val366Ile		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.V366I	ENST00000331113.4	37	c.1096	CCDS5776.1	7	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211413	0.79240	.	.	ENSG00000184408	ENST00000331113	D	0.97620	-4.46	5.53	5.53	0.82687	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.97813	0.9282	L	0.55017	1.72	0.80722	D	1	D	0.71674	0.998	D	0.68192	0.956	D	0.97326	0.9947	9	.	.	.	.	19.8217	0.96599	0.0:0.0:1.0:0.0	.	366	Q9NZV8	KCND2_HUMAN	I	366	ENSP00000333496:V366I	.	V	+	1	0	KCND2	119703018	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.813000	0.99286	2.775000	0.95449	0.650000	0.86243	GTC	KCND2	-	pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl	ENSG00000184408		0.507	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	89	0.00	0	G	NM_012281		119915782	119915782	+1	no_errors	ENST00000331113	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	1.000	A
KCNK2	3776	genome.wustl.edu	37	1	215408280	215408280	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:215408280delC	ENST00000444842.2	+	7	1223	c.1073delC	c.(1072-1074)gccfs	p.A358fs	KCNK2_ENST00000391895.2_Frame_Shift_Del_p.A354fs|KCNK2_ENST00000391894.2_Frame_Shift_Del_p.A343fs	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	358	Required for basal channel activity. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	TTCCAGCGGGCCACCTCCATC	0.552																																						dbGAP											0													74.0	71.0	72.0					1																	215408280		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.1073delC	1.37:g.215408280delC	ENSP00000394033:p.Ala358fs		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Frame_Shift_Del	DEL	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.T359fs	ENST00000444842.2	37	c.1073	CCDS41467.1	1																																																																																			KCNK2	-	prints_2pore_dom_K_chnl_TREK	ENSG00000082482		0.552	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	164	0.00	0	C	NM_014217		215408280	215408280	+1	no_errors	ENST00000444842	ensembl	human	known	69_37n	frame_shift_del	229	22.19	67	DEL	1.000	-
KCNK2	3776	genome.wustl.edu	37	1	215408281	215408281	+	Silent	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:215408281C>G	ENST00000444842.2	+	7	1224	c.1074C>G	c.(1072-1074)gcC>gcG	p.A358A	KCNK2_ENST00000391895.2_Silent_p.A354A|KCNK2_ENST00000391894.2_Silent_p.A343A	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	358	Required for basal channel activity. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	TCCAGCGGGCCACCTCCATCA	0.557																																						dbGAP											0													74.0	71.0	72.0					1																	215408281		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.1074C>G	1.37:g.215408281C>G			A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Silent	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.A358	ENST00000444842.2	37	c.1074	CCDS41467.1	1																																																																																			KCNK2	-	prints_2pore_dom_K_chnl_TREK	ENSG00000082482		0.557	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	168	0.00	0	C	NM_014217		215408281	215408281	+1	no_errors	ENST00000444842	ensembl	human	known	69_37n	silent	234	22.37	68	SNP	1.000	G
KIAA1109	84162	genome.wustl.edu	37	4	123234825	123234825	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr4:123234825C>T	ENST00000264501.4	+	60	10668	c.10295C>T	c.(10294-10296)aCa>aTa	p.T3432I	KIAA1109_ENST00000388738.3_Missense_Mutation_p.T3432I|KIAA1109_ENST00000455637.1_Missense_Mutation_p.T3432I			Q2LD37	K1109_HUMAN	KIAA1109	3432					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TCAAGAACTACAGGACAAGCA	0.343																																						dbGAP											0													119.0	111.0	114.0					4																	123234825		1844	4104	5948	-	-	-	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.10295C>T	4.37:g.123234825C>T	ENSP00000264501:p.Thr3432Ile		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.T3432I	ENST00000264501.4	37	c.10295	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727180	0.48833	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637;ENST00000438707;ENST00000421930	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.48	5.48	0.80851	.	0.000000	0.64402	U	0.000002	T	0.51415	0.1673	N	0.20986	0.625	0.54753	D	0.999988	D;D	0.71674	0.997;0.998	D;D	0.76071	0.986;0.987	T	0.42832	-0.9428	10	0.24483	T	0.36	.	19.3512	0.94387	0.0:1.0:0.0:0.0	.	3432;3432	Q2LD37-6;Q2LD37	.;K1109_HUMAN	I	3432;3432;3432;48;48	ENSP00000264501:T3432I;ENSP00000373390:T3432I;ENSP00000389925:T3432I;ENSP00000410874:T48I	ENSP00000264501:T3432I	T	+	2	0	KIAA1109	123454275	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.157000	0.77461	2.566000	0.86566	0.460000	0.39030	ACA	KIAA1109	-	NULL	ENSG00000138688		0.343	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	110	0.00	0	C	NM_020797		123234825	123234825	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	missense	36	57.65	49	SNP	1.000	T
KIAA1549	57670	genome.wustl.edu	37	7	138583717	138583717	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:138583717T>A	ENST00000422774.1	-	9	3879	c.3831A>T	c.(3829-3831)caA>caT	p.Q1277H	KIAA1549_ENST00000242365.4_Missense_Mutation_p.Q1227H|KIAA1549_ENST00000440172.1_Missense_Mutation_p.Q1277H			Q9HCM3	K1549_HUMAN	KIAA1549	1277						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CAATGACACCTTGAATTCGGT	0.507			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	dbGAP		Dom	yes		7	7q34	57670	KIAA1549		O	0													156.0	151.0	153.0					7																	138583717		2135	4250	6385	-	-	-	SO:0001583	missense	0				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3831A>T	7.37:g.138583717T>A	ENSP00000416040:p.Gln1277His		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NULL	p.Q1277H	ENST00000422774.1	37	c.3831	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	T	12.81	2.050275	0.36181	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.29142	1.58;1.59;1.58	5.19	1.44	0.22558	.	0.261013	0.39020	N	0.001499	T	0.23649	0.0572	L	0.39147	1.195	0.47621	D	0.999476	P;B;P;B	0.44195	0.828;0.043;0.794;0.043	B;B;B;B	0.43950	0.437;0.026;0.31;0.026	T	0.02109	-1.1212	10	0.41790	T	0.15	.	5.2959	0.15752	0.123:0.2892:0.0:0.5877	.	1277;61;1277;61	Q9HCM3;Q9HCM3-4;Q9HCM3-2;Q9HCM3-3	K1549_HUMAN;.;.;.	H	1277;1227;1277	ENSP00000406661:Q1277H;ENSP00000242365:Q1227H;ENSP00000416040:Q1277H	ENSP00000242365:Q1227H	Q	-	3	2	KIAA1549	138234257	0.915000	0.31059	0.993000	0.49108	0.291000	0.27294	-0.084000	0.11268	0.296000	0.22592	-0.441000	0.05720	CAA	KIAA1549	-	NULL	ENSG00000122778		0.507	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	398	0.00	0	T			138583717	138583717	-1	no_errors	ENST00000422774	ensembl	human	known	69_37n	missense	334	38.03	205	SNP	0.919	A
KIR3DL2	3812	genome.wustl.edu	37	19	55378001	55378001	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:55378001G>A	ENST00000326321.3	+	9	1216	c.1183G>A	c.(1183-1185)Gag>Aag	p.E395K	RNU6-222P_ENST00000362438.1_RNA|KIR3DL2_ENST00000270442.5_Missense_Mutation_p.E378K|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.E395K	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	395					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		AGACCCTCAGGAGGTGACGTA	0.498																																						dbGAP											0													264.0	253.0	257.0					19																	55378001		2203	4300	6503	-	-	-	SO:0001583	missense	0			L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.1183G>A	19.37:g.55378001G>A	ENSP00000325525:p.Glu395Lys		Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.E395K	ENST00000326321.3	37	c.1183	CCDS12906.1	19	.	.	.	.	.	.	.	.	.	.	G	14.56	2.571148	0.45798	.	.	ENSG00000167633;ENSG00000240403;ENSG00000240403	ENST00000402254;ENST00000326321;ENST00000270442	T;T;T	0.00509	7.01;7.01;6.91	1.59	1.59	0.23543	.	.	.	.	.	T	0.01695	0.0054	M	0.87682	2.9	0.09310	N	1	D;D;D	0.63880	0.969;0.989;0.993	P;D;D	0.77557	0.824;0.977;0.99	T	0.37686	-0.9695	9	0.87932	D	0	.	6.5911	0.22647	0.0:0.0:1.0:0.0	.	378;395;395	Q95366;P43630;F6QF33	.;KI3L2_HUMAN;.	K	395;395;378	ENSP00000384528:E395K;ENSP00000325525:E395K;ENSP00000270442:E378K	ENSP00000384528:E395K	E	+	1	0	KIR3DL1;KIR3DL2	60069813	0.984000	0.35163	0.014000	0.15608	0.020000	0.10135	1.495000	0.35627	0.909000	0.36697	0.393000	0.25936	GAG	KIR3DL2	-	NULL	ENSG00000240403		0.498	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIR3DL2	HGNC	protein_coding	OTTHUMT00000141241.1	958	0.10	1	G			55378001	55378001	+1	no_errors	ENST00000326321	ensembl	human	known	69_37n	missense	964	16.80	195	SNP	0.041	A
KIRREL	55243	genome.wustl.edu	37	1	158058209	158058209	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:158058209C>T	ENST00000359209.6	+	8	1076	c.1009C>T	c.(1009-1011)Ctc>Ttc	p.L337F	KIRREL_ENST00000368173.3_Missense_Mutation_p.L337F|KIRREL_ENST00000392272.2_Missense_Mutation_p.L234F|KIRREL_ENST00000416935.2_Missense_Mutation_p.L237F|KIRREL_ENST00000368172.1_Missense_Mutation_p.L135F|KIRREL_ENST00000360089.4_Missense_Mutation_p.L173F			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	337	Ig-like C2-type 4.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GAATCCCCCCCTCACTCTCAC	0.463																																						dbGAP											0													105.0	105.0	105.0					1																	158058209		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1009C>T	1.37:g.158058209C>T	ENSP00000352138:p.Leu337Phe		Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L337F	ENST00000359209.6	37	c.1009	CCDS1172.2	1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690228	0.88735	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61	5.28	5.28	0.74379	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.32836	U	0.005600	T	0.40196	0.1107	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.71674	0.958;0.998;0.964;0.99	D;D;P;P	0.68621	0.934;0.959;0.767;0.89	T	0.06356	-1.0831	10	0.33940	T	0.23	-21.0919	16.4039	0.83651	0.0:1.0:0.0:0.0	.	237;173;135;337	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	F	173;337;234;337;237;135	ENSP00000353202:L173F;ENSP00000357155:L337F;ENSP00000376098:L234F;ENSP00000352138:L337F;ENSP00000389674:L237F;ENSP00000357154:L135F	ENSP00000352138:L337F	L	+	1	0	KIRREL	156324833	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	5.502000	0.66956	2.466000	0.83321	0.557000	0.71058	CTC	KIRREL	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000183853		0.463	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	HGNC	protein_coding	OTTHUMT00000058342.3	331	0.00	0	C	NM_018240		158058209	158058209	+1	no_errors	ENST00000368173	ensembl	human	known	69_37n	missense	146	34.38	77	SNP	1.000	T
KRT5	3852	genome.wustl.edu	37	12	52914042	52914043	+	Frame_Shift_Ins	INS	-	-	C	rs116931869	byFrequency	TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:52914042_52914043insC	ENST00000252242.4	-	1	428_429	c.38_39insG	c.(37-39)ggcfs	p.G13fs		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	13	Head.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCTACGACTGCCCCCGCTCCG	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.39dupG	12.37:g.52914047_52914047dupC	ENSP00000252242:p.Gly13fs		Q6PI71|Q6UBJ0|Q8TA91	Frame_Shift_Ins	INS	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S14fs	ENST00000252242.4	37	c.39_38	CCDS8830.1	12																																																																																			KRT5	-	NULL	ENSG00000186081		0.644	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT5	HGNC	protein_coding	OTTHUMT00000405312.1	52	0.00	0	-			52914042	52914043	-1	no_errors	ENST00000252242	ensembl	human	known	69_37n	frame_shift_ins	32	23.81	10	INS	0.019:0.124	C
KRTAP3-2	83897	genome.wustl.edu	37	17	39155853	39155853	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:39155853A>T	ENST00000391587.1	-	1	285	c.253T>A	c.(253-255)Ttc>Atc	p.F85I		NM_031959.2	NP_114165.1	Q9BYR7	KRA32_HUMAN	keratin associated protein 3-2	85						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)	3		Breast(137;0.00043)				GGCTGAGTGAAGGTGGTGAGG	0.612																																						dbGAP											0													62.0	75.0	71.0					17																	39155853		2203	4296	6499	-	-	-	SO:0001583	missense	0			AJ406932	CCDS32644.1	17q21.2	2013-06-25			ENSG00000212900	ENSG00000212900		"""Keratin associated proteins"""	16779	protein-coding gene	gene with protein product						11279113	Standard	NM_031959		Approved	KAP3.2	uc002hvs.3	Q9BYR7	OTTHUMG00000133581	ENST00000391587.1:c.253T>A	17.37:g.39155853A>T	ENSP00000375429:p.Phe85Ile			Missense_Mutation	SNP	pfam_Keratin_matx	p.F85I	ENST00000391587.1	37	c.253	CCDS32644.1	17	.	.	.	.	.	.	.	.	.	.	A	15.15	2.749355	0.49257	.	.	ENSG00000212900	ENST00000391587	T	0.25749	1.78	5.76	5.76	0.90799	.	0.981089	0.08335	N	0.961707	T	0.21509	0.0518	.	.	.	0.09310	N	0.999996	B	0.22909	0.077	B	0.25614	0.062	T	0.20240	-1.0281	9	0.28530	T	0.3	.	12.5184	0.56046	1.0:0.0:0.0:0.0	.	85	Q9BYR7	KRA32_HUMAN	I	85	ENSP00000375429:F85I	ENSP00000375429:F85I	F	-	1	0	KRTAP3-2	36409379	0.260000	0.24053	0.374000	0.26016	0.801000	0.45260	1.293000	0.33353	2.206000	0.71126	0.456000	0.33151	TTC	KRTAP3-2	-	pfam_Keratin_matx	ENSG00000212900		0.612	KRTAP3-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP3-2	HGNC	protein_coding	OTTHUMT00000257685.1	68	0.00	0	A			39155853	39155853	-1	no_errors	ENST00000391587	ensembl	human	known	69_37n	missense	58	35.87	33	SNP	0.413	T
KTN1	3895	genome.wustl.edu	37	14	56085923	56085923	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:56085923G>C	ENST00000395314.3	+	5	924	c.856G>C	c.(856-858)Gat>Cat	p.D286H	KTN1_ENST00000395311.1_Missense_Mutation_p.D286H|KTN1_ENST00000413890.2_Missense_Mutation_p.D286H|KTN1_ENST00000395308.1_Missense_Mutation_p.D286H|KTN1_ENST00000438792.2_Missense_Mutation_p.D286H|KTN1_ENST00000416613.1_Missense_Mutation_p.D286H|KTN1_ENST00000395309.3_Missense_Mutation_p.D286H	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	286					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						GAAGTTTAAAGATTTTCTTCT	0.318			T	RET	papillary thryoid																																	dbGAP		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	0													138.0	131.0	134.0					14																	56085923		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.856G>C	14.37:g.56085923G>C	ENSP00000378725:p.Asp286His		B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	NULL	p.D286H	ENST00000395314.3	37	c.856	CCDS41957.1	14	.	.	.	.	.	.	.	.	.	.	G	19.22	3.784767	0.70222	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44	5.28	4.37	0.52481	.	0.111332	0.39274	N	0.001419	T	0.65281	0.2676	L	0.50333	1.59	0.48696	D	0.999698	D;D;D;D	0.89917	0.999;1.0;0.993;0.999	D;D;D;D	0.66716	0.946;0.916;0.916;0.946	T	0.67787	-0.5580	10	0.62326	D	0.03	-7.7885	14.2369	0.65932	0.0733:0.0:0.9267:0.0	.	286;286;286;286	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	H	286	ENSP00000394992:D286H;ENSP00000378720:D286H;ENSP00000391964:D286H;ENSP00000378725:D286H;ENSP00000378719:D286H;ENSP00000378722:D286H;ENSP00000388807:D286H	ENSP00000378719:D286H	D	+	1	0	KTN1	55155676	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.564000	0.67359	1.208000	0.43306	0.573000	0.79308	GAT	KTN1	-	NULL	ENSG00000126777		0.318	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KTN1	HGNC	protein_coding	OTTHUMT00000276912.2	288	0.00	0	G			56085923	56085923	+1	no_errors	ENST00000395309	ensembl	human	known	69_37n	missense	407	36.60	235	SNP	1.000	C
LRP1	4035	genome.wustl.edu	37	12	57573717	57573717	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:57573717C>G	ENST00000243077.3	+	30	5585	c.5119C>G	c.(5119-5121)Ctt>Gtt	p.L1707V		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1707					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GCCCCATGGCCTTGTCGTCCA	0.617																																						dbGAP											0													82.0	86.0	85.0					12																	57573717		2203	4300	6503	-	-	-	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5119C>G	12.37:g.57573717C>G	ENSP00000243077:p.Leu1707Val		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.L1707V	ENST00000243077.3	37	c.5119	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891125	0.52014	.	.	ENSG00000123384	ENST00000243077	D	0.91740	-2.9	5.01	4.12	0.48240	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.56097	D	0.000040	D	0.93416	0.7900	L	0.50333	1.59	0.80722	D	1	D	0.63880	0.993	D	0.70016	0.967	D	0.92787	0.6245	10	0.56958	D	0.05	.	9.2943	0.37806	0.0:0.8278:0.0:0.1722	.	1707	Q07954	LRP1_HUMAN	V	1707	ENSP00000243077:L1707V	ENSP00000243077:L1707V	L	+	1	0	LRP1	55859984	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.186000	0.50942	1.341000	0.45600	0.655000	0.94253	CTT	LRP1	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000123384		0.617	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	162	0.00	0	C	NM_002332		57573717	57573717	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	missense	31	38.00	19	SNP	1.000	G
LRRN1	57633	genome.wustl.edu	37	3	3887067	3887067	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:3887067G>C	ENST00000319331.3	+	2	1503	c.742G>C	c.(742-744)Gat>Cat	p.D248H	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	248						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		GTCTTTTTATGATAACAAACT	0.398																																						dbGAP											0													86.0	93.0	91.0					3																	3887067		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.742G>C	3.37:g.3887067G>C	ENSP00000314901:p.Asp248His		Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D248H	ENST00000319331.3	37	c.742	CCDS33685.1	3	.	.	.	.	.	.	.	.	.	.	G	19.54	3.845976	0.71603	.	.	ENSG00000175928	ENST00000319331	T	0.56444	0.46	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.65302	0.2678	L	0.39898	1.24	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.58645	-0.7600	10	0.25751	T	0.34	.	19.529	0.95219	0.0:0.0:1.0:0.0	.	248	Q6UXK5	LRRN1_HUMAN	H	248	ENSP00000314901:D248H	ENSP00000314901:D248H	D	+	1	0	LRRN1	3862067	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.787000	0.99055	2.604000	0.88044	0.585000	0.79938	GAT	LRRN1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000175928		0.398	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN1	HGNC	protein_coding	OTTHUMT00000337704.2	237	0.00	0	G	NM_020873		3887067	3887067	+1	no_errors	ENST00000319331	ensembl	human	known	69_37n	missense	448	26.07	158	SNP	1.000	C
MEGF8	1954	genome.wustl.edu	37	19	42838297	42838298	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:42838297_42838298insG	ENST00000251268.6	+	3	490_491	c.490_491insG	c.(490-492)tggfs	p.W164fs	MEGF8_ENST00000334370.4_Frame_Shift_Ins_p.W164fs	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	164	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CGAGCCGGGCTGGGGGGGTCCT	0.703																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.497dupG	19.37:g.42838304_42838304dupG	ENSP00000251268:p.Trp164fs		A8KAY0|O75097	Frame_Shift_Ins	INS	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.P167fs	ENST00000251268.6	37	c.490_491		19																																																																																			MEGF8	-	smart_EGF-like	ENSG00000105429		0.703	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	25	0.00	0	-	NM_001410		42838297	42838298	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	1.000:1.000	G
MFN1	55669	genome.wustl.edu	37	3	179066656	179066656	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:179066656C>G	ENST00000471841.1	+	2	143	c.17C>G	c.(16-18)tCt>tGt	p.S6C	MFN1_ENST00000263969.5_Missense_Mutation_p.S6C|MFN1_ENST00000280653.7_Missense_Mutation_p.S6C	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	6					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GAACCTGTTTCTCCACTGAAG	0.413																																						dbGAP											0													210.0	204.0	206.0					3																	179066656		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.17C>G	3.37:g.179066656C>G	ENSP00000420617:p.Ser6Cys		B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase	p.S6C	ENST00000471841.1	37	c.17	CCDS3228.1	3	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442773	0.63067	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000467174;ENST00000263969	D;D;D;D	0.99837	-6.17;-7.06;-5.35;-6.17	3.73	3.73	0.42828	.	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.96513	0.9380	10	0.87932	D	0	-11.8925	16.0729	0.80948	0.0:1.0:0.0:0.0	.	34;6	Q4AEJ4;Q8IWA4	.;MFN1_HUMAN	C	6	ENSP00000420617:S6C;ENSP00000280653:S6C;ENSP00000419134:S6C;ENSP00000263969:S6C	ENSP00000263969:S6C	S	+	2	0	MFN1	180549350	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.215000	0.77966	2.074000	0.62210	0.585000	0.79938	TCT	MFN1	-	NULL	ENSG00000171109		0.413	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN1	HGNC	protein_coding	OTTHUMT00000348654.2	105	0.00	0	C	NM_017927		179066656	179066656	+1	no_errors	ENST00000263969	ensembl	human	known	69_37n	missense	83	32.26	40	SNP	1.000	G
MPP4	58538	genome.wustl.edu	37	2	202557736	202557736	+	Silent	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:202557736C>T	ENST00000409474.3	-	3	303	c.96G>A	c.(94-96)ctG>ctA	p.L32L	MPP4_ENST00000428900.2_Silent_p.L32L|MPP4_ENST00000409143.1_Silent_p.L32L|MPP4_ENST00000359962.5_Silent_p.L32L|MPP4_ENST00000396886.3_Silent_p.L32L|MPP4_ENST00000447335.2_Silent_p.L32L|MPP4_ENST00000315506.7_Silent_p.L32L	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	32	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						GCACAAGCCTCAGGATCTGGG	0.557																																						dbGAP											0													63.0	65.0	65.0					2																	202557736		1986	4176	6162	-	-	-	SO:0001819	synonymous_variant	0			AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.96G>A	2.37:g.202557736C>T			C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Silent	SNP	pfam_Guanylate_kin,pfam_L27_C,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.L32	ENST00000409474.3	37	c.96	CCDS46491.1	2																																																																																			MPP4	-	smart_L27,pfscan_L27	ENSG00000082126		0.557	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPP4	HGNC	protein_coding	OTTHUMT00000335748.2	132	0.00	0	C			202557736	202557736	-1	no_errors	ENST00000359962	ensembl	human	known	69_37n	silent	128	20.99	34	SNP	1.000	T
MUC17	140453	genome.wustl.edu	37	7	100692662	100692662	+	Splice_Site	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:100692662C>T	ENST00000306151.4	+	6	12785	c.12721C>T	c.(12721-12723)Cgt>Tgt	p.R4241C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4241	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACAAAGCTACGGTAAGTGTC	0.527																																						dbGAP											0													198.0	182.0	188.0					7																	100692662		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12722+1C>T	7.37:g.100692662C>T			O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	pfam_SEA,pfscan_EG-like_dom,pfscan_SEA	p.R4241*	ENST00000306151.4	37	c.12721	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	52	19.505351	0.99920	.	.	ENSG00000169876	ENST00000306151	T	0.48836	0.8	4.3	-8.09	0.01090	SEA (3);	.	.	.	.	T	0.43612	0.1255	L	0.50333	1.59	0.09310	N	1	D	0.64830	0.994	P	0.51385	0.668	T	0.52185	-0.8609	9	0.62326	D	0.03	.	7.7238	0.28748	0.1787:0.1234:0.0:0.6979	.	4241	Q685J3	MUC17_HUMAN	C	4241	ENSP00000302716:R4241C	ENSP00000302716:R4241C	R	+	1	0	MUC17	100479382	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.500000	0.06405	-0.972000	0.03559	-0.467000	0.05162	CGT	MUC17	-	pfam_SEA,pfscan_SEA	ENSG00000169876		0.527	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	121	0.00	0	C	NM_001040105	Missense_Mutation	100692662	100692662	+1	no_errors	ENST00000379439	ensembl	human	known	69_37n	nonsense	89	36.43	51	SNP	0.000	T
MYBPHL	343263	genome.wustl.edu	37	1	109839776	109839776	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:109839776C>A	ENST00000357155.1	-	4	515	c.466G>T	c.(466-468)Gac>Tac	p.D156Y	MYBPHL_ENST00000477962.1_Intron	NM_001010985.2|NM_001265613.1	NP_001010985.2|NP_001252542.1	A2RUH7	MBPHL_HUMAN	myosin binding protein H-like	156	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.									central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(2)	14		all_lung(203;0.00519)|all_epithelial(167;0.00575)|Lung NSC(277;0.00822)		Colorectal(144;0.0306)|Lung(183;0.0681)|COAD - Colon adenocarcinoma(174;0.117)|Epithelial(280;0.197)|all cancers(265;0.225)		CCCCAAACGTCCACCAGCTTA	0.547																																						dbGAP											0													134.0	136.0	135.0					1																	109839776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129834	CCDS30793.1	1p13	2013-02-11			ENSG00000221986	ENSG00000221986		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	30434	protein-coding gene	gene with protein product							Standard	NM_001010985		Approved		uc001dxk.1	A2RUH7	OTTHUMG00000012002	ENST00000357155.1:c.466G>T	1.37:g.109839776C>A	ENSP00000349678:p.Asp156Tyr		B7ZME5|Q5T2Z7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D156Y	ENST00000357155.1	37	c.466	CCDS30793.1	1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.814709	0.70912	.	.	ENSG00000221986	ENST00000357155	T	0.58940	0.3	3.79	3.79	0.43588	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76399	0.3982	M	0.91972	3.26	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81709	-0.0809	9	0.87932	D	0	.	13.9631	0.64193	0.0:1.0:0.0:0.0	.	133;156	B7ZME5;A2RUH7	.;MBPHL_HUMAN	Y	156	ENSP00000349678:D156Y	ENSP00000349678:D156Y	D	-	1	0	MYBPHL	109641299	1.000000	0.71417	0.985000	0.45067	0.840000	0.47671	5.490000	0.66881	2.437000	0.82529	0.561000	0.74099	GAC	MYBPHL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000221986		0.547	MYBPHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPHL	HGNC	protein_coding	OTTHUMT00000033197.1	254	0.39	1	C	NM_001010985		109839776	109839776	-1	no_errors	ENST00000357155	ensembl	human	known	69_37n	missense	45	56.31	58	SNP	1.000	A
MYH11	4629	genome.wustl.edu	37	16	15854467	15854467	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:15854467G>T	ENST00000300036.5	-	11	1287	c.1178C>A	c.(1177-1179)aCc>aAc	p.T393N	MYH11_ENST00000396324.3_Missense_Mutation_p.T400N|MYH11_ENST00000576790.2_Missense_Mutation_p.T393N|MYH11_ENST00000452625.2_Missense_Mutation_p.T400N	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	393	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GATGGATCTGGTGAAATCTGT	0.433			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													365.0	292.0	317.0					16																	15854467		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1178C>A	16.37:g.15854467G>T	ENSP00000300036:p.Thr393Asn		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T400N	ENST00000300036.5	37	c.1199	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	G	19.49	3.838081	0.71373	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25	5.0	5.0	0.66597	Myosin head, motor domain (2);	0.000000	0.85682	U	0.000000	D	0.91009	0.7172	L	0.57536	1.79	0.58432	D	0.999999	P;P;P;P;P;B	0.43352	0.557;0.804;0.804;0.804;0.804;0.414	P;P;P;P;P;P	0.55667	0.781;0.781;0.781;0.781;0.781;0.781	D	0.92016	0.5622	10	0.87932	D	0	.	17.3351	0.87278	0.0:0.0:1.0:0.0	.	400;393;393;400;393;400	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	N	393;393;400;400;400	ENSP00000300036:T393N;ENSP00000345136:T393N;ENSP00000379616:T400N;ENSP00000407821:T400N	ENSP00000300036:T393N	T	-	2	0	MYH11	15761968	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	7.919000	0.87513	2.336000	0.79503	0.306000	0.20318	ACC	MYH11	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133392		0.433	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	601	0.00	0	G	NM_001040113		15854467	15854467	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	432	36.12	246	SNP	1.000	T
MYH7	4625	genome.wustl.edu	37	14	23897763	23897763	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:23897763C>A	ENST00000355349.3	-	15	1686	c.1524G>T	c.(1522-1524)tgG>tgT	p.W508C		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	508	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CAATGAATGTCCACTCGATGC	0.522																																						dbGAP											0													272.0	196.0	222.0					14																	23897763		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1524G>T	14.37:g.23897763C>A	ENSP00000347507:p.Trp508Cys		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.W508C	ENST00000355349.3	37	c.1524	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	19.87	3.908108	0.72868	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.89810	-2.57	4.46	4.46	0.54185	Myosin head, motor domain (2);	.	.	.	.	D	0.96873	0.8979	H	0.98754	4.32	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	D	0.98920	1.0783	9	0.87932	D	0	.	17.3	0.87180	0.0:1.0:0.0:0.0	.	508	P12883	MYH7_HUMAN	C	508	ENSP00000347507:W508C	ENSP00000347507:W508C	W	-	3	0	MYH7	22967603	1.000000	0.71417	0.996000	0.52242	0.889000	0.51656	7.419000	0.80179	2.312000	0.78011	0.551000	0.68910	TGG	MYH7	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000092054		0.522	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	199	0.00	0	C	NM_000257		23897763	23897763	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	missense	127	28.65	51	SNP	1.000	A
NAA20	51126	genome.wustl.edu	37	20	20013817	20013817	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr20:20013817G>C	ENST00000334982.4	+	6	804	c.523G>C	c.(523-525)Gaa>Caa	p.E175Q	CRNKL1_ENST00000521379.1_5'Flank|NAA20_ENST00000398602.2_Missense_Mutation_p.E163Q|NAA20_ENST00000484480.1_3'UTR|NAA20_ENST00000310450.4_3'UTR	NM_016100.4	NP_057184.1	P61599	NAA20_HUMAN	N(alpha)-acetyltransferase 20, NatB catalytic subunit	175						cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(3)|lung(2)|prostate(1)	6						TGTGAGGCCTGAAGACATTGA	0.383																																						dbGAP											0													122.0	120.0	121.0					20																	20013817		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF085355	CCDS13141.1, CCDS13142.1, CCDS42854.1	20p11.23	2010-05-07	2010-01-14	2010-01-14	ENSG00000173418	ENSG00000173418	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	15908	protein-coding gene	gene with protein product	"""N-acetyltransferase 3 homolog (S. cerevisiae)"""	610833	"""N-acetyltransferase 5, ARD1 subunit (arrest-defective 1, S. cerevisiae, homolog)"", ""N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae)"", ""N-acetyltransferase 5"", ""N-acetyltransferase 5 (GCN5-related, putative)"""	NAT5		12888564, 19660095	Standard	NM_016100		Approved	dJ1002M8.1, NAT3	uc002wrp.3	P61599	OTTHUMG00000031998	ENST00000334982.4:c.523G>C	20.37:g.20013817G>C	ENSP00000335636:p.Glu175Gln		A6NHA3|B2R4G4|Q5TFT7|Q9D7H8|Q9H0Y4|Q9NQH6|Q9Y6D2	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.E175Q	ENST00000334982.4	37	c.523	CCDS13141.1	20	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492034	0.84962	.	.	ENSG00000173418	ENST00000334982;ENST00000398602	T;T	0.65916	0.4;-0.18	5.72	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.73361	0.3577	M	0.85099	2.735	0.58432	D	0.999991	P;P	0.48640	0.913;0.913	P;P	0.50352	0.638;0.536	T	0.77101	-0.2712	9	.	.	.	-17.9114	13.5302	0.61617	0.0764:0.0:0.9236:0.0	.	163;175	A8MZB2;P61599	.;NAA20_HUMAN	Q	175;163	ENSP00000335636:E175Q;ENSP00000381603:E163Q	.	E	+	1	0	NAA20	19961817	1.000000	0.71417	0.979000	0.43373	0.994000	0.84299	9.396000	0.97270	1.412000	0.46977	0.655000	0.94253	GAA	NAA20	-	NULL	ENSG00000173418		0.383	NAA20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA20	HGNC	protein_coding	OTTHUMT00000078217.2	274	0.00	0	G	NM_016100		20013817	20013817	+1	no_errors	ENST00000334982	ensembl	human	known	69_37n	missense	152	22.34	44	SNP	0.999	C
NEUROD1	4760	genome.wustl.edu	37	2	182543042	182543042	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:182543042G>A	ENST00000295108.3	-	2	1003	c.546C>T	c.(544-546)aaC>aaT	p.N182N	CERKL_ENST00000479558.1_Intron|NEUROD1_ENST00000496876.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	182					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CCGCAACCAGGTTGGTGGTGG	0.607																																						dbGAP											0													60.0	60.0	60.0					2																	182543042		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.546C>T	2.37:g.182543042G>A			B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	pfam_Neurogenic_DUF,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pirsf_TF_bHLH_NeuroD,pfscan_HLH_DNA-bd	p.N182	ENST00000295108.3	37	c.546	CCDS2283.1	2																																																																																			NEUROD1	-	pfam_Neurogenic_DUF,pirsf_TF_bHLH_NeuroD	ENSG00000162992		0.607	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD1	HGNC	protein_coding	OTTHUMT00000255792.2	140	0.00	0	G	NM_002500		182543042	182543042	-1	no_errors	ENST00000295108	ensembl	human	known	69_37n	silent	52	55.56	65	SNP	1.000	A
NBEAL1	65065	genome.wustl.edu	37	2	204009564	204009564	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:204009564C>T	ENST00000449802.1	+	31	5336	c.5003C>T	c.(5002-5004)tCa>tTa	p.S1668L		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1668										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GGTAGCTCCTCATTTTTTGAA	0.318																																						dbGAP											0													88.0	76.0	80.0					2																	204009564		1813	4076	5889	-	-	-	SO:0001583	missense	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.5003C>T	2.37:g.204009564C>T	ENSP00000399903:p.Ser1668Leu		A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1668L	ENST00000449802.1	37	c.5003	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	C	28.0	4.880277	0.91740	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.56103	0.48	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.73481	0.3592	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.74306	-0.3708	10	0.66056	D	0.02	.	19.6495	0.95795	0.0:1.0:0.0:0.0	.	1668;1657	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	L	1668	ENSP00000399903:S1668L	ENSP00000344985:S1668L	S	+	2	0	NBEAL1	203717809	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.487000	0.81328	2.748000	0.94277	0.655000	0.94253	TCA	NBEAL1	-	NULL	ENSG00000144426		0.318	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	143	0.00	0	C			204009564	204009564	+1	no_errors	ENST00000449802	ensembl	human	known	69_37n	missense	270	26.03	95	SNP	1.000	T
NEUROD6	63974	genome.wustl.edu	37	7	31378755	31378755	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:31378755A>G	ENST00000297142.3	-	2	450	c.128T>C	c.(127-129)cTt>cCt	p.L43P		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	43					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						CTTTCCTCGAAGGACAATCTG	0.453																																						dbGAP											0													135.0	142.0	139.0					7																	31378755		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.128T>C	7.37:g.31378755A>G	ENSP00000297142:p.Leu43Pro		Q548T9|Q9H3H6	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pirsf_TF_bHLH_NeuroD,pfscan_HLH_DNA-bd	p.L43P	ENST00000297142.3	37	c.128	CCDS5434.1	7	.	.	.	.	.	.	.	.	.	.	A	6.906	0.536812	0.13188	.	.	ENSG00000164600	ENST00000297142	D	0.95554	-3.74	5.56	5.56	0.83823	.	0.453943	0.23577	N	0.046692	D	0.90232	0.6946	L	0.38175	1.15	0.80722	D	1	P	0.36733	0.567	B	0.34991	0.193	D	0.86965	0.2094	10	0.28530	T	0.3	-29.6701	6.108	0.20084	0.781:0.0:0.0747:0.1442	.	43	Q96NK8	NDF6_HUMAN	P	43	ENSP00000297142:L43P	ENSP00000297142:L43P	L	-	2	0	NEUROD6	31345280	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.298000	0.43602	2.123000	0.65237	0.528000	0.53228	CTT	NEUROD6	-	pirsf_TF_bHLH_NeuroD	ENSG00000164600		0.453	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD6	HGNC	protein_coding	OTTHUMT00000215050.1	294	0.00	0	A	NM_022728		31378755	31378755	-1	no_errors	ENST00000297142	ensembl	human	known	69_37n	missense	149	14.29	25	SNP	1.000	G
NFAT5	10725	genome.wustl.edu	37	16	69725789	69725789	+	Silent	SNP	A	A	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:69725789A>T	ENST00000354436.2	+	12	2325	c.2007A>T	c.(2005-2007)gcA>gcT	p.A669A	NFAT5_ENST00000566899.1_Silent_p.A593A|NFAT5_ENST00000567239.1_Silent_p.A686A|NFAT5_ENST00000393742.2_Silent_p.A593A|NFAT5_ENST00000432919.1_Silent_p.A687A|NFAT5_ENST00000349945.1_Silent_p.A593A	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	669					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AGCCCAAGGCATACAACCCAG	0.458																																						dbGAP											0													100.0	96.0	97.0					16																	69725789		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2007A>T	16.37:g.69725789A>T			A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Silent	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.A687	ENST00000354436.2	37	c.2061	CCDS10881.1	16																																																																																			NFAT5	-	NULL	ENSG00000102908		0.458	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2	485	0.00	0	A	NM_138714		69725789	69725789	+1	no_errors	ENST00000432919	ensembl	human	known	69_37n	silent	521	32.82	255	SNP	0.783	T
NLE1	54475	genome.wustl.edu	37	17	33463426	33463426	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr17:33463426C>G	ENST00000442241.4	-	8	958	c.919G>C	c.(919-921)Gaa>Caa	p.E307Q	NLE1_ENST00000593176.1_5'Flank|NLE1_ENST00000360831.5_Missense_Mutation_p.E265Q|NLE1_ENST00000586869.1_Missense_Mutation_p.E15Q	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	307					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				TCAGCAGGTTCAAAGGCCCCA	0.597																																						dbGAP											0													135.0	147.0	143.0					17																	33463426		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.919G>C	17.37:g.33463426C>G	ENSP00000413572:p.Glu307Gln		O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NLE,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep,prints_Gprotein_B	p.E307Q	ENST00000442241.4	37	c.919	CCDS11291.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.04|18.04	3.535007|3.535007	0.64972|0.64972	.|.	.|.	ENSG00000073536|ENSG00000073536	ENST00000442241;ENST00000360831;ENST00000537697|ENST00000436188	T|.	0.58060|.	0.36|.	5.44|5.44	5.44|5.44	0.79542|0.79542	WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.092960|.	0.64402|.	D|.	0.000001|.	T|T	0.46908|0.46908	0.1417|0.1417	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999999|0.999999	B;P|.	0.43938|.	0.044;0.822|.	B;P|.	0.48598|.	0.077;0.583|.	T|T	0.29458|0.29458	-1.0011|-1.0011	10|5	0.59425|.	D|.	0.04|.	-33.9305|-33.9305	10.0637|10.0637	0.42290|0.42290	0.0:0.9115:0.0:0.0885|0.0:0.9115:0.0:0.0885	.|.	283;307|.	B4E074;Q9NVX2|.	.;NLE1_HUMAN|.	Q|F	307;15;283|86	ENSP00000413572:E307Q|.	ENSP00000354075:E15Q|.	E|L	-|-	1|3	0|2	NLE1|NLE1	30487539|30487539	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.984000|0.984000	0.73092|0.73092	5.355000|5.355000	0.66046|0.66046	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	GAA|TTG	NLE1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000073536		0.597	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLE1	HGNC	protein_coding	OTTHUMT00000256441.2	187	0.00	0	C	NM_018096		33463426	33463426	-1	no_errors	ENST00000442241	ensembl	human	known	69_37n	missense	67	34.31	35	SNP	1.000	G
NME6	10201	genome.wustl.edu	37	3	48336135	48336135	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:48336135G>C	ENST00000452211.1	-	7	790	c.553C>G	c.(553-555)Cca>Gca	p.P185A	NME6_ENST00000426689.2_Missense_Mutation_p.P185A|NME6_ENST00000442597.1_Missense_Mutation_p.P185A|NME6_ENST00000451657.1_3'UTR|ZNF589_ENST00000412564.1_Intron|NME6_ENST00000421967.1_Missense_Mutation_p.P193A|NME6_ENST00000447314.1_Missense_Mutation_p.P140A|NME6_ENST00000444069.1_5'UTR|NME6_ENST00000450160.1_3'UTR|NME6_ENST00000415644.1_Missense_Mutation_p.P118A|NME6_ENST00000415053.1_Missense_Mutation_p.P185A|NME6_ENST00000426723.1_Missense_Mutation_p.P118A			O75414	NDK6_HUMAN	NME/NM23 nucleoside diphosphate kinase 6	185					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|negative regulation of cell growth (GO:0030308)|negative regulation of mitosis (GO:0045839)|UTP biosynthetic process (GO:0006228)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			breast(1)|large_intestine(5)	6				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		CATCAGGCTGGTCCTAGGCCT	0.552																																						dbGAP											0													103.0	91.0	95.0					3																	48336135		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF051941	CCDS2763.1	3p21.31	2012-05-18	2012-05-18		ENSG00000172113	ENSG00000172113			20567	protein-coding gene	gene with protein product		608294	"""non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)"""			10453732, 19852809	Standard	NM_005793		Approved	NM23-H6, IPIA-ALPHA	uc003cso.3	O75414	OTTHUMG00000133531	ENST00000452211.1:c.553C>G	3.37:g.48336135G>C	ENSP00000392352:p.Pro185Ala		B4DGW7|B4DM99|Q53HM5|Q96E73|Q9BQ63	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	p.P193A	ENST00000452211.1	37	c.577		3	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602697	0.46423	.	.	ENSG00000172113	ENST00000421967;ENST00000426689;ENST00000452211;ENST00000426723;ENST00000415644;ENST00000415053;ENST00000442597;ENST00000447314	T;T;T;T;T;T	0.63580	0.47;0.53;0.53;0.53;0.53;-0.05	3.95	3.08	0.35506	.	0.846866	0.10245	N	0.697954	T	0.63885	0.2549	N	0.14661	0.345	0.80722	D	1	B;D	0.76494	0.105;0.999	B;D	0.75484	0.034;0.986	T	0.62656	-0.6808	10	0.87932	D	0	0.0871	10.1019	0.42511	0.1008:0.0:0.8992:0.0	.	118;185	O75414-2;O75414	.;NDK6_HUMAN	A	193;185;185;118;118;185;185;140	ENSP00000416658:P193A;ENSP00000440286:P185A;ENSP00000392352:P185A;ENSP00000399582:P185A;ENSP00000406642:P185A;ENSP00000414842:P140A	ENSP00000399582:P185A	P	-	1	0	NME6	48311139	0.197000	0.23362	0.529000	0.27951	0.335000	0.28730	0.721000	0.25911	1.248000	0.43934	-0.291000	0.09656	CCA	NME6	-	NULL	ENSG00000172113		0.552	NME6-005	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_candidate	protein_coding	NME6	HGNC	protein_coding	OTTHUMT00000346107.1	220	0.00	0	G	NM_005793		48336135	48336135	-1	no_errors	ENST00000421967	ensembl	human	known	69_37n	missense	34	52.78	38	SNP	0.997	C
NOMO2	283820	genome.wustl.edu	37	16	18549937	18549937	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:18549937G>C	ENST00000381474.3	-	11	1196	c.1131C>G	c.(1129-1131)atC>atG	p.I377M	NOMO2_ENST00000330537.6_Missense_Mutation_p.I377M|NOMO2_ENST00000543392.1_Missense_Mutation_p.I210M	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	377						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						TCTGAGCATGGATGGTGTATG	0.428																																						dbGAP											0													13.0	9.0	10.0					16																	18549937		1551	3202	4753	-	-	-	SO:0001583	missense	0			AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.1131C>G	16.37:g.18549937G>C	ENSP00000370883:p.Ile377Met		Q4G177	Missense_Mutation	SNP	pfam_DUF2012,superfamily_Carb-bd-like_fold,superfamily_CarboxyPept-like_regulatory,superfamily_Collagen-bd_Cna_B-typ_dom	p.I377M	ENST00000381474.3	37	c.1131	CCDS32394.1	16	.	.	.	.	.	.	.	.	.	.	.	13.69	2.311969	0.40895	.	.	ENSG00000185164	ENST00000330537;ENST00000381474;ENST00000543392	T;T;T	0.48201	0.82;0.82;0.82	2.57	1.59	0.23543	Carbohydrate-binding-like fold (1);Domain of unknown function DUF2012 (1);Carboxypeptidase, regulatory domain (1);	0.065274	0.64402	D	0.000014	T	0.56262	0.1973	M	0.85462	2.755	0.58432	D	0.999997	P;P	0.43542	0.81;0.81	P;P	0.53006	0.715;0.622	T	0.59679	-0.7409	10	0.72032	D	0.01	-17.3845	1.8183	0.03105	0.2596:0.0:0.4269:0.3134	.	210;377	Q4G177;Q5JPE7	.;NOMO2_HUMAN	M	377;377;210	ENSP00000331851:I377M;ENSP00000370883:I377M;ENSP00000439970:I210M	ENSP00000331851:I377M	I	-	3	3	NOMO2	18457438	1.000000	0.71417	0.984000	0.44739	0.874000	0.50279	3.178000	0.50879	1.416000	0.47057	0.400000	0.26472	ATC	NOMO2	-	pfam_DUF2012,superfamily_Carb-bd-like_fold	ENSG00000185164		0.428	NOMO2-002	KNOWN	basic|CCDS	protein_coding	NOMO2	HGNC	protein_coding	OTTHUMT00000435858.1	272	0.00	0	G	NM_001004060		18549937	18549937	-1	no_errors	ENST00000381474	ensembl	human	known	69_37n	missense	190	37.38	114	SNP	0.995	C
NPR1	4881	genome.wustl.edu	37	1	153659779	153659779	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:153659779G>T	ENST00000368680.3	+	13	2511	c.2039G>T	c.(2038-2040)gGg>gTg	p.G680V		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	680	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	ACCGACTATGGGCTGGAGAGC	0.547																																					Pancreas(141;1349 1870 15144 15830 40702)	dbGAP											0													124.0	100.0	108.0					1																	153659779		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2039G>T	1.37:g.153659779G>T	ENSP00000357669:p.Gly680Val		B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.G680V	ENST00000368680.3	37	c.2039	CCDS1051.1	1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893407	0.72524	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	D	0.92858	-3.12	4.09	4.09	0.47781	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.97993	0.9339	H	0.99794	4.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.98607	1.0661	10	0.87932	D	0	.	14.1901	0.65633	0.0:0.0:1.0:0.0	.	159;680	B7Z4Y7;P16066	.;ANPRA_HUMAN	V	680;159	ENSP00000357669:G680V	ENSP00000357669:G680V	G	+	2	0	NPR1	151926403	1.000000	0.71417	0.961000	0.40146	0.981000	0.71138	7.721000	0.84768	2.287000	0.76781	0.455000	0.32223	GGG	NPR1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169418		0.547	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	HGNC	protein_coding	OTTHUMT00000090034.1	203	0.00	0	G	NM_000906		153659779	153659779	+1	no_errors	ENST00000368680	ensembl	human	known	69_37n	missense	131	25.57	45	SNP	1.000	T
NSG1	27065	genome.wustl.edu	37	4	4411347	4411347	+	Silent	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr4:4411347C>A	ENST00000421177.2	+	8	2285	c.294C>A	c.(292-294)gtC>gtA	p.V98V	NSG1_ENST00000513555.1_Silent_p.V98V|NSG1_ENST00000505246.1_Silent_p.V98V|NSG1_ENST00000506380.1_Silent_p.V98V|NSG1_ENST00000504171.1_Silent_p.V59V|NSG1_ENST00000433139.2_Silent_p.V98V|NSG1_ENST00000397958.1_Silent_p.V98V			P42857	NSG1_HUMAN		98					clathrin coat assembly (GO:0048268)|dopamine receptor signaling pathway (GO:0007212)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											CCTGCGTCGTCTTCCTGGTTG	0.617																																						dbGAP											0													197.0	152.0	167.0					4																	4411347		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000421177.2:c.294C>A	4.37:g.4411347C>A			B4DXC5|Q49AQ1	Silent	SNP	pfam_D1-dopamine_rcpt_interact,pirsf_D1-dopamine_rcpt_interact	p.V98	ENST00000421177.2	37	c.294	CCDS3376.1	4																																																																																			NSG1	-	pfam_D1-dopamine_rcpt_interact,pirsf_D1-dopamine_rcpt_interact	ENSG00000168824		0.617	NSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSG1	Clone_based_vega_gene	protein_coding	OTTHUMT00000246799.1	43	0.00	0	C			4411347	4411347	+1	no_errors	ENST00000397958	ensembl	human	known	69_37n	silent	7	56.25	9	SNP	1.000	A
NUP214	8021	genome.wustl.edu	37	9	134108840	134108840	+	Splice_Site	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:134108840G>A	ENST00000359428.5	+	36	6383		c.e36-1		NUP214_ENST00000483497.2_Splice_Site|NUP214_ENST00000411637.2_Splice_Site|NUP214_ENST00000451030.1_Splice_Site			P35658	NU214_HUMAN	nucleoporin 214kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CTTCCTTGCAGGTCTGTCCAG	0.577			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	dbGAP		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0													88.0	69.0	75.0					9																	134108840		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.6240-1G>A	9.37:g.134108840G>A			A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Splice_Site	SNP	-	e36-1	ENST00000359428.5	37	c.6243-1	CCDS6940.1	9	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968257	0.34754	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000540899;ENST00000438605;ENST00000483497;ENST00000476004;ENST00000528406	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1549	0.81657	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NUP214	133098661	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	5.148000	0.64857	2.660000	0.90430	0.467000	0.42956	.	NUP214	-	-	ENSG00000126883		0.577	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUP214	HGNC	protein_coding	OTTHUMT00000054694.2	33	0.00	0	G	NM_005085	Intron	134108840	134108840	+1	no_errors	ENST00000451030	ensembl	human	known	69_37n	splice_site	22	46.34	19	SNP	1.000	A
TENM1	10178	genome.wustl.edu	37	X	123785795	123785795	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chrX:123785795C>G	ENST00000371130.3	-	8	1611	c.1548G>C	c.(1546-1548)atG>atC	p.M516I	TENM1_ENST00000422452.2_Missense_Mutation_p.M516I	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	516					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATACTTGCTCCATCTTTTTTC	0.403																																						dbGAP											0													194.0	165.0	175.0					X																	123785795		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1548G>C	X.37:g.123785795C>G	ENSP00000360171:p.Met516Ile		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.M516I	ENST00000371130.3	37	c.1548	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811392	0.32053	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.21361	2.01;2.01	5.3	5.3	0.74995	.	0.153499	0.56097	D	0.000030	T	0.19287	0.0463	L	0.40543	1.245	0.45554	D	0.998504	B;B;B	0.09022	0.001;0.002;0.0	B;B;B	0.12156	0.004;0.002;0.007	T	0.02553	-1.1142	10	0.36615	T	0.2	.	13.5406	0.61672	0.0:0.92:0.0:0.08	.	515;516;516	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	I	516	ENSP00000360171:M516I;ENSP00000403954:M516I	ENSP00000360171:M516I	M	-	3	0	ODZ1	123613476	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.249000	0.32839	2.197000	0.70478	0.600000	0.82982	ATG	ODZ1	-	NULL	ENSG00000009694		0.403	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	240	0.00	0	C	NM_014253		123785795	123785795	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	200	34.10	104	SNP	1.000	G
OR10H1	26539	genome.wustl.edu	37	19	15918164	15918164	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:15918164C>G	ENST00000334920.2	-	1	772	c.684G>C	c.(682-684)aaG>aaC	p.K228N		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						CAGAAGGGATCTTCAAGATGG	0.567																																						dbGAP											0													74.0	62.0	66.0					19																	15918164		2202	4279	6481	-	-	-	SO:0001583	missense	0			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.684G>C	19.37:g.15918164C>G	ENSP00000335596:p.Lys228Asn		Q6IFQ2|Q96R59	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K228N	ENST00000334920.2	37	c.684	CCDS12335.1	19	.	.	.	.	.	.	.	.	.	.	.	8.105	0.777548	0.16120	.	.	ENSG00000186723	ENST00000334920	T	0.00183	8.6	4.96	3.9	0.45041	GPCR, rhodopsin-like superfamily (1);	0.398067	0.21502	N	0.073504	T	0.00241	0.0007	M	0.77712	2.385	0.28411	N	0.918181	B	0.12630	0.006	B	0.22880	0.042	T	0.26744	-1.0094	10	0.66056	D	0.02	.	6.4176	0.21725	0.0:0.7566:0.0:0.2434	.	228	Q9Y4A9	O10H1_HUMAN	N	228	ENSP00000335596:K228N	ENSP00000335596:K228N	K	-	3	2	OR10H1	15779164	0.124000	0.22315	0.990000	0.47175	0.201000	0.24016	0.236000	0.17967	0.974000	0.38366	0.643000	0.83706	AAG	OR10H1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186723		0.567	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H1	HGNC	protein_coding	OTTHUMT00000460364.1	151	0.00	0	C			15918164	15918164	-1	no_errors	ENST00000334920	ensembl	human	known	69_37n	missense	102	31.08	46	SNP	0.858	G
OR10X1	128367	genome.wustl.edu	37	1	158548883	158548883	+	Silent	SNP	A	A	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:158548883A>C	ENST00000368150.1	-	1	806	c.807T>G	c.(805-807)ggT>ggG	p.G269G		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					TAGATGCAAAACCAAAGTGGA	0.478																																						dbGAP											0													124.0	127.0	126.0					1																	158548883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.807T>G	1.37:g.158548883A>C			Q6IFR8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G269	ENST00000368150.1	37	c.807	CCDS30900.1	1																																																																																			OR10X1	-	pfam_7TM_GPCR_Rhodpsn	ENSG00000186400		0.478	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10X1	HGNC	protein_coding	OTTHUMT00000051850.2	220	0.00	0	A	NM_001004477		158548883	158548883	-1	no_errors	ENST00000368150	ensembl	human	known	69_37n	silent	226	28.93	92	SNP	0.023	C
OR12D3	81797	genome.wustl.edu	37	6	29342374	29342374	+	Silent	SNP	T	T	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:29342374T>G	ENST00000396806.3	-	1	694	c.691A>C	c.(691-693)Aga>Cga	p.R231R	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						TGGAGTATTCTGCAGGACCTG	0.458																																						dbGAP											0													72.0	74.0	73.0					6																	29342374		1510	2709	4219	-	-	-	SO:0001819	synonymous_variant	0				CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.691A>C	6.37:g.29342374T>G			A2BDZ1|Q5SQI8|Q6IF23	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R231	ENST00000396806.3	37	c.691	CCDS4658.1	6																																																																																			OR12D3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000112462		0.458	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR12D3	HGNC	protein_coding	OTTHUMT00000076056.3	304	0.00	0	T			29342374	29342374	-1	no_errors	ENST00000377143	ensembl	human	known	69_37n	silent	134	67.47	280	SNP	0.000	G
OR2A12	346525	genome.wustl.edu	37	7	143793109	143793109	+	Silent	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:143793109C>T	ENST00000408949.2	+	1	969	c.909C>T	c.(907-909)gtC>gtT	p.V303V		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					TAAAGAGAGTCCTTTGGAAAC	0.438																																						dbGAP											0													144.0	139.0	141.0					7																	143793109		1867	4105	5972	-	-	-	SO:0001819	synonymous_variant	0				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.909C>T	7.37:g.143793109C>T			Q6IF43	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V303	ENST00000408949.2	37	c.909	CCDS43670.1	7																																																																																			OR2A12	-	NULL	ENSG00000221858		0.438	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A12	HGNC	protein_coding	OTTHUMT00000349969.1	426	0.00	0	C			143793109	143793109	+1	no_errors	ENST00000408949	ensembl	human	known	69_37n	silent	324	37.81	197	SNP	0.000	T
OR2G3	81469	genome.wustl.edu	37	1	247769389	247769389	+	Missense_Mutation	SNP	C	C	A	rs546158623	byFrequency	TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:247769389C>A	ENST00000320002.2	+	1	534	c.502C>A	c.(502-504)Ctc>Atc	p.L168I	RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GCAATTGCCTCTCTGTGGCAA	0.473																																						dbGAP											0													158.0	146.0	150.0					1																	247769389		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.502C>A	1.37:g.247769389C>A	ENSP00000326301:p.Leu168Ile		B2RN64|Q5JQT1|Q6IF45	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L168I	ENST00000320002.2	37	c.502	CCDS31093.1	1	.	.	.	.	.	.	.	.	.	.	C	0.119	-1.127819	0.01770	.	.	ENSG00000177476	ENST00000320002	T	0.00224	8.51	3.65	-3.33	0.04958	GPCR, rhodopsin-like superfamily (1);	1.134970	0.07113	U	0.842535	T	0.00178	0.0005	L	0.47716	1.5	0.09310	N	1	B	0.25667	0.131	B	0.38921	0.285	T	0.23904	-1.0175	10	0.45353	T	0.12	.	0.1495	0.00091	0.3167:0.1835:0.1581:0.3416	.	168	Q8NGZ4	OR2G3_HUMAN	I	168	ENSP00000326301:L168I	ENSP00000326301:L168I	L	+	1	0	OR2G3	245836012	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-0.070000	0.11523	-0.443000	0.07180	-0.478000	0.04885	CTC	OR2G3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000177476		0.473	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G3	HGNC	protein_coding	OTTHUMT00000097624.1	350	0.00	0	C			247769389	247769389	+1	no_errors	ENST00000320002	ensembl	human	known	69_37n	missense	482	28.17	189	SNP	0.000	A
OR4X2	119764	genome.wustl.edu	37	11	48267160	48267160	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr11:48267160T>A	ENST00000302329.3	+	1	553	c.505T>A	c.(505-507)Tat>Aat	p.Y169N		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						GATCAATCACTATTTCTGTGA	0.493																																						dbGAP											0													290.0	262.0	272.0					11																	48267160		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.505T>A	11.37:g.48267160T>A	ENSP00000307751:p.Tyr169Asn		B2RNK3|Q6IF73|Q96R63	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y169N	ENST00000302329.3	37	c.505	CCDS31486.1	11	.	.	.	.	.	.	.	.	.	.	T	17.12	3.308136	0.60305	.	.	ENSG00000172208	ENST00000302329	T	0.00198	8.57	5.37	5.37	0.77165	GPCR, rhodopsin-like superfamily (1);	0.135993	0.33834	N	0.004507	T	0.00695	0.0023	M	0.89601	3.045	0.30757	N	0.744506	D	0.67145	0.996	D	0.74674	0.984	T	0.09729	-1.0661	10	0.87932	D	0	.	13.3324	0.60495	0.0:0.0:0.0:1.0	.	169	Q8NGF9	OR4X2_HUMAN	N	169	ENSP00000307751:Y169N	ENSP00000307751:Y169N	Y	+	1	0	OR4X2	48223736	0.006000	0.16342	0.993000	0.49108	0.755000	0.42902	1.799000	0.38824	2.020000	0.59435	0.528000	0.53228	TAT	OR4X2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000172208		0.493	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X2	HGNC	protein_coding	OTTHUMT00000383376.2	610	0.00	0	T	NM_001004727		48267160	48267160	+1	no_errors	ENST00000302329	ensembl	human	known	69_37n	missense	459	35.30	251	SNP	0.964	A
OR5H1	26341	genome.wustl.edu	37	3	97851818	97851818	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:97851818T>C	ENST00000354565.2	+	1	277	c.277T>C	c.(277-279)Tct>Cct	p.S93P	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TAAGATGATATCTCTCTCTGA	0.398																																						dbGAP											0													151.0	150.0	150.0					3																	97851818		2203	4299	6502	-	-	-	SO:0001583	missense	0			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.277T>C	3.37:g.97851818T>C	ENSP00000346575:p.Ser93Pro			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S93P	ENST00000354565.2	37	c.277	CCDS33797.1	3	.	.	.	.	.	.	.	.	.	.	t	8.221	0.802396	0.16397	.	.	ENSG00000231192	ENST00000354565	T	0.00737	5.76	3.48	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	0.152578	0.31031	N	0.008386	T	0.02767	0.0083	M	0.75150	2.29	0.18873	N	0.999981	D	0.67145	0.996	D	0.65874	0.939	T	0.30794	-0.9966	10	0.49607	T	0.09	.	7.2433	0.26107	0.1985:0.0:0.0:0.8015	.	93	A6NKK0	OR5H1_HUMAN	P	93	ENSP00000346575:S93P	ENSP00000346575:S93P	S	+	1	0	OR5H1	99334508	0.127000	0.22367	0.014000	0.15608	0.016000	0.09150	0.812000	0.27211	0.412000	0.25729	-1.240000	0.01540	TCT	OR5H1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000231192		0.398	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H1	HGNC	protein_coding	OTTHUMT00000359100.2	598	0.00	0	T	NM_001005338		97851818	97851818	+1	no_errors	ENST00000354565	ensembl	human	known	69_37n	missense	465	34.64	248	SNP	0.445	C
OR5W2	390148	genome.wustl.edu	37	11	55681165	55681165	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr11:55681165T>A	ENST00000344514.1	-	1	893	c.894A>T	c.(892-894)aaA>aaT	p.K298N		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K298N(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TCAGGGCCTCTTTCACATCCT	0.328																																					Melanoma(48;171 1190 15239 43886 49348)	dbGAP											1	Substitution - Missense(1)	endometrium(1)											27.0	30.0	29.0					11																	55681165		2197	4294	6491	-	-	-	SO:0001583	missense	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.894A>T	11.37:g.55681165T>A	ENSP00000342448:p.Lys298Asn			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K298N	ENST00000344514.1	37	c.894	CCDS31513.1	11	.	.	.	.	.	.	.	.	.	.	t	16.73	3.205008	0.58234	.	.	ENSG00000187612	ENST00000344514	T	0.40756	1.02	5.01	3.87	0.44632	.	0.000000	0.40728	N	0.001028	T	0.67126	0.2860	M	0.92219	3.285	0.30214	N	0.797433	D	0.63880	0.993	D	0.64687	0.928	T	0.70163	-0.4947	10	0.72032	D	0.01	.	9.0391	0.36307	0.0:0.0886:0.0:0.9114	.	298	Q8NH69	OR5W2_HUMAN	N	298	ENSP00000342448:K298N	ENSP00000342448:K298N	K	-	3	2	OR5W2	55437741	0.366000	0.25014	0.740000	0.30986	0.836000	0.47400	0.391000	0.20784	0.754000	0.32968	-0.379000	0.06801	AAA	OR5W2	-	prints_7TM_GPCR_Rhodpsn	ENSG00000187612		0.328	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	HGNC	protein_coding	OTTHUMT00000391523.1	91	0.00	0	T	NM_001001960		55681165	55681165	-1	no_errors	ENST00000344514	ensembl	human	known	69_37n	missense	126	37.93	77	SNP	0.922	A
AKAP2	11217	genome.wustl.edu	37	9	112899779	112899779	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:112899779C>T	ENST00000259318.7	+	2	1469	c.1262C>T	c.(1261-1263)cCt>cTt	p.P421L	AKAP2_ENST00000510514.5_Missense_Mutation_p.P652L|AKAP2_ENST00000374525.1_Missense_Mutation_p.P510L|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.P652L|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.P652L|AKAP2_ENST00000555236.1_Missense_Mutation_p.P652L|AKAP2_ENST00000434623.2_Missense_Mutation_p.P510L	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	421										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TACAGCGAGCCTTCTAAACGT	0.592																																						dbGAP											0													75.0	79.0	78.0					9																	112899779		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1262C>T	9.37:g.112899779C>T	ENSP00000259318:p.Pro421Leu		B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.P652L	ENST00000259318.7	37	c.1955	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089726	0.36855	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.47528	2.17;2.17;2.17;2.17;1.42;0.84;0.84;1.44	5.86	5.86	0.93980	.	0.507655	0.20467	N	0.091779	T	0.32133	0.0819	N	0.08118	0	0.43238	D	0.995142	B;P;B;P;P;P;P;P	0.42785	0.124;0.57;0.376;0.649;0.518;0.763;0.763;0.79	B;B;B;B;B;B;B;B	0.41571	0.033;0.294;0.154;0.23;0.115;0.173;0.173;0.36	T	0.15009	-1.0452	10	0.33940	T	0.23	-19.2353	15.4269	0.75059	0.0:0.8513:0.1487:0.0	.	421;510;504;510;511;652;652;470	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	L	652;652;652;652;510;510;470;421	ENSP00000363654:P652L;ENSP00000305861:P652L;ENSP00000451476:P652L;ENSP00000421522:P652L;ENSP00000404782:P510L;ENSP00000363649:P510L;ENSP00000419268:P470L;ENSP00000259318:P421L	ENSP00000259318:P421L	P	+	2	0	PALM2-AKAP2;AKAP2	111939600	0.465000	0.25815	0.998000	0.56505	0.873000	0.50193	1.548000	0.36201	2.757000	0.94681	0.655000	0.94253	CCT	PALM2-AKAP2	-	NULL	ENSG00000157654		0.592	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	158	0.00	0	C	NM_001004065		112899779	112899779	+1	no_errors	ENST00000374530	ensembl	human	known	69_37n	missense	96	34.90	52	SNP	0.921	T
PARP14	54625	genome.wustl.edu	37	3	122418982	122418982	+	Silent	SNP	G	G	A	rs527995936		TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:122418982G>A	ENST00000474629.2	+	6	1847	c.1581G>A	c.(1579-1581)aaG>aaA	p.K527K		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		TCCAGGAAAAGGTGTACACCA	0.393																																						dbGAP											0													58.0	54.0	55.0					3																	122418982		1861	4104	5965	-	-	-	SO:0001819	synonymous_variant	0			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1581G>A	3.37:g.122418982G>A			B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	pfam_A1pp,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_A1pp,pfscan_A1pp,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.K527	ENST00000474629.2	37	c.1581	CCDS46894.1	3																																																																																			PARP14	-	NULL	ENSG00000173193		0.393	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	HGNC	protein_coding	OTTHUMT00000356173.2	86	0.00	0	G	NM_017554		122418982	122418982	+1	no_errors	ENST00000474629	ensembl	human	known	69_37n	silent	155	26.42	56	SNP	0.141	A
PCDHA4	56144	genome.wustl.edu	37	5	140187617	140187617	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr5:140187617C>T	ENST00000530339.1	+	1	845	c.845C>T	c.(844-846)tCa>tTa	p.S282L	PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.S282L|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.S282L|PCDHA1_ENST00000504120.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	282	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATTCATTCTCAAATGATATT	0.328																																						dbGAP											0													63.0	67.0	66.0					5																	140187617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.845C>T	5.37:g.140187617C>T	ENSP00000435300:p.Ser282Leu		O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S282L	ENST00000530339.1	37	c.845	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	c	5.726	0.318397	0.10845	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.43688	0.94;0.94;0.94	4.34	1.26	0.21427	Cadherin (4);Cadherin-like (1);	0.838313	0.09715	U	0.765240	T	0.33030	0.0849	L	0.35723	1.085	0.09310	N	1	B;B;B	0.22146	0.009;0.038;0.065	B;B;B	0.32342	0.019;0.144;0.144	T	0.36383	-0.9750	10	0.19590	T	0.45	.	8.2036	0.31438	0.3298:0.451:0.2192:0.0	.	282;282;282	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	L	282	ENSP00000423470:S282L;ENSP00000349344:S282L;ENSP00000435300:S282L	ENSP00000349344:S282L	S	+	2	0	PCDHA4	140167801	0.000000	0.05858	0.093000	0.20910	0.421000	0.31385	-1.796000	0.01750	0.934000	0.37316	0.467000	0.42956	TCA	PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204967		0.328	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	164	0.00	0	C	NM_018907		140187617	140187617	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	missense	64	32.63	31	SNP	0.026	T
PCID2	55795	genome.wustl.edu	37	13	113849401	113849401	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr13:113849401C>G	ENST00000337344.4	-	6	423	c.347G>C	c.(346-348)cGa>cCa	p.R116P	PCID2_ENST00000246505.5_Missense_Mutation_p.R170P|PCID2_ENST00000375459.1_Missense_Mutation_p.R114P|PCID2_ENST00000375479.2_Missense_Mutation_p.R116P|PCID2_ENST00000375477.1_Missense_Mutation_p.R116P|PCID2_ENST00000375457.2_Missense_Mutation_p.R114P	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	116					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			GGCAAACACTCGAAGGTCAAG	0.413																																						dbGAP											0													94.0	95.0	94.0					13																	113849401		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.347G>C	13.37:g.113849401C>G	ENSP00000337405:p.Arg116Pro		A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	pfam_PCI_dom,smart_PAM	p.R170P	ENST00000337344.4	37	c.509	CCDS9532.2	13	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392167	0.83011	.	.	ENSG00000126226	ENST00000337344;ENST00000375479;ENST00000375477;ENST00000246505;ENST00000375459;ENST00000375457;ENST00000246506	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.85725	0.5763	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.941	D	0.88101	0.2819	9	0.51188	T	0.08	-9.1433	18.1609	0.89707	0.0:1.0:0.0:0.0	.	170;116	Q5JVF3-4;Q5JVF3	.;PCID2_HUMAN	P	116;116;116;170;114;114;116	.	ENSP00000246505:R170P	R	-	2	0	PCID2	112897402	1.000000	0.71417	0.940000	0.37924	0.885000	0.51271	5.371000	0.66150	2.385000	0.81259	0.563000	0.77884	CGA	PCID2	-	NULL	ENSG00000126226		0.413	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PCID2	HGNC	protein_coding	OTTHUMT00000045897.1	111	0.00	0	C	NM_018386		113849401	113849401	-1	no_errors	ENST00000246505	ensembl	human	known	69_37n	missense	160	21.57	44	SNP	1.000	G
PDE5A	8654	genome.wustl.edu	37	4	120528318	120528318	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr4:120528318G>T	ENST00000354960.3	-	2	606	c.287C>A	c.(286-288)aCa>aAa	p.T96K	PDE5A_ENST00000394439.1_Missense_Mutation_p.T44K|PDE5A_ENST00000264805.5_Missense_Mutation_p.T54K	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	96					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	CCTGGTTGGTGTTCCAGGGGC	0.517																																						dbGAP											0													92.0	90.0	91.0					4																	120528318		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.287C>A	4.37:g.120528318G>T	ENSP00000347046:p.Thr96Lys		A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.T96K	ENST00000354960.3	37	c.287	CCDS3713.1	4	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700475	0.68501	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805;ENST00000420633	T;T;T;T	0.08008	3.14;3.14;3.14;3.14	5.64	5.64	0.86602	.	0.208927	0.40302	N	0.001139	T	0.13841	0.0335	M	0.70595	2.14	0.45883	D	0.998734	B;B	0.29835	0.258;0.096	B;B	0.29176	0.046;0.099	T	0.00865	-1.1535	10	0.87932	D	0	.	14.871	0.70456	0.0704:0.0:0.9296:0.0	.	96;54	O76074;O76074-2	PDE5A_HUMAN;.	K	96;44;54;44	ENSP00000347046:T96K;ENSP00000377957:T44K;ENSP00000264805:T54K;ENSP00000416309:T44K	ENSP00000264805:T54K	T	-	2	0	PDE5A	120747766	1.000000	0.71417	0.995000	0.50966	0.919000	0.55068	7.978000	0.88095	2.659000	0.90383	0.655000	0.94253	ACA	PDE5A	-	NULL	ENSG00000138735		0.517	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	HGNC	protein_coding	OTTHUMT00000256529.1	194	0.00	0	G	NM_001083		120528318	120528318	-1	no_errors	ENST00000354960	ensembl	human	known	69_37n	missense	66	60.12	101	SNP	0.997	T
PI16	221476	genome.wustl.edu	37	6	36930982	36930982	+	Silent	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:36930982C>A	ENST00000373674.3	+	5	1192	c.864C>A	c.(862-864)gtC>gtA	p.V288V	PI16_ENST00000491324.1_Intron	NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	288				V -> A (in Ref. 2; BAC11640). {ECO:0000305}.	negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CAACTGAGGTCCCTTCCATTT	0.552																																						dbGAP											0													85.0	70.0	75.0					6																	36930982		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.864C>A	6.37:g.36930982C>A			Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Silent	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.V288	ENST00000373674.3	37	c.864	CCDS34440.1	6																																																																																			PI16	-	NULL	ENSG00000164530		0.552	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI16	HGNC	protein_coding	OTTHUMT00000040380.1	246	0.00	0	C	NM_153370		36930982	36930982	+1	no_errors	ENST00000373674	ensembl	human	known	69_37n	silent	46	35.21	25	SNP	0.244	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	168	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	154	55.62	193	SNP	1.000	G
PIKFYVE	200576	genome.wustl.edu	37	2	209218801	209218801	+	Silent	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:209218801C>T	ENST00000264380.4	+	40	6182	c.6024C>T	c.(6022-6024)ttC>ttT	p.F2008F		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	2008	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						ACTCCCATTTCCTTTCTAGCC	0.408																																						dbGAP											0													172.0	169.0	170.0					2																	209218801		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.6024C>T	2.37:g.209218801C>T			Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.F2008	ENST00000264380.4	37	c.6024	CCDS2382.1	2																																																																																			PIKFYVE	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000115020		0.408	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	206	0.00	0	C	NM_015040		209218801	209218801	+1	no_errors	ENST00000264380	ensembl	human	known	69_37n	silent	195	22.62	57	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110534984	110534984	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr8:110534984G>T	ENST00000378402.5	+	75	12299	c.12195G>T	c.(12193-12195)caG>caT	p.Q4065H		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4065					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGACTGCCCAGCCAGTTGAAA	0.478										HNSCC(38;0.096)																												dbGAP											0													49.0	52.0	51.0					8																	110534984		2168	4266	6434	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12195G>T	8.37:g.110534984G>T	ENSP00000367655:p.Gln4065His		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.Q4065H	ENST00000378402.5	37	c.12195	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	13.64	2.299016	0.40694	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.86030	-2.06;-1.88	5.96	-3.03	0.05429	.	0.327461	0.32343	N	0.006230	D	0.87708	0.6245	M	0.72118	2.19	0.25078	N	0.990949	D	0.69078	0.997	P	0.55749	0.783	D	0.84807	0.0788	10	0.62326	D	0.03	.	16.0267	0.80550	0.289:0.0:0.711:0.0	.	4065	Q86WI1	PKHL1_HUMAN	H	4065;993	ENSP00000367655:Q4065H;ENSP00000437376:Q993H	ENSP00000367655:Q4065H	Q	+	3	2	PKHD1L1	110604160	0.081000	0.21417	0.969000	0.41365	0.187000	0.23431	-0.522000	0.06237	-0.420000	0.07427	0.650000	0.86243	CAG	PKHD1L1	-	NULL	ENSG00000205038		0.478	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	82	0.00	0	G	NM_177531		110534984	110534984	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	75	47.22	68	SNP	0.947	T
PLCB4	5332	genome.wustl.edu	37	20	9449256	9449256	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr20:9449256C>T	ENST00000378493.1	+	32	3266	c.3251C>T	c.(3250-3252)tCt>tTt	p.S1084F	PLCB4_ENST00000414679.2_Missense_Mutation_p.S1096F|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000278655.4_Missense_Mutation_p.S1084F|PLCB4_ENST00000378473.3_Missense_Mutation_p.S1096F|PLCB4_ENST00000378501.2_Missense_Mutation_p.S1084F|PLCB4_ENST00000334005.3_Missense_Mutation_p.S1084F			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	1084					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						GCTAAGATTTCTATGGAAAAT	0.408																																						dbGAP											0													156.0	151.0	153.0					20																	9449256		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.3251C>T	20.37:g.9449256C>T	ENSP00000367754:p.Ser1084Phe		B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_PLC-beta_CS,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.S1084F	ENST00000378493.1	37	c.3251	CCDS13105.1	20	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887173	0.91814	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6	5.75	5.75	0.90469	.	0.120124	0.64402	D	0.000015	T	0.74397	0.3711	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.99;0.999	D;D;D;D	0.77557	0.99;0.969;0.974;0.987	T	0.75814	-0.3185	10	0.72032	D	0.01	.	19.9433	0.97172	0.0:1.0:0.0:0.0	.	1096;931;1084;1084	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	F	1084;1096;1084;1084;1084;932	ENSP00000334105:S1084F;ENSP00000367734:S1096F;ENSP00000278655:S1084F;ENSP00000367754:S1084F;ENSP00000367762:S1084F;ENSP00000390616:S932F	ENSP00000278655:S1084F	S	+	2	0	PLCB4	9397256	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.183000	0.77697	2.716000	0.92895	0.655000	0.94253	TCT	PLCB4	-	pirsf_PLC-beta	ENSG00000101333		0.408	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCB4	HGNC	protein_coding	OTTHUMT00000077948.2	321	0.00	0	C			9449256	9449256	+1	no_errors	ENST00000334005	ensembl	human	known	69_37n	missense	130	55.02	159	SNP	1.000	T
POLR3C	10623	genome.wustl.edu	37	1	145594157	145594157	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:145594157C>A	ENST00000334163.3	-	14	1565	c.1405G>T	c.(1405-1407)Gcc>Tcc	p.A469S	POLR3C_ENST00000369294.1_Intron	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	469					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			GCAATGATGGCTTCTACCCTC	0.473																																						dbGAP											0													150.0	138.0	142.0					1																	145594157		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.1405G>T	1.37:g.145594157C>A	ENSP00000334564:p.Ala469Ser		O15317|Q9Y3R6	Missense_Mutation	SNP	pfam_RNA_pol_III_Rpc82_C,pfam_RNA_pol_III_RPC82-rel_HTH	p.A469S	ENST00000334163.3	37	c.1405	CCDS921.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.975818	0.74360	.	.	ENSG00000186141	ENST00000334163	T	0.47177	0.85	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.33789	0.0875	L	0.27053	0.805	0.80722	D	1	P;D	0.55172	0.915;0.97	P;P	0.54346	0.468;0.749	T	0.04885	-1.0920	10	0.13470	T	0.59	-15.4716	15.4695	0.75429	0.0:1.0:0.0:0.0	.	469;469	Q9BUI4;Q53F76	RPC3_HUMAN;.	S	469	ENSP00000334564:A469S	ENSP00000334564:A469S	A	-	1	0	POLR3C	144305514	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.778000	0.75043	2.733000	0.93635	0.655000	0.94253	GCC	POLR3C	-	NULL	ENSG00000186141		0.473	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3C	HGNC	protein_coding	OTTHUMT00000038542.1	218	0.00	0	C	NM_006468		145594157	145594157	-1	no_errors	ENST00000334163	ensembl	human	known	69_37n	missense	114	35.23	62	SNP	1.000	A
POMT2	29954	genome.wustl.edu	37	14	77769225	77769225	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:77769225G>C	ENST00000261534.4	-	5	811	c.609C>G	c.(607-609)atC>atG	p.I203M	POMT2_ENST00000556880.1_5'UTR	NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	203						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		TGGCAGCCATGATGAAGAACA	0.537																																						dbGAP											0													83.0	71.0	75.0					14																	77769225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.609C>G	14.37:g.77769225G>C	ENSP00000261534:p.Ile203Met		Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	pfam_Glyco_trans_39,pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	p.I203M	ENST00000261534.4	37	c.609	CCDS9857.1	14	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876817	0.51801	.	.	ENSG00000009830	ENST00000261534;ENST00000554948	D;D	0.85556	-2.0;-2.0	5.54	5.54	0.83059	Glycosyl transferase, family 39 (1);	0.113755	0.64402	D	0.000017	T	0.81451	0.4825	L	0.45470	1.425	0.52501	D	0.999957	B	0.28801	0.223	B	0.37731	0.257	T	0.74163	-0.3754	10	0.13470	T	0.59	-19.2747	10.9808	0.47492	0.1446:0.0:0.8554:0.0	.	203	Q9UKY4	POMT2_HUMAN	M	203;112	ENSP00000261534:I203M;ENSP00000452060:I112M	ENSP00000261534:I203M	I	-	3	3	POMT2	76838978	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.491000	0.45303	2.592000	0.87571	0.655000	0.94253	ATC	POMT2	-	pfam_Glyco_trans_39	ENSG00000009830		0.537	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMT2	HGNC	protein_coding	OTTHUMT00000414155.1	30	0.00	0	G	NM_013382		77769225	77769225	-1	no_errors	ENST00000261534	ensembl	human	known	69_37n	missense	10	52.38	11	SNP	1.000	C
PRB2	653247	genome.wustl.edu	37	12	11546090	11546090	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:11546090G>T	ENST00000389362.4	-	3	957	c.922C>A	c.(922-924)Ccc>Acc	p.P308T	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	308	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			CCTTGTGGGGGTGGTCCTTGT	0.612																																						dbGAP											0													131.0	168.0	156.0					12																	11546090		2175	4275	6450	-	-	-	SO:0001583	missense	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.922C>A	12.37:g.11546090G>T	ENSP00000374013:p.Pro308Thr		O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.P308T	ENST00000389362.4	37	c.922	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	6.512	0.462635	0.12402	.	.	ENSG00000121335	ENST00000389362	T	0.27256	1.68	1.8	0.799	0.18667	.	0.000000	0.26439	U	0.024367	T	0.27832	0.0685	M	0.81112	2.525	0.09310	N	1	D	0.55172	0.97	B	0.43225	0.412	T	0.19976	-1.0289	10	0.34782	T	0.22	.	7.5005	0.27516	0.0:0.0:0.7414:0.2586	.	308	P02812	PRB2_HUMAN	T	308	ENSP00000374013:P308T	ENSP00000374013:P308T	P	-	1	0	PRB2	11437357	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.135000	0.15952	0.058000	0.16222	0.378000	0.23410	CCC	PRB2	-	NULL	ENSG00000121335		0.612	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	471	0.00	0	G	NM_006248		11546090	11546090	-1	no_errors	ENST00000389362	ensembl	human	known	69_37n	missense	311	34.53	164	SNP	0.006	T
PREX1	57580	genome.wustl.edu	37	20	47266010	47266010	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr20:47266010G>A	ENST00000371941.3	-	25	3155	c.3133C>T	c.(3133-3135)Ctc>Ttc	p.L1045F	PREX1_ENST00000396220.1_Missense_Mutation_p.L1045F	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1045					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CCATCATGGAGACCCTGGCCT	0.622																																						dbGAP											0													60.0	55.0	57.0					20																	47266010		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3133C>T	20.37:g.47266010G>A	ENSP00000361009:p.Leu1045Phe		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L1045F	ENST00000371941.3	37	c.3133	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	G	5.223	0.226559	0.09916	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.33654	1.4;1.4	4.08	3.09	0.35607	.	1.150750	0.06854	U	0.797912	T	0.21921	0.0528	N	0.08118	0	0.09310	N	1	B;B	0.33919	0.055;0.432	B;B	0.36289	0.03;0.221	T	0.10222	-1.0639	10	0.09338	T	0.73	.	12.4877	0.55883	0.0:0.1701:0.8299:0.0	.	1045;342	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	F	1045	ENSP00000361009:L1045F;ENSP00000379522:L1045F	ENSP00000361009:L1045F	L	-	1	0	PREX1	46699417	0.184000	0.23200	0.022000	0.16811	0.052000	0.14988	2.907000	0.48743	0.879000	0.35944	0.561000	0.74099	CTC	PREX1	-	NULL	ENSG00000124126		0.622	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	48	0.00	0	G	NM_020820		47266010	47266010	-1	no_errors	ENST00000371941	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	0.018	A
PREX2	80243	genome.wustl.edu	37	8	69129855	69129855	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr8:69129855A>T	ENST00000288368.4	+	38	4886	c.4609A>T	c.(4609-4611)Acc>Tcc	p.T1537S		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1537					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CCACAGGTGCACCCTGAGCGT	0.537																																						dbGAP											0													93.0	72.0	79.0					8																	69129855		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4609A>T	8.37:g.69129855A>T	ENSP00000288368:p.Thr1537Ser		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T1537S	ENST00000288368.4	37	c.4609	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	A	28.4	4.912769	0.92178	.	.	ENSG00000046889	ENST00000288368	T	0.59502	0.26	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.64338	0.2589	L	0.45581	1.43	0.80722	D	1	P	0.47545	0.897	P	0.54401	0.751	T	0.61337	-0.7083	10	0.33940	T	0.23	.	15.4522	0.75282	1.0:0.0:0.0:0.0	.	1537	Q70Z35	PREX2_HUMAN	S	1537	ENSP00000288368:T1537S	ENSP00000288368:T1537S	T	+	1	0	PREX2	69292409	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	8.490000	0.90464	2.289000	0.77006	0.482000	0.46254	ACC	PREX2	-	NULL	ENSG00000046889		0.537	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	43	0.00	0	A	NM_025170		69129855	69129855	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	26	28.21	11	SNP	1.000	T
PSMC6	5706	genome.wustl.edu	37	14	53187699	53187699	+	Splice_Site	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:53187699C>T	ENST00000606149.1	+	11	914	c.898C>T	c.(898-900)Cat>Tat	p.H300Y	PSMC6_ENST00000445930.2_Splice_Site_p.H314Y	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	300					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					TAGAAAAATACGTGAGTTAAG	0.363																																						dbGAP											0													101.0	104.0	103.0					14																	53187699		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.898+1C>T	14.37:g.53187699C>T			B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.H314Y	ENST00000606149.1	37	c.940		14	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781617	0.70222	.	.	ENSG00000100519	ENST00000445930	D	0.94497	-3.44	4.93	4.93	0.64822	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.87253	0.6131	N	0.03917	-0.325	0.80722	D	1	B	0.27823	0.19	B	0.24006	0.05	D	0.85704	0.1315	10	0.87932	D	0	.	18.4944	0.90860	0.0:1.0:0.0:0.0	.	300	P62333	PRS10_HUMAN	Y	314	ENSP00000401802:H314Y	ENSP00000401802:H314Y	H	+	1	0	PSMC6	52257449	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.486000	0.81215	2.420000	0.82092	0.585000	0.79938	CAT	PSMC6	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	ENSG00000100519		0.363	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	HGNC	protein_coding	OTTHUMT00000470741.1	169	0.00	0	C	NM_002806	Missense_Mutation	53187699	53187699	+1	no_errors	ENST00000445930	ensembl	human	known	69_37n	missense	146	33.78	75	SNP	1.000	T
RALGAPA2	57186	genome.wustl.edu	37	20	20585841	20585841	+	Silent	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr20:20585841C>T	ENST00000202677.7	-	15	2023	c.2016G>A	c.(2014-2016)aaG>aaA	p.K672K	RALGAPA2_ENST00000495793.1_5'UTR	NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	672					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GCTTCTTTTCCTTTTGTTCAC	0.423																																						dbGAP											0													85.0	80.0	81.0					20																	20585841		1885	4121	6006	-	-	-	SO:0001819	synonymous_variant	0			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2016G>A	20.37:g.20585841C>T			Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.R489K	ENST00000202677.7	37	c.1466	CCDS46584.1	20	.	.	.	.	.	.	.	.	.	.	C	9.585	1.124628	0.20959	.	.	ENSG00000188559	ENST00000430436	.	.	.	5.28	4.13	0.48395	.	.	.	.	.	T	0.68714	0.3031	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67329	-0.5698	4	.	.	.	.	13.8199	0.63313	0.0:0.8675:0.0:0.1325	.	.	.	.	K	489	.	.	R	-	2	0	RALGAPA2	20533841	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.187000	0.32090	2.474000	0.83562	0.460000	0.39030	AGG	RALGAPA2	-	NULL	ENSG00000188559		0.423	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGAPA2	HGNC	protein_coding	OTTHUMT00000471941.1	112	0.00	0	C	NM_020343		20585841	20585841	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430436	ensembl	human	known	69_37n	missense	109	29.68	46	SNP	1.000	T
RARG	5916	genome.wustl.edu	37	12	53607384	53607384	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:53607384C>T	ENST00000425354.2	-	8	1401	c.914G>A	c.(913-915)gGg>gAg	p.G305E	RARG_ENST00000543726.1_Missense_Mutation_p.G283E|RARG_ENST00000394426.1_Missense_Mutation_p.G305E|RARG_ENST00000327550.3_Missense_Mutation_p.G233E|RARG_ENST00000338561.5_Missense_Mutation_p.G294E|RARG_ENST00000543762.1_5'UTR	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	305	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	TGTGAGGGGCCCGAAGCCGGC	0.612											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													83.0	75.0	78.0					12																	53607384		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.914G>A	12.37:g.53607384C>T	ENSP00000388510:p.Gly305Glu	993	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.G305E	ENST00000425354.2	37	c.914	CCDS8850.1	12	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428310	0.62844	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000538479;ENST00000327550;ENST00000338561;ENST00000543726;ENST00000550265	D;D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94;-3.94	5.21	4.32	0.51571	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.97601	0.9214	M	0.84683	2.71	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98126	1.0428	10	0.87932	D	0	.	13.0195	0.58777	0.0:0.9203:0.0:0.0797	.	342;283;305;294	F8VR45;B7Z4F1;P13631;F1D8P1	.;.;RARG_HUMAN;.	E	305;305;67;233;294;283;342	ENSP00000388510:G305E;ENSP00000377947:G305E;ENSP00000332695:G233E;ENSP00000343698:G294E;ENSP00000444335:G283E	ENSP00000332695:G233E	G	-	2	0	RARG	51893651	1.000000	0.71417	0.987000	0.45799	0.414000	0.31173	7.818000	0.86416	1.344000	0.45657	-0.373000	0.07131	GGG	RARG	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Retinoid-X_rcpt/HNF4	ENSG00000172819		0.612	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARG	HGNC	protein_coding	OTTHUMT00000109404.2	112	0.00	0	C	NM_000966		53607384	53607384	-1	no_errors	ENST00000394426	ensembl	human	known	69_37n	missense	25	45.65	21	SNP	1.000	T
RARRES1	5918	genome.wustl.edu	37	3	158422690	158422690	+	Missense_Mutation	SNP	G	G	C	rs201670043		TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:158422690G>C	ENST00000237696.5	-	4	842	c.562C>G	c.(562-564)Ctg>Gtg	p.L188V	RARRES1_ENST00000479756.1_Missense_Mutation_p.L188V|RARRES1_ENST00000498640.1_5'UTR	NM_206963.1	NP_996846.1	P49788	TIG1_HUMAN	retinoic acid receptor responder (tazarotene induced) 1	188					negative regulation of cell proliferation (GO:0008285)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)	ATGAGTCTCAGAGAGGGATCA	0.398													g|||	1	0.000199681	0.0	0.0	5008	,	,		19558	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													90.0	81.0	84.0					3																	158422690		2203	4300	6503	-	-	-	SO:0001583	missense	0			U27185	CCDS3184.1, CCDS54665.1	3q25.32	2013-07-29			ENSG00000118849	ENSG00000118849			9867	protein-coding gene	gene with protein product	"""latexin-like"""	605090				8601727, 9270552	Standard	NM_002888		Approved	TIG1, LXNL	uc003fci.3	P49788	OTTHUMG00000158834	ENST00000237696.5:c.562C>G	3.37:g.158422690G>C	ENSP00000237696:p.Leu188Val		Q8N1D7	Missense_Mutation	SNP	pfam_Prot_inh_latexin,pirsf_Prot_inh_latexin	p.L188V	ENST00000237696.5	37	c.562	CCDS3184.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	-	13.45	2.241496	0.39598	.	.	ENSG00000118849	ENST00000237696;ENST00000479756	T;T	0.32988	1.43;1.43	5.1	4.21	0.49690	.	0.372525	0.25634	N	0.029326	T	0.37544	0.1007	L	0.53249	1.67	0.25304	N	0.989256	P;P	0.49559	0.925;0.916	P;B	0.49597	0.616;0.418	T	0.18903	-1.0322	10	0.52906	T	0.07	-41.9633	11.6078	0.51041	0.0:0.1801:0.8199:0.0	.	188;188	P49788-2;P49788	.;TIG1_HUMAN	V	188	ENSP00000237696:L188V;ENSP00000418556:L188V	ENSP00000237696:L188V	L	-	1	2	RARRES1	159905384	0.822000	0.29219	0.938000	0.37757	0.556000	0.35491	0.997000	0.29731	1.138000	0.42230	0.387000	0.25754	CTG	RARRES1	-	pfam_Prot_inh_latexin,pirsf_Prot_inh_latexin	ENSG00000118849		0.398	RARRES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARRES1	HGNC	protein_coding	OTTHUMT00000352358.1	67	0.00	0	G			158422690	158422690	-1	no_errors	ENST00000237696	ensembl	human	known	69_37n	missense	88	22.12	25	SNP	0.994	C
RELN	5649	genome.wustl.edu	37	7	103236919	103236919	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:103236919C>G	ENST00000428762.1	-	25	3682	c.3523G>C	c.(3523-3525)Gac>Cac	p.D1175H	RELN_ENST00000424685.2_Missense_Mutation_p.D1175H|RELN_ENST00000343529.5_Missense_Mutation_p.D1175H	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1175					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTGCTGAAGTCTGAAAAGTAC	0.468																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													178.0	163.0	168.0					7																	103236919		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3523G>C	7.37:g.103236919C>G	ENSP00000392423:p.Asp1175His		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.D1175H	ENST00000428762.1	37	c.3523	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466906	0.84425	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.41065	1.83;1.01;1.83	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.59445	0.2194	L	0.54323	1.7	0.80722	D	1	P;D	0.76494	0.864;0.999	P;P	0.61328	0.523;0.887	T	0.49643	-0.8918	10	0.35671	T	0.21	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	1175;1175	P78509-2;P78509	.;RELN_HUMAN	H	1175	ENSP00000392423:D1175H;ENSP00000345694:D1175H;ENSP00000388446:D1175H	ENSP00000345694:D1175H	D	-	1	0	RELN	103024155	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.270000	0.78493	2.878000	0.98634	0.650000	0.86243	GAC	RELN	-	superfamily_Growth_fac_rcpt	ENSG00000189056		0.468	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	172	0.00	0	C	NM_005045		103236919	103236919	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	119	32.00	56	SNP	1.000	G
RIPK3	11035	genome.wustl.edu	37	14	24808754	24808754	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:24808754G>A	ENST00000216274.5	-	2	288	c.70C>T	c.(70-72)Cag>Tag	p.Q24*	RIPK3_ENST00000554338.1_5'UTR|RP11-934B9.3_ENST00000555591.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	24	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		ACGAGCTCCTGGTTCTCCAGT	0.652																																					Pancreas(58;918 1191 4668 13304 15331)	dbGAP											0													94.0	96.0	96.0					14																	24808754		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.70C>T	14.37:g.24808754G>A	ENSP00000216274:p.Gln24*		B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q24*	ENST00000216274.5	37	c.70	CCDS9628.1	14	.	.	.	.	.	.	.	.	.	.	G	19.75	3.886567	0.72410	.	.	ENSG00000129465	ENST00000216274	.	.	.	4.85	2.74	0.32292	.	0.506232	0.16825	N	0.198016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-3.3045	5.6228	0.17467	0.1101:0.0:0.7047:0.1852	.	.	.	.	X	24	.	ENSP00000216274:Q24X	Q	-	1	0	RIPK3	23878594	0.784000	0.28713	0.007000	0.13788	0.003000	0.03518	2.002000	0.40835	0.475000	0.27415	0.561000	0.74099	CAG	RIPK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000129465		0.652	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK3	HGNC	protein_coding	OTTHUMT00000073203.4	123	0.00	0	G	NM_006871		24808754	24808754	-1	no_errors	ENST00000216274	ensembl	human	known	69_37n	nonsense	25	32.43	12	SNP	0.007	A
RORB	6096	genome.wustl.edu	37	9	77275546	77275546	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:77275546G>C	ENST00000396204.2	+	5	684	c.684G>C	c.(682-684)caG>caC	p.Q228H	RORB_ENST00000376896.3_Missense_Mutation_p.Q217H			Q92753	RORB_HUMAN	RAR-related orphan receptor B	228	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	GAATTGCACAGAACATCATTA	0.383																																						dbGAP											0													137.0	136.0	136.0					9																	77275546		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.684G>C	9.37:g.77275546G>C	ENSP00000379507:p.Gln228His		Q8WX73	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.Q228H	ENST00000396204.2	37	c.684		9	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083692	0.76642	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	T;T	0.59224	0.28;0.28	6.06	4.24	0.50183	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	T	0.72045	0.3412	M	0.80982	2.52	0.58432	D	0.999999	D;D	0.76494	0.999;0.979	P;P	0.61874	0.895;0.8	T	0.70978	-0.4725	10	0.27082	T	0.32	.	12.7159	0.57115	0.1321:0.0:0.8679:0.0	.	228;217	Q92753;Q58EY0	RORB_HUMAN;.	H	217;228	ENSP00000366093:Q217H;ENSP00000379507:Q228H	ENSP00000366093:Q217H	Q	+	3	2	RORB	76465366	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.893000	0.63199	0.908000	0.36671	0.655000	0.94253	CAG	RORB	-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_ROR_rcpt	ENSG00000198963		0.383	RORB-201	KNOWN	basic	protein_coding	RORB	HGNC	protein_coding		235	0.00	0	G			77275546	77275546	+1	no_errors	ENST00000396204	ensembl	human	known	69_37n	missense	202	33.33	101	SNP	1.000	C
RPAP2	79871	genome.wustl.edu	37	1	92789796	92789796	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:92789796G>A	ENST00000610020.1	+	8	1428	c.1319G>A	c.(1318-1320)gGt>gAt	p.G440D		NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	440					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		AGGGGCTCAGGTACAGCCATT	0.413																																						dbGAP											0													65.0	69.0	67.0					1																	92789796		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.1319G>A	1.37:g.92789796G>A	ENSP00000476948:p.Gly440Asp		C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	pfam_DUF408	p.G440D	ENST00000610020.1	37	c.1319	CCDS740.1	1	.	.	.	.	.	.	.	.	.	.	G	1.445	-0.566633	0.03910	.	.	ENSG00000122484	ENST00000370343;ENST00000394482	.	.	.	5.72	1.75	0.24633	.	0.557940	0.21846	N	0.068252	T	0.03827	0.0108	N	0.02011	-0.69	0.21105	N	0.999783	B	0.02656	0.0	B	0.01281	0.0	T	0.42344	-0.9457	8	0.02654	T	1	-4.8483	8.2622	0.31793	0.6519:0.0:0.3481:0.0	.	440	Q8IXW5	RPAP2_HUMAN	D	440	.	ENSP00000359368:G440D	G	+	2	0	RPAP2	92562384	0.979000	0.34478	0.989000	0.46669	0.992000	0.81027	1.181000	0.32017	0.458000	0.26988	-0.238000	0.12139	GGT	RPAP2	-	NULL	ENSG00000122484		0.413	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP2	HGNC	protein_coding	OTTHUMT00000028368.2	131	0.00	0	G	NM_024813		92789796	92789796	+1	no_errors	ENST00000370343	ensembl	human	known	69_37n	missense	68	59.28	99	SNP	0.690	A
RYR2	6262	genome.wustl.edu	37	1	237659960	237659960	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:237659960C>T	ENST00000366574.2	+	20	2428	c.2111C>T	c.(2110-2112)tCt>tTt	p.S704F	RYR2_ENST00000360064.6_Missense_Mutation_p.S702F|RYR2_ENST00000542537.1_Missense_Mutation_p.S688F	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	704	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAGGATATTCTCCCTACCCT	0.512																																						dbGAP											0													116.0	122.0	120.0					1																	237659960		1941	4152	6093	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2111C>T	1.37:g.237659960C>T	ENSP00000355533:p.Ser704Phe		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.S702F	ENST00000366574.2	37	c.2105	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049823	0.55218	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.61158	0.13;0.13;0.13	5.98	5.98	0.97165	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.094242	0.44688	D	0.000427	T	0.70316	0.3210	L	0.61387	1.9	0.80722	D	1	D	0.54397	0.966	P	0.58331	0.837	T	0.71159	-0.4674	10	0.62326	D	0.03	.	15.8847	0.79238	0.0:0.8654:0.1346:0.0	.	704	Q92736	RYR2_HUMAN	F	704;702;688	ENSP00000355533:S704F;ENSP00000353174:S702F;ENSP00000443798:S688F	ENSP00000353174:S702F	S	+	2	0	RYR2	235726583	0.843000	0.29541	0.219000	0.23793	0.968000	0.65278	2.432000	0.44784	2.835000	0.97688	0.650000	0.86243	TCT	RYR2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000198626		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	127	0.00	0	C	NM_001035		237659960	237659960	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	210	18.22	47	SNP	0.863	T
RYR2	6262	genome.wustl.edu	37	1	237777665	237777665	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:237777665A>G	ENST00000366574.2	+	37	5554	c.5237A>G	c.(5236-5238)cAc>cGc	p.H1746R	RYR2_ENST00000360064.6_Missense_Mutation_p.H1744R|RYR2_ENST00000542537.1_Missense_Mutation_p.H1730R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1746	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.H1744R(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACAAAAAACACGGCCTTCCA	0.512																																						dbGAP											1	Substitution - Missense(1)	lung(1)											65.0	65.0	65.0					1																	237777665		2044	4196	6240	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5237A>G	1.37:g.237777665A>G	ENSP00000355533:p.His1746Arg		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.H1744R	ENST00000366574.2	37	c.5231	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.144537	0.57044	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.73897	-0.79;-0.79;-0.79	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000006	T	0.73528	0.3598	M	0.64997	1.995	0.80722	D	1	P	0.39480	0.675	B	0.39840	0.311	T	0.74896	-0.3508	10	0.42905	T	0.14	.	15.4979	0.75669	1.0:0.0:0.0:0.0	.	1746	Q92736	RYR2_HUMAN	R	1746;1744;1730	ENSP00000355533:H1746R;ENSP00000353174:H1744R;ENSP00000443798:H1730R	ENSP00000353174:H1744R	H	+	2	0	RYR2	235844288	1.000000	0.71417	0.980000	0.43619	0.798000	0.45092	9.287000	0.95975	2.073000	0.62155	0.528000	0.53228	CAC	RYR2	-	NULL	ENSG00000198626		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	288	0.00	0	A	NM_001035		237777665	237777665	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	450	20.35	115	SNP	1.000	G
S100A7A	338324	genome.wustl.edu	37	1	153391682	153391682	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:153391682A>C	ENST00000368729.4	+	3	260	c.203A>C	c.(202-204)aAg>aCg	p.K68T	S100A7A_ENST00000368728.2_Missense_Mutation_p.K68T|S100A7A_ENST00000329256.2_Missense_Mutation_p.K68T	NM_176823.3	NP_789793.1	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7A	68	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein self-association (GO:0043621)			cervix(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	12	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			AATGAGGATAAGAAGATTGAT	0.448																																						dbGAP											0													103.0	95.0	98.0					1																	153391682		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY189118	CCDS30872.1	1q22	2013-01-10	2006-09-11	2006-09-11	ENSG00000184330	ENSG00000184330		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	21657	protein-coding gene	gene with protein product			"""S100 calcium binding protein A15"", ""S100 calcium binding protein A7-like 1"""	S100A15, S100A7L1		11230159	Standard	NM_176823		Approved	S100A7f	uc001fbt.1	Q86SG5	OTTHUMG00000013122	ENST00000368729.4:c.203A>C	1.37:g.153391682A>C	ENSP00000357718:p.Lys68Thr		D3DV38|Q5SY69	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.K68T	ENST00000368729.4	37	c.203	CCDS30872.1	1	.	.	.	.	.	.	.	.	.	.	.	10.85	1.466005	0.26335	.	.	ENSG00000184330	ENST00000368729;ENST00000368728;ENST00000329256	T;T;T	0.06849	3.25;3.25;3.25	1.88	0.73	0.18271	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	.	.	.	.	T	0.05777	0.0151	M	0.65975	2.015	0.09310	N	1	P	0.44195	0.828	P	0.50231	0.635	T	0.27020	-1.0086	9	0.46703	T	0.11	.	3.6087	0.08052	0.789:0.0:0.211:0.0	.	68	Q86SG5	S1A7A_HUMAN	T	68	ENSP00000357718:K68T;ENSP00000357717:K68T;ENSP00000329008:K68T	ENSP00000329008:K68T	K	+	2	0	S100A7A	151658306	0.005000	0.15991	0.004000	0.12327	0.006000	0.05464	0.582000	0.23834	0.177000	0.19895	-0.326000	0.08463	AAG	S100A7A	-	pfscan_EF_HAND_2	ENSG00000184330		0.448	S100A7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A7A	HGNC	protein_coding	OTTHUMT00000036786.2	152	0.00	0	A	NM_176823		153391682	153391682	+1	no_errors	ENST00000329256	ensembl	human	known	69_37n	missense	199	30.07	86	SNP	0.007	C
RYR2	6262	genome.wustl.edu	37	1	237791164	237791164	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:237791164T>C	ENST00000366574.2	+	41	6541	c.6224T>C	c.(6223-6225)aTt>aCt	p.I2075T	RYR2_ENST00000360064.6_Missense_Mutation_p.I2073T|RYR2_ENST00000542537.1_Missense_Mutation_p.I2059T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2075	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGTCTGTCATTGAAGACCCC	0.493																																						dbGAP											0													49.0	48.0	48.0					1																	237791164		1963	4148	6111	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6224T>C	1.37:g.237791164T>C	ENSP00000355533:p.Ile2075Thr		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.I2073T	ENST00000366574.2	37	c.6218	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.462622	0.84425	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98329	-4.87;-4.84;-4.86	5.17	5.17	0.71159	.	0.079396	0.46442	D	0.000289	D	0.98632	0.9542	M	0.83223	2.63	0.80722	D	1	D	0.59767	0.986	P	0.58210	0.835	D	0.99552	1.0966	10	0.87932	D	0	.	15.3078	0.74008	0.0:0.0:0.0:1.0	.	2075	Q92736	RYR2_HUMAN	T	2075;2073;2059	ENSP00000355533:I2075T;ENSP00000353174:I2073T;ENSP00000443798:I2059T	ENSP00000353174:I2073T	I	+	2	0	RYR2	235857787	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.972000	0.88022	2.079000	0.62486	0.482000	0.46254	ATT	RYR2	-	NULL	ENSG00000198626		0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	57	0.00	0	T	NM_001035		237791164	237791164	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	104	22.96	31	SNP	0.997	C
SEC31A	22872	genome.wustl.edu	37	4	83782814	83782814	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr4:83782814G>T	ENST00000395310.2	-	14	1778	c.1596C>A	c.(1594-1596)agC>agA	p.S532R	SEC31A_ENST00000508502.1_Missense_Mutation_p.S532R|SEC31A_ENST00000513858.1_Intron|SEC31A_ENST00000326950.5_Intron|SEC31A_ENST00000508479.1_Missense_Mutation_p.S532R|SEC31A_ENST00000436790.2_5'Flank|SEC31A_ENST00000505984.1_Intron|SEC31A_ENST00000509142.1_Missense_Mutation_p.S532R|SEC31A_ENST00000348405.4_Intron|SEC31A_ENST00000443462.2_Missense_Mutation_p.S527R|SEC31A_ENST00000448323.1_Missense_Mutation_p.S532R|SEC31A_ENST00000355196.2_Missense_Mutation_p.S532R|SEC31A_ENST00000505472.1_Missense_Mutation_p.S532R|SEC31A_ENST00000311785.7_Missense_Mutation_p.S532R|SEC31A_ENST00000500777.2_Intron|SEC31A_ENST00000432794.1_Missense_Mutation_p.S532R|SEC31A_ENST00000264405.5_Intron	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	532					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				CAGCAGCAGGGCTCTCCTCCC	0.383																																						dbGAP											0													49.0	49.0	49.0					4																	83782814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.1596C>A	4.37:g.83782814G>T	ENSP00000378721:p.Ser532Arg		B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S532R	ENST00000395310.2	37	c.1596	CCDS3596.1	4	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600791	0.28534	.	.	ENSG00000138674	ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000311785;ENST00000505472;ENST00000508502;ENST00000355196;ENST00000508479;ENST00000510167	T;T;T;T;T;T;T;T;T;T;T	0.38560	2.37;2.37;1.25;2.26;2.37;1.25;1.13;2.37;2.37;2.27;2.25	5.32	3.55	0.40652	.	0.624630	0.18261	N	0.146611	T	0.28167	0.0695	L	0.33485	1.01	0.34915	D	0.747863	B;B;B;B;B	0.12013	0.0;0.002;0.005;0.001;0.005	B;B;B;B;B	0.18263	0.001;0.003;0.021;0.003;0.006	T	0.24476	-1.0159	10	0.19147	T	0.46	-5.3516	7.4212	0.27073	0.1441:0.0:0.7235:0.1325	.	527;532;532;532;532	B4DIW6;D6RHZ5;O94979-3;O94979-2;O94979	.;.;.;.;SC31A_HUMAN	R	532;527;532;532;532;532;532;532;532;532;120	ENSP00000378721:S532R;ENSP00000408027:S527R;ENSP00000426569:S532R;ENSP00000407944:S532R;ENSP00000400926:S532R;ENSP00000309070:S532R;ENSP00000421633:S532R;ENSP00000424635:S532R;ENSP00000347329:S532R;ENSP00000425999:S532R;ENSP00000422267:S120R	ENSP00000309070:S532R	S	-	3	2	SEC31A	84001838	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	0.505000	0.22642	1.184000	0.42957	0.585000	0.79938	AGC	SEC31A	-	NULL	ENSG00000138674		0.383	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1	52	0.00	0	G	NM_016211		83782814	83782814	-1	no_errors	ENST00000432794	ensembl	human	known	69_37n	missense	22	35.29	12	SNP	1.000	T
SEC61A1	29927	genome.wustl.edu	37	3	127779472	127779472	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:127779472C>G	ENST00000243253.3	+	7	768	c.584C>G	c.(583-585)gCa>gGa	p.A195G	SEC61A1_ENST00000424880.2_Missense_Mutation_p.A75G|SEC61A1_ENST00000464451.1_Missense_Mutation_p.A201G	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	195					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						GTATGGAAGGCATTCAGCCCC	0.483																																						dbGAP											0													103.0	91.0	95.0					3																	127779472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.584C>G	3.37:g.127779472C>G	ENSP00000243253:p.Ala195Gly		P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Missense_Mutation	SNP	pfam_SecY,pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY,tigrfam_SecY	p.A195G	ENST00000243253.3	37	c.584	CCDS3046.1	3	.	.	.	.	.	.	.	.	.	.	C	19.62	3.860962	0.71949	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000424880	.	.	.	5.15	5.15	0.70609	SecY subunit domain (2);	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	M	0.90483	3.12	0.80722	D	1	B	0.12013	0.005	B	0.31495	0.131	T	0.79424	-0.1809	9	0.51188	T	0.08	.	19.0112	0.92874	0.0:1.0:0.0:0.0	.	195	P61619	S61A1_HUMAN	G	201;195;75	.	ENSP00000243253:A195G	A	+	2	0	SEC61A1	129262162	1.000000	0.71417	0.986000	0.45419	0.703000	0.40648	7.741000	0.84997	2.550000	0.86006	0.655000	0.94253	GCA	SEC61A1	-	pfam_SecY,superfamily_SecY_su_dom,pirsf_SecY,tigrfam_SecY	ENSG00000058262		0.483	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A1	HGNC	protein_coding	OTTHUMT00000356541.2	51	0.00	0	C	NM_013336		127779472	127779472	+1	no_errors	ENST00000243253	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	1.000	G
SERPINA1	5265	genome.wustl.edu	37	14	94849023	94849023	+	Nonsense_Mutation	SNP	G	G	C	rs267606950|rs199422210		TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr14:94849023G>C	ENST00000448921.1	-	4	1124	c.552C>G	c.(550-552)taC>taG	p.Y184*	SERPINA1_ENST00000402629.1_Nonsense_Mutation_p.Y184*|SERPINA1_ENST00000393088.4_Nonsense_Mutation_p.Y184*|SERPINA1_ENST00000449399.3_Nonsense_Mutation_p.Y184*|SERPINA1_ENST00000404814.4_Nonsense_Mutation_p.Y184*|SERPINA1_ENST00000355814.4_Nonsense_Mutation_p.Y184*|SERPINA1_ENST00000440909.1_Nonsense_Mutation_p.Y184*|SERPINA1_ENST00000393087.4_Nonsense_Mutation_p.Y184*|SERPINA1_ENST00000437397.1_Nonsense_Mutation_p.Y184*|SERPINA1_ENST00000555289.1_5'Flank	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	184					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		CCTTCTCCACGTAATCGTTGA	0.428																																						dbGAP											0			GRCh37	CD870026|CM870017	SERPINA1	D|M							136.0	138.0	138.0					14																	94849023		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.552C>G	14.37:g.94849023G>C	ENSP00000416066:p.Tyr184*		A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Nonsense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.Y184*	ENST00000448921.1	37	c.552	CCDS9925.1	14	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259285	0.80246	.	.	ENSG00000197249	ENST00000440909;ENST00000448921;ENST00000437397;ENST00000355814;ENST00000393087;ENST00000393088;ENST00000404814;ENST00000449399;ENST00000402629;ENST00000554720	.	.	.	5.79	-11.6	0.00059	.	0.289615	0.29609	N	0.011669	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	24.2276	0.99989	0.3424:0.0:0.6576:0.0	.	.	.	.	X	184;184;184;184;184;184;184;184;184;98	.	ENSP00000348068:Y184X	Y	-	3	2	SERPINA1	93918776	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-1.835000	0.01692	-3.473000	0.00156	-1.421000	0.01109	TAC	SERPINA1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000197249		0.428	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA1	HGNC	protein_coding	OTTHUMT00000317768.2	153	0.00	0	G	NM_001002235		94849023	94849023	-1	no_errors	ENST00000355814	ensembl	human	known	69_37n	nonsense	40	52.38	44	SNP	0.000	C
SHANK2	22941	genome.wustl.edu	37	11	70331834	70331834	+	Missense_Mutation	SNP	C	C	T	rs544418717		TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr11:70331834C>T	ENST00000423696.2	-	15	3463	c.3427G>A	c.(3427-3429)Gaa>Aaa	p.E1143K	SHANK2_ENST00000449833.2_Missense_Mutation_p.E927K|SHANK2_ENST00000338508.4_Missense_Mutation_p.E1523K|SHANK2_ENST00000409161.1_Missense_Mutation_p.E926K			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1143					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TCTCCACCTTCGGAAGACAGG	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		14465	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													118.0	101.0	107.0					11																	70331834		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.3427G>A	11.37:g.70331834C>T	ENSP00000394536:p.Glu1143Lys		C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.E1523K	ENST00000423696.2	37	c.4567		11	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530650	0.85706	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03;2.03	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.52725	0.1752	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.942;0.996;0.997	T	0.57207	-0.7851	10	0.62326	D	0.03	.	19.2305	0.93836	0.0:1.0:0.0:0.0	.	1143;1522;927	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	K	927;926;801;1523;1143;1161;1146	ENSP00000399423:E927K;ENSP00000386491:E926K;ENSP00000402944:E801K;ENSP00000345193:E1523K;ENSP00000394536:E1143K;ENSP00000294018:E1146K	ENSP00000294018:E1146K	E	-	1	0	SHANK2	70009482	1.000000	0.71417	0.658000	0.29665	0.923000	0.55619	7.254000	0.78329	2.549000	0.85964	0.655000	0.94253	GAA	SHANK2	-	NULL	ENSG00000162105		0.547	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding		30	0.00	0	C	NM_012309		70331834	70331834	-1	no_errors	ENST00000338508	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	1.000	T
SLC16A12	387700	genome.wustl.edu	37	10	91203597	91203598	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr10:91203597_91203598insA	ENST00000341233.4	-	4	519_520	c.129_130insT	c.(127-132)tttgtgfs	p.V44fs	SLC16A12_ENST00000371790.4_Frame_Shift_Ins_p.V74fs	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						TGGAACTCCACAAAAAAAATTG	0.361																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.130dupT	10.37:g.91203605_91203605dupA	ENSP00000343022:p.Val44fs		Q5M9M9|Q5T7J2|Q6ZV76	Frame_Shift_Ins	INS	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.V73fs	ENST00000341233.4	37	c.220_219		10																																																																																			SLC16A12	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000152779		0.361	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	SLC16A12	HGNC	protein_coding		88	0.00	0	-	NM_213606		91203597	91203598	-1	no_errors	ENST00000371790	ensembl	human	known	69_37n	frame_shift_ins	92	13.21	14	INS	1.000:1.000	A
SLC1A1	6505	genome.wustl.edu	37	9	4583113	4583113	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:4583113G>A	ENST00000262352.3	+	11	1505	c.1269G>A	c.(1267-1269)ctG>ctA	p.L423L		NM_004170.5	NP_004161.4	P43005	EAA3_HUMAN	solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1	423					D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|pancreas(1)|skin(1)	15		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|Pregabalin(DB00230)	TGATTGTGCTGAGTGCCGTGG	0.587																																						dbGAP											0													135.0	114.0	121.0					9																	4583113		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6452.1	9p24	2013-05-22			ENSG00000106688	ENSG00000106688		"""Solute carriers"""	10939	protein-coding gene	gene with protein product		133550				8020993	Standard	NM_004170		Approved	EAAC1, EAAT3	uc003zij.2	P43005	OTTHUMG00000019468	ENST00000262352.3:c.1269G>A	9.37:g.4583113G>A			O75587|Q5VZ24|Q8N199|Q9UEW2	Silent	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.L423	ENST00000262352.3	37	c.1269	CCDS6452.1	9																																																																																			SLC1A1	-	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	ENSG00000106688		0.587	SLC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A1	HGNC	protein_coding	OTTHUMT00000051571.1	201	0.00	0	G			4583113	4583113	+1	no_errors	ENST00000262352	ensembl	human	known	69_37n	silent	43	59.43	63	SNP	1.000	A
SLC35B2	347734	genome.wustl.edu	37	6	44222510	44222510	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:44222510G>A	ENST00000393812.3	-	4	1375	c.1232C>T	c.(1231-1233)gCg>gTg	p.A411V	SLC35B2_ENST00000538577.1_Missense_Mutation_p.A318V|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000537814.1_Missense_Mutation_p.A278V|SLC35B2_ENST00000393810.1_3'UTR	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	411					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACGGCCCCGCGCGTAGACTCT	0.582																																						dbGAP											0													88.0	91.0	90.0					6																	44222510		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.1232C>T	6.37:g.44222510G>A	ENSP00000377401:p.Ala411Val		B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	pfam_UAA,pfam_DMT	p.A411V	ENST00000393812.3	37	c.1232	CCDS34462.1	6	.	.	.	.	.	.	.	.	.	.	g	14.04	2.415406	0.42817	.	.	ENSG00000157593	ENST00000393812;ENST00000537814;ENST00000538577;ENST00000341553	T;T;T	0.69806	-0.43;-0.43;-0.43	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.65984	0.2744	L	0.41573	1.285	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.991;0.999	T	0.60786	-0.7194	10	0.13108	T	0.6	-13.5626	17.5442	0.87856	0.0:0.0:1.0:0.0	.	318;411	F5H7Y9;Q8TB61	.;S35B2_HUMAN	V	411;278;318;371	ENSP00000377401:A411V;ENSP00000440340:A278V;ENSP00000443845:A318V	ENSP00000342455:A371V	A	-	2	0	SLC35B2	44330488	1.000000	0.71417	0.992000	0.48379	0.014000	0.08584	9.591000	0.98241	2.368000	0.80403	0.546000	0.68486	GCG	SLC35B2	-	pfam_UAA	ENSG00000157593		0.582	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B2	HGNC	protein_coding	OTTHUMT00000040724.2	264	0.38	1	G			44222510	44222510	-1	no_errors	ENST00000393812	ensembl	human	known	69_37n	missense	9	80.85	38	SNP	1.000	A
SLC44A5	204962	genome.wustl.edu	37	1	75862283	75862283	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:75862283C>G	ENST00000370855.5	-	3	150	c.37G>C	c.(37-39)Gag>Cag	p.E13Q	SLC44A5_ENST00000370859.3_Missense_Mutation_p.E13Q|SLC44A5_ENST00000469525.1_5'UTR|SLC44A5_ENST00000535611.1_5'UTR	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	13					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TCCTCTTCCTCAGAGGGAGTA	0.363																																						dbGAP											0													111.0	115.0	113.0					1																	75862283		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.37G>C	1.37:g.75862283C>G	ENSP00000359892:p.Glu13Gln		B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.E13Q	ENST00000370855.5	37	c.37	CCDS667.1	1	.	.	.	.	.	.	.	.	.	.	C	7.549	0.662387	0.14645	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855	T;T	0.10099	2.91;2.91	4.18	1.32	0.21799	.	3.420860	0.00881	N	0.002137	T	0.02083	0.0065	L	0.32530	0.975	0.20074	N	0.999935	B;P;B	0.37781	0.295;0.608;0.264	B;B;B	0.31495	0.105;0.131;0.107	T	0.36456	-0.9747	10	0.18710	T	0.47	-1.7731	4.4263	0.11505	0.0:0.6111:0.1858:0.2031	.	52;13;13	B7Z470;Q8NCS7;Q8NCS7-2	.;CTL5_HUMAN;.	Q	13;52;13	ENSP00000359896:E13Q;ENSP00000359892:E13Q	ENSP00000359892:E13Q	E	-	1	0	SLC44A5	75634871	0.000000	0.05858	0.004000	0.12327	0.127000	0.20565	-0.171000	0.09883	0.314000	0.23086	-0.127000	0.14921	GAG	SLC44A5	-	NULL	ENSG00000137968		0.363	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026921.1	216	0.00	0	C	NM_152697		75862283	75862283	-1	no_errors	ENST00000370855	ensembl	human	known	69_37n	missense	183	26.80	67	SNP	0.005	G
SLC5A12	159963	genome.wustl.edu	37	11	26743111	26743111	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr11:26743111C>A	ENST00000396005.3	-	1	460	c.151G>T	c.(151-153)Ggc>Tgc	p.G51C	SLC5A12_ENST00000280467.6_Missense_Mutation_p.G51C	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	51					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						CCGACAGGGCCAAAGCTCATT	0.517																																						dbGAP											0													69.0	71.0	70.0					11																	26743111		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.151G>T	11.37:g.26743111C>A	ENSP00000379326:p.Gly51Cys		Q86UC7	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.G51C	ENST00000396005.3	37	c.151	CCDS7860.2	11	.	.	.	.	.	.	.	.	.	.	C	31	5.097076	0.94197	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.87729	-2.29;-2.29	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.92672	0.7671	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	0.975;1.0	P;D	0.74674	0.854;0.984	D	0.92479	0.5991	10	0.56958	D	0.05	.	19.5898	0.95506	0.0:1.0:0.0:0.0	.	51;51	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	C	51	ENSP00000379326:G51C;ENSP00000280467:G51C	ENSP00000280467:G51C	G	-	1	0	SLC5A12	26699687	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.992000	0.56980	2.643000	0.89663	0.585000	0.79938	GGC	SLC5A12	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000148942		0.517	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A12	HGNC	protein_coding	OTTHUMT00000319681.1	189	0.00	0	C	NM_178498		26743111	26743111	-1	no_errors	ENST00000396005	ensembl	human	known	69_37n	missense	97	52.22	106	SNP	1.000	A
SLC6A9	6536	genome.wustl.edu	37	1	44463290	44463290	+	Missense_Mutation	SNP	A	A	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:44463290A>T	ENST00000360584.2	-	14	2239	c.2048T>A	c.(2047-2049)cTg>cAg	p.L683Q	SLC6A9_ENST00000475075.2_Missense_Mutation_p.L499Q|SLC6A9_ENST00000357730.2_Missense_Mutation_p.L629Q|SLC6A9_ENST00000372307.3_Intron|SLC6A9_ENST00000372306.3_Intron|SLC6A9_ENST00000372310.3_Missense_Mutation_p.L610Q	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	683					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	GTCCGGGTGCAGTGGCTGGAC	0.677																																						dbGAP											0													70.0	83.0	79.0					1																	44463290		2203	4300	6503	-	-	-	SO:0001583	missense	0			S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.2048T>A	1.37:g.44463290A>T	ENSP00000353791:p.Leu683Gln		A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_glycine_GLY1	p.L683Q	ENST00000360584.2	37	c.2048	CCDS41317.1	1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.755987	0.49362	.	.	ENSG00000196517	ENST00000372310;ENST00000475075;ENST00000360584;ENST00000357730	T;T;T;T	0.74737	-0.83;-0.87;-0.85;-0.86	4.92	4.92	0.64577	.	0.909696	0.09361	N	0.812744	T	0.72145	0.3424	L	0.53249	1.67	0.80722	D	1	P;B;P;P	0.45902	0.868;0.019;0.517;0.868	B;B;B;B	0.39876	0.243;0.019;0.156;0.312	T	0.70795	-0.4775	10	0.49607	T	0.09	.	14.3832	0.66926	1.0:0.0:0.0:0.0	.	614;610;629;683	B7Z3W8;P48067-2;P48067-3;P48067	.;.;.;SC6A9_HUMAN	Q	610;499;683;629	ENSP00000361384:L610Q;ENSP00000434460:L499Q;ENSP00000353791:L683Q;ENSP00000350362:L629Q	ENSP00000350362:L629Q	L	-	2	0	SLC6A9	44235877	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	4.647000	0.61418	2.064000	0.61679	0.496000	0.49642	CTG	SLC6A9	-	NULL	ENSG00000196517		0.677	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	SLC6A9	HGNC	protein_coding	OTTHUMT00000022825.2	65	0.00	0	A	NM_201649		44463290	44463290	-1	no_errors	ENST00000360584	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	1.000	T
SLCO4C1	353189	genome.wustl.edu	37	5	101582963	101582963	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr5:101582963T>C	ENST00000310954.6	-	10	2090	c.1804A>G	c.(1804-1806)Atc>Gtc	p.I602V		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TACCTTAGGATAGACACAGTT	0.373																																						dbGAP											0													71.0	75.0	73.0					5																	101582963		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1804A>G	5.37:g.101582963T>C	ENSP00000309741:p.Ile602Val			Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.I602V	ENST00000310954.6	37	c.1804	CCDS34205.1	5	.	.	.	.	.	.	.	.	.	.	T	10.42	1.344643	0.24426	.	.	ENSG00000173930	ENST00000310954	T	0.80566	-1.39	6.11	4.96	0.65561	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.072930	0.56097	D	0.000035	T	0.70509	0.3232	L	0.35341	1.055	0.32110	N	0.589467	B	0.20671	0.047	B	0.28011	0.085	T	0.68213	-0.5468	10	0.20046	T	0.44	.	10.6001	0.45362	0.0:0.125:0.0:0.875	.	602	Q6ZQN7	SO4C1_HUMAN	V	602	ENSP00000309741:I602V	ENSP00000309741:I602V	I	-	1	0	SLCO4C1	101610862	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	2.649000	0.46656	2.343000	0.79666	0.533000	0.62120	ATC	SLCO4C1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000173930		0.373	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	190	0.00	0	T	NM_180991		101582963	101582963	-1	no_errors	ENST00000310954	ensembl	human	known	69_37n	missense	89	51.61	96	SNP	0.997	C
SMC5	23137	genome.wustl.edu	37	9	72893519	72893519	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:72893519G>C	ENST00000361138.5	+	5	714	c.656G>C	c.(655-657)aGg>aCg	p.R219T		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	219					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						AAAAACTTAAGGGAGAAAGAA	0.368																																						dbGAP											0													84.0	82.0	82.0					9																	72893519		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.656G>C	9.37:g.72893519G>C	ENSP00000354957:p.Arg219Thr		A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC	p.R219T	ENST00000361138.5	37	c.656	CCDS6632.1	9	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336754	0.81801	.	.	ENSG00000198887	ENST00000361138	T	0.80566	-1.39	5.52	5.52	0.82312	RecF/RecN/SMC (1);	0.048144	0.85682	D	0.000000	D	0.88168	0.6364	M	0.78049	2.395	0.80722	D	1	D	0.71674	0.998	D	0.66084	0.941	D	0.85992	0.1489	10	0.29301	T	0.29	-14.2917	15.0333	0.71725	0.0703:0.0:0.9297:0.0	.	219	Q8IY18	SMC5_HUMAN	T	219	ENSP00000354957:R219T	ENSP00000354957:R219T	R	+	2	0	SMC5	72083339	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.526000	0.81920	2.765000	0.95021	0.650000	0.86243	AGG	SMC5	-	pfam_RecF/RecN/SMC	ENSG00000198887		0.368	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	HGNC	protein_coding	OTTHUMT00000052603.1	143	0.00	0	G	NM_015110		72893519	72893519	+1	no_errors	ENST00000361138	ensembl	human	known	69_37n	missense	155	34.04	80	SNP	1.000	C
SNX3	8724	genome.wustl.edu	37	6	108544177	108544177	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:108544177T>G	ENST00000230085.8	-	2	573	c.235A>C	c.(235-237)Agt>Cgt	p.S79R	SNX3_ENST00000349379.5_Missense_Mutation_p.S57R|SNX3_ENST00000368982.4_Missense_Mutation_p.S79R|SNX3_ENST00000426155.2_Intron	NM_003795.4	NP_003786.1	O60493	SNX3_HUMAN	sorting nexin 3	79	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				hemoglobin biosynthetic process (GO:0042541)|intracellular protein transport (GO:0006886)|intralumenal vesicle formation (GO:0070676)|membrane invagination (GO:0010324)|negative regulation of early endosome to late endosome transport (GO:2000642)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein transport (GO:0051224)|negative regulation of viral entry into host cell (GO:0046597)|regulation of cellular protein metabolic process (GO:0032268)|regulation of intracellular protein transport (GO:0033157)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein phosphatase binding (GO:0019903)			large_intestine(1)	1		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)		TCTAATTCACTTCGCAGCCAT	0.303																																						dbGAP											0													91.0	82.0	85.0					6																	108544177		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF034546	CCDS5064.1, CCDS5065.1, CCDS75501.1	6q21	2010-08-05			ENSG00000112335	ENSG00000112335		"""Sorting nexins"""	11174	protein-coding gene	gene with protein product		605930				9819414	Standard	XM_005267192		Approved	Grd19	uc003psh.3	O60493	OTTHUMG00000015323	ENST00000230085.8:c.235A>C	6.37:g.108544177T>G	ENSP00000230085:p.Ser79Arg		A8K0B1|E1P5E4|E1P5E5|O60718|Q4TT29|Q4TT31|Q5JXJ7|Q5JXJ8|Q96AP9|Q9C0J5|Q9NU45	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.S79R	ENST00000230085.8	37	c.235	CCDS5064.1	6	.	.	.	.	.	.	.	.	.	.	T	16.63	3.176729	0.57692	.	.	ENSG00000112335	ENST00000230085;ENST00000349379;ENST00000368982	T;T;T	0.39997	1.05;1.05;1.05	6.08	6.08	0.98989	Phox homologous domain (5);	0.127312	0.64402	D	0.000001	T	0.24236	0.0587	L	0.31578	0.945	0.46609	D	0.999121	B	0.18310	0.027	B	0.28784	0.094	T	0.07986	-1.0744	10	0.54805	T	0.06	-4.9217	16.643	0.85134	0.0:0.0:0.0:1.0	.	79	O60493	SNX3_HUMAN	R	79;57;79	ENSP00000230085:S79R;ENSP00000296991:S57R;ENSP00000357978:S79R	ENSP00000230085:S79R	S	-	1	0	SNX3	108650870	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.064000	0.71169	2.330000	0.79161	0.533000	0.62120	AGT	SNX3	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000112335		0.303	SNX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX3	HGNC	protein_coding	OTTHUMT00000041717.1	66	0.00	0	T			108544177	108544177	-1	no_errors	ENST00000230085	ensembl	human	known	69_37n	missense	91	40.52	62	SNP	1.000	G
SORBS2	8470	genome.wustl.edu	37	4	186578664	186578664	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr4:186578664C>G	ENST00000284776.7	-	6	690	c.181G>C	c.(181-183)Gag>Cag	p.E61Q	SORBS2_ENST00000498125.1_5'Flank|SORBS2_ENST00000437304.2_Missense_Mutation_p.E240Q|SORBS2_ENST00000448662.2_Missense_Mutation_p.E130Q|SORBS2_ENST00000355634.5_Missense_Mutation_p.E161Q|SORBS2_ENST00000431808.1_Missense_Mutation_p.E61Q|SORBS2_ENST00000319471.9_Missense_Mutation_p.E147Q|SORBS2_ENST00000393528.3_Missense_Mutation_p.E107Q|SORBS2_ENST00000418609.1_5'Flank|SORBS2_ENST00000449407.2_Missense_Mutation_p.E147Q	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	61					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		ACTCTCTTCTCTTCCTCTGAG	0.537																																					Esophageal Squamous(153;41 2433 9491 36028)	dbGAP											0													115.0	111.0	112.0					4																	186578664		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.181G>C	4.37:g.186578664C>G	ENSP00000284776:p.Glu61Gln		A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.E61Q	ENST00000284776.7	37	c.181	CCDS3845.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.99|18.99	3.739993|3.739993	0.69304|0.69304	.|.	.|.	ENSG00000154556|ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454;ENST00000445343;ENST00000439914;ENST00000444771;ENST00000430503;ENST00000450341;ENST00000445115|ENST00000438278	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.30182|.	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54|.	4.88|4.88	4.04|4.04	0.47022|0.47022	.|.	0.147585|.	0.64402|.	D|.	0.000012|.	T|T	0.54255|0.54255	0.1847|0.1847	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;P;D;D;D|.	0.89917|.	0.995;0.998;0.999;0.997;0.997;0.997;0.998;0.993;0.94;1.0;0.997;0.995|.	D;D;D;D;D;D;D;D;P;D;D;D|.	0.87578|.	0.934;0.998;0.998;0.988;0.995;0.993;0.993;0.968;0.771;0.997;0.971;0.971|.	T|T	0.50625|0.50625	-0.8806|-0.8806	10|5	0.72032|.	D|.	0.01|.	-27.0443|-27.0443	13.3318|13.3318	0.60492|0.60492	0.0:0.9238:0.0:0.0762|0.0:0.9238:0.0:0.0762	.|.	124;107;130;107;161;61;147;240;130;107;61;107|.	B7Z3D7;G3XAI0;C9JKV9;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2|.	.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.|.	Q|T	61;130;61;240;147;147;161;107;107;61;61;61;107;61;61|4	ENSP00000284776:E61Q;ENSP00000409158:E130Q;ENSP00000411764:E61Q;ENSP00000396008:E240Q;ENSP00000322182:E147Q;ENSP00000397262:E147Q;ENSP00000347852:E161Q;ENSP00000377162:E107Q;ENSP00000321983:E107Q;ENSP00000399048:E61Q;ENSP00000408909:E61Q;ENSP00000410483:E61Q;ENSP00000405349:E107Q;ENSP00000415680:E61Q;ENSP00000397664:E61Q|.	ENSP00000284776:E61Q|.	E|R	-|-	1|2	0|0	SORBS2|SORBS2	186815658|186815658	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.481000|0.481000	0.33189|0.33189	7.085000|7.085000	0.76875|0.76875	1.420000|1.420000	0.47138|0.47138	0.563000|0.563000	0.77884|0.77884	GAG|AGA	SORBS2	-	NULL	ENSG00000154556		0.537	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	47	0.00	0	C	NM_003603		186578664	186578664	-1	no_errors	ENST00000284776	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	G
SPINK5	11005	genome.wustl.edu	37	5	147481391	147481391	+	Silent	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr5:147481391T>C	ENST00000256084.7	+	15	1392	c.1350T>C	c.(1348-1350)ttT>ttC	p.F450F	SPINK5_ENST00000359874.3_Silent_p.F450F|SPINK5_ENST00000398454.1_Silent_p.F450F	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	450	Kazal-like 7. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGGCTTTTTTGCACCAGAG	0.483																																						dbGAP											0													108.0	103.0	104.0					5																	147481391		1886	4111	5997	-	-	-	SO:0001819	synonymous_variant	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1350T>C	5.37:g.147481391T>C			A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Silent	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	p.F450	ENST00000256084.7	37	c.1350	CCDS43382.1	5																																																																																			SPINK5	-	smart_Prot_inh_Kazal	ENSG00000133710		0.483	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	200	0.00	0	T	NM_001127698		147481391	147481391	+1	no_errors	ENST00000359874	ensembl	human	known	69_37n	silent	186	32.85	91	SNP	0.007	C
SPN	6693	genome.wustl.edu	37	16	29675524	29675524	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:29675524G>C	ENST00000360121.3	+	2	567	c.475G>C	c.(475-477)Gag>Cag	p.E159Q	SPN_ENST00000395389.2_Missense_Mutation_p.E159Q	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0					anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						TAGCTCTCTGGAGACCTCCAG	0.567																																						dbGAP											0													82.0	83.0	83.0					16																	29675524		2197	4300	6497	-	-	-	SO:0001583	missense	0			J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.475G>C	16.37:g.29675524G>C	ENSP00000353238:p.Glu159Gln		A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	NULL	p.E159Q	ENST00000360121.3	37	c.475	CCDS10650.1	16	.	.	.	.	.	.	.	.	.	.	.	16.14	3.038464	0.55003	.	.	ENSG00000197471	ENST00000395389;ENST00000436527;ENST00000360121	T;T;T	0.36340	1.27;1.26;1.27	4.88	2.88	0.33553	.	1.629460	0.03573	N	0.228917	T	0.36880	0.0983	L	0.47190	1.495	0.09310	N	1	B	0.29162	0.235	B	0.32342	0.144	T	0.33445	-0.9868	10	0.56958	D	0.05	-1.0181	7.3221	0.26533	0.2138:0.0:0.7862:0.0	.	159	P16150	LEUK_HUMAN	Q	159	ENSP00000378787:E159Q;ENSP00000412907:E159Q;ENSP00000353238:E159Q	ENSP00000353238:E159Q	E	+	1	0	SPN	29583025	0.972000	0.33761	0.019000	0.16419	0.035000	0.12851	2.212000	0.42835	0.713000	0.32060	0.585000	0.79938	GAG	SPN	-	NULL	ENSG00000197471		0.567	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPN	HGNC	protein_coding	OTTHUMT00000215001.2	204	0.00	0	G			29675524	29675524	+1	no_errors	ENST00000360121	ensembl	human	known	69_37n	missense	57	35.96	32	SNP	0.042	C
SPTY2D1	144108	genome.wustl.edu	37	11	18636180	18636180	+	Silent	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr11:18636180G>T	ENST00000336349.5	-	3	1876	c.1641C>A	c.(1639-1641)atC>atA	p.I547I	SPTY2D1_ENST00000543776.1_5'Flank	NM_194285.2	NP_919261.2	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)	547	Ser-rich.									breast(4)|cervix(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|skin(1)|stomach(1)	30						ACCGGCTAATGATATTCTTGG	0.478																																						dbGAP											0													92.0	94.0	93.0					11																	18636180		2199	4293	6492	-	-	-	SO:0001819	synonymous_variant	0			BX647798	CCDS31441.1	11p15.1	2005-10-28			ENSG00000179119	ENSG00000179119			26818	protein-coding gene	gene with protein product							Standard	NM_194285		Approved	FLJ39441, DKFZp686I068	uc001moy.3	Q68D10	OTTHUMG00000167733	ENST00000336349.5:c.1641C>A	11.37:g.18636180G>T			Q6AWA5|Q6MZI5|Q7Z390|Q7Z470|Q86VG8|Q8N3E7|Q8N417|Q8N8I3	Silent	SNP	pfam_Chromatin_SPT2,smart_Chromatin_SPT2	p.I547	ENST00000336349.5	37	c.1641	CCDS31441.1	11																																																																																			SPTY2D1	-	NULL	ENSG00000179119		0.478	SPTY2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTY2D1	HGNC	protein_coding	OTTHUMT00000395941.1	100	0.00	0	G	NM_194285		18636180	18636180	-1	no_errors	ENST00000336349	ensembl	human	known	69_37n	silent	43	52.75	48	SNP	0.430	T
SRRM2	23524	genome.wustl.edu	37	16	2812610	2812610	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:2812610C>G	ENST00000301740.8	+	11	2630	c.2081C>G	c.(2080-2082)tCt>tGt	p.S694C		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	694	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGGTCTCGGTCTAGGACACCA	0.562																																						dbGAP											0													75.0	76.0	76.0					16																	2812610		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2081C>G	16.37:g.2812610C>G	ENSP00000301740:p.Ser694Cys		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.S694C	ENST00000301740.8	37	c.2081	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	9.315	1.056526	0.19907	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.26223	1.75	5.84	5.84	0.93424	.	0.000000	0.56097	D	0.000032	T	0.31979	0.0814	N	0.24115	0.695	0.43598	D	0.995957	D	0.67145	0.996	P	0.54499	0.754	T	0.03384	-1.1042	10	0.72032	D	0.01	-11.4012	17.6372	0.88125	0.0:1.0:0.0:0.0	.	694	Q9UQ35	SRRM2_HUMAN	C	694;694;659	ENSP00000301740:S694C	ENSP00000301740:S694C	S	+	2	0	SRRM2	2752611	1.000000	0.71417	0.994000	0.49952	0.362000	0.29581	3.572000	0.53849	2.769000	0.95229	0.563000	0.77884	TCT	SRRM2	-	NULL	ENSG00000167978		0.562	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	555	0.18	1	C			2812610	2812610	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	missense	213	30.74	95	SNP	1.000	G
SRRM2	23524	genome.wustl.edu	37	16	2816258	2816258	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:2816258G>C	ENST00000301740.8	+	11	6278	c.5729G>C	c.(5728-5730)aGa>aCa	p.R1910T		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1910	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						ACTCGACGAAGATCCCGGTCA	0.577																																						dbGAP											0													93.0	93.0	93.0					16																	2816258		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5729G>C	16.37:g.2816258G>C	ENSP00000301740:p.Arg1910Thr		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R1910T	ENST00000301740.8	37	c.5729	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	5.553	0.286826	0.10513	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.26223	1.75	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000001	T	0.21761	0.0524	N	0.08118	0	0.40120	D	0.97659	P	0.51791	0.948	P	0.50049	0.629	T	0.08700	-1.0709	10	0.33141	T	0.24	-12.7188	16.7947	0.85598	0.0:0.0:1.0:0.0	.	1910	Q9UQ35	SRRM2_HUMAN	T	1910;1910;1162	ENSP00000301740:R1910T	ENSP00000301740:R1910T	R	+	2	0	SRRM2	2756259	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	3.241000	0.51376	2.572000	0.86782	0.650000	0.86243	AGA	SRRM2	-	NULL	ENSG00000167978		0.577	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	274	0.00	0	G			2816258	2816258	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	missense	77	37.40	46	SNP	1.000	C
SRRM2	23524	genome.wustl.edu	37	16	2816377	2816377	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:2816377A>C	ENST00000301740.8	+	11	6397	c.5848A>C	c.(5848-5850)Act>Cct	p.T1950P		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1950	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCGTTCTAGAACTCCACCAGT	0.572																																						dbGAP											0													67.0	70.0	69.0					16																	2816377		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5848A>C	16.37:g.2816377A>C	ENSP00000301740:p.Thr1950Pro		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.T1950P	ENST00000301740.8	37	c.5848	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	A	8.587	0.883736	0.17467	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.28454	1.61	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000007	T	0.31231	0.0790	N	0.08118	0	0.29742	N	0.837051	D	0.69078	0.997	D	0.71414	0.973	T	0.19192	-1.0313	10	0.72032	D	0.01	-16.5652	8.5569	0.33487	0.828:0.0:0.0:0.172	.	1950	Q9UQ35	SRRM2_HUMAN	P	1950;1950;1202	ENSP00000301740:T1950P	ENSP00000301740:T1950P	T	+	1	0	SRRM2	2756378	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.064000	0.49986	1.986000	0.57962	0.528000	0.53228	ACT	SRRM2	-	NULL	ENSG00000167978		0.572	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	286	0.35	1	A			2816377	2816377	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	missense	83	36.15	47	SNP	1.000	C
SSR3	6747	genome.wustl.edu	37	3	156260995	156260995	+	Silent	SNP	T	T	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:156260995T>C	ENST00000265044.2	-	5	649	c.555A>G	c.(553-555)aaA>aaG	p.K185K	SSR3_ENST00000496050.1_Silent_p.K133K|SSR3_ENST00000467789.1_Silent_p.K198K|SSR3_ENST00000476217.1_3'UTR|SSR3_ENST00000463503.1_Silent_p.K133K|SSR3_ENST00000478842.1_5'UTR	NM_007107.3	NP_009038.1	Q9UNL2	SSRG_HUMAN	signal sequence receptor, gamma (translocon-associated protein gamma)	185					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	integral component of endoplasmic reticulum membrane (GO:0030176)|Sec61 translocon complex (GO:0005784)				endometrium(1)|prostate(2)	3			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ACATGGTCTATTTGGAGCCAG	0.448																																						dbGAP											0													75.0	68.0	71.0					3																	156260995		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017203	CCDS3176.1	3q25.31	2004-02-27			ENSG00000114850	ENSG00000114850			11325	protein-coding gene	gene with protein product		606213					Standard	NM_007107		Approved	TRAPG	uc003fau.3	Q9UNL2	OTTHUMG00000158632	ENST00000265044.2:c.555A>G	3.37:g.156260995T>C			B2R7D0|B4E2P2|D3DNK5|Q549M4	Silent	SNP	pfam_TRAP-gamma	p.K185	ENST00000265044.2	37	c.555	CCDS3176.1	3																																																																																			SSR3	-	NULL	ENSG00000114850		0.448	SSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSR3	HGNC	protein_coding	OTTHUMT00000351521.1	112	0.00	0	T	NM_007107		156260995	156260995	-1	no_errors	ENST00000265044	ensembl	human	known	69_37n	silent	56	37.08	33	SNP	1.000	C
STARD3NL	83930	genome.wustl.edu	37	7	38247149	38247149	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:38247149G>C	ENST00000009041.7	+	2	301	c.44G>C	c.(43-45)aGc>aCc	p.S15T	STARD3NL_ENST00000544203.1_Missense_Mutation_p.S8T|STARD3NL_ENST00000396013.1_Missense_Mutation_p.S15T|STARD3NL_ENST00000434197.1_Missense_Mutation_p.S15T	NM_032016.3	NP_114405.1	O95772	MENTO_HUMAN	STARD3 N-terminal like	15						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10						CTCACCGGGAGCCAGAGCTCC	0.512																																						dbGAP											0													96.0	89.0	91.0					7																	38247149		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ492267	CCDS5455.1	7p14-p13	2003-02-06			ENSG00000010270	ENSG00000010270			19169	protein-coding gene	gene with protein product		611759				12393907	Standard	NM_032016		Approved	MENTHO, MGC3251	uc003tfr.3	O95772	OTTHUMG00000023659	ENST00000009041.7:c.44G>C	7.37:g.38247149G>C	ENSP00000009041:p.Ser15Thr		A4D1X0	Missense_Mutation	SNP	pfam_MENTAL	p.S15T	ENST00000009041.7	37	c.44	CCDS5455.1	7	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184850	0.78677	.	.	ENSG00000010270	ENST00000009041;ENST00000544203;ENST00000434197;ENST00000396013;ENST00000440144;ENST00000453225;ENST00000429075	T;T;T;T;T;T;T	0.49432	1.36;1.32;1.38;1.36;0.79;0.79;0.78	6.17	6.17	0.99709	.	0.188673	0.64402	D	0.000003	T	0.55909	0.1950	L	0.27053	0.805	0.40377	D	0.979406	D;D	0.69078	0.997;0.997	D;P	0.73380	0.98;0.906	T	0.57118	-0.7866	10	0.59425	D	0.04	-16.7233	14.4841	0.67603	0.0:0.0:0.853:0.147	.	15;15	C9JKL2;O95772	.;MENTO_HUMAN	T	15;8;15;15;15;15;15	ENSP00000009041:S15T;ENSP00000439436:S8T;ENSP00000394000:S15T;ENSP00000379334:S15T;ENSP00000411933:S15T;ENSP00000395455:S15T;ENSP00000402028:S15T	ENSP00000009041:S15T	S	+	2	0	STARD3NL	38213674	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.875000	0.63072	2.941000	0.99782	0.655000	0.94253	AGC	STARD3NL	-	NULL	ENSG00000010270		0.512	STARD3NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3NL	HGNC	protein_coding	OTTHUMT00000226929.2	148	0.00	0	G			38247149	38247149	+1	no_errors	ENST00000009041	ensembl	human	known	69_37n	missense	120	22.08	34	SNP	1.000	C
SYBU	55638	genome.wustl.edu	37	8	110587199	110587199	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr8:110587199A>C	ENST00000422135.1	-	8	2443	c.1928T>G	c.(1927-1929)cTc>cGc	p.L643R	SYBU_ENST00000533171.1_Missense_Mutation_p.L643R|SYBU_ENST00000399066.3_Missense_Mutation_p.L640R|SYBU_ENST00000528331.1_Missense_Mutation_p.L524R|SYBU_ENST00000533895.1_Missense_Mutation_p.L642R|SYBU_ENST00000408908.2_Missense_Mutation_p.L643R|SYBU_ENST00000529690.1_Missense_Mutation_p.L513R|SYBU_ENST00000446070.2_Missense_Mutation_p.L642R|SYBU_ENST00000528647.1_Missense_Mutation_p.L642R|SYBU_ENST00000440310.1_Missense_Mutation_p.L643R|SYBU_ENST00000533065.1_Missense_Mutation_p.L524R|SYBU_ENST00000419099.1_Missense_Mutation_p.L642R|SYBU_ENST00000527707.1_5'Flank|SYBU_ENST00000408889.3_Missense_Mutation_p.L524R|SYBU_ENST00000532779.1_Missense_Mutation_p.L575R|SYBU_ENST00000424158.2_Missense_Mutation_p.L648R|SYBU_ENST00000433638.1_Missense_Mutation_p.L643R|SYBU_ENST00000529175.1_Missense_Mutation_p.L437R|SYBU_ENST00000276646.9_Missense_Mutation_p.L643R	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	643					regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						ACAGCCCCTGAGCAAGGCCCC	0.577																																						dbGAP											0													82.0	93.0	89.0					8																	110587199		2058	4186	6244	-	-	-	SO:0001583	missense	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.1928T>G	8.37:g.110587199A>C	ENSP00000407118:p.Leu643Arg		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.L643R	ENST00000422135.1	37	c.1928	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	A	17.16	3.318347	0.60524	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000529175;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171	.	.	.	5.7	5.7	0.88788	.	0.165528	0.52532	D	0.000065	T	0.79411	0.4441	M	0.77103	2.36	0.48341	D	0.999637	D;P;D;D;D	0.89917	0.999;0.936;1.0;0.999;0.999	D;P;D;D;D	0.80764	0.976;0.64;0.994;0.976;0.976	T	0.82234	-0.0558	9	0.87932	D	0	-20.3486	15.1577	0.72755	1.0:0.0:0.0:0.0	.	513;575;642;643;640	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	R	642;648;575;640;642;524;437;643;642;643;642;643;643;643;524;524;513;643	.	ENSP00000276646:L643R	L	-	2	0	SYBU	110656375	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	7.218000	0.77991	2.172000	0.68678	0.533000	0.62120	CTC	SYBU	-	NULL	ENSG00000147642		0.577	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	121	0.00	0	A	NM_017786		110587199	110587199	-1	no_errors	ENST00000276646	ensembl	human	known	69_37n	missense	115	23.33	35	SNP	1.000	C
SYT2	127833	genome.wustl.edu	37	1	202571101	202571101	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:202571101C>G	ENST00000367267.1	-	6	910	c.718G>C	c.(718-720)Gag>Cag	p.E240Q	SYT2_ENST00000367268.4_Missense_Mutation_p.E240Q|RP11-569A11.1_ENST00000428573.1_RNA	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	240	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000250}.				neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	ACCTTTACCTCTCCAATGATG	0.542																																						dbGAP											0													185.0	167.0	173.0					1																	202571101		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.718G>C	1.37:g.202571101C>G	ENSP00000356236:p.Glu240Gln		Q496K5|Q8NBE5	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting	p.E240Q	ENST00000367267.1	37	c.718	CCDS1427.1	1	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723456	0.68959	.	.	ENSG00000143858	ENST00000367268;ENST00000367267	T;T	0.70164	-0.46;-0.46	5.45	5.45	0.79879	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.85682	D	0.000000	T	0.57533	0.2060	N	0.17872	0.535	0.80722	D	1	P	0.41131	0.739	B	0.42087	0.375	T	0.56667	-0.7941	10	0.30854	T	0.27	.	18.9002	0.92439	0.0:1.0:0.0:0.0	.	240	Q8N9I0	SYT2_HUMAN	Q	240	ENSP00000356237:E240Q;ENSP00000356236:E240Q	ENSP00000356236:E240Q	E	-	1	0	SYT2	200837724	1.000000	0.71417	0.987000	0.45799	0.957000	0.61999	7.794000	0.85869	2.558000	0.86282	0.563000	0.77884	GAG	SYT2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,pfscan_C2_membr_targeting	ENSG00000143858		0.542	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT2	HGNC	protein_coding	OTTHUMT00000099157.1	254	0.00	0	C	NM_177402		202571101	202571101	-1	no_errors	ENST00000367267	ensembl	human	known	69_37n	missense	225	17.58	48	SNP	1.000	G
TAAR6	319100	genome.wustl.edu	37	6	132891576	132891576	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:132891576T>G	ENST00000275198.1	+	1	116	c.116T>G	c.(115-117)tTt>tGt	p.F39C		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	39					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		TACATAGTGTTTGGCTTTGGG	0.537																																						dbGAP											0													178.0	160.0	166.0					6																	132891576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.116T>G	6.37:g.132891576T>G	ENSP00000275198:p.Phe39Cys		Q5VUQ4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Trace_amine_rcpt	p.F39C	ENST00000275198.1	37	c.116	CCDS5155.1	6	.	.	.	.	.	.	.	.	.	.	T	8.864	0.947555	0.18356	.	.	ENSG00000146383	ENST00000275198;ENST00000539228	T	0.41758	0.99	4.99	4.99	0.66335	.	0.357966	0.22264	N	0.062362	T	0.19604	0.0471	L	0.48260	1.515	0.09310	N	0.999999	B	0.16396	0.017	B	0.23018	0.043	T	0.05767	-1.0865	10	0.34782	T	0.22	-7.7265	11.2034	0.48754	0.0:0.0:0.198:0.802	.	39	Q96RI8	TAAR6_HUMAN	C	39;22	ENSP00000275198:F39C	ENSP00000275198:F39C	F	+	2	0	TAAR6	132933269	0.380000	0.25131	0.011000	0.14972	0.001000	0.01503	3.794000	0.55492	2.081000	0.62600	0.460000	0.39030	TTT	TAAR6	-	prints_7TM_GPCR_Rhodpsn	ENSG00000146383		0.537	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR6	HGNC	protein_coding	OTTHUMT00000042255.1	139	0.00	0	T	NM_175067		132891576	132891576	+1	no_errors	ENST00000275198	ensembl	human	known	69_37n	missense	191	24.61	63	SNP	0.121	G
TARS2	80222	genome.wustl.edu	37	1	150471122	150471122	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:150471122C>G	ENST00000369064.3	+	11	1417	c.1383C>G	c.(1381-1383)atC>atG	p.I461M	TARS2_ENST00000463555.1_3'UTR|TARS2_ENST00000369054.2_Missense_Mutation_p.I331M|TARS2_ENST00000606933.1_Missense_Mutation_p.I379M|TARS2_ENST00000438568.2_3'UTR	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	461					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	ACGCTCACATCTTCTGTACAA	0.542																																						dbGAP											0													56.0	58.0	58.0					1																	150471122		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.1383C>G	1.37:g.150471122C>G	ENSP00000358060:p.Ile461Met		Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-synth_IIa,tigrfam_Thr-tRNA-synth_IIa	p.I461M	ENST00000369064.3	37	c.1383	CCDS952.1	1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912723	0.52439	.	.	ENSG00000143374	ENST00000369054;ENST00000369064;ENST00000369051;ENST00000369052	T;T;T	0.70749	-0.51;-0.51;-0.51	5.3	3.44	0.39384	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.81772	0.4893	H	0.95402	3.665	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.81735	-0.0797	10	0.72032	D	0.01	-10.8536	4.2601	0.10737	0.1596:0.594:0.0:0.2464	.	331;186;461	Q9H9V2;E7EVR9;Q9BW92	.;.;SYTM_HUMAN	M	331;461;186;186	ENSP00000358050:I331M;ENSP00000358060:I461M;ENSP00000358047:I186M	ENSP00000358047:I186M	I	+	3	3	TARS2	148737746	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	0.867000	0.27968	0.811000	0.34303	-0.291000	0.09656	ATC	TARS2	-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-synth_IIa	ENSG00000143374		0.542	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS2	HGNC	protein_coding	OTTHUMT00000035847.1	172	0.00	0	C	NM_025150		150471122	150471122	+1	no_errors	ENST00000369064	ensembl	human	known	69_37n	missense	163	22.64	48	SNP	1.000	G
TAS2R40	259286	genome.wustl.edu	37	7	142919307	142919307	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:142919307G>C	ENST00000408947.3	+	1	178	c.136G>C	c.(136-138)Gag>Cag	p.E46Q	AC073342.1_ENST00000595842.1_Silent_p.L18L	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	46					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					CTATGGGGCTGAGTGGGCCAG	0.517																																						dbGAP											0													91.0	93.0	92.0					7																	142919307		1988	4168	6156	-	-	-	SO:0001583	missense	0			AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.136G>C	7.37:g.142919307G>C	ENSP00000386210:p.Glu46Gln		A4D2I2|Q645W6	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.E46Q	ENST00000408947.3	37	c.136	CCDS43662.1	7	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131769	0.56828	.	.	ENSG00000221937	ENST00000408947	T	0.00912	5.55	5.18	2.02	0.26589	.	1.003210	0.08041	U	0.995156	T	0.04003	0.0112	M	0.86420	2.815	0.09310	N	1	D	0.58268	0.982	P	0.55055	0.767	T	0.35276	-0.9795	10	0.59425	D	0.04	.	5.4103	0.16344	0.2822:0.1473:0.5706:0.0	.	46	P59535	T2R40_HUMAN	Q	46	ENSP00000386210:E46Q	ENSP00000386210:E46Q	E	+	1	0	TAS2R40	142629429	0.000000	0.05858	0.331000	0.25455	0.981000	0.71138	0.073000	0.14640	0.599000	0.29845	-0.345000	0.07892	GAG	TAS2R40	-	pfam_TAS2_rcpt	ENSG00000221937		0.517	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R40	HGNC	protein_coding	OTTHUMT00000327097.1	281	0.00	0	G			142919307	142919307	+1	no_errors	ENST00000408947	ensembl	human	known	69_37n	missense	200	35.48	110	SNP	0.082	C
TCEA3	6920	genome.wustl.edu	37	1	23743853	23743853	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:23743853C>A	ENST00000450454.2	-	4	375	c.269G>T	c.(268-270)gGa>gTa	p.G90V	TCEA3_ENST00000374601.3_Missense_Mutation_p.G90V|TCEA3_ENST00000461794.1_Missense_Mutation_p.G53V	NM_003196.1	NP_003187.1	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	90					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		tctttcctctcctttttctcc	0.488																																						dbGAP											0													108.0	105.0	106.0					1																	23743853		1853	4101	5954	-	-	-	SO:0001583	missense	0			AJ223473	CCDS44086.1	1p36.11	2011-01-25			ENSG00000204219	ENSG00000204219			11615	protein-coding gene	gene with protein product		604128				9790746	Standard	NM_003196		Approved	TFIIS.H	uc021oig.1	O75764	OTTHUMG00000003233	ENST00000450454.2:c.269G>T	1.37:g.23743853C>A	ENSP00000406293:p.Gly90Val		A8K2K7|Q5DR83	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_Znf_TFIIS,pfam_TFIIS_N,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.G90V	ENST00000450454.2	37	c.269	CCDS44086.1	1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.974366	0.34848	.	.	ENSG00000204219	ENST00000450454;ENST00000374601	.	.	.	4.88	2.89	0.33648	Transcription factor IIS, N-terminal (2);	0.646470	0.16535	N	0.210187	T	0.38878	0.1057	L	0.27053	0.805	0.45415	D	0.998396	B;B	0.10296	0.003;0.003	B;B	0.06405	0.002;0.002	T	0.21348	-1.0248	9	0.30078	T	0.28	-15.4051	6.0973	0.20027	0.0:0.708:0.1914:0.1005	.	90;90	A8K2K7;O75764	.;TCEA3_HUMAN	V	90	.	ENSP00000363729:G90V	G	-	2	0	TCEA3	23616440	0.998000	0.40836	1.000000	0.80357	0.769000	0.43574	1.130000	0.31393	1.419000	0.47118	0.655000	0.94253	GGA	TCEA3	-	superfamily_TFIIS_N,pirsf_TF_IIS-rel,tigrfam_TFSII	ENSG00000204219		0.488	TCEA3-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TCEA3	HGNC	protein_coding	OTTHUMT00000008911.2	83	0.00	0	C	NM_003196		23743853	23743853	-1	no_errors	ENST00000450454	ensembl	human	known	69_37n	missense	48	43.02	37	SNP	1.000	A
TCP11L2	255394	genome.wustl.edu	37	12	106704987	106704987	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr12:106704987C>G	ENST00000299045.3	+	2	308	c.134C>G	c.(133-135)tCc>tGc	p.S45C	TCP11L2_ENST00000546625.1_Missense_Mutation_p.S45C|TCP11L2_ENST00000547153.1_Missense_Mutation_p.S45C	NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	45	Ser-rich.									endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						AGTGACTCCTCCAGCAAATCC	0.522																																						dbGAP											0													72.0	69.0	70.0					12																	106704987		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.134C>G	12.37:g.106704987C>G	ENSP00000299045:p.Ser45Cys		B2RA65|G3V1Y9	Missense_Mutation	SNP	pfam_Tcp11	p.S45C	ENST00000299045.3	37	c.134	CCDS9104.1	12	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800768	0.90538	.	.	ENSG00000166046	ENST00000547153;ENST00000299045;ENST00000546625;ENST00000553098;ENST00000551802;ENST00000548428	T;T;T;T;T;T	0.37235	2.02;2.69;2.02;2.04;1.7;1.21	5.91	5.91	0.95273	.	0.050807	0.85682	D	0.000000	T	0.61160	0.2325	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	T	0.55970	-0.8056	9	.	.	.	-2.4279	19.8936	0.96942	0.0:1.0:0.0:0.0	.	45;45;45	Q8N4U5;G3V1Y9;G3V1Z2	T11L2_HUMAN;.;.	C	45	ENSP00000448952:S45C;ENSP00000299045:S45C;ENSP00000449123:S45C;ENSP00000448629:S45C;ENSP00000447174:S45C;ENSP00000447457:S45C	.	S	+	2	0	TCP11L2	105229117	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.980000	0.70516	2.793000	0.96121	0.655000	0.94253	TCC	TCP11L2	-	NULL	ENSG00000166046		0.522	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP11L2	HGNC	protein_coding	OTTHUMT00000407206.1	77	0.00	0	C	NM_152772		106704987	106704987	+1	no_errors	ENST00000299045	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	1.000	G
TERF2IP	54386	genome.wustl.edu	37	16	75690231	75690231	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:75690231C>G	ENST00000300086.4	+	3	1019	c.922C>G	c.(922-924)Caa>Gaa	p.Q308E		NM_018975.3	NP_061848.2	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting protein	308					negative regulation of DNA recombination at telomere (GO:0048239)|negative regulation of telomere maintenance (GO:0032205)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of transcription, DNA-templated (GO:0006355)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear chromosome (GO:0000228)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5						aaaagTTTCTCAACCAGAGGT	0.413																																						dbGAP											0													72.0	73.0	73.0					16																	75690231		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK000669	CCDS32491.1	16q23.1	2012-10-03			ENSG00000166848	ENSG00000166848			19246	protein-coding gene	gene with protein product		605061				10850490	Standard	NM_018975		Approved	RAP1	uc002fet.2	Q9NYB0	OTTHUMG00000177136	ENST00000300086.4:c.922C>G	16.37:g.75690231C>G	ENSP00000300086:p.Gln308Glu		B4DQN4|Q4W4Y2|Q8WYZ3|Q9NWR2	Missense_Mutation	SNP	pfam_Rap1_Myb_dom,superfamily_Homeodomain-like,superfamily_BRCT_dom	p.Q308E	ENST00000300086.4	37	c.922	CCDS32491.1	16	.	.	.	.	.	.	.	.	.	.	C	11.81	1.749682	0.30955	.	.	ENSG00000166848	ENST00000300086	T	0.42131	0.98	5.75	-4.18	0.03846	.	1.036390	0.07575	N	0.919225	T	0.13628	0.0330	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.27971	-1.0058	10	0.02654	T	1	2.5448	0.8538	0.01178	0.2082:0.3397:0.2106:0.2415	.	308	Q9NYB0	TE2IP_HUMAN	E	308	ENSP00000300086:Q308E	ENSP00000300086:Q308E	Q	+	1	0	TERF2IP	74247732	0.001000	0.12720	0.247000	0.24249	0.909000	0.53808	-0.144000	0.10280	-0.572000	0.06006	-0.218000	0.12543	CAA	TERF2IP	-	NULL	ENSG00000166848		0.413	TERF2IP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TERF2IP	HGNC	protein_coding	OTTHUMT00000435519.1	177	0.00	0	C	NM_018975		75690231	75690231	+1	no_errors	ENST00000300086	ensembl	human	putative	69_37n	missense	121	44.75	98	SNP	0.009	G
TFRC	7037	genome.wustl.edu	37	3	195802199	195802199	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:195802199G>A	ENST00000360110.4	-	3	238	c.69C>T	c.(67-69)ttC>ttT	p.F23F	TFRC_ENST00000540528.1_Intron|TFRC_ENST00000535031.1_Intron|TFRC_ENST00000392396.3_Silent_p.F23F|RNU7-18P_ENST00000516365.1_RNA|TFRC_ENST00000420415.1_Intron	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	23	Mediates interaction with SH3BP4.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	GAGCCAGGCTGAACCGGGTAT	0.443			T	BCL6	NHL																																	dbGAP		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	0													162.0	148.0	153.0					3																	195802199		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.69C>T	3.37:g.195802199G>A			D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.F23	ENST00000360110.4	37	c.69	CCDS3312.1	3																																																																																			TFRC	-	NULL	ENSG00000072274		0.443	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFRC	HGNC	protein_coding	OTTHUMT00000341346.1	153	0.00	0	G			195802199	195802199	-1	no_errors	ENST00000360110	ensembl	human	known	69_37n	silent	143	23.12	43	SNP	0.995	A
TIAM2	26230	genome.wustl.edu	37	6	155450749	155450749	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:155450749G>C	ENST00000461783.3	+	6	1665	c.392G>C	c.(391-393)aGa>aCa	p.R131T	TIAM2_ENST00000318981.5_Missense_Mutation_p.R131T|TIAM2_ENST00000456144.1_Missense_Mutation_p.R131T|TIAM2_ENST00000529824.2_Missense_Mutation_p.R131T|TIAM2_ENST00000360366.4_Missense_Mutation_p.R131T|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	131					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ATCACCTCCAGAGACTGCAAC	0.572																																						dbGAP											0													81.0	69.0	73.0					6																	155450749		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.392G>C	6.37:g.155450749G>C	ENSP00000437188:p.Arg131Thr		B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,superfamily_HR1_rho-bd,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.R131T	ENST00000461783.3	37	c.392	CCDS34558.1	6	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409887	0.25465	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000535583;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.05513	3.55;3.43;3.49;3.55;3.55;3.49	5.02	1.14	0.20703	.	0.278303	0.30269	N	0.010016	T	0.02012	0.0063	L	0.57536	1.79	0.09310	N	0.999998	B	0.32245	0.361	B	0.24541	0.054	T	0.39761	-0.9598	10	0.87932	D	0	.	6.0253	0.19652	0.2926:0.1252:0.5822:0.0	.	131	Q8IVF5	TIAM2_HUMAN	T	131;377;131;131;131;131;131;131	ENSP00000437188:R131T;ENSP00000434901:R131T;ENSP00000407746:R131T;ENSP00000327315:R131T;ENSP00000353528:R131T;ENSP00000433348:R131T	ENSP00000327315:R131T	R	+	2	0	TIAM2	155492441	0.066000	0.20996	0.004000	0.12327	0.619000	0.37552	0.306000	0.19279	-0.019000	0.14055	0.462000	0.41574	AGA	TIAM2	-	NULL	ENSG00000146426		0.572	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	HGNC	protein_coding	OTTHUMT00000387980.2	92	0.00	0	G	NM_012454		155450749	155450749	+1	no_errors	ENST00000456144	ensembl	human	known	69_37n	missense	40	56.04	51	SNP	0.001	C
TIMMDC1	51300	genome.wustl.edu	37	3	119232527	119232527	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:119232527G>A	ENST00000494664.1	+	5	759	c.557G>A	c.(556-558)cGt>cAt	p.R186H	TIMMDC1_ENST00000493694.1_Intron	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	186						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						GTAGGCCTGCGTGGCCTGGTG	0.373																																						dbGAP											0													102.0	93.0	96.0					3																	119232527		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.557G>A	3.37:g.119232527G>A	ENSP00000418803:p.Arg186His		D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Missense_Mutation	SNP	pfam_Tim17/Tim22/Tim23/PMP24	p.R186H	ENST00000494664.1	37	c.557	CCDS33831.1	3	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900014	0.33535	.	.	ENSG00000113845	ENST00000494664;ENST00000466984	T;T	0.53206	1.45;0.63	5.36	1.51	0.23008	.	0.667620	0.14734	N	0.301576	T	0.33527	0.0866	L	0.35793	1.09	0.80722	D	1	B	0.19583	0.037	B	0.12837	0.008	T	0.08994	-1.0695	10	0.51188	T	0.08	-0.1912	5.9324	0.19146	0.1228:0.1409:0.7362:0.0	.	186	Q9NPL8	TIDC1_HUMAN	H	186;101	ENSP00000418803:R186H;ENSP00000420122:R101H	ENSP00000420122:R101H	R	+	2	0	TIMMDC1	120715217	0.846000	0.29590	0.984000	0.44739	0.978000	0.69477	0.228000	0.17814	0.090000	0.17273	0.563000	0.77884	CGT	TIMMDC1	-	pfam_Tim17/Tim22/Tim23/PMP24	ENSG00000113845		0.373	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMMDC1	HGNC	protein_coding	OTTHUMT00000355077.3	74	0.00	0	G	NM_016589		119232527	119232527	+1	no_errors	ENST00000494664	ensembl	human	known	69_37n	missense	86	38.13	53	SNP	0.981	A
TLN1	7094	genome.wustl.edu	37	9	35714848	35714848	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr9:35714848G>C	ENST00000314888.9	-	22	3133	c.2780C>G	c.(2779-2781)tCa>tGa	p.S927*	TLN1_ENST00000540444.1_Nonsense_Mutation_p.S927*	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	927					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTGTGTGGCTGAGGCTGCAGC	0.632																																						dbGAP											0													43.0	48.0	46.0					9																	35714848		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.2780C>G	9.37:g.35714848G>C	ENSP00000316029:p.Ser927*		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Nonsense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.S927*	ENST00000314888.9	37	c.2780	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	G	44	10.924008	0.99489	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	.	.	.	5.56	5.56	0.83823	.	0.062093	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-7.0	19.5343	0.95242	0.0:0.0:1.0:0.0	.	.	.	.	X	927	.	ENSP00000316029:S927X	S	-	2	0	TLN1	35704848	1.000000	0.71417	0.985000	0.45067	0.995000	0.86356	7.889000	0.87307	2.601000	0.87937	0.655000	0.94253	TCA	TLN1	-	NULL	ENSG00000137076		0.632	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	124	0.00	0	G	NM_006289		35714848	35714848	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	nonsense	43	43.42	33	SNP	1.000	C
TMCO4	255104	genome.wustl.edu	37	1	20066416	20066416	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr1:20066416G>A	ENST00000294543.6	-	12	1321	c.1080C>T	c.(1078-1080)ctC>ctT	p.L360L	TMCO4_ENST00000375127.1_Silent_p.L360L|TMCO4_ENST00000489814.1_5'Flank|TMCO4_ENST00000375122.2_Silent_p.L320L	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	360						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		TGGCGACACTGAGGAGTGAGG	0.607																																						dbGAP											0													66.0	63.0	64.0					1																	20066416		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.1080C>T	1.37:g.20066416G>A			Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Silent	SNP	pfam_DUF726,pfam_DUF900_hydrolase	p.L360	ENST00000294543.6	37	c.1080	CCDS198.1	1																																																																																			TMCO4	-	pfam_DUF726,pfam_DUF900_hydrolase	ENSG00000162542		0.607	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO4	HGNC	protein_coding	OTTHUMT00000007658.1	33	0.00	0	G	NM_181719		20066416	20066416	-1	no_errors	ENST00000294543	ensembl	human	known	69_37n	silent	14	42.31	11	SNP	0.955	A
TMEM127	55654	genome.wustl.edu	37	2	96919811	96919811	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr2:96919811G>C	ENST00000258439.3	-	4	708	c.452C>G	c.(451-453)tCt>tGt	p.S151C	TMEM127_ENST00000432959.1_Missense_Mutation_p.S151C|TMEM127_ENST00000435268.1_Missense_Mutation_p.S67C	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127	151					negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						GATGAGTTCAGAAGCCCAATA	0.527																																						dbGAP											0													99.0	95.0	96.0					2																	96919811		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454	ENST00000258439.3:c.452C>G	2.37:g.96919811G>C	ENSP00000258439:p.Ser151Cys		D3DXH0	Missense_Mutation	SNP	NULL	p.S151C	ENST00000258439.3	37	c.452	CCDS2018.1	2	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513101	0.85389	.	.	ENSG00000135956	ENST00000258439;ENST00000432959;ENST00000435268	D;D;D	0.96073	-3.9;-3.9;-3.18	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.95928	0.8674	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.96687	0.9508	10	0.87932	D	0	-18.7642	19.0795	0.93177	0.0:0.0:1.0:0.0	.	151	O75204	TM127_HUMAN	C	151;151;67	ENSP00000258439:S151C;ENSP00000416660:S151C;ENSP00000411810:S67C	ENSP00000258439:S151C	S	-	2	0	TMEM127	96283538	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.266000	0.95659	2.795000	0.96236	0.655000	0.94253	TCT	TMEM127	-	NULL	ENSG00000135956		0.527	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM127	HGNC	protein_coding	OTTHUMT00000252845.3	104	0.00	0	G	NM_017849		96919811	96919811	-1	no_errors	ENST00000258439	ensembl	human	known	69_37n	missense	52	35.80	29	SNP	1.000	C
TNFSF10	8743	genome.wustl.edu	37	3	172241142	172241142	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:172241142G>A	ENST00000241261.2	-	1	155	c.33C>T	c.(31-33)agC>agT	p.S11S	TNFSF10_ENST00000420541.2_Silent_p.S11S	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	11					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			TCTGTCCCAGGCTGGGTCCCC	0.552																																						dbGAP											0													112.0	98.0	103.0					3																	172241142		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.33C>T	3.37:g.172241142G>A			A1Y9B3	Silent	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,pirsf_TNF_ligand_10/11,pfscan_TNF	p.S11	ENST00000241261.2	37	c.33	CCDS3219.1	3																																																																																			TNFSF10	-	pirsf_TNF_ligand_10/11	ENSG00000121858		0.552	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF10	HGNC	protein_coding	OTTHUMT00000346601.1	146	0.00	0	G			172241142	172241142	-1	no_errors	ENST00000241261	ensembl	human	known	69_37n	silent	178	28.29	71	SNP	0.000	A
TNXB	7148	genome.wustl.edu	37	6	32021406	32021406	+	Silent	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:32021406C>G	ENST00000375244.3	-	25	8751	c.8550G>C	c.(8548-8550)ctG>ctC	p.L2850L	TNXB_ENST00000375247.2_Silent_p.L2848L			P22105	TENX_HUMAN	tenascin XB	2897	Fibronectin type-III 20. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTGTCACGGTCAGCTCCCCGA	0.632																																						dbGAP											0													76.0	87.0	84.0					6																	32021406		1325	2584	3909	-	-	-	SO:0001819	synonymous_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8550G>C	6.37:g.32021406C>G			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.L2848	ENST00000375244.3	37	c.8544		6																																																																																			TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.632	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	59	0.00	0	C	NM_019105		32021406	32021406	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	silent	4	77.78	14	SNP	0.821	G
TREM2	54209	genome.wustl.edu	37	6	41126463	41126463	+	3'UTR	SNP	G	G	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr6:41126463G>T	ENST00000373113.3	-	0	825				TREM2_ENST00000338469.3_Missense_Mutation_p.P180T|TREM2_ENST00000373122.4_3'UTR	NM_018965.2	NP_061838.1	Q9NZC2	TREM2_HUMAN	triggering receptor expressed on myeloid cells 2						axon guidance (GO:0007411)|dendritic cell differentiation (GO:0097028)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of C-C chemokine receptor CCR7 signaling pathway (GO:1903082)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of CD40 signaling pathway (GO:2000350)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to plasma membrane (GO:1903078)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	11	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGGTCCCTGGTGGGACTTCT	0.582																																						dbGAP											0													102.0	90.0	94.0					6																	41126463		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF213457	CCDS4852.1, CCDS64422.1	6p21.1	2014-09-17	2002-08-15		ENSG00000095970	ENSG00000095970		"""Immunoglobulin superfamily / V-set domain containing"""	17761	protein-coding gene	gene with protein product		605086	"""triggering receptor expressed on myeloid cells 2a"""			10799849, 12080485	Standard	NM_001271821		Approved	TREM-2, Trem2a, Trem2b, Trem2c	uc003opy.3	Q9NZC2	OTTHUMG00000014671	ENST00000373113.3:c.*39C>A	6.37:g.41126463G>T			Q8N5H8|Q8WYN6	Missense_Mutation	SNP	pfam_Ig_V-set	p.P180T	ENST00000373113.3	37	c.538	CCDS4852.1	6	.	.	.	.	.	.	.	.	.	.	G	7.867	0.727326	0.15439	.	.	ENSG00000095970	ENST00000373122	.	.	.	4.16	0.206	0.15208	.	.	.	.	.	T	0.03477	0.0100	.	.	.	0.09310	N	1	B	0.17038	0.02	B	0.21360	0.034	T	0.44221	-0.9342	7	0.05721	T	0.95	.	4.3695	0.11241	0.3545:0.2548:0.3906:0.0	.	180	Q9NZC2-2	.	T	180	.	ENSP00000362214:P180T	P	-	1	0	TREM2	41234441	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.059000	0.11731	0.018000	0.15052	-0.773000	0.03387	CCA	TREM2	-	NULL	ENSG00000095970		0.582	TREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TREM2	HGNC	protein_coding	OTTHUMT00000040499.1	114	0.00	0	G	NM_018965		41126463	41126463	-1	no_errors	ENST00000338469	ensembl	human	known	69_37n	missense	38	63.21	67	SNP	0.000	T
TRIM42	287015	genome.wustl.edu	37	3	140401484	140401484	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:140401484G>C	ENST00000286349.3	+	2	713	c.522G>C	c.(520-522)caG>caC	p.Q174H		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	174						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GGCAGCTGCAGAAGCACGCCG	0.607																																						dbGAP											0													99.0	91.0	94.0					3																	140401484		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.522G>C	3.37:g.140401484G>C	ENSP00000286349:p.Gln174His		A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.Q174H	ENST00000286349.3	37	c.522	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817449	0.50633	.	.	ENSG00000155890	ENST00000286349	T	0.38560	1.13	5.22	-1.19	0.09585	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.116230	0.38959	N	0.001504	T	0.29524	0.0736	L	0.50333	1.59	0.27478	N	0.952669	P	0.38565	0.637	B	0.34093	0.175	T	0.16247	-1.0409	10	0.44086	T	0.13	-5.9574	8.8431	0.35153	0.615:0.0:0.385:0.0	.	174	Q8IWZ5	TRI42_HUMAN	H	174	ENSP00000286349:Q174H	ENSP00000286349:Q174H	Q	+	3	2	TRIM42	141884174	0.354000	0.24912	0.750000	0.31169	0.905000	0.53344	-0.510000	0.06328	-0.320000	0.08640	-0.367000	0.07326	CAG	TRIM42	-	pfscan_Znf_RING	ENSG00000155890		0.607	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	109	0.00	0	G	NM_152616		140401484	140401484	+1	no_errors	ENST00000286349	ensembl	human	known	69_37n	missense	105	27.40	40	SNP	0.570	C
TYK2	7297	genome.wustl.edu	37	19	10475330	10475330	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:10475330G>C	ENST00000525621.1	-	9	1808	c.1327C>G	c.(1327-1329)Ctg>Gtg	p.L443V	TYK2_ENST00000529370.1_Missense_Mutation_p.L443V|TYK2_ENST00000524462.1_Missense_Mutation_p.L258V|TYK2_ENST00000264818.6_Missense_Mutation_p.L443V	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	443					cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CTCATCACCAGCCGTGGGGGA	0.687																																						dbGAP											0													41.0	49.0	47.0					19																	10475330		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.1327C>G	19.37:g.10475330G>C	ENSP00000431885:p.Leu443Val		Q6QB10|Q96CH0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.L443V	ENST00000525621.1	37	c.1327	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	G	5.889	0.348160	0.11126	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.0	1.61	0.23674	.	0.171598	0.25997	N	0.026971	T	0.37945	0.1022	L	0.41632	1.29	0.40146	D	0.976897	P;B	0.39759	0.687;0.089	B;B	0.30316	0.114;0.052	T	0.18304	-1.0341	10	0.13470	T	0.59	-11.5969	3.7189	0.08449	0.288:0.1892:0.5228:0.0	.	443;443	E9PPF2;P29597	.;TYK2_HUMAN	V	258;443;443;190;443	ENSP00000433203:L258V;ENSP00000431885:L443V;ENSP00000264818:L443V;ENSP00000432728:L443V	ENSP00000264818:L443V	L	-	1	2	TYK2	10336330	0.998000	0.40836	1.000000	0.80357	0.980000	0.70556	3.063000	0.49978	0.486000	0.27676	0.471000	0.43371	CTG	TYK2	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2	ENSG00000105397		0.687	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	32	0.00	0	G			10475330	10475330	-1	no_errors	ENST00000264818	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	0.818	C
TSIX	9383	genome.wustl.edu	37	X	73042055	73042055	+	lincRNA	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chrX:73042055G>C	ENST00000604411.1	+	0	30016				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		GGATGGACTAGGAAAATGAAG	0.473																																						dbGAP											0													46.0	42.0	43.0					X																	73042055		876	1991	2867	-	-	-			0					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73042055G>C				RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.473	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	107	0.00	0	G	NR_003255		73042055	73042055	-1	no_errors	ENST00000417942	ensembl	human	known	69_37n	rna	81	31.93	38	SNP	0.001	C
XRN1	54464	genome.wustl.edu	37	3	142139962	142139962	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr3:142139962C>A	ENST00000264951.4	-	10	1186	c.1069G>T	c.(1069-1071)Gac>Tac	p.D357Y	XRN1_ENST00000544157.1_Missense_Mutation_p.D147Y|XRN1_ENST00000463916.1_Missense_Mutation_p.D357Y|XRN1_ENST00000392981.2_Missense_Mutation_p.D357Y|RNU1-100P_ENST00000365255.1_RNA	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	357					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CATTTTAGGTCCACAAAAACT	0.333																																						dbGAP											0													102.0	104.0	104.0					3																	142139962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1069G>T	3.37:g.142139962C>A	ENSP00000264951:p.Asp357Tyr		Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.D357Y	ENST00000264951.4	37	c.1069	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	C	25.8	4.678824	0.88542	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000544157	T;T	0.35236	1.32;1.33	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.69061	0.3069	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.997;0.993;0.995;0.989	T	0.75866	-0.3166	10	0.72032	D	0.01	-17.7827	19.2878	0.94085	0.0:1.0:0.0:0.0	.	147;357;218;357;357	B4E2K3;Q8IZH2-3;B3KW17;Q8IZH2-2;Q8IZH2	.;.;.;.;XRN1_HUMAN	Y	357;357;357;147	ENSP00000264951:D357Y;ENSP00000376707:D357Y	ENSP00000264951:D357Y	D	-	1	0	XRN1	143622652	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.741000	0.84997	2.608000	0.88229	0.585000	0.79938	GAC	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.333	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	82	0.00	0	C	NM_019001		142139962	142139962	-1	no_errors	ENST00000264951	ensembl	human	known	69_37n	missense	175	26.16	62	SNP	1.000	A
YBEY	54059	genome.wustl.edu	37	21	47707027	47707027	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr21:47707027C>T	ENST00000329319.3	+	2	598	c.200C>T	c.(199-201)cCa>cTa	p.P67L	YBEY_ENST00000339195.6_Missense_Mutation_p.P67L|YBEY_ENST00000397691.1_Missense_Mutation_p.P67L|MCM3AP_ENST00000291688.1_5'Flank|YBEY_ENST00000397694.1_Intron|YBEY_ENST00000397692.1_Intron|YBEY_ENST00000397701.4_Missense_Mutation_p.P67L|MCM3AP_ENST00000397708.1_5'Flank	NM_058181.1	NP_478061.1	P58557	YBEY_HUMAN	ybeY metallopeptidase (putative)	67					rRNA processing (GO:0006364)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)	9						CTTTCTTTTCCATTTCATGAG	0.338																																						dbGAP											0													56.0	54.0	54.0					21																	47707027		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK294975	CCDS33591.1	21q22.3	2010-12-08	2010-12-08	2010-12-08	ENSG00000182362	ENSG00000182362			1299	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 57"""	C21orf57			Standard	XM_005261155		Approved		uc002ziv.3	P58557	OTTHUMG00000090632	ENST00000329319.3:c.200C>T	21.37:g.47707027C>T	ENSP00000329614:p.Pro67Leu		B7WPA9|B7WPF7|D3DSN2	Missense_Mutation	SNP	pfam_UPF0054_metalloprotease_prd,tigrfam_UPF0054_metalloprotease_prd	p.P67L	ENST00000329319.3	37	c.200	CCDS33591.1	21	.	.	.	.	.	.	.	.	.	.	C	18.34	3.602162	0.66445	.	.	ENSG00000182362	ENST00000397701;ENST00000329319;ENST00000339195;ENST00000397691	.	.	.	5.35	5.35	0.76521	Metalloprotease catalytic domain, predicted (1);	0.132282	0.51477	D	0.000100	D	0.87204	0.6119	H	0.95043	3.615	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.993	D;D;P	0.71870	0.939;0.975;0.83	D	0.91035	0.4867	9	0.87932	D	0	-31.1729	17.8396	0.88711	0.0:1.0:0.0:0.0	.	67;67;67	P58557-2;P58557;Q8TBC8	.;YBEY_HUMAN;.	L	67	.	ENSP00000329614:P67L	P	+	2	0	YBEY	46531455	1.000000	0.71417	0.080000	0.20451	0.227000	0.25037	6.817000	0.75252	2.488000	0.83962	0.655000	0.94253	CCA	YBEY	-	pfam_UPF0054_metalloprotease_prd,tigrfam_UPF0054_metalloprotease_prd	ENSG00000182362		0.338	YBEY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YBEY	HGNC	protein_coding	OTTHUMT00000207265.1	37	0.00	0	C	NM_058181		47707027	47707027	+1	no_errors	ENST00000329319	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	1.000	T
ZNF141	7700	genome.wustl.edu	37	4	367624	367624	+	Silent	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr4:367624G>C	ENST00000240499.7	+	4	1547	c.1398G>C	c.(1396-1398)ctG>ctC	p.L466L	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	466					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						TCTCACACCTGAATAAACATA	0.328																																						dbGAP											0													55.0	62.0	60.0					4																	367624		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.1398G>C	4.37:g.367624G>C			Q6DK07	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L466	ENST00000240499.7	37	c.1398	CCDS33931.1	4																																																																																			ZNF141	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000131127		0.328	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF141	HGNC	protein_coding	OTTHUMT00000357710.1	235	0.00	0	G	NM_003441		367624	367624	+1	no_errors	ENST00000240499	ensembl	human	known	69_37n	silent	242	12.90	36	SNP	0.006	C
ZNF263	10127	genome.wustl.edu	37	16	3336096	3336096	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:3336096G>C	ENST00000219069.5	+	4	1592	c.716G>C	c.(715-717)aGg>aCg	p.R239T	ZNF263_ENST00000574253.1_Intron|ZNF263_ENST00000538765.1_Intron|ZNF263_ENST00000573578.1_3'UTR	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	239	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						CCTAGTAAGAGGGCCCTCTCC	0.527																																						dbGAP											0													167.0	160.0	162.0					16																	3336096		2197	4300	6497	-	-	-	SO:0001583	missense	0			AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.716G>C	16.37:g.3336096G>C	ENSP00000219069:p.Arg239Thr		B2R634|O43387|Q96H95	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R239T	ENST00000219069.5	37	c.716	CCDS10499.1	16	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882037	0.72294	.	.	ENSG00000006194	ENST00000219069	T	0.03004	4.08	5.54	2.39	0.29439	Krueppel-associated box (4);	0.284298	0.31221	N	0.008036	T	0.08980	0.0222	M	0.91300	3.195	0.80722	D	1	B	0.27882	0.192	B	0.31614	0.133	T	0.01420	-1.1359	10	0.72032	D	0.01	.	6.1347	0.20225	0.3088:0.0:0.6912:0.0	.	239	O14978	ZN263_HUMAN	T	239	ENSP00000219069:R239T	ENSP00000219069:R239T	R	+	2	0	ZNF263	3276097	0.338000	0.24775	0.992000	0.48379	0.999000	0.98932	0.465000	0.22004	0.906000	0.36621	0.655000	0.94253	AGG	ZNF263	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000006194		0.527	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF263	HGNC	protein_coding	OTTHUMT00000251463.2	127	0.00	0	G			3336096	3336096	+1	no_errors	ENST00000219069	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	0.973	C
ZNF19	7567	genome.wustl.edu	37	16	71512160	71512160	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr16:71512160G>A	ENST00000288177.5	-	5	500	c.245C>T	c.(244-246)cCa>cTa	p.P82L	AC010547.9_ENST00000561908.1_Missense_Mutation_p.P82L|ZNF19_ENST00000564230.1_Missense_Mutation_p.P82L|ZNF19_ENST00000567225.1_Missense_Mutation_p.P82L|ZNF19_ENST00000565637.1_Missense_Mutation_p.P40L|ZNF19_ENST00000565100.2_Missense_Mutation_p.P12L	NM_006961.3	NP_008892.2	P17023	ZNF19_HUMAN	zinc finger protein 19	82	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|prostate(1)|stomach(1)	22		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		CCTCTCTGCTGGGGGATCATC	0.468																																						dbGAP											0													85.0	78.0	80.0					16																	71512160		2198	4300	6498	-	-	-	SO:0001583	missense	0			X52343	CCDS10901.1	16q22	2013-01-08	2006-05-10		ENSG00000157429	ENSG00000157429		"""Zinc fingers, C2H2-type"", ""-"""	12981	protein-coding gene	gene with protein product		194525	"""zinc finger protein 19 (KOX 12)"""			1505991, 1946370	Standard	NM_006961		Approved	KOX12, MGC51021	uc002fam.1	P17023	OTTHUMG00000137593	ENST00000288177.5:c.245C>T	16.37:g.71512160G>A	ENSP00000288177:p.Pro82Leu		A8K895|Q86Y66|Q8NDE2|Q96M79|Q96NE5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P82L	ENST00000288177.5	37	c.245	CCDS10901.1	16	.	.	.	.	.	.	.	.	.	.	G	4.755	0.140436	0.09083	.	.	ENSG00000157429	ENST00000288177	T	0.05258	3.47	2.96	-2.87	0.05700	Krueppel-associated box (1);	1.376750	0.05261	N	0.515668	T	0.02342	0.0072	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44283	-0.9338	10	0.15066	T	0.55	.	2.6828	0.05099	0.3317:0.0:0.3222:0.3461	.	82	P17023	ZNF19_HUMAN	L	82	ENSP00000288177:P82L	ENSP00000288177:P82L	P	-	2	0	ZNF19	70069661	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.294000	0.08309	-0.623000	0.05618	-3.052000	0.00069	CCA	ZNF19	-	pfscan_Krueppel-associated_box	ENSG00000157429		0.468	ZNF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF19	HGNC	protein_coding	OTTHUMT00000268993.2	90	0.00	0	G	NM_006961		71512160	71512160	-1	no_errors	ENST00000288177	ensembl	human	known	69_37n	missense	67	26.37	24	SNP	0.000	A
ZNF408	79797	genome.wustl.edu	37	11	46722615	46722615	+	Silent	SNP	G	G	A			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr11:46722615G>A	ENST00000311764.2	+	1	248	c.18G>A	c.(16-18)gaG>gaA	p.E6E	ARHGAP1_ENST00000311956.4_5'Flank	NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	6					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AGGCGGAGGAGCTGCTCTTGG	0.592																																					Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	dbGAP											0													118.0	126.0	124.0					11																	46722615		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.18G>A	11.37:g.46722615G>A				Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E6	ENST00000311764.2	37	c.18	CCDS7923.1	11																																																																																			ZNF408	-	NULL	ENSG00000175213		0.592	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF408	HGNC	protein_coding	OTTHUMT00000390485.2	28	0.00	0	G	NM_024741		46722615	46722615	+1	no_errors	ENST00000311764	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	0.146	A
ZNF440	126070	genome.wustl.edu	37	19	11943461	11943461	+	Silent	SNP	A	A	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:11943461A>G	ENST00000304060.5	+	4	1634	c.1470A>G	c.(1468-1470)caA>caG	p.Q490Q		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						AATGCAAGCAACGTTCAGTAG	0.388																																						dbGAP											0													60.0	66.0	64.0					19																	11943461		2180	4293	6473	-	-	-	SO:0001819	synonymous_variant	0			AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.1470A>G	19.37:g.11943461A>G			Q8N1R9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q490	ENST00000304060.5	37	c.1470	CCDS42503.1	19																																																																																			ZNF440	-	NULL	ENSG00000171295		0.388	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF440	HGNC	protein_coding	OTTHUMT00000344508.1	216	0.92	2	A	NM_152357		11943461	11943461	+1	no_errors	ENST00000304060	ensembl	human	known	69_37n	silent	185	32.97	91	SNP	0.008	G
ZNF625	90589	genome.wustl.edu	37	19	12256910	12256910	+	Silent	SNP	C	C	T			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:12256910C>T	ENST00000355738.1	-	4	472	c.123G>A	c.(121-123)gtG>gtA	p.V41V	ZNF625_ENST00000542938.1_Silent_p.V41V|ZNF625_ENST00000455799.1_3'UTR|ZNF625-ZNF20_ENST00000430024.1_Intron|CTC-359D24.3_ENST00000472362.1_RNA|ZNF625_ENST00000439556.2_Silent_p.V107V			Q96I27	ZN625_HUMAN	zinc finger protein 625	41			V -> M (in dbSNP:rs7258368).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						ATGCATGACCCACGCTGACTT	0.433																																						dbGAP											0													88.0	82.0	84.0					19																	12256910		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000355738.1:c.123G>A	19.37:g.12256910C>T			A4FU45|I3L0E9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V107	ENST00000355738.1	37	c.321		19																																																																																			ZNF625	-	NULL	ENSG00000257591		0.433	ZNF625-201	KNOWN	basic	protein_coding	ZNF625	Clone_based_vega_gene	protein_coding		195	0.00	0	C	NM_145233		12256910	12256910	-1	no_errors	ENST00000439556	ensembl	human	known	69_37n	silent	94	31.88	44	SNP	0.001	T
ZNF845	91664	genome.wustl.edu	37	19	53855591	53855591	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr19:53855591G>C	ENST00000595091.1	+	5	1882	c.1663G>C	c.(1663-1665)Gag>Cag	p.E555Q	ZNF845_ENST00000458035.1_Missense_Mutation_p.E555Q			Q96IR2	ZN845_HUMAN	zinc finger protein 845	555					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						CCAGTGTAATGAGTGTGGCAA	0.413																																						dbGAP											0													68.0	61.0	63.0					19																	53855591		692	1591	2283	-	-	-	SO:0001583	missense	0			BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.1663G>C	19.37:g.53855591G>C	ENSP00000470005:p.Glu555Gln			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E555Q	ENST00000595091.1	37	c.1663	CCDS46170.1	19	.	.	.	.	.	.	.	.	.	.	G	4.746	0.138734	0.09083	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	T	0.18502	2.21	1.94	0.827	0.18835	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10594	0.0259	N	0.16602	0.42	0.09310	N	1	B	0.32409	0.37	B	0.36244	0.22	T	0.35674	-0.9779	9	0.33141	T	0.24	.	7.3082	0.26459	0.1522:0.0:0.8478:0.0	.	555	Q96IR2	ZN845_HUMAN	Q	555	ENSP00000388311:E555Q	ENSP00000412086:E555Q	E	+	1	0	ZNF845	58547403	0.000000	0.05858	0.002000	0.10522	0.082000	0.17680	-0.538000	0.06120	0.144000	0.18951	0.405000	0.27470	GAG	ZNF845	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213799		0.413	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ZNF845	HGNC	protein_coding	OTTHUMT00000464359.1	188	0.00	0	G	XM_039908		53855591	53855591	+1	no_errors	ENST00000458035	ensembl	human	known	69_37n	missense	145	13.17	22	SNP	0.034	C
ZYX	7791	genome.wustl.edu	37	7	143080094	143080094	+	Silent	SNP	C	C	G			TCGA-A8-A08L-01A-11W-A019-09	TCGA-A8-A08L-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8b819a59-f0c1-456a-9e81-64b5bed025c1	3f7a64f1-bed9-4e3f-9109-09c320e2fc96	g.chr7:143080094C>G	ENST00000322764.5	+	5	1047	c.702C>G	c.(700-702)gtC>gtG	p.V234V	AC093673.5_ENST00000429630.1_RNA|ZYX_ENST00000392910.2_Silent_p.V77V|ZYX_ENST00000477373.1_3'UTR|ZYX_ENST00000449423.2_Silent_p.V147V	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin	234					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					agcctcaggtccaactccatg	0.642																																						dbGAP											0													98.0	115.0	109.0					7																	143080094		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.702C>G	7.37:g.143080094C>G			A4D2G6|Q6I9S4	Missense_Mutation	SNP	NULL	p.S51C	ENST00000322764.5	37	c.152	CCDS5883.1	7																																																																																			ZYX	-	NULL	ENSG00000159840		0.642	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYX	HGNC	protein_coding	OTTHUMT00000156296.2	107	0.00	0	C	NM_003461		143080094	143080094	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000436448	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.041	G
