#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48311643	48311643	+	Silent	SNP	T	T	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr7:48311643T>C	ENST00000435803.1	+	17	2404	c.2380T>C	c.(2380-2382)Ttg>Ctg	p.L794L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	794					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCAGAAACTCTTGGAATTTGG	0.373																																						dbGAP											0													41.0	41.0	41.0					7																	48311643		1833	4093	5926	-	-	-	SO:0001819	synonymous_variant	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.2380T>C	7.37:g.48311643T>C			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L794	ENST00000435803.1	37	c.2380	CCDS47584.1	7																																																																																			ABCA13	-	NULL	ENSG00000179869		0.373	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	143	0.00	0	T	NM_152701		48311643	48311643	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	silent	130	17.72	28	SNP	0.123	C
ABCA7	10347	genome.wustl.edu	37	19	1062286	1062286	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr19:1062286G>T	ENST00000263094.6	+	42	5917	c.5686G>T	c.(5686-5688)Ggt>Tgt	p.G1896C	ABCA7_ENST00000433129.1_Missense_Mutation_p.G1896C|ABCA7_ENST00000435683.2_Missense_Mutation_p.G1758C	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1896	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCCTGCGCGGTGTCCCGGA	0.677																																						dbGAP											0													82.0	90.0	87.0					19																	1062286		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5686G>T	19.37:g.1062286G>T	ENSP00000263094:p.Gly1896Cys		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G1896C	ENST00000263094.6	37	c.5686	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816112	0.50527	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.97016	-4.21;-4.21	3.61	2.55	0.30701	ATPase, AAA+ type, core (1);ABC transporter-like (2);	.	.	.	.	D	0.98770	0.9586	H	0.98951	4.38	0.49582	D	0.9998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.989	D	0.98290	1.0513	9	0.87932	D	0	.	11.1274	0.48325	0.0:0.0:0.8143:0.1857	.	1021;1896	D6W5Y0;Q8IZY2	.;ABCA7_HUMAN	C	1896	ENSP00000263094:G1896C;ENSP00000414062:G1896C	ENSP00000263094:G1896C	G	+	1	0	ABCA7	1013286	1.000000	0.71417	0.019000	0.16419	0.327000	0.28475	7.306000	0.78905	0.717000	0.32145	0.555000	0.69702	GGT	ABCA7	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000064687		0.677	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	15	0.00	0	G	NM_019112		1062286	1062286	+1	no_errors	ENST00000263094	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	0.966	T
ABCC12	94160	genome.wustl.edu	37	16	48117854	48117854	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr16:48117854T>A	ENST00000311303.3	-	28	4304	c.3959A>T	c.(3958-3960)aAc>aTc	p.N1320I	ABCC12_ENST00000532355.1_5'Flank|ABCC12_ENST00000448542.1_3'UTR|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	1320	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				GTGATCGCAGTTGAGAACTGT	0.512																																						dbGAP											0													153.0	148.0	150.0					16																	48117854		2201	4300	6501	-	-	-	SO:0001583	missense	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.3959A>T	16.37:g.48117854T>A	ENSP00000311030:p.Asn1320Ile		Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.N1320I	ENST00000311303.3	37	c.3959	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	T	18.10	3.547987	0.65311	.	.	ENSG00000140798	ENST00000311303	T	0.79352	-1.26	5.5	5.5	0.81552	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.180339	0.49916	D	0.000125	T	0.76026	0.3930	L	0.35288	1.05	0.80722	D	1	D	0.54601	0.967	P	0.54460	0.753	T	0.78247	-0.2278	10	0.72032	D	0.01	.	9.1721	0.37089	0.0:0.0824:0.0:0.9176	.	1320	Q96J65	MRP9_HUMAN	I	1320	ENSP00000311030:N1320I	ENSP00000311030:N1320I	N	-	2	0	ABCC12	46675355	0.999000	0.42202	1.000000	0.80357	0.578000	0.36192	2.527000	0.45615	2.066000	0.61787	0.533000	0.62120	AAC	ABCC12	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000140798		0.512	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	192	0.00	0	T	NM_033226		48117854	48117854	-1	no_errors	ENST00000311303	ensembl	human	known	69_37n	missense	223	15.53	41	SNP	1.000	A
ANKRD12	23253	genome.wustl.edu	37	18	9258366	9258369	+	Frame_Shift_Del	DEL	CAGT	CAGT	-			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	CAGT	CAGT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr18:9258366_9258369delCAGT	ENST00000262126.4	+	9	5341_5344	c.5101_5104delCAGT	c.(5101-5106)cagtcafs	p.QS1701fs	ANKRD12_ENST00000383440.2_Frame_Shift_Del_p.QS1678fs|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000400020.3_Frame_Shift_Del_p.QS1678fs	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1701						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CCATTCACAGCAGTCAACTCAACC	0.343																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.5101_5104delCAGT	18.37:g.9258366_9258369delCAGT	ENSP00000262126:p.Gln1701fs		O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S1702fs	ENST00000262126.4	37	c.5101_5104	CCDS11843.1	18																																																																																			ANKRD12	-	NULL	ENSG00000101745		0.343	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	208	0.00	0	CAGT	NM_015208		9258366	9258369	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	frame_shift_del	182	21.89	51	DEL	0.170:0.111:0.004:0.001	-
ANKRD28	23243	genome.wustl.edu	37	3	15765918	15765918	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr3:15765918C>G	ENST00000399451.2	-	7	1031	c.664G>C	c.(664-666)Gtc>Ctc	p.V222L	ANKRD28_ENST00000497037.1_5'UTR|ANKRD28_ENST00000383777.1_Missense_Mutation_p.V255L	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	222						nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						AGGTACTTGACTACGCTGATC	0.363																																						dbGAP											0													55.0	52.0	53.0					3																	15765918		1939	4130	6069	-	-	-	SO:0001583	missense	0			AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.664G>C	3.37:g.15765918C>G	ENSP00000382379:p.Val222Leu		B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V255L	ENST00000399451.2	37	c.763	CCDS46769.1	3	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719645	0.68844	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	T;T;T	0.70282	-0.47;-0.47;-0.47	5.68	5.68	0.88126	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.66982	0.2845	L	0.54908	1.71	0.58432	D	0.999999	B;B;B	0.24576	0.074;0.106;0.005	B;B;B	0.26202	0.029;0.067;0.016	T	0.65537	-0.6144	10	0.56958	D	0.05	.	13.0546	0.58973	0.0:0.9267:0.0:0.0733	.	255;252;222	O15084-1;O15084-4;O15084	.;.;ANR28_HUMAN	L	222;255;222	ENSP00000382379:V222L;ENSP00000373287:V255L;ENSP00000397341:V222L	ENSP00000373287:V255L	V	-	1	0	ANKRD28	15740922	1.000000	0.71417	0.985000	0.45067	0.995000	0.86356	6.051000	0.71072	2.678000	0.91216	0.650000	0.86243	GTC	ANKRD28	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000206560		0.363	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ANKRD28	HGNC	protein_coding	OTTHUMT00000339758.1	48	0.00	0	C	NM_015199		15765918	15765918	-1	no_errors	ENST00000383777	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	G
APLP1	333	genome.wustl.edu	37	19	36369538	36369538	+	Silent	SNP	G	G	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr19:36369538G>T	ENST00000221891.4	+	14	1824	c.1632G>T	c.(1630-1632)ctG>ctT	p.L544L	APLP1_ENST00000586861.1_Silent_p.L537L|APLP1_ENST00000537454.2_Silent_p.L504L	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	543					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGAACCCGCTGGAACAGTATG	0.493																																						dbGAP											0													70.0	64.0	66.0					19																	36369538		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1632G>T	19.37:g.36369538G>T			O00113|Q96A92	Silent	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,smart_Amyloid_glyco_extra,prints_Amyloid_glyco	p.L544	ENST00000221891.4	37	c.1632	CCDS32997.1	19																																																																																			APLP1	-	NULL	ENSG00000105290		0.493	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	APLP1	HGNC	protein_coding	OTTHUMT00000452564.1	76	0.00	0	G	NM_001024807		36369538	36369538	+1	no_errors	ENST00000221891	ensembl	human	known	69_37n	silent	54	14.29	9	SNP	0.984	T
ATP1B4	23439	genome.wustl.edu	37	X	119509272	119509272	+	Missense_Mutation	SNP	C	C	A	rs150466232		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chrX:119509272C>A	ENST00000218008.3	+	5	665	c.608C>A	c.(607-609)cCg>cAg	p.P203Q	ATP1B4_ENST00000361319.3_Missense_Mutation_p.P199Q|ATP1B4_ENST00000539306.1_Missense_Mutation_p.P160Q	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	203					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						GATTGTCCCCCGGGGCAGTAC	0.483																																						dbGAP											0													121.0	111.0	114.0					X																	119509272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.608C>A	X.37:g.119509272C>A	ENSP00000218008:p.Pro203Gln		Q17RR0|Q9UN41	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	p.P203Q	ENST00000218008.3	37	c.608	CCDS48158.1	X	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465113	0.43839	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.35973	1.28;1.28;1.28	5.49	4.58	0.56647	.	0.360117	0.33477	N	0.004867	T	0.37461	0.1004	L	0.42008	1.315	0.23232	N	0.998074	P;P;P;P	0.46064	0.872;0.791;0.771;0.729	P;P;B;B	0.47603	0.551;0.527;0.397;0.276	T	0.19128	-1.0315	10	0.30078	T	0.28	-6.0432	13.8426	0.63449	0.0:0.8505:0.1495:0.0	.	160;168;203;199	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	Q	203;199;160	ENSP00000218008:P203Q;ENSP00000355346:P199Q;ENSP00000443334:P160Q	ENSP00000218008:P203Q	P	+	2	0	ATP1B4	119393300	0.157000	0.22836	0.664000	0.29753	0.764000	0.43329	3.507000	0.53371	2.297000	0.77311	0.600000	0.82982	CCG	ATP1B4	-	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	ENSG00000101892		0.483	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP1B4	HGNC	protein_coding	OTTHUMT00000058095.1	219	0.00	0	C	NM_001142447		119509272	119509272	+1	no_errors	ENST00000218008	ensembl	human	known	69_37n	missense	269	15.41	49	SNP	0.239	A
BMPER	168667	genome.wustl.edu	37	7	34091485	34091485	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr7:34091485T>C	ENST00000297161.2	+	9	1063	c.689T>C	c.(688-690)gTg>gCg	p.V230A	BMPER_ENST00000426693.1_Missense_Mutation_p.V230A|BMPER_ENST00000494786.1_3'UTR	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	230					blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CAGAGGAAAGTGTTTGACCTC	0.443																																						dbGAP											0													185.0	159.0	168.0					7																	34091485		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.689T>C	7.37:g.34091485T>C	ENSP00000297161:p.Val230Ala		A8K1P8|Q8TF36	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_VWF_C,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_C,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,pfscan_VWF_C	p.V230A	ENST00000297161.2	37	c.689	CCDS5442.1	7	.	.	.	.	.	.	.	.	.	.	T	24.6	4.551428	0.86127	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.19669	2.13;2.13	5.44	5.44	0.79542	.	0.060106	0.64402	D	0.000003	T	0.27900	0.0687	L	0.60455	1.87	0.58432	D	0.999998	P	0.49447	0.924	P	0.46796	0.527	T	0.03335	-1.1047	10	0.17832	T	0.49	.	15.804	0.78477	0.0:0.0:0.0:1.0	.	230	Q8N8U9	BMPER_HUMAN	A	230	ENSP00000297161:V230A;ENSP00000393950:V230A	ENSP00000297161:V230A	V	+	2	0	BMPER	34058010	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.206000	0.77891	2.193000	0.70182	0.533000	0.62120	GTG	BMPER	-	NULL	ENSG00000164619		0.443	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPER	HGNC	protein_coding	OTTHUMT00000250570.2	163	0.00	0	T	NM_133468		34091485	34091485	+1	no_errors	ENST00000297161	ensembl	human	known	69_37n	missense	98	19.01	23	SNP	1.000	C
BRWD1	54014	genome.wustl.edu	37	21	40569039	40569039	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr21:40569039C>G	ENST00000333229.2	-	41	6283	c.5956G>C	c.(5956-5958)Gaa>Caa	p.E1986Q	BRWD1_ENST00000342449.3_Missense_Mutation_p.E1986Q|BRWD1_ENST00000380800.3_Missense_Mutation_p.E1986Q	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1986					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTTGGTACTTCACAATGTACA	0.428																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													182.0	158.0	166.0					21																	40569039		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5956G>C	21.37:g.40569039C>G	ENSP00000330753:p.Glu1986Gln		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1986Q	ENST00000333229.2	37	c.5956	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	10.07	1.250815	0.22880	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.61392	0.11;0.18;0.26	4.83	3.95	0.45737	.	0.349470	0.25774	N	0.028383	T	0.56804	0.2010	M	0.73217	2.22	0.80722	D	1	B;P	0.38195	0.403;0.622	B;B	0.36666	0.118;0.23	T	0.61422	-0.7066	10	0.59425	D	0.04	-4.0178	13.2404	0.59994	0.0:0.9226:0.0:0.0774	.	1986;1986	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	Q	1986	ENSP00000330753:E1986Q;ENSP00000344333:E1986Q;ENSP00000370178:E1986Q	ENSP00000330753:E1986Q	E	-	1	0	BRWD1	39490909	0.929000	0.31497	0.887000	0.34795	0.033000	0.12548	2.452000	0.44961	1.020000	0.39573	-0.137000	0.14449	GAA	BRWD1	-	NULL	ENSG00000185658		0.428	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	244	0.00	0	C	NM_033656		40569039	40569039	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	missense	166	38.38	104	SNP	0.991	G
CCDC7	79741	genome.wustl.edu	37	10	33165292	33165292	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr10:33165292C>T	ENST00000375030.2	+	23	2353	c.1735C>T	c.(1735-1737)Cga>Tga	p.R579*	C10orf68_ENST00000375028.3_Nonsense_Mutation_p.R624*|C10orf68_ENST00000375025.4_Nonsense_Mutation_p.R684*			Q9H943	CJ068_HUMAN		620										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						TGCTGCTGCCCGAAAATCTGT	0.308																																						dbGAP											0													77.0	76.0	76.0					10																	33165292		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0																														ENST00000375030.2:c.1735C>T	10.37:g.33165292C>T	ENSP00000364170:p.Arg579*		B0QZ71|Q08AN7|Q8N7T7	Nonsense_Mutation	SNP	NULL	p.R684*	ENST00000375030.2	37	c.2050		10	.	.	.	.	.	.	.	.	.	.	.	13.07	2.126430	0.37533	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	.	.	.	4.14	-4.13	0.03904	.	.	.	.	.	.	.	.	.	.	.	0.23449	N	0.99765	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.3173	0.15862	0.0:0.2193:0.2855:0.4953	.	.	.	.	X	620;579;624;684;596	.	ENSP00000303710:R620X	R	+	1	2	C10orf68	33205298	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.367000	0.07553	-0.842000	0.04195	-0.878000	0.02970	CGA	C10orf68	-	NULL	ENSG00000150076		0.308	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	130	0.00	0	C			33165292	33165292	+1	no_errors	ENST00000375025	ensembl	human	known	69_37n	nonsense	171	12.76	25	SNP	0.000	T
ERICH3	127254	genome.wustl.edu	37	1	75037981	75037981	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:75037981G>A	ENST00000326665.5	-	14	3631	c.3413C>T	c.(3412-3414)tCt>tTt	p.S1138F	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1138	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TGGATTGTCAGACAACTCAGA	0.453																																						dbGAP											0													63.0	69.0	67.0					1																	75037981		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000326665.5:c.3413C>T	1.37:g.75037981G>A	ENSP00000322609:p.Ser1138Phe		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.S1138F	ENST00000326665.5	37	c.3413	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909482	0.33721	.	.	ENSG00000178965	ENST00000326665	T	0.12361	2.69	4.61	-3.01	0.05463	.	.	.	.	.	T	0.02156	0.0067	N	0.22421	0.69	0.09310	N	1	B	0.29508	0.246	B	0.29353	0.101	T	0.44590	-0.9318	9	0.59425	D	0.04	-0.0469	1.6823	0.02834	0.3822:0.1378:0.3487:0.1313	.	1138	Q5RHP9	CA173_HUMAN	F	1138	ENSP00000322609:S1138F	ENSP00000322609:S1138F	S	-	2	0	C1orf173	74810569	0.000000	0.05858	0.000000	0.03702	0.200000	0.23975	-0.829000	0.04415	-0.344000	0.08338	0.561000	0.74099	TCT	C1orf173	-	NULL	ENSG00000178965		0.453	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	507	0.00	0	G			75037981	75037981	-1	no_errors	ENST00000326665	ensembl	human	known	69_37n	missense	363	38.89	231	SNP	0.000	A
DRICH1	51233	genome.wustl.edu	37	22	23964316	23964316	+	Missense_Mutation	SNP	C	C	A	rs148052602		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr22:23964316C>A	ENST00000317749.5	-	4	643	c.346G>T	c.(346-348)Gat>Tat	p.D116Y		NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		116	Asp-rich.							p.D116N(1)		endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						cagtcatcatcttcaCTTCGT	0.433																																						dbGAP											1	Substitution - Missense(1)	skin(1)											103.0	91.0	95.0					22																	23964316		1987	4163	6150	-	-	-	SO:0001583	missense	0																														ENST00000317749.5:c.346G>T	22.37:g.23964316C>A	ENSP00000316137:p.Asp116Tyr		Q6ICJ8|Q6P4I3|Q9NU31	Missense_Mutation	SNP	NULL	p.D116Y	ENST00000317749.5	37	c.346	CCDS42985.1	22	.	.	.	.	.	.	.	.	.	.	c	8.863	0.947416	0.18356	.	.	ENSG00000189269	ENST00000317749	T	0.40756	1.02	0.333	0.333	0.15943	.	.	.	.	.	T	0.38374	0.1038	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.72982	0.979	T	0.25676	-1.0125	8	0.59425	D	0.04	.	.	.	.	.	116	Q6PGQ1	CV043_HUMAN	Y	116	ENSP00000316137:D116Y	ENSP00000316137:D116Y	D	-	1	0	C22orf43	22294316	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	0.212000	0.17497	0.385000	0.24970	0.390000	0.25778	GAT	C22orf43	-	NULL	ENSG00000189269		0.433	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf43	HGNC	protein_coding	OTTHUMT00000319708.2	120	0.00	0	C			23964316	23964316	-1	no_errors	ENST00000317749	ensembl	human	known	69_37n	missense	321	12.30	45	SNP	0.008	A
C4orf22	255119	genome.wustl.edu	37	4	81884720	81884720	+	Missense_Mutation	SNP	A	A	G	rs528646259		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr4:81884720A>G	ENST00000358105.3	+	6	705	c.656A>G	c.(655-657)tAc>tGc	p.Y219C	C4orf22_ENST00000508675.1_Missense_Mutation_p.Y236C	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22	219										NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						ACAGAACTCTACGTACAAGCT	0.338													A|||	1	0.000199681	0.0008	0.0	5008	,	,		14530	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													70.0	69.0	69.0					4																	81884720		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.656A>G	4.37:g.81884720A>G	ENSP00000350818:p.Tyr219Cys		E7EQ13|Q6ZQY4|Q8N4G9	Missense_Mutation	SNP	NULL	p.Y236C	ENST00000358105.3	37	c.707	CCDS3587.1	4	.	.	.	.	.	.	.	.	.	.	A	13.61	2.288806	0.40494	.	.	ENSG00000197826	ENST00000358105;ENST00000508675	T;T	0.54279	0.58;0.58	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000002	T	0.76962	0.4061	M	0.91818	3.245	0.41817	D	0.990002	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.82458	-0.0447	10	0.87932	D	0	.	12.0322	0.53403	1.0:0.0:0.0:0.0	.	236;219	E7EQ13;Q6V702	.;CD022_HUMAN	C	219;236	ENSP00000350818:Y219C;ENSP00000425786:Y236C	ENSP00000350818:Y219C	Y	+	2	0	C4orf22	82103744	1.000000	0.71417	0.998000	0.56505	0.064000	0.16182	5.332000	0.65911	2.100000	0.63781	0.460000	0.39030	TAC	C4orf22	-	NULL	ENSG00000197826		0.338	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf22	HGNC	protein_coding	OTTHUMT00000252629.2	207	0.00	0	A	NM_152770		81884720	81884720	+1	no_errors	ENST00000508675	ensembl	human	known	69_37n	missense	181	18.47	41	SNP	1.000	G
CACNA1E	777	genome.wustl.edu	37	1	181480573	181480573	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:181480573G>T	ENST00000367573.2	+	3	439	c.439G>T	c.(439-441)Ggg>Tgg	p.G147W	CACNA1E_ENST00000526775.1_Missense_Mutation_p.G147W|CACNA1E_ENST00000358338.5_Missense_Mutation_p.G98W|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000367570.1_Missense_Mutation_p.G147W|CACNA1E_ENST00000357570.5_Missense_Mutation_p.G98W|CACNA1E_ENST00000360108.3_Missense_Mutation_p.G147W	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	147					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TGTGGCCCTGGGGTTCATCTT	0.483																																						dbGAP											0													235.0	226.0	229.0					1																	181480573		1917	4138	6055	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.439G>T	1.37:g.181480573G>T	ENSP00000356545:p.Gly147Trp		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.G147W	ENST00000367573.2	37	c.439	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711556	0.89112	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97994	-4.65;-4.65;-4.65;-4.65;-4.65;-4.65;-4.65	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.99468	0.9811	H	0.99815	4.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97796	1.0241	10	0.87932	D	0	.	18.7453	0.91789	0.0:0.0:1.0:0.0	.	147;147	Q15878-2;Q15878-3	.;.	W	147;147;147;98;98;147;147	ENSP00000432038:G147W;ENSP00000356542:G147W;ENSP00000434814:G147W;ENSP00000350183:G98W;ENSP00000351101:G98W;ENSP00000353222:G147W;ENSP00000356545:G147W	ENSP00000350183:G98W	G	+	1	0	CACNA1E	179747196	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.731000	0.98807	2.528000	0.85240	0.561000	0.74099	GGG	CACNA1E	-	pfam_Ion_trans_dom	ENSG00000198216		0.483	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	364	0.00	0	G	NM_000721		181480573	181480573	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	644	10.80	78	SNP	1.000	T
CACNG1	786	genome.wustl.edu	37	17	65052324	65052324	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr17:65052324C>A	ENST00000226021.3	+	4	677	c.606C>A	c.(604-606)ttC>ttA	p.F202L		NM_000727.3	NP_000718.1	Q06432	CCG1_HUMAN	calcium channel, voltage-dependent, gamma subunit 1	202					muscle contraction (GO:0006936)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transport (GO:0006810)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)	8	all_cancers(12;1.04e-10)|Breast(2;1.45e-16)|all_epithelial(3;4.81e-12)				Diltiazem(DB00343)|Fluspirilene(DB04842)|Ibutilide(DB00308)|Lercanidipine(DB00528)|Magnesium Sulfate(DB00653)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TCCTGCTGTTCTCCCTGCCTC	0.622																																						dbGAP											0													153.0	119.0	130.0					17																	65052324		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07738	CCDS11668.1	17q24	2008-05-02				ENSG00000108878		"""Calcium channel subunits"""	1405	protein-coding gene	gene with protein product		114209		CACNLG		8395940	Standard	NM_000727		Approved		uc002jfu.3	Q06432		ENST00000226021.3:c.606C>A	17.37:g.65052324C>A	ENSP00000226021:p.Phe202Leu		B2R9N3|Q14D59	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_g1su,prints_VDCC_gsu	p.F202L	ENST00000226021.3	37	c.606	CCDS11668.1	17	.	.	.	.	.	.	.	.	.	.	C	7.472	0.646823	0.14516	.	.	ENSG00000108878	ENST00000226021	T	0.38401	1.14	5.0	4.01	0.46588	.	0.298969	0.32444	N	0.006081	T	0.10252	0.0251	N	0.00554	-1.385	0.42359	D	0.992403	B	0.02656	0.0	B	0.04013	0.001	T	0.30794	-0.9966	10	0.02654	T	1	.	14.0833	0.64939	0.1517:0.8483:0.0:0.0	.	202	Q06432	CCG1_HUMAN	L	202	ENSP00000226021:F202L	ENSP00000226021:F202L	F	+	3	2	CACNG1	62482786	1.000000	0.71417	0.939000	0.37840	0.711000	0.40976	3.761000	0.55242	1.205000	0.43262	0.462000	0.41574	TTC	CACNG1	-	prints_VDCC_g1su	ENSG00000108878		0.622	CACNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG1	HGNC	protein_coding	OTTHUMT00000447039.1	67	0.00	0	C			65052324	65052324	+1	no_errors	ENST00000226021	ensembl	human	known	69_37n	missense	52	15.62	10	SNP	1.000	A
CFAP36	112942	genome.wustl.edu	37	2	55746978	55746978	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr2:55746978A>G	ENST00000349456.4	+	1	189	c.41A>G	c.(40-42)gAg>gGg	p.E14G	CCDC104_ENST00000403007.3_Missense_Mutation_p.E14G|CCDC104_ENST00000407816.3_Missense_Mutation_p.E14G|CCDC104_ENST00000339012.3_Missense_Mutation_p.E14G|CCDC104_ENST00000406691.3_Missense_Mutation_p.E14G			Q96G28	CFA36_HUMAN		14										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGGGTAGTGGAGAGCATCGCG	0.602																																						dbGAP											0													95.0	101.0	99.0					2																	55746978		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000349456.4:c.41A>G	2.37:g.55746978A>G	ENSP00000295117:p.Glu14Gly		Q53SF0|Q53ST9|Q6UY34	Missense_Mutation	SNP	pfam_ARF-like_2-bdp_dom	p.E14G	ENST00000349456.4	37	c.41	CCDS1854.2	2	.	.	.	.	.	.	.	.	.	.	A	24.6	4.547415	0.86022	.	.	ENSG00000163001	ENST00000339012;ENST00000406691;ENST00000349456;ENST00000407816;ENST00000403007	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	5.76	5.76	0.90799	ADP-ribosylation factor-like 2-binding protein, domain (2);	0.143616	0.64402	D	0.000006	T	0.67878	0.2940	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70935	0.971;0.951	T	0.71303	-0.4633	10	0.72032	D	0.01	.	16.0784	0.80982	1.0:0.0:0.0:0.0	.	14;14	Q96G28;Q96G28-2	CC104_HUMAN;.	G	14	ENSP00000342699:E14G;ENSP00000385400:E14G;ENSP00000295117:E14G;ENSP00000385376:E14G;ENSP00000385972:E14G	ENSP00000342699:E14G	E	+	2	0	CCDC104	55600482	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.421000	0.66447	2.208000	0.71279	0.496000	0.49642	GAG	CCDC104	-	pfam_ARF-like_2-bdp_dom	ENSG00000163001		0.602	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC104	HGNC	protein_coding	OTTHUMT00000319610.2	28	0.00	0	A			55746978	55746978	+1	no_errors	ENST00000339012	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	1.000	G
CCDC171	203238	genome.wustl.edu	37	9	15623373	15623373	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr9:15623373A>C	ENST00000380701.3	+	7	1112	c.784A>C	c.(784-786)Agc>Cgc	p.S262R	CCDC171_ENST00000535968.1_Missense_Mutation_p.S262R|CCDC171_ENST00000297641.3_Missense_Mutation_p.S262R	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	262	Glu-rich.																ACTTGAATTTAGCACTCAACG	0.378																																						dbGAP											0													151.0	156.0	154.0					9																	15623373		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.784A>C	9.37:g.15623373A>C	ENSP00000370077:p.Ser262Arg		B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	superfamily_STAT_TF_coiled-coil	p.S262R	ENST00000380701.3	37	c.784	CCDS6481.1	9	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019169	0.75275	.	.	ENSG00000164989	ENST00000535968;ENST00000297641;ENST00000380701	T;T;T	0.35421	1.31;2.28;2.28	5.41	5.41	0.78517	.	0.091748	0.64402	D	0.000001	T	0.45975	0.1369	L	0.32530	0.975	0.36462	D	0.866758	P;P;P;D	0.76494	0.899;0.899;0.899;0.999	P;P;P;D	0.72075	0.571;0.571;0.571;0.976	T	0.47497	-0.9113	10	0.23302	T	0.38	-8.7512	13.2407	0.59995	1.0:0.0:0.0:0.0	.	262;262;262;262	B7ZM22;Q6TFL3-3;Q6TFL3;Q7Z3F8	.;.;CI093_HUMAN;.	R	262	ENSP00000438838:S262R;ENSP00000297641:S262R;ENSP00000370077:S262R	ENSP00000297641:S262R	S	+	1	0	C9orf93	15613373	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.038000	0.64177	2.175000	0.68902	0.460000	0.39030	AGC	CCDC171	-	NULL	ENSG00000164989		0.378	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4	365	0.00	0	A	NM_173550		15623373	15623373	+1	no_errors	ENST00000380701	ensembl	human	known	69_37n	missense	387	12.05	53	SNP	1.000	C
CD97	976	genome.wustl.edu	37	19	14513412	14513412	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr19:14513412C>G	ENST00000242786.5	+	12	1267	c.1187C>G	c.(1186-1188)cCc>cGc	p.P396R	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000358600.3_Missense_Mutation_p.P303R|CD97_ENST00000357355.3_Missense_Mutation_p.P347R	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	396					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TCCCCAGGCCCCGCCGTGGCG	0.592																																						dbGAP											0													81.0	82.0	82.0					19																	14513412		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1187C>G	19.37:g.14513412C>G	ENSP00000242786:p.Pro396Arg		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_secretin-like,prints_GPCR_2_EMR1_rcpt	p.P396R	ENST00000242786.5	37	c.1187	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	C	13.23	2.173662	0.38413	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.70869	-0.52;-0.44;-0.07	5.25	-9.02	0.00741	.	.	.	.	.	T	0.63058	0.2479	M	0.77103	2.36	0.09310	N	1	B;B;B	0.20164	0.035;0.035;0.042	B;B;B	0.28709	0.093;0.093;0.058	T	0.58358	-0.7650	9	0.41790	T	0.15	.	4.7061	0.12849	0.5239:0.1969:0.2069:0.0723	.	303;347;396	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	R	396;347;303;346	ENSP00000242786:P396R;ENSP00000349918:P347R;ENSP00000351413:P303R	ENSP00000242786:P396R	P	+	2	0	CD97	14374412	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-2.263000	0.01174	-0.707000	0.05022	-0.234000	0.12200	CCC	CD97	-	NULL	ENSG00000123146		0.592	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2	61	0.00	0	C	NM_078481		14513412	14513412	+1	no_errors	ENST00000242786	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.000	G
CTSE	1510	genome.wustl.edu	37	1	206325403	206325403	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:206325403G>C	ENST00000358184.2	+	5	746	c.628G>C	c.(628-630)Gtg>Ctg	p.V210L	CTSE_ENST00000468617.1_3'UTR|CTSE_ENST00000361052.3_Missense_Mutation_p.V215L|CTSE_ENST00000432969.2_Missense_Mutation_p.V135L|CTSE_ENST00000360218.2_Missense_Mutation_p.V210L	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	215					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TCAGAACCTGGTGGACTTGCC	0.483																																						dbGAP											0													154.0	131.0	139.0					1																	206325403		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.628G>C	1.37:g.206325403G>C	ENSP00000350911:p.Val210Leu		Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Missense_Mutation	SNP	pfam_Peptidase_A1,pfam_Propep_A1,superfamily_Peptidase_aspartic,prints_Peptidase_A1	p.V215L	ENST00000358184.2	37	c.643	CCDS1462.1	1	.	.	.	.	.	.	.	.	.	.	G	8.941	0.965800	0.18583	.	.	ENSG00000196188	ENST00000358184;ENST00000361052;ENST00000360218;ENST00000432969	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.29	4.38	0.52667	.	0.000000	0.64402	D	0.000007	T	0.63721	0.2535	L	0.31476	0.935	0.46336	D	0.99899	D;D;D	0.65815	0.995;0.994;0.994	D;D;D	0.73380	0.98;0.966;0.975	T	0.63857	-0.6542	10	0.41790	T	0.15	.	13.5674	0.61826	0.0755:0.0:0.9245:0.0	.	135;210;210	B4DNU8;P14091-2;P14091-1	.;.;.	L	210;215;210;135	ENSP00000350911:V210L;ENSP00000354337:V215L;ENSP00000353350:V210L;ENSP00000394607:V135L	ENSP00000350911:V210L	V	+	1	0	CTSE	204492026	1.000000	0.71417	0.969000	0.41365	0.153000	0.21895	3.382000	0.52463	1.453000	0.47775	0.655000	0.94253	GTG	CTSE	-	pfam_Peptidase_A1,superfamily_Peptidase_aspartic	ENSG00000196188		0.483	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CTSE	HGNC	protein_coding	OTTHUMT00000087998.1	128	0.00	0	G	NM_001910		206325403	206325403	+1	no_errors	ENST00000361052	ensembl	human	known	69_37n	missense	167	13.02	25	SNP	1.000	C
DYNC2H1	79659	genome.wustl.edu	37	11	103027330	103027330	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr11:103027330G>A	ENST00000375735.2	+	26	4102	c.3958G>A	c.(3958-3960)Gga>Aga	p.G1320R	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.G1320R	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1320	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTATTATAAAGGATTTGAAGA	0.328																																						dbGAP											0													54.0	54.0	54.0					11																	103027330		1796	4068	5864	-	-	-	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3958G>A	11.37:g.103027330G>A	ENSP00000364887:p.Gly1320Arg		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.G1320R	ENST00000375735.2	37	c.3958	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	13.21	2.168404	0.38315	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.60548	0.18;0.18	5.13	5.13	0.70059	Dynein heavy chain, domain-2 (1);	0.414164	0.18555	N	0.137794	T	0.50257	0.1605	L	0.33485	1.01	0.43110	D	0.994815	B;B	0.22211	0.037;0.066	B;B	0.25405	0.06;0.037	T	0.42378	-0.9455	10	0.25106	T	0.35	.	18.5852	0.91187	0.0:0.0:1.0:0.0	.	1320;1320	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	R	1320	ENSP00000364887:G1320R;ENSP00000381167:G1320R	ENSP00000364887:G1320R	G	+	1	0	DYNC2H1	102532540	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.356000	0.66052	2.403000	0.81681	0.462000	0.41574	GGA	DYNC2H1	-	pfam_Dynein_heavy_dom-2	ENSG00000187240		0.328	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	260	0.00	0	G	XM_370652		103027330	103027330	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	missense	154	24.51	50	SNP	1.000	A
EFCAB13	124989	genome.wustl.edu	37	17	45452315	45452315	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr17:45452315C>G	ENST00000331493.2	+	12	1766	c.1355C>G	c.(1354-1356)aCt>aGt	p.T452S	EFCAB13_ENST00000517484.1_Missense_Mutation_p.T356S	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	452						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										ACGGAAAAAACTGCAATTAGT	0.353																																						dbGAP											0													38.0	38.0	38.0					17																	45452315		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.1355C>G	17.37:g.45452315C>G	ENSP00000332111:p.Thr452Ser		G3V128|Q49AG9	Missense_Mutation	SNP	NULL	p.T452S	ENST00000331493.2	37	c.1355	CCDS11512.1	17	.	.	.	.	.	.	.	.	.	.	C	6.426	0.446746	0.12223	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	T;T	0.64803	0.25;-0.12	3.65	1.65	0.23941	.	1.360150	0.04711	N	0.417554	T	0.51839	0.1698	L	0.43152	1.355	0.09310	N	1	B;B;B	0.25312	0.047;0.021;0.123	B;B;B	0.13407	0.009;0.009;0.009	T	0.30504	-0.9976	9	.	.	.	1.6246	6.3212	0.21219	0.0:0.7858:0.0:0.2142	.	404;452;356	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	S	452;356;404	ENSP00000332111:T452S;ENSP00000430048:T356S	.	T	+	2	0	C17orf57	42807314	0.000000	0.05858	0.001000	0.08648	0.093000	0.18481	-0.097000	0.11042	0.530000	0.28619	0.585000	0.79938	ACT	EFCAB13	-	NULL	ENSG00000178852		0.353	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFCAB13	HGNC	protein_coding	OTTHUMT00000380147.4	235	0.00	0	C	NM_152347		45452315	45452315	+1	no_errors	ENST00000331493	ensembl	human	known	69_37n	missense	433	10.86	53	SNP	0.001	G
EFR3A	23167	genome.wustl.edu	37	8	132980672	132980672	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr8:132980672C>A	ENST00000254624.5	+	9	1211	c.986C>A	c.(985-987)tCc>tAc	p.S329Y	EFR3A_ENST00000519656.1_Missense_Mutation_p.S293Y|EFR3A_ENST00000334503.4_Missense_Mutation_p.S329Y	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	329						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)		p.S329C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			GCTAAAGGTTCCATAGGTGAG	0.403																																						dbGAP											1	Substitution - Missense(1)	lung(1)											75.0	69.0	71.0					8																	132980672		2203	4299	6502	-	-	-	SO:0001583	missense	0			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.986C>A	8.37:g.132980672C>A	ENSP00000254624:p.Ser329Tyr		A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S329Y	ENST00000254624.5	37	c.986	CCDS34942.2	8	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720679	0.89205	.	.	ENSG00000132294	ENST00000254624;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T	0.67171	3.54;3.54;-0.25	5.37	5.37	0.77165	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.82141	-0.0604	10	0.87932	D	0	-9.9488	18.0853	0.89455	0.0:1.0:0.0:0.0	.	329	Q14156	EFR3A_HUMAN	Y	329;329;329;293	ENSP00000254624:S329Y;ENSP00000334769:S329Y;ENSP00000428086:S293Y	ENSP00000254624:S329Y	S	+	2	0	EFR3A	133049854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.442000	0.80503	2.494000	0.84150	0.655000	0.94253	TCC	EFR3A	-	superfamily_ARM-type_fold	ENSG00000132294		0.403	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	108	0.00	0	C	NM_015137		132980672	132980672	+1	no_errors	ENST00000254624	ensembl	human	known	69_37n	missense	177	21.68	49	SNP	1.000	A
EHMT1	79813	genome.wustl.edu	37	9	140637847	140637847	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr9:140637847C>T	ENST00000460843.1	+	5	875	c.848C>T	c.(847-849)gCt>gTt	p.A283V	EHMT1_ENST00000334856.6_Missense_Mutation_p.A252V|EHMT1_ENST00000462484.1_Missense_Mutation_p.A283V|EHMT1_ENST00000371394.2_3'UTR	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	283					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		gttttAGCAGCTGCAGTATCT	0.353																																						dbGAP											0													44.0	42.0	43.0					9																	140637847		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.848C>T	9.37:g.140637847C>T	ENSP00000417980:p.Ala283Val		B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.A283V	ENST00000460843.1	37	c.848	CCDS7050.2	9	.	.	.	.	.	.	.	.	.	.	C	29.6	5.021517	0.93462	.	.	ENSG00000181090	ENST00000334856;ENST00000371400;ENST00000462484;ENST00000460843	T;T;T	0.75938	1.0;0.22;-0.98	5.42	5.42	0.78866	.	0.063182	0.64402	D	0.000005	D	0.85775	0.5775	M	0.67953	2.075	0.54753	D	0.999987	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.99;0.998;0.999	D	0.86564	0.1843	10	0.66056	D	0.02	.	19.214	0.93768	0.0:1.0:0.0:0.0	.	283;252;283	Q9H9B1;Q9H9B1-2;Q9H9B1-4	EHMT1_HUMAN;.;.	V	252;252;283;283	ENSP00000334476:A252V;ENSP00000417328:A283V;ENSP00000417980:A283V	ENSP00000334476:A252V	A	+	2	0	EHMT1	139757668	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.740000	0.62087	2.539000	0.85634	0.561000	0.74099	GCT	EHMT1	-	NULL	ENSG00000181090		0.353	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	37	0.00	0	C	NM_024757		140637847	140637847	+1	no_errors	ENST00000460843	ensembl	human	known	69_37n	missense	51	23.88	16	SNP	1.000	T
EPB41L2	2037	genome.wustl.edu	37	6	131184807	131184807	+	Missense_Mutation	SNP	T	T	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:131184807T>G	ENST00000337057.3	-	18	3062	c.2881A>C	c.(2881-2883)Aca>Cca	p.T961P	EPB41L2_ENST00000527659.1_Missense_Mutation_p.T767P|EPB41L2_ENST00000528282.1_Missense_Mutation_p.T703P|EPB41L2_ENST00000530481.1_Missense_Mutation_p.T808P|EPB41L2_ENST00000525271.1_Missense_Mutation_p.T629P|EPB41L2_ENST00000527411.1_Missense_Mutation_p.T891P|EPB41L2_ENST00000368128.2_Missense_Mutation_p.T961P|EPB41L2_ENST00000531410.1_Missense_Mutation_p.T82P|EPB41L2_ENST00000525193.1_Missense_Mutation_p.T662P|EPB41L2_ENST00000529208.1_Missense_Mutation_p.T891P|EPB41L2_ENST00000392427.3_Missense_Mutation_p.T629P|EPB41L2_ENST00000530757.1_Missense_Mutation_p.T157P|EPB41L2_ENST00000524581.1_Missense_Mutation_p.T339P|EPB41L2_ENST00000445890.2_Missense_Mutation_p.T703P	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	961	C-terminal (CTD).				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		CCATCTCCTGTGATCACAATG	0.363																																						dbGAP											0													182.0	147.0	159.0					6																	131184807		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.2881A>C	6.37:g.131184807T>G	ENSP00000338481:p.Thr961Pro		B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.T961P	ENST00000337057.3	37	c.2881	CCDS5141.1	6	.	.	.	.	.	.	.	.	.	.	T	20.3	3.959469	0.74016	.	.	ENSG00000079819	ENST00000531410;ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000530757;ENST00000392427;ENST00000368128;ENST00000527411;ENST00000524581;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208;ENST00000527017	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56;-1.56	6.0	4.81	0.61882	Band 4.1, C-terminal (1);	0.094278	0.64402	D	0.000001	D	0.89065	0.6609	M	0.86028	2.79	0.44061	D	0.996805	D;D;D;D;D;D	0.89917	0.999;0.994;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.968;0.999;0.995;0.998;0.993	D	0.90088	0.4175	10	0.56958	D	0.05	.	12.5041	0.55972	0.1252:0.0:0.0:0.8747	.	629;808;961;703;339;128	B4DHI8;E9PPD9;O43491;Q68DV2;Q6R5J7;Q9UG62	.;.;E41L2_HUMAN;.;.;.	P	82;703;808;703;961;157;629;961;891;339;629;662;767;891;225	ENSP00000434596:T82P;ENSP00000434308:T703P;ENSP00000434576:T808P;ENSP00000402041:T703P;ENSP00000338481:T961P;ENSP00000436349:T157P;ENSP00000376222:T629P;ENSP00000357110:T961P;ENSP00000436348:T891P;ENSP00000437207:T339P;ENSP00000432803:T629P;ENSP00000431988:T662P;ENSP00000431647:T767P;ENSP00000436641:T891P;ENSP00000432949:T225P	ENSP00000338481:T961P	T	-	1	0	EPB41L2	131226500	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.759000	0.62227	1.043000	0.40175	0.533000	0.62120	ACA	EPB41L2	-	pirsf_Band_41_protein,pfam_Band_4.1_C	ENSG00000079819		0.363	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3	205	0.00	0	T			131184807	131184807	-1	no_errors	ENST00000337057	ensembl	human	known	69_37n	missense	151	12.21	21	SNP	1.000	G
EPG5	57724	genome.wustl.edu	37	18	43460065	43460065	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr18:43460065G>C	ENST00000282041.5	-	32	5676	c.5642C>G	c.(5641-5643)tCt>tGt	p.S1881C	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1881					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GAGAGCATCAGAAGAGCTGGG	0.557											OREG0024951	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													55.0	58.0	57.0					18																	43460065		1960	4140	6100	-	-	-	SO:0001583	missense	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.5642C>G	18.37:g.43460065G>C	ENSP00000282041:p.Ser1881Cys	916	A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.S1881C	ENST00000282041.5	37	c.5642	CCDS11926.2	18	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259287	0.23051	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.11277	2.79	5.35	4.46	0.54185	.	.	.	.	.	T	0.10465	0.0256	L	0.40543	1.245	0.09310	N	1	P	0.42649	0.786	B	0.38712	0.28	T	0.14476	-1.0471	9	0.54805	T	0.06	-0.3297	10.4131	0.44305	0.0704:0.2545:0.6752:0.0	.	1881	Q9HCE0	EPG5_HUMAN	C	1881;756	ENSP00000282041:S1881C	ENSP00000282041:S1881C	S	-	2	0	EPG5	41714063	0.631000	0.27164	0.005000	0.12908	0.024000	0.10985	2.710000	0.47169	1.342000	0.45619	0.455000	0.32223	TCT	EPG5	-	NULL	ENSG00000152223		0.557	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	105	0.00	0	G	NM_020964		43460065	43460065	-1	no_errors	ENST00000282041	ensembl	human	known	69_37n	missense	27	56.45	35	SNP	0.013	C
EPHB1	2047	genome.wustl.edu	37	3	134670326	134670326	+	Silent	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr3:134670326G>C	ENST00000398015.3	+	3	607	c.237G>C	c.(235-237)cgG>cgC	p.R79R	EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	79	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TCATCAACCGGCGGGGGGCCC	0.552																																						dbGAP											0													28.0	31.0	30.0					3																	134670326		2046	4212	6258	-	-	-	SO:0001819	synonymous_variant	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.237G>C	3.37:g.134670326G>C			A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.R79	ENST00000398015.3	37	c.237	CCDS46921.1	3																																																																																			EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000154928		0.552	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	144	0.00	0	G	NM_004441		134670326	134670326	+1	no_errors	ENST00000398015	ensembl	human	known	69_37n	silent	111	29.75	47	SNP	0.954	C
EPT1	85465	genome.wustl.edu	37	2	26607960	26607960	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr2:26607960C>G	ENST00000260585.7	+	8	984	c.865C>G	c.(865-867)Cct>Gct	p.P289A		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	289					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)										AGAGCTACATCCTAGAGTATT	0.343																																						dbGAP											0													109.0	97.0	101.0					2																	26607960		1841	4083	5924	-	-	-	SO:0001583	missense	0				CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.865C>G	2.37:g.26607960C>G	ENSP00000260585:p.Pro289Ala		Q63ZE3	Missense_Mutation	SNP	NULL	p.P165A	ENST00000260585.7	37	c.493	CCDS46240.1	2	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674019	0.67928	.	.	ENSG00000138018	ENST00000260585;ENST00000447170	T	0.48836	0.8	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.71290	0.3322	M	0.84156	2.68	0.80722	D	1	D	0.67145	0.996	D	0.67725	0.953	T	0.70063	-0.4975	10	0.40728	T	0.16	-21.9335	18.9876	0.92779	0.0:1.0:0.0:0.0	.	289	Q9C0D9	EPT1_HUMAN	A	289;165	ENSP00000260585:P289A	ENSP00000260585:P289A	P	+	1	0	EPT1	26461464	1.000000	0.71417	0.998000	0.56505	0.867000	0.49689	6.821000	0.75272	2.834000	0.97654	0.650000	0.86243	CCT	EPT1	-	NULL	ENSG00000138018		0.343	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	EPT1	HGNC	protein_coding	OTTHUMT00000324484.3	67	0.00	0	C	NM_033505.2		26607960	26607960	+1	no_stop_codon	ENST00000447170	ensembl	human	novel	69_37n	missense	96	21.31	26	SNP	1.000	G
FBXW7	55294	genome.wustl.edu	37	4	153253831	153253831	+	Missense_Mutation	SNP	A	A	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr4:153253831A>G	ENST00000281708.4	-	6	2131	c.902T>C	c.(901-903)cTg>cCg	p.L301P	FBXW7_ENST00000603841.1_Missense_Mutation_p.L301P|FBXW7_ENST00000603548.1_Missense_Mutation_p.L301P|FBXW7_ENST00000296555.5_Missense_Mutation_p.L183P|FBXW7_ENST00000393956.3_Missense_Mutation_p.L125P|FBXW7_ENST00000263981.5_Missense_Mutation_p.L221P	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	301	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGCTTGTAGCAGGTCTTTGGG	0.358			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											64.0	65.0	64.0					4																	153253831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.902T>C	4.37:g.153253831A>G	ENSP00000281708:p.Leu301Pro		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L301P	ENST00000281708.4	37	c.902	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	A	25.8	4.675471	0.88445	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	6.16	6.16	0.99307	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.062950	0.64402	D	0.000004	D	0.85217	0.5646	H	0.94925	3.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.998	D	0.88903	0.3354	10	0.66056	D	0.02	-10.7659	16.8061	0.85666	1.0:0.0:0.0:0.0	.	125;301;183;221	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	P	301;183;221;125	ENSP00000281708:L301P;ENSP00000296555:L183P;ENSP00000263981:L221P;ENSP00000377528:L125P	ENSP00000263981:L221P	L	-	2	0	FBXW7	153473281	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.268000	0.95675	2.367000	0.80283	0.528000	0.53228	CTG	FBXW7	-	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	ENSG00000109670		0.358	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	224	0.00	0	A			153253831	153253831	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	missense	224	24.83	74	SNP	1.000	G
FLT3	2322	genome.wustl.edu	37	13	28622415	28622415	+	Missense_Mutation	SNP	T	T	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr13:28622415T>C	ENST00000241453.7	-	9	1283	c.1202A>G	c.(1201-1203)tAc>tGc	p.Y401C	FLT3_ENST00000537084.1_Missense_Mutation_p.Y401C|FLT3_ENST00000380982.4_Missense_Mutation_p.Y401C	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	401					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTCTCACCTGTATCCGTTATC	0.403			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													166.0	159.0	161.0					13																	28622415		2203	4300	6503	-	-	-	SO:0001583	missense	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1202A>G	13.37:g.28622415T>C	ENSP00000241453:p.Tyr401Cys		A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Y401C	ENST00000241453.7	37	c.1202	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	T	12.98	2.100747	0.37048	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	T;T;T	0.80304	-1.3;-1.36;-1.13	5.45	2.62	0.31277	Immunoglobulin-like fold (1);	0.331944	0.26116	N	0.026242	T	0.78033	0.4220	N	0.19112	0.55	0.37270	D	0.90736	D;D	0.76494	0.999;0.998	P;P	0.60949	0.881;0.661	T	0.80094	-0.1526	10	0.52906	T	0.07	.	10.539	0.45022	0.2716:0.0:0.0:0.7284	.	401;401	P36888-2;P36888	.;FLT3_HUMAN	C	401	ENSP00000241453:Y401C;ENSP00000370369:Y401C;ENSP00000438139:Y401C	ENSP00000241453:Y401C	Y	-	2	0	FLT3	27520415	0.992000	0.36948	1.000000	0.80357	0.195000	0.23768	0.012000	0.13287	0.880000	0.35969	0.379000	0.24179	TAC	FLT3	-	NULL	ENSG00000122025		0.403	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	410	0.24	1	T			28622415	28622415	-1	no_errors	ENST00000380982	ensembl	human	known	69_37n	missense	437	10.82	53	SNP	1.000	C
FNIP2	57600	genome.wustl.edu	37	4	159756601	159756601	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr4:159756601G>C	ENST00000264433.6	+	7	775	c.700G>C	c.(700-702)Gac>Cac	p.D234H	FNIP2_ENST00000379346.3_Missense_Mutation_p.D257H	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	234					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		ACAGAATGAAGACAGGGACAG	0.418																																						dbGAP											0													291.0	306.0	301.0					4																	159756601		2019	4184	6203	-	-	-	SO:0001583	missense	0			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.700G>C	4.37:g.159756601G>C	ENSP00000264433:p.Asp234His		Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	NULL	p.D257H	ENST00000264433.6	37	c.769	CCDS47155.1	4	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977796	0.92982	.	.	ENSG00000052795	ENST00000264433;ENST00000512986;ENST00000379346;ENST00000504715	T;T;T;T	0.38240	1.66;1.69;1.65;1.15	5.91	5.91	0.95273	.	.	.	.	.	T	0.61400	0.2344	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56019	-0.8048	8	.	.	.	.	20.2857	0.98533	0.0:0.0:1.0:0.0	.	234	Q9P278	FNIP2_HUMAN	H	234;257;257;99	ENSP00000264433:D234H;ENSP00000421488:D257H;ENSP00000368651:D257H;ENSP00000420841:D99H	.	D	+	1	0	FNIP2	159976051	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.224000	0.95209	2.803000	0.96430	0.650000	0.86243	GAC	FNIP2	-	NULL	ENSG00000052795		0.418	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNIP2	HGNC	protein_coding	OTTHUMT00000366602.1	476	0.00	0	G	NM_020840		159756601	159756601	+1	no_errors	ENST00000379346	ensembl	human	known	69_37n	missense	353	17.67	76	SNP	1.000	C
FSCB	84075	genome.wustl.edu	37	14	44975063	44975063	+	Silent	SNP	A	A	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr14:44975063A>G	ENST00000340446.4	-	1	1419	c.1128T>C	c.(1126-1128)ccT>ccC	p.P376P	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	376	Pro-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GCTCTACTGAAGGAGACTTTT	0.527																																						dbGAP											0													90.0	103.0	99.0					14																	44975063		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1128T>C	14.37:g.44975063A>G			Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	NULL	p.P376	ENST00000340446.4	37	c.1128	CCDS9679.1	14																																																																																			FSCB	-	NULL	ENSG00000189139		0.527	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	319	0.31	1	A	NM_032135		44975063	44975063	-1	no_errors	ENST00000340446	ensembl	human	known	69_37n	silent	244	18.94	57	SNP	0.000	G
GP2	2813	genome.wustl.edu	37	16	20335274	20335274	+	Silent	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr16:20335274G>C	ENST00000381362.4	-	3	475	c.399C>G	c.(397-399)acC>acG	p.T133T	GP2_ENST00000381360.5_Intron|GP2_ENST00000341642.5_Intron|GP2_ENST00000302555.5_Silent_p.T133T|GP2_ENST00000573897.1_5'Flank	NM_001007240.1|NM_001502.2	NP_001007241.2|NP_001493.2	P55259	GP2_HUMAN	glycoprotein 2 (zymogen granule membrane)	133					antigen transcytosis by M cells in mucosal-associated lymphoid tissue (GO:0002412)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CAGTGTGGTTGGTGATGCCAT	0.597																																						dbGAP											0													84.0	66.0	72.0					16																	20335274		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U36221	CCDS10582.2, CCDS42128.1, CCDS45432.1, CCDS45433.1	16p12.3	2008-02-05			ENSG00000169347	ENSG00000169347			4441	protein-coding gene	gene with protein product		602977				9605860	Standard	XM_005255259		Approved		uc002dgw.3	P55259	OTTHUMG00000131489	ENST00000381362.4:c.399C>G	16.37:g.20335274G>C			A6NFM9|A6NJA8|Q13338|Q9UIF1	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.T133	ENST00000381362.4	37	c.399	CCDS42128.1	16																																																																																			GP2	-	NULL	ENSG00000169347		0.597	GP2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GP2	HGNC	protein_coding	OTTHUMT00000436920.1	93	0.00	0	G	NM_016295		20335274	20335274	-1	no_errors	ENST00000381362	ensembl	human	known	69_37n	silent	73	17.05	15	SNP	0.850	C
GRIK3	2899	genome.wustl.edu	37	1	37270667	37270667	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:37270667G>C	ENST00000373091.3	-	15	2502	c.2486C>G	c.(2485-2487)gCc>gGc	p.A829G	GRIK3_ENST00000373093.4_Missense_Mutation_p.A829G	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	829					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CAGCCCGGCGGCCAGGACAAT	0.602																																						dbGAP											0													59.0	67.0	65.0					1																	37270667		2203	4300	6503	-	-	-	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2486C>G	1.37:g.37270667G>C	ENSP00000362183:p.Ala829Gly		A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A829G	ENST00000373091.3	37	c.2486	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.697463	0.68386	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.53640	0.61;0.61	4.41	4.41	0.53225	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.55924	0.1951	N	0.25094	0.71	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.76071	0.98;0.987	T	0.62992	-0.6736	10	0.66056	D	0.02	.	17.0164	0.86420	0.0:0.0:1.0:0.0	.	829;829	A9Z1Z8;Q13003	.;GRIK3_HUMAN	G	829	ENSP00000362183:A829G;ENSP00000362185:A829G	ENSP00000362183:A829G	A	-	2	0	GRIK3	37043254	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.785000	0.99042	1.979000	0.57680	0.551000	0.68910	GCC	GRIK3	-	pfam_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000163873		0.602	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	100	0.00	0	G	NM_000831		37270667	37270667	-1	no_errors	ENST00000373091	ensembl	human	known	69_37n	missense	53	37.65	32	SNP	1.000	C
HEPHL1	341208	genome.wustl.edu	37	11	93844724	93844724	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr11:93844724C>A	ENST00000315765.9	+	19	3238	c.3230C>A	c.(3229-3231)aCc>aAc	p.T1077N		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	1077	Plastocyanin-like 6.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CCTTACTCCACCACATCTCCT	0.423																																						dbGAP											0													48.0	47.0	48.0					11																	93844724		1990	4177	6167	-	-	-	SO:0001583	missense	0			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.3230C>A	11.37:g.93844724C>A	ENSP00000313699:p.Thr1077Asn		Q3C1W7	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.T1077N	ENST00000315765.9	37	c.3230	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	C	9.639	1.138585	0.21123	.	.	ENSG00000181333	ENST00000315765	D	0.99220	-5.58	5.65	4.73	0.59995	.	3.584980	0.04693	U	0.414540	D	0.98012	0.9345	L	0.42245	1.32	0.30728	N	0.747493	B	0.19817	0.039	B	0.12156	0.007	D	0.93430	0.6784	10	0.27785	T	0.31	-14.9871	12.9437	0.58362	0.0:0.8373:0.1627:0.0	.	1077	Q6MZM0	HPHL1_HUMAN	N	1077	ENSP00000313699:T1077N	ENSP00000313699:T1077N	T	+	2	0	HEPHL1	93484372	0.705000	0.27846	0.986000	0.45419	0.015000	0.08874	1.340000	0.33896	1.521000	0.48983	-0.176000	0.13171	ACC	HEPHL1	-	NULL	ENSG00000181333		0.423	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	HGNC	protein_coding	OTTHUMT00000396103.2	101	0.00	0	C	XM_291947		93844724	93844724	+1	no_errors	ENST00000315765	ensembl	human	known	69_37n	missense	55	32.10	26	SNP	0.992	A
HMGB1	3146	genome.wustl.edu	37	13	31035512	31035512	+	Missense_Mutation	SNP	T	T	A	rs200836895	byFrequency	TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr13:31035512T>A	ENST00000405805.1	-	5	1570	c.630A>T	c.(628-630)gaA>gaT	p.E210D	HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000399489.1_3'UTR|HMGB1_ENST00000341423.5_Missense_Mutation_p.E210D|HMGB1_ENST00000339872.4_Missense_Mutation_p.E210D|HMGB1_ENST00000399494.1_Missense_Mutation_p.E210D			P09429	HMGB1_HUMAN	high mobility group box 1	210	Asp/Glu-rich (acidic).				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		CATCAtcatcttcttcttcat	0.378													T|||	6	0.00119808	0.003	0.0	5008	,	,		18295	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													20.0	25.0	23.0					13																	31035512		1894	4135	6029	-	-	-	SO:0001583	missense	0			D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.630A>T	13.37:g.31035512T>A	ENSP00000384678:p.Glu210Asp		A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.E210D	ENST00000405805.1	37	c.630	CCDS9335.1	13	.	.	.	.	.	.	.	.	.	.	T	13.77	2.336740	0.41398	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399494	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.68	-1.58	0.08479	Armadillo-like helical (1);	0.305542	0.22770	N	0.055856	T	0.33440	0.0863	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.02901	-1.1096	10	0.87932	D	0	.	4.5078	0.11896	0.474:0.2443:0.0:0.2817	.	171;210	B3KQ05;P09429	.;HMGB1_HUMAN	D	210	ENSP00000384678:E210D;ENSP00000343040:E210D;ENSP00000345347:E210D;ENSP00000382417:E210D	ENSP00000343040:E210D	E	-	3	2	HMGB1	29933512	0.999000	0.42202	0.997000	0.53966	0.995000	0.86356	0.152000	0.16302	-0.149000	0.11215	-0.276000	0.10085	GAA	HMGB1	-	NULL	ENSG00000189403		0.378	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGB1	HGNC	protein_coding	OTTHUMT00000303998.2	116	0.85	1	T	NM_002128		31035512	31035512	-1	no_errors	ENST00000339872	ensembl	human	known	69_37n	missense	75	16.48	15	SNP	0.995	A
HUWE1	10075	genome.wustl.edu	37	X	53565354	53565354	+	Silent	SNP	C	C	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chrX:53565354C>A	ENST00000342160.3	-	76	12397	c.11940G>T	c.(11938-11940)ggG>ggT	p.G3980G	HUWE1_ENST00000262854.6_Silent_p.G3980G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3980					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAGCAAAAGGCCCATCAGCAA	0.522																																						dbGAP											0													172.0	104.0	127.0					X																	53565354		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11940G>T	X.37:g.53565354C>A			O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_HECT,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.A3014S	ENST00000342160.3	37	c.9040	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	10.47	1.358805	0.24598	.	.	ENSG00000086758	ENST00000427052;ENST00000426907	.	.	.	5.42	3.61	0.41365	.	.	.	.	.	T	0.53578	0.1805	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45702	-0.9243	4	.	.	.	.	4.7612	0.13110	0.1544:0.6127:0.1469:0.086	.	.	.	.	S	3014;803	.	.	A	-	1	0	HUWE1	53582079	0.008000	0.16893	1.000000	0.80357	0.981000	0.71138	-1.415000	0.02469	0.456000	0.26937	0.529000	0.55759	GCC	HUWE1	-	NULL	ENSG00000086758		0.522	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	64	0.00	0	C	XM_497119		53565354	53565354	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427052	ensembl	human	known	69_37n	missense	107	13.01	16	SNP	1.000	A
IL15	3600	genome.wustl.edu	37	4	142651125	142651125	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr4:142651125G>T	ENST00000296545.7	+	7	1210	c.366G>T	c.(364-366)ttG>ttT	p.L122F	IL15_ENST00000529613.1_Missense_Mutation_p.L122F|IL15_ENST00000394159.1_Missense_Mutation_p.L95F|IL15_ENST00000514653.1_Missense_Mutation_p.L95F|IL15_ENST00000477265.1_Missense_Mutation_p.L95F|IL15_ENST00000320650.4_Missense_Mutation_p.L122F			P40933	IL15_HUMAN	interleukin 15	122					aging (GO:0007568)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|cellular response to vitamin D (GO:0071305)|extrathymic T cell selection (GO:0045062)|hyaluronan metabolic process (GO:0030212)|immune response (GO:0006955)|inflammatory response (GO:0006954)|lymph node development (GO:0048535)|natural killer cell differentiation (GO:0001779)|negative regulation of smooth muscle cell proliferation (GO:0048662)|NK T cell proliferation (GO:0001866)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immune response (GO:0050778)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of defense response to virus by host (GO:0050691)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_hematologic(180;0.158)					ACAACAGTTTGTCTTCTAATG	0.398																																					Pancreas(10;184 986 25902)	dbGAP											0													115.0	116.0	116.0					4																	142651125		2203	4299	6502	-	-	-	SO:0001583	missense	0			U14407	CCDS3755.1, CCDS3756.1	4q31	2011-07-14			ENSG00000164136	ENSG00000164136		"""Interleukins and interleukin receptors"""	5977	protein-coding gene	gene with protein product		600554				8178155	Standard	NM_000585		Approved	IL-15, MGC9721	uc003iis.3	P40933	OTTHUMG00000133418	ENST00000296545.7:c.366G>T	4.37:g.142651125G>T	ENSP00000296545:p.Leu122Phe		D3DNZ2|O00440|O43512|Q495Z8|Q6FGX7|Q93058|Q9UBA3	Missense_Mutation	SNP	pfam_Interleukin_15-like,prints_Interleukin-15_mammal,prints_Interleukin-15	p.L122F	ENST00000296545.7	37	c.366	CCDS3755.1	4	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423405	0.25639	.	.	ENSG00000164136	ENST00000320650;ENST00000296545;ENST00000514653;ENST00000529613;ENST00000477265;ENST00000394159	.	.	.	5.49	-3.36	0.04913	.	0.113080	0.39985	N	0.001219	T	0.57489	0.2057	M	0.64260	1.97	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.54262	-0.8320	9	0.38643	T	0.18	-4.8928	11.1233	0.48304	0.4278:0.0:0.5722:0.0	.	122	P40933	IL15_HUMAN	F	122;122;95;122;95;95	.	ENSP00000296545:L122F	L	+	3	2	IL15	142870575	0.793000	0.28825	0.002000	0.10522	0.023000	0.10783	0.264000	0.18497	-0.614000	0.05687	-1.223000	0.01593	TTG	IL15	-	pfam_Interleukin_15-like	ENSG00000164136		0.398	IL15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL15	HGNC	protein_coding	OTTHUMT00000257278.2	238	0.00	0	G	NM_172175		142651125	142651125	+1	no_errors	ENST00000296545	ensembl	human	known	69_37n	missense	97	40.85	67	SNP	0.091	T
INTS2	57508	genome.wustl.edu	37	17	59967189	59967189	+	Silent	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr17:59967189G>A	ENST00000444766.3	-	15	2041	c.1966C>T	c.(1966-1968)Ctg>Ttg	p.L656L	INTS2_ENST00000251334.6_Silent_p.L648L	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	656					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TCATAAGACAGTATATAGTAG	0.383																																						dbGAP											0													79.0	79.0	79.0					17																	59967189		1904	4130	6034	-	-	-	SO:0001819	synonymous_variant	0			AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.1966C>T	17.37:g.59967189G>A			Q9ULD3	Silent	SNP	NULL	p.L656	ENST00000444766.3	37	c.1966	CCDS45750.1	17																																																																																			INTS2	-	NULL	ENSG00000108506		0.383	INTS2-001	KNOWN	basic|CCDS	protein_coding	INTS2	HGNC	protein_coding	OTTHUMT00000445368.1	62	0.00	0	G	NM_020748		59967189	59967189	-1	no_errors	ENST00000444766	ensembl	human	known	69_37n	silent	94	16.81	19	SNP	1.000	A
KIAA0907	22889	genome.wustl.edu	37	1	155893455	155893455	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:155893455G>C	ENST00000368321.3	-	8	940	c.917C>G	c.(916-918)gCt>gGt	p.A306G	SCARNA4_ENST00000516999.1_RNA|KIAA0907_ENST00000368319.3_Missense_Mutation_p.A306G|KIAA0907_ENST00000368320.3_Missense_Mutation_p.A306G|KIAA0907_ENST00000482337.1_5'UTR	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	306							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			CTTGGCAGCAGCCAGGCCTTC	0.393																																						dbGAP											0													89.0	92.0	91.0					1																	155893455		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.917C>G	1.37:g.155893455G>C	ENSP00000357304:p.Ala306Gly		O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	NULL	p.A306G	ENST00000368321.3	37	c.917	CCDS30885.1	1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249564	0.80024	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	T;T;T	0.45668	0.89;0.89;0.89	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.37046	0.0989	M	0.62266	1.93	0.80722	D	1	P;B;B	0.35192	0.489;0.318;0.172	B;B;B	0.40864	0.187;0.342;0.254	T	0.12142	-1.0559	10	0.25106	T	0.35	-9.9279	19.6068	0.95584	0.0:0.0:1.0:0.0	.	306;306;306	Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;K0907_HUMAN	G	306	ENSP00000357304:A306G;ENSP00000357303:A306G;ENSP00000357302:A306G	ENSP00000357302:A306G	A	-	2	0	KIAA0907	154160079	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.447000	0.97595	2.742000	0.94016	0.650000	0.86243	GCT	KIAA0907	-	NULL	ENSG00000132680		0.393	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0907	HGNC	protein_coding	OTTHUMT00000039583.1	120	0.00	0	G	NM_014949		155893455	155893455	-1	no_errors	ENST00000368321	ensembl	human	known	69_37n	missense	114	29.63	48	SNP	1.000	C
CEP162	22832	genome.wustl.edu	37	6	84834930	84834930	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:84834930T>A	ENST00000403245.3	-	27	4185	c.4071A>T	c.(4069-4071)agA>agT	p.R1357S	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.R1281S	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		ACTGTGCCAGTCTTTTCCATT	0.408																																						dbGAP											0													146.0	127.0	133.0					6																	84834930		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000403245.3:c.4071A>T	6.37:g.84834930T>A	ENSP00000385215:p.Arg1357Ser			Missense_Mutation	SNP	NULL	p.R1357S	ENST00000403245.3	37	c.4071	CCDS34494.2	6	.	.	.	.	.	.	.	.	.	.	T	14.97	2.693044	0.48202	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.18810	2.19;2.19	5.46	2.82	0.32997	.	0.115058	0.53938	D	0.000060	T	0.19005	0.0456	M	0.73962	2.25	0.32298	N	0.565456	P	0.52316	0.952	P	0.51055	0.657	T	0.03706	-1.1011	10	0.66056	D	0.02	-16.2602	8.1964	0.31398	0.0:0.2447:0.0:0.7553	.	1357	Q5TB80	QN1_HUMAN	S	1281;1357	ENSP00000257766:R1281S;ENSP00000385215:R1357S	ENSP00000257766:R1281S	R	-	3	2	KIAA1009	84891649	0.999000	0.42202	1.000000	0.80357	0.204000	0.24138	0.381000	0.20619	1.006000	0.39211	0.533000	0.62120	AGA	KIAA1009	-	NULL	ENSG00000135315		0.408	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	HGNC	protein_coding	OTTHUMT00000317315.1	288	0.00	0	T			84834930	84834930	-1	no_errors	ENST00000403245	ensembl	human	known	69_37n	missense	177	30.86	79	SNP	1.000	A
LDHAL6CP	121498	genome.wustl.edu	37	12	63397672	63397672	+	lincRNA	SNP	C	C	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr12:63397672C>T	ENST00000552996.1	-	0	1070				LDHAL6CP_ENST00000550738.1_RNA																							GACAATGGATCTTCAACATGA	0.433																																						dbGAP											0																																										-	-	-			0																															12.37:g.63397672C>T				RNA	SNP	-	NULL	ENST00000552996.1	37	NULL		12																																																																																			LDHAL6CP	-	-	ENSG00000250517		0.433	RP11-848D3.5-001	KNOWN	basic	lincRNA	LDHAL6CP	HGNC	lincRNA	OTTHUMT00000406731.1	220	0.00	0	C			63397672	63397672	+1	no_errors	ENST00000550738	ensembl	human	known	69_37n	rna	100	16.67	20	SNP	1.000	T
LRRC42	115353	genome.wustl.edu	37	1	54423919	54423919	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:54423919C>G	ENST00000371370.3	+	4	1092	c.571C>G	c.(571-573)Ctt>Gtt	p.L191V	LRRC42_ENST00000319223.4_Missense_Mutation_p.L191V	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	191										breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						TGAGCATGAACTTCTAGAACA	0.443																																						dbGAP											0													158.0	138.0	145.0					1																	54423919		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.571C>G	1.37:g.54423919C>G	ENSP00000360421:p.Leu191Val		D3DQ46|Q8N2Q8	Missense_Mutation	SNP	NULL	p.L191V	ENST00000371370.3	37	c.571	CCDS585.1	1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678869	0.68042	.	.	ENSG00000116212	ENST00000371370;ENST00000371368;ENST00000319223;ENST00000444987	T;T;T	0.29917	5.02;5.02;1.55	5.32	5.32	0.75619	.	0.123853	0.52532	D	0.000066	T	0.35278	0.0926	N	0.24115	0.695	0.49687	D	0.999815	P;D;P	0.56521	0.94;0.976;0.952	P;P;P	0.58130	0.742;0.81;0.833	T	0.03374	-1.1043	10	0.54805	T	0.06	-13.129	12.8454	0.57827	0.0:0.9259:0.0:0.0741	.	191;191;191	E7EP35;A6NL66;Q9Y546	.;.;LRC42_HUMAN	V	191	ENSP00000360421:L191V;ENSP00000318185:L191V;ENSP00000389368:L191V	ENSP00000318185:L191V	L	+	1	0	LRRC42	54196507	0.991000	0.36638	0.998000	0.56505	0.966000	0.64601	0.858000	0.27845	2.941000	0.99782	0.655000	0.94253	CTT	LRRC42	-	NULL	ENSG00000116212		0.443	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC42	HGNC	protein_coding	OTTHUMT00000023250.1	134	0.00	0	C	NM_052940		54423919	54423919	+1	no_errors	ENST00000319223	ensembl	human	known	69_37n	missense	91	16.51	18	SNP	0.995	G
LY75	4065	genome.wustl.edu	37	2	160750486	160750486	+	Silent	SNP	T	T	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr2:160750486T>A	ENST00000263636.4	-	3	603	c.576A>T	c.(574-576)ccA>ccT	p.P192P	LY75-CD302_ENST00000504764.1_Silent_p.P192P|LY75_ENST00000553424.1_Silent_p.P192P|LY75-CD302_ENST00000505052.1_Silent_p.P192P|LY75_ENST00000554112.1_Silent_p.P192P	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	192	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TGGCACACCATGGCCCACTAT	0.428																																						dbGAP											0													110.0	104.0	106.0					2																	160750486		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.576A>T	2.37:g.160750486T>A			O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.P192	ENST00000263636.4	37	c.576	CCDS2211.1	2																																																																																			LY75	-	pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	ENSG00000054219		0.428	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	137	0.00	0	T			160750486	160750486	-1	no_errors	ENST00000554112	ensembl	human	known	69_37n	silent	116	19.44	28	SNP	0.963	A
MAP3K1	4214	genome.wustl.edu	37	5	56152573	56152574	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr5:56152573_56152574insT	ENST00000399503.3	+	2	629_630	c.629_630insT	c.(628-633)cctgtgfs	p.V211fs	AC008937.2_ENST00000415589.1_RNA|snoU13_ENST00000459264.1_RNA	NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	211			V -> VIQ (in SRXY6).		activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		AGGCGAGGGCCTGTGGTAAGTG	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.630dupT	5.37:g.56152574_56152574dupT	ENSP00000382423:p.Val211fs			Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.V211fs	ENST00000399503.3	37	c.629_630	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.446	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	139	0.00	0	-	XM_042066		56152573	56152574	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_ins	102	41.71	73	INS	1.000:0.725	T
MAP3K9	4293	genome.wustl.edu	37	14	71197537	71197537	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr14:71197537G>C	ENST00000554752.2	-	12	2874	c.2875C>G	c.(2875-2877)Ccc>Gcc	p.P959A	MAP3K9_ENST00000554146.1_Missense_Mutation_p.P687A|MAP3K9_ENST00000553414.1_Missense_Mutation_p.P692A|MAP3K9_ENST00000381250.4_Missense_Mutation_p.P936A|MAP3K9_ENST00000555993.2_Missense_Mutation_p.P973A	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	959	Pro-rich.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GGGAGACGGGGGAATTCACCT	0.542																																					GBM(114;411 1587 13539 28235 50070)	dbGAP											0													20.0	24.0	23.0					14																	71197537		2201	4291	6492	-	-	-	SO:0001583	missense	0			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.2875C>G	14.37:g.71197537G>C	ENSP00000451612:p.Pro959Ala		A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_Regulat_G_prot_signal_superfam,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.P973A	ENST00000554752.2	37	c.2917		14	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233501	0.79688	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.78364	-1.12;-1.17;-1.07;-1.11	4.7	4.7	0.59300	.	0.050199	0.85682	D	0.000000	D	0.85779	0.5776	L	0.55990	1.75	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;0.958;0.986;1.0	D;P;P;D	0.91635	0.999;0.549;0.793;0.999	D	0.86909	0.2059	10	0.62326	D	0.03	.	17.8283	0.88673	0.0:0.0:1.0:0.0	.	687;959;973;692	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	A	959;973;692;936;687;675	ENSP00000451612:P959A;ENSP00000451038:P692A;ENSP00000370649:P936A;ENSP00000451921:P687A	ENSP00000005198:P973A	P	-	1	0	MAP3K9	70267290	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.411000	0.97342	2.455000	0.83008	0.561000	0.74099	CCC	MAP3K9	-	pirsf_MAPKKK9/10/11	ENSG00000006432		0.542	MAP3K9-001	KNOWN	basic	protein_coding	MAP3K9	HGNC	protein_coding	OTTHUMT00000412550.2	25	0.00	0	G			71197537	71197537	-1	no_errors	ENST00000555993	ensembl	human	known	69_37n	missense	3	70.00	7	SNP	1.000	C
MC3R	4159	genome.wustl.edu	37	20	54824566	54824566	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr20:54824566G>A	ENST00000243911.2	+	1	779	c.667G>A	c.(667-669)Gca>Aca	p.A223T		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	223					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			GCGCATAGCAGCACTGCCACC	0.592																																						dbGAP											0													194.0	130.0	152.0					20																	54824566		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.667G>A	20.37:g.54824566G>A	ENSP00000243911:p.Ala223Thr		Q4KN27|Q9H517	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Melcrt_ACTH_rcpt,prints_Mcort_3_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Melancort_rcpt	p.A223T	ENST00000243911.2	37	c.667	CCDS13449.2	20	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106255	0.37145	.	.	ENSG00000124089	ENST00000243911	T	0.71817	-0.6	4.91	4.91	0.64330	GPCR, rhodopsin-like superfamily (1);	0.080287	0.47852	D	0.000220	T	0.65954	0.2741	L	0.48877	1.53	0.46725	D	0.999176	B	0.28233	0.204	B	0.27170	0.077	T	0.63963	-0.6518	10	0.35671	T	0.21	.	17.7079	0.88313	0.0:0.0:1.0:0.0	.	260	P41968	MC3R_HUMAN	T	223	ENSP00000243911:A223T	ENSP00000243911:A223T	A	+	1	0	MC3R	54257973	1.000000	0.71417	0.007000	0.13788	0.124000	0.20399	9.604000	0.98317	2.259000	0.74868	0.555000	0.69702	GCA	MC3R	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Melancort_rcpt	ENSG00000124089		0.592	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC3R	HGNC	protein_coding	OTTHUMT00000079786.2	115	0.00	0	G			54824566	54824566	+1	no_errors	ENST00000243911	ensembl	human	known	69_37n	missense	187	23.36	57	SNP	0.988	A
MUC17	140453	genome.wustl.edu	37	7	100681618	100681618	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr7:100681618C>A	ENST00000306151.4	+	3	6985	c.6921C>A	c.(6919-6921)aaC>aaA	p.N2307K		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2307	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTGACTCCAACACTCCTTTCA	0.473																																						dbGAP											0													225.0	226.0	225.0					7																	100681618		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6921C>A	7.37:g.100681618C>A	ENSP00000302716:p.Asn2307Lys		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.N2307K	ENST00000306151.4	37	c.6921	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	1.783	-0.481403	0.04383	.	.	ENSG00000169876	ENST00000306151	T	0.02395	4.31	1.19	-2.38	0.06622	.	.	.	.	.	T	0.01387	0.0045	N	0.14661	0.345	0.09310	N	1	B	0.22480	0.07	B	0.10450	0.005	T	0.48969	-0.8987	9	0.13108	T	0.6	.	2.4336	0.04477	0.0:0.3073:0.2843:0.4084	.	2307	Q685J3	MUC17_HUMAN	K	2307	ENSP00000302716:N2307K	ENSP00000302716:N2307K	N	+	3	2	MUC17	100468338	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.870000	0.04228	-0.374000	0.07967	0.134000	0.15878	AAC	MUC17	-	NULL	ENSG00000169876		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	307	0.00	0	C	NM_001040105		100681618	100681618	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	249	39.12	160	SNP	0.001	A
MYH11	4629	genome.wustl.edu	37	16	15829383	15829383	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr16:15829383G>T	ENST00000300036.5	-	26	3455	c.3346C>A	c.(3346-3348)Ctg>Atg	p.L1116M	MYH11_ENST00000452625.2_Missense_Mutation_p.L1123M|AF001548.5_ENST00000574212.1_RNA|MYH11_ENST00000396324.3_Missense_Mutation_p.L1123M|MYH11_ENST00000576790.2_Missense_Mutation_p.L1116M	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1116					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TGGCCCTCCAGCTCCCGGATC	0.587			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													104.0	103.0	103.0					16																	15829383		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.3346C>A	16.37:g.15829383G>T	ENSP00000300036:p.Leu1116Met		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1123M	ENST00000300036.5	37	c.3367	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352430	0.61293	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15	5.51	4.36	0.52297	Myosin tail (1);	0.000000	0.64402	D	0.000005	D	0.89368	0.6695	M	0.78801	2.425	0.58432	D	0.999998	P;P;P;P;P	0.36974	0.514;0.576;0.576;0.576;0.576	P;P;P;P;P	0.46339	0.491;0.513;0.513;0.513;0.457	D	0.90111	0.4192	10	0.87932	D	0	.	10.7915	0.46436	0.1345:0.0:0.8655:0.0	.	1123;1116;1123;1116;1123	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	M	1116;1116;1123;1123;1123	ENSP00000300036:L1116M;ENSP00000345136:L1116M;ENSP00000379616:L1123M;ENSP00000407821:L1123M	ENSP00000300036:L1116M	L	-	1	2	MYH11	15736884	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.474000	0.45154	2.593000	0.87608	0.442000	0.29010	CTG	MYH11	-	pfam_Myosin_tail	ENSG00000133392		0.587	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	76	0.00	0	G	NM_001040113		15829383	15829383	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	155	10.40	18	SNP	1.000	T
NBPF10	100132406	genome.wustl.edu	37	1	145366859	145366859	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:145366859C>G	ENST00000342960.5	+	82	10204	c.10169C>G	c.(10168-10170)cCt>cGt	p.P3390R	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	704						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAGAAAGAGCCTGAAGTCTTG	0.483																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10169C>G	1.37:g.145366859C>G	ENSP00000345684:p.Pro3390Arg		Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.P3390R	ENST00000342960.5	37	c.10169	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	8.312	0.822345	0.16678	.	.	ENSG00000163386	ENST00000342960	T	0.07327	3.2	0.914	-1.83	0.07833	.	.	.	.	.	T	0.02083	0.0065	L	0.38175	1.15	0.09310	N	1	.	.	.	.	.	.	T	0.44283	-0.9338	7	0.59425	D	0.04	.	1.4276	0.02326	0.3439:0.3352:0.0:0.3209	.	.	.	.	R	3390	ENSP00000345684:P3390R	ENSP00000345684:P3390R	P	+	2	0	NBPF10	144078216	0.007000	0.16637	0.001000	0.08648	0.062000	0.15995	-1.395000	0.02516	-0.785000	0.04522	0.152000	0.16155	CCT	NBPF10	-	pfam_NBPF_dom	ENSG00000163386		0.483	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		88	0.00	0	C	NM_001039703		145366859	145366859	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	missense	98	37.58	59	SNP	0.001	G
NFASC	23114	genome.wustl.edu	37	1	204921156	204921156	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:204921156A>C	ENST00000401399.1	+	4	326	c.127A>C	c.(127-129)Atc>Ctc	p.I43L	NFASC_ENST00000513543.1_Missense_Mutation_p.I37L|NFASC_ENST00000367172.4_Missense_Mutation_p.I43L|NFASC_ENST00000360049.4_Missense_Mutation_p.I37L|NFASC_ENST00000338586.6_Missense_Mutation_p.I43L|NFASC_ENST00000339876.6_Missense_Mutation_p.I43L|NFASC_ENST00000367171.4_Missense_Mutation_p.I43L|NFASC_ENST00000404076.1_Missense_Mutation_p.I37L|NFASC_ENST00000367169.4_Missense_Mutation_p.I43L|NFASC_ENST00000338515.6_Missense_Mutation_p.I43L|NFASC_ENST00000404907.1_Missense_Mutation_p.I37L|NFASC_ENST00000367170.4_Missense_Mutation_p.I43L|NFASC_ENST00000403080.1_Missense_Mutation_p.I43L|NFASC_ENST00000539706.1_Missense_Mutation_p.I37L			O94856	NFASC_HUMAN	neurofascin	43	Ig-like C2-type 1.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCCGCCAACCATCACCAAGCA	0.587																																						dbGAP											0													106.0	81.0	90.0					1																	204921156		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.127A>C	1.37:g.204921156A>C	ENSP00000385637:p.Ile43Leu		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I43L	ENST00000401399.1	37	c.127	CCDS53460.1	1	.	.	.	.	.	.	.	.	.	.	A	34	5.357262	0.95854	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000446412;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000505079;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	5.55	5.55	0.83447	.	0.000000	0.56097	D	0.000040	D	0.82554	0.5062	M	0.81802	2.56	0.80722	D	1	D;B;D;P;P;D	0.64830	0.994;0.204;0.975;0.935;0.838;0.971	D;B;D;P;P;D	0.83275	0.996;0.239;0.985;0.889;0.899;0.992	D	0.85212	0.1021	10	0.87932	D	0	.	15.3723	0.74573	1.0:0.0:0.0:0.0	.	37;37;139;43;37;43	O94856-11;O94856-8;B4DRH7;O94856-9;O94856-3;O94856-2	.;.;.;.;.;.	L	43;43;43;43;43;43;37;37;37;43;43;43;37;43;43;37;37;13	ENSP00000356140:I43L;ENSP00000356139:I43L;ENSP00000356138:I43L;ENSP00000342128:I43L;ENSP00000344786:I43L;ENSP00000343509:I43L;ENSP00000438614:I37L;ENSP00000353154:I37L;ENSP00000356137:I43L;ENSP00000412161:I43L;ENSP00000384875:I43L;ENSP00000385676:I37L;ENSP00000385637:I43L;ENSP00000427586:I43L;ENSP00000384061:I37L;ENSP00000425908:I37L;ENSP00000415031:I13L	ENSP00000295776:I37L	I	+	1	0	NFASC	203187779	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.197000	0.94985	2.115000	0.64714	0.528000	0.53228	ATC	NFASC	-	pfam_Ig_I-set,pfscan_Ig-like	ENSG00000163531		0.587	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	68	0.00	0	A	NM_001005388		204921156	204921156	+1	no_errors	ENST00000367172	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	1.000	C
NKTR	4820	genome.wustl.edu	37	3	42679861	42679861	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr3:42679861T>A	ENST00000232978.8	+	13	2853	c.2665T>A	c.(2665-2667)Tca>Aca	p.S889T	RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	889					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		GGACTCTGAGTCAAATTCAGA	0.393																																						dbGAP											0													47.0	47.0	47.0					3																	42679861		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2665T>A	3.37:g.42679861T>A	ENSP00000232978:p.Ser889Thr			Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom	p.S889T	ENST00000232978.8	37	c.2665	CCDS2702.1	3	.	.	.	.	.	.	.	.	.	.	T	15.63	2.890225	0.52014	.	.	ENSG00000114857	ENST00000232978	T	0.18016	2.24	5.52	5.52	0.82312	.	0.119121	0.56097	D	0.000023	T	0.41604	0.1166	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.985	T	0.31308	-0.9948	10	0.87932	D	0	-8.7257	15.6286	0.76882	0.0:0.0:0.0:1.0	.	589;889	Q6M1B8;P30414	.;NKTR_HUMAN	T	889	ENSP00000232978:S889T	ENSP00000232978:S889T	S	+	1	0	NKTR	42654865	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	6.024000	0.70857	2.099000	0.63709	0.533000	0.62120	TCA	NKTR	-	NULL	ENSG00000114857		0.393	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	HGNC	protein_coding	OTTHUMT00000256642.2	182	0.00	0	T	NM_005385		42679861	42679861	+1	no_errors	ENST00000232978	ensembl	human	known	69_37n	missense	65	66.32	128	SNP	1.000	A
NOX3	50508	genome.wustl.edu	37	6	155775952	155775952	+	Missense_Mutation	SNP	G	G	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:155775952G>T	ENST00000159060.2	-	3	350	c.248C>A	c.(247-249)aCa>aAa	p.T83K		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	83	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TACAATACTTGTTCCTCTTAT	0.348																																						dbGAP											0													51.0	51.0	51.0					6																	155775952		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.248C>A	6.37:g.155775952G>T	ENSP00000159060:p.Thr83Lys		Q9HBJ9	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.T83K	ENST00000159060.2	37	c.248	CCDS5250.1	6	.	.	.	.	.	.	.	.	.	.	G	18.96	3.733795	0.69189	.	.	ENSG00000074771	ENST00000159060	D	0.91068	-2.78	5.91	5.91	0.95273	Flavoprotein transmembrane component (1);	0.370529	0.26478	N	0.024147	D	0.87474	0.6186	L	0.38175	1.15	0.35830	D	0.825253	P	0.36683	0.565	B	0.43413	0.419	D	0.88317	0.2960	10	0.56958	D	0.05	-6.5583	20.3011	0.98612	0.0:0.0:1.0:0.0	.	83	Q9HBY0	NOX3_HUMAN	K	83	ENSP00000159060:T83K	ENSP00000159060:T83K	T	-	2	0	NOX3	155817644	1.000000	0.71417	0.397000	0.26308	0.947000	0.59692	7.647000	0.83462	2.804000	0.96469	0.650000	0.86243	ACA	NOX3	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000074771		0.348	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1	170	0.00	0	G			155775952	155775952	-1	no_errors	ENST00000159060	ensembl	human	known	69_37n	missense	191	13.96	31	SNP	0.767	T
NPR3	4883	genome.wustl.edu	37	5	32780845	32780847	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr5:32780845_32780847delTCC	ENST00000265074.8	+	5	1556_1558	c.1213_1215delTCC	c.(1213-1215)tccdel	p.S405del	NPR3_ENST00000434067.2_In_Frame_Del_p.S189del|NPR3_ENST00000415167.2_In_Frame_Del_p.S405del|NPR3_ENST00000415685.2_In_Frame_Del_p.S189del|AC026703.2_ENST00000607869.1_RNA	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	405					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)	p.S405S(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	CGGGCAGGTGTCCATAGATGCCA	0.507																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.1213_1215delTCC	5.37:g.32780845_32780847delTCC	ENSP00000265074:p.Ser405del		A2RRD1|B4DT84|E7EPG9	In_Frame_Del	DEL	pfam_ANF_lig-bd_rcpt,prints_Ntpep_rcpt	p.S405in_frame_del	ENST00000265074.8	37	c.1213_1215	CCDS56357.1	5																																																																																			NPR3	-	pfam_ANF_lig-bd_rcpt,prints_Ntpep_rcpt	ENSG00000113389		0.507	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPR3	HGNC	protein_coding	OTTHUMT00000317550.3	127	0.00	0	TCC	NM_000908		32780845	32780847	+1	no_errors	ENST00000265074	ensembl	human	known	69_37n	in_frame_del	64	30.53	29	DEL	1.000:1.000:1.000	-
OTUD7A	161725	genome.wustl.edu	37	15	31851321	31851321	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr15:31851321G>A	ENST00000307050.4	-	3	493	c.401C>T	c.(400-402)gCa>gTa	p.A134V	OTUD7A_ENST00000382902.1_Missense_Mutation_p.A134V	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	134					protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GCATTCACTTGCCACGTGGGA	0.577																																						dbGAP											0													83.0	67.0	72.0					15																	31851321		2201	4300	6501	-	-	-	SO:0001583	missense	0			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.401C>T	15.37:g.31851321G>A	ENSP00000305926:p.Ala134Val		Q8IWK5	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.A134V	ENST00000307050.4	37	c.401	CCDS10026.1	15	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883356	0.91740	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.32753	1.44;1.44	5.75	5.75	0.90469	.	0.217737	0.47093	D	0.000260	T	0.46889	0.1416	L	0.50333	1.59	0.52501	D	0.999958	D;P	0.55385	0.971;0.952	P;P	0.55749	0.783;0.612	T	0.28459	-1.0043	10	0.52906	T	0.07	-17.8211	19.9472	0.97186	0.0:0.0:1.0:0.0	.	134;134	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	V	134	ENSP00000305926:A134V;ENSP00000372358:A134V	ENSP00000305926:A134V	A	-	2	0	OTUD7A	29638613	1.000000	0.71417	0.962000	0.40283	0.925000	0.55904	8.904000	0.92590	2.695000	0.91970	0.561000	0.74099	GCA	OTUD7A	-	NULL	ENSG00000169918		0.577	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2	35	0.00	0	G	NM_130901		31851321	31851321	-1	no_errors	ENST00000382902	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	A
PANK3	79646	genome.wustl.edu	37	5	167984618	167984618	+	Silent	SNP	A	A	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr5:167984618A>G	ENST00000239231.6	-	7	1387	c.1071T>C	c.(1069-1071)ttT>ttC	p.F357F	PANK3_ENST00000520504.1_5'UTR	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	357					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		CAACTGCTCCAAAGTAACCCT	0.373																																						dbGAP											0													115.0	105.0	109.0					5																	167984618		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.1071T>C	5.37:g.167984618A>G			D3DQL1|Q53FJ9|Q7RTX4	Silent	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.F357	ENST00000239231.6	37	c.1071	CCDS4368.1	5																																																																																			PANK3	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000120137		0.373	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK3	HGNC	protein_coding	OTTHUMT00000252793.2	186	0.00	0	A	NM_024594		167984618	167984618	-1	no_errors	ENST00000239231	ensembl	human	known	69_37n	silent	172	41.41	123	SNP	1.000	G
PARD6B	84612	genome.wustl.edu	37	20	49366477	49366477	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr20:49366477G>C	ENST00000371610.2	+	3	814	c.571G>C	c.(571-573)Ggg>Cgg	p.G191R	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	191	Interaction with PARD3 and CDC42. {ECO:0000250}.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						AAAGGTTCCAGGGATCTTTAT	0.453																																						dbGAP											0													74.0	74.0	74.0					20																	49366477		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.571G>C	20.37:g.49366477G>C	ENSP00000360672:p.Gly191Arg		A2A2A7|Q9Y510	Missense_Mutation	SNP	pfam_OPR_PB1,pfam_PDZ,superfamily_PDZ,smart_OPR_PB1,smart_PDZ,pfscan_PDZ	p.G191R	ENST00000371610.2	37	c.571	CCDS33485.1	20	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758291	0.69763	.	.	ENSG00000124171	ENST00000371610	T	0.34667	1.35	6.02	5.07	0.68467	PDZ/DHR/GLGF (4);	0.094665	0.64402	N	0.000001	T	0.66406	0.2786	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74569	-0.3622	10	0.87932	D	0	-30.1813	15.2123	0.73235	0.0672:0.0:0.9328:0.0	.	191	Q9BYG5	PAR6B_HUMAN	R	191	ENSP00000360672:G191R	ENSP00000360672:G191R	G	+	1	0	PARD6B	48799884	1.000000	0.71417	0.676000	0.29932	0.378000	0.30076	9.383000	0.97214	1.555000	0.49500	0.655000	0.94253	GGG	PARD6B	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000124171		0.453	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARD6B	HGNC	protein_coding	OTTHUMT00000079697.2	138	0.00	0	G	NM_032521		49366477	49366477	+1	no_errors	ENST00000371610	ensembl	human	known	69_37n	missense	321	21.13	86	SNP	0.995	C
PAX6	5080	genome.wustl.edu	37	11	31816281	31816281	+	Silent	SNP	G	G	A	rs367589686		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr11:31816281G>A	ENST00000379132.3	-	7	859	c.579C>T	c.(577-579)aaC>aaT	p.N193N	PAX6_ENST00000419022.1_Silent_p.N207N|PAX6_ENST00000379115.4_Silent_p.N207N|PAX6_ENST00000379111.2_Silent_p.N193N|PAX6_ENST00000379129.2_Silent_p.N207N|PAX6_ENST00000379107.2_Silent_p.N207N|PAX6_ENST00000241001.8_Silent_p.N193N|PAX6_ENST00000379123.5_Silent_p.N193N			P26367	PAX6_HUMAN	paired box 6	193	Gln/Gly-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					AATCTTCTCCGTTGGAACTGA	0.453									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																													dbGAP											0													123.0	111.0	115.0					11																	31816281		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.579C>T	11.37:g.31816281G>A			Q6N006|Q99413	Silent	SNP	pfam_Paired_dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeodomain,pfscan_Homeodomain,pfscan_Paired_dom,prints_Paired_dom	p.N207	ENST00000379132.3	37	c.621	CCDS31451.1	11																																																																																			PAX6	-	superfamily_Homeodomain-like	ENSG00000007372		0.453	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	PAX6	HGNC	protein_coding	OTTHUMT00000099293.4	95	0.00	0	G	NM_001604		31816281	31816281	-1	no_errors	ENST00000379107	ensembl	human	known	69_37n	silent	62	31.87	29	SNP	0.104	A
PCDHA8	56140	genome.wustl.edu	37	5	140223040	140223040	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr5:140223040G>C	ENST00000531613.1	+	1	2134	c.2134G>C	c.(2134-2136)Gtg>Ctg	p.V712L	PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.V712L|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	712					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCTGCTGGTGCTCACGCT	0.657																																						dbGAP											0													72.0	67.0	69.0					5																	140223040		2197	4266	6463	-	-	-	SO:0001583	missense	0			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.2134G>C	5.37:g.140223040G>C	ENSP00000434655:p.Val712Leu		B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V712L	ENST00000531613.1	37	c.2134	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	G	0.052	-1.247533	0.01469	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.16743	2.32;2.32	3.06	3.06	0.35304	.	0.000000	0.33199	U	0.005173	T	0.11367	0.0277	L	0.37561	1.115	0.23997	N	0.996226	B;B	0.30634	0.266;0.288	B;B	0.32533	0.147;0.109	T	0.25916	-1.0118	10	0.05436	T	0.98	.	10.802	0.46493	0.0:0.3553:0.6447:0.0	.	712;712	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	L	712	ENSP00000434655:V712L;ENSP00000367363:V712L	ENSP00000367363:V712L	V	+	1	0	PCDHA8	140203224	0.759000	0.28416	0.996000	0.52242	0.157000	0.22087	0.647000	0.24812	1.692000	0.51112	0.460000	0.39030	GTG	PCDHA8	-	NULL	ENSG00000204962		0.657	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	61	0.00	0	G	NM_018911		140223040	140223040	+1	no_errors	ENST00000531613	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	0.984	C
PCDHB18	54660	genome.wustl.edu	37	5	140615467	140615467	+	RNA	SNP	C	C	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr5:140615467C>T	ENST00000526308.1	+	0	1530					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N394N(1)		endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						TCAATGACAACGCCCCCATCT	0.562																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)																																								-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615467C>T			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.562	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	225	0.00	0	C			140615467	140615467	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	158	28.18	62	SNP	0.989	T
PCDHGA8	9708	genome.wustl.edu	37	5	140774003	140774003	+	Silent	SNP	C	C	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr5:140774003C>A	ENST00000398604.2	+	1	1623	c.1623C>A	c.(1621-1623)ccC>ccA	p.P541P	PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	541	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGACCCGCCCCTCAGCAGCA	0.607																																						dbGAP											0													86.0	104.0	98.0					5																	140774003		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1623C>A	5.37:g.140774003C>A			A7MCZ4|O15039	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P541	ENST00000398604.2	37	c.1623	CCDS47291.1	5																																																																																			PCDHGA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253767		0.607	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA8	HGNC	protein_coding	OTTHUMT00000376972.1	81	0.00	0	C	NM_032088		140774003	140774003	+1	no_errors	ENST00000398604	ensembl	human	known	69_37n	silent	55	14.06	9	SNP	0.771	A
PCDH12	51294	genome.wustl.edu	37	5	141335925	141335925	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr5:141335925G>A	ENST00000231484.3	-	1	2702	c.1492C>T	c.(1492-1494)Cgc>Tgc	p.R498C	PCDH12_ENST00000512221.1_5'Flank|AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	498	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTGGATGCGGTATGAGACT	0.488																																						dbGAP											0													99.0	98.0	99.0					5																	141335925		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.1492C>T	5.37:g.141335925G>A	ENSP00000231484:p.Arg498Cys		Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R498C	ENST00000231484.3	37	c.1492	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955934	0.34471	.	.	ENSG00000113555	ENST00000231484	T	0.54071	0.59	5.16	4.29	0.51040	Cadherin (4);Cadherin-like (1);	0.329239	0.34200	N	0.004170	T	0.56688	0.2002	L	0.60904	1.88	0.42985	D	0.994474	D	0.71674	0.998	P	0.54815	0.761	T	0.59059	-0.7525	10	0.52906	T	0.07	.	6.4747	0.22028	0.0906:0.0:0.7301:0.1792	.	498	Q9NPG4	PCD12_HUMAN	C	498	ENSP00000231484:R498C	ENSP00000231484:R498C	R	-	1	0	PCDH12	141316109	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	2.829000	0.48128	1.401000	0.46761	0.655000	0.94253	CGC	PCDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113555		0.488	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	HGNC	protein_coding	OTTHUMT00000251858.1	141	0.00	0	G	NM_016580		141335925	141335925	-1	no_errors	ENST00000231484	ensembl	human	known	69_37n	missense	158	18.13	35	SNP	1.000	A
PEX6	5190	genome.wustl.edu	37	6	42932585	42932585	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:42932585G>C	ENST00000304611.8	-	16	2818	c.2749C>G	c.(2749-2751)Ctc>Gtc	p.L917V	PEX6_ENST00000244546.4_3'UTR	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	917					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			TCAGAGCAGAGAGAGTAGAGG	0.552																																						dbGAP											0													113.0	104.0	107.0					6																	42932585		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.2749C>G	6.37:g.42932585G>C	ENSP00000303511:p.Leu917Val		Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.L917V	ENST00000304611.8	37	c.2749	CCDS4877.1	6	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700767	0.88924	.	.	ENSG00000124587	ENST00000304611	D	0.95690	-3.78	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.95258	0.8462	L	0.51914	1.62	0.80722	D	1	D	0.65815	0.995	D	0.64410	0.925	D	0.93602	0.6931	10	0.28530	T	0.3	-16.6446	13.6207	0.62136	0.0751:0.0:0.9249:0.0	.	917	Q13608	PEX6_HUMAN	V	917	ENSP00000303511:L917V	ENSP00000303511:L917V	L	-	1	0	PEX6	43040563	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.060000	0.71141	2.662000	0.90505	0.555000	0.69702	CTC	PEX6	-	NULL	ENSG00000124587		0.552	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX6	HGNC	protein_coding	OTTHUMT00000040569.1	103	0.00	0	G	NM_000287		42932585	42932585	-1	no_errors	ENST00000304611	ensembl	human	known	69_37n	missense	58	22.67	17	SNP	1.000	C
PTCH2	8643	genome.wustl.edu	37	1	45288193	45288194	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:45288193_45288194insG	ENST00000372192.3	-	22	3635_3636	c.3505_3506insC	c.(3505-3507)ctgfs	p.L1169fs	RNU5E-6P_ENST00000365574.1_RNA|PTCH2_ENST00000447098.2_Intron	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	1169					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					GGCACCAGGCAGGGGGGGTGGG	0.653									Basal Cell Nevus syndrome																													dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.3506dupC	1.37:g.45288200_45288200dupG	ENSP00000361266:p.Leu1169fs		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Frame_Shift_Ins	INS	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.L1169fs	ENST00000372192.3	37	c.3506_3505	CCDS516.1	1																																																																																			PTCH2	-	NULL	ENSG00000117425		0.653	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCH2	HGNC	protein_coding	OTTHUMT00000023428.4	35	0.00	0	-	NM_003738		45288193	45288194	-1	no_errors	ENST00000372192	ensembl	human	known	69_37n	frame_shift_ins	27	12.90	4	INS	0.924:0.616	G
PIK3C2B	5287	genome.wustl.edu	37	1	204393999	204393999	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:204393999C>T	ENST00000367187.3	-	34	5442	c.4886G>A	c.(4885-4887)cGa>cAa	p.R1629Q	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.R1601Q|RP11-739N20.2_ENST00000443515.1_RNA	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1629					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GCCATGACTTCGAGATCCCAG	0.632																																						dbGAP											0													58.0	55.0	56.0					1																	204393999		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4886G>A	1.37:g.204393999C>T	ENSP00000356155:p.Arg1629Gln		O95666|Q5SW99	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.R1629Q	ENST00000367187.3	37	c.4886	CCDS1446.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965106	0.74131	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.79352	-1.26;-1.26	5.46	4.54	0.55810	C2 calcium/lipid-binding domain, CaLB (1);	0.278501	0.32563	N	0.005934	D	0.82444	0.5038	M	0.73217	2.22	0.27748	N	0.944245	D;B	0.67145	0.996;0.016	P;B	0.53062	0.717;0.002	T	0.78152	-0.2315	10	0.56958	D	0.05	.	14.2906	0.66275	0.0:0.9264:0.0:0.0736	.	1601;1629	F5GWN5;O00750	.;P3C2B_HUMAN	Q	1629;1601	ENSP00000356155:R1629Q;ENSP00000400561:R1601Q	ENSP00000356155:R1629Q	R	-	2	0	PIK3C2B	202660622	1.000000	0.71417	0.953000	0.39169	0.519000	0.34347	2.970000	0.49240	2.571000	0.86741	0.655000	0.94253	CGA	PIK3C2B	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000133056		0.632	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	33	0.00	0	C	NM_002646		204393999	204393999	-1	no_errors	ENST00000367187	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	0.993	T
RALGAPA2	57186	genome.wustl.edu	37	20	20493753	20493753	+	Silent	SNP	C	C	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr20:20493753C>T	ENST00000202677.7	-	32	4267	c.4260G>A	c.(4258-4260)gtG>gtA	p.V1420V		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1420					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GACTTCTGAACACCTCAAAGG	0.552																																						dbGAP											0													52.0	51.0	51.0					20																	20493753		1942	4146	6088	-	-	-	SO:0001819	synonymous_variant	0			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.4260G>A	20.37:g.20493753C>T			Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.C1237Y	ENST00000202677.7	37	c.3710	CCDS46584.1	20	.	.	.	.	.	.	.	.	.	.	C	7.616	0.675882	0.14841	.	.	ENSG00000188559	ENST00000430436	.	.	.	5.62	3.59	0.41128	.	.	.	.	.	T	0.64193	0.2576	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61148	-0.7121	4	.	.	.	.	13.1848	0.59675	0.1033:0.7238:0.1729:0.0	.	.	.	.	Y	1237	.	.	C	-	2	0	RALGAPA2	20441753	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	1.349000	0.33998	2.803000	0.96430	0.591000	0.81541	TGT	RALGAPA2	-	NULL	ENSG00000188559		0.552	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGAPA2	HGNC	protein_coding	OTTHUMT00000471941.1	92	0.00	0	C	NM_020343		20493753	20493753	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430436	ensembl	human	known	69_37n	missense	43	41.89	31	SNP	1.000	T
RBM47	54502	genome.wustl.edu	37	4	40440303	40440304	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr4:40440303_40440304delCT	ENST00000381793.2	-	3	1003_1004	c.607_608delAG	c.(607-609)agcfs	p.S203fs	RBM47_ENST00000381795.6_Frame_Shift_Del_p.S203fs|RBM47_ENST00000319592.4_Frame_Shift_Del_p.S203fs|RBM47_ENST00000514014.1_Frame_Shift_Del_p.S165fs|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000295971.7_Frame_Shift_Del_p.S203fs			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	203	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						CGCGCGGTGGCTCTCGTACTCC	0.663																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.607_608delAG	4.37:g.40440305_40440306delCT	ENSP00000371212:p.Ser203fs		A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.S203fs	ENST00000381793.2	37	c.608_607	CCDS43223.1	4																																																																																			RBM47	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000163694		0.663	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM47	HGNC	protein_coding	OTTHUMT00000250456.2	34	0.00	0	CT	NM_019027		40440303	40440304	-1	no_errors	ENST00000295971	ensembl	human	known	69_37n	frame_shift_del	15	34.78	8	DEL	1.000:1.000	-
RFPL1	5988	genome.wustl.edu	37	22	29834893	29834893	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr22:29834893G>A	ENST00000354373.2	+	1	322	c.113G>A	c.(112-114)aGc>aAc	p.S38N	RFPL1S_ENST00000461286.3_RNA|RFPL1S_ENST00000539579.1_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1	38							zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						CAAGAAGCAAGCAGCTGTCCC	0.507																																						dbGAP											0													96.0	92.0	94.0					22																	29834893		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516	ENST00000354373.2:c.113G>A	22.37:g.29834893G>A	ENSP00000346342:p.Ser38Asn		Q6IC06|Q9UJ97	Missense_Mutation	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.S38N	ENST00000354373.2	37	c.113	CCDS13857.2	22	.	.	.	.	.	.	.	.	.	.	-	11.85	1.762282	0.31228	.	.	ENSG00000128250	ENST00000354373	T	0.17054	2.3	1.52	-0.0341	0.13898	Zinc finger, RING/FYVE/PHD-type (1);	.	.	.	.	T	0.28566	0.0707	L	0.61036	1.89	0.09310	N	1	D	0.59767	0.986	P	0.62491	0.903	T	0.11012	-1.0605	9	0.59425	D	0.04	.	4.0621	0.09843	0.0:0.0:0.5934:0.4066	.	38	O75677	RFPL1_HUMAN	N	38	ENSP00000346342:S38N	ENSP00000346342:S38N	S	+	2	0	RFPL1	28164893	0.006000	0.16342	0.010000	0.14722	0.073000	0.16967	0.539000	0.23175	0.763000	0.33175	0.418000	0.28097	AGC	RFPL1	-	NULL	ENSG00000128250		0.507	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFPL1	HGNC	protein_coding	OTTHUMT00000318719.1	266	0.00	0	G	NM_021026		29834893	29834893	+1	no_errors	ENST00000354373	ensembl	human	known	69_37n	missense	555	11.48	72	SNP	0.003	A
RGPD3	653489	genome.wustl.edu	37	2	107041153	107041153	+	Silent	SNP	G	G	A	rs538928650		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr2:107041153G>A	ENST00000409886.3	-	20	3357	c.3270C>T	c.(3268-3270)aaC>aaT	p.N1090N	RGPD3_ENST00000304514.7_Silent_p.N1090N	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1090	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						CATTGACCTCGTTTTTGAGAA	0.388													.|||	1	0.000199681	0.0	0.0	5008	,	,		19875	0.0		0.0	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.3270C>T	2.37:g.107041153G>A			B8ZZM4	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.N1090	ENST00000409886.3	37	c.3270	CCDS46379.1	2																																																																																			RGPD3	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000153165		0.388	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	1286	0.00	0	G	XM_929931		107041153	107041153	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	silent	1164	15.85	220	SNP	0.929	A
RMND5B	64777	genome.wustl.edu	37	5	177573261	177573261	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr5:177573261G>A	ENST00000515098.1	+	9	1192	c.841G>A	c.(841-843)Gag>Aag	p.E281K	RMND5B_ENST00000542098.1_Missense_Mutation_p.E268K|RMND5B_ENST00000313386.4_Missense_Mutation_p.E281K			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	281										endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTTTCTGTGGAGTCCCCCCT	0.602											OREG0017097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													54.0	48.0	50.0					5																	177573261		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.841G>A	5.37:g.177573261G>A	ENSP00000420875:p.Glu281Lys	1939	Q1HE27|Q6UVY7|Q9H6F6	Missense_Mutation	SNP	smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.E281K	ENST00000515098.1	37	c.841	CCDS4431.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.662184	0.96734	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000542098	.	.	.	5.65	5.65	0.86999	Ran binding protein-like, CRA domain (1);	0.055638	0.64402	N	0.000001	T	0.76118	0.3943	M	0.76574	2.34	0.80722	D	1	P;P;P	0.46859	0.743;0.698;0.885	B;B;P	0.57620	0.359;0.245;0.824	T	0.74677	-0.3585	9	0.39692	T	0.17	-28.1227	17.2182	0.86950	0.0:0.0:1.0:0.0	.	268;268;281	B3KSG5;F5H6G4;Q96G75	.;.;RMD5B_HUMAN	K	281;281;268	.	ENSP00000320623:E281K	E	+	1	0	RMND5B	177505867	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.602000	0.98312	2.659000	0.90383	0.655000	0.94253	GAG	RMND5B	-	smart_CRA_dom	ENSG00000145916		0.602	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMND5B	HGNC	protein_coding	OTTHUMT00000373542.1	16	0.00	0	G	NM_022762		177573261	177573261	+1	no_errors	ENST00000313386	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237890431	237890431	+	Silent	SNP	A	A	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:237890431A>G	ENST00000366574.2	+	76	11087	c.10770A>G	c.(10768-10770)ctA>ctG	p.L3590L	RYR2_ENST00000542537.1_Silent_p.L3574L|RYR2_ENST00000360064.6_Silent_p.L3588L|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3590	Interaction with CALM.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGCATAAACTACTGTCCAAGC	0.398																																						dbGAP											0													89.0	86.0	87.0					1																	237890431		1847	4080	5927	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10770A>G	1.37:g.237890431A>G			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L3588	ENST00000366574.2	37	c.10764	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.398	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	265	0.00	0	A	NM_001035		237890431	237890431	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	256	13.51	40	SNP	0.942	G
SLC13A1	6561	genome.wustl.edu	37	7	122759261	122759261	+	Missense_Mutation	SNP	T	T	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr7:122759261T>A	ENST00000194130.2	-	13	1425	c.1386A>T	c.(1384-1386)ttA>ttT	p.L462F	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	462					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	CCAGAGGAGATAATTTATTTC	0.333																																						dbGAP											0													77.0	82.0	80.0					7																	122759261		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.1386A>T	7.37:g.122759261T>A	ENSP00000194130:p.Leu462Phe		Q9H5Z0	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.L462F	ENST00000194130.2	37	c.1386	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	T	17.74	3.463847	0.63513	.	.	ENSG00000081800	ENST00000194130	T	0.03689	3.84	5.26	2.88	0.33553	.	0.143183	0.47852	N	0.000214	T	0.14356	0.0347	M	0.78344	2.41	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76575	0.988;0.988	T	0.00173	-1.1957	10	0.66056	D	0.02	-11.7488	7.0968	0.25315	0.0:0.3607:0.0:0.6393	.	462;462	A4D0X1;Q9BZW2	.;S13A1_HUMAN	F	462	ENSP00000194130:L462F	ENSP00000194130:L462F	L	-	3	2	SLC13A1	122546497	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.983000	0.29552	0.319000	0.23209	0.482000	0.46254	TTA	SLC13A1	-	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	ENSG00000081800		0.333	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	HGNC	protein_coding	OTTHUMT00000347404.1	175	0.00	0	T	NM_022444		122759261	122759261	-1	no_errors	ENST00000194130	ensembl	human	known	69_37n	missense	130	41.70	93	SNP	0.993	A
SLC17A2	10246	genome.wustl.edu	37	6	25921430	25921430	+	Silent	SNP	G	G	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:25921430G>T	ENST00000265425.3	-	3	471	c.451C>A	c.(451-453)Cgg>Agg	p.R151R	SLC17A2_ENST00000360488.3_Silent_p.R151R|SLC17A2_ENST00000377850.3_Silent_p.R151R			O00624	NPT3_HUMAN	solute carrier family 17, member 2	151					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						TGGACTGTCCGAACCATGATG	0.438																																						dbGAP											0													115.0	104.0	107.0					6																	25921430		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.451C>A	6.37:g.25921430G>T			A6NK81|A6NLD6|Q5TB84|Q76P85	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R151	ENST00000265425.3	37	c.451		6																																																																																			SLC17A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000112337		0.438	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	SLC17A2	HGNC	protein_coding	OTTHUMT00000040075.1	195	0.00	0	G			25921430	25921430	-1	no_errors	ENST00000377850	ensembl	human	known	69_37n	silent	232	14.71	40	SNP	0.691	T
SLC17A2	10246	genome.wustl.edu	37	6	25921485	25921485	+	Silent	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:25921485G>A	ENST00000265425.3	-	3	416	c.396C>T	c.(394-396)ctC>ctT	p.L132L	SLC17A2_ENST00000360488.3_Silent_p.L132L|SLC17A2_ENST00000377850.3_Silent_p.L132L			O00624	NPT3_HUMAN	solute carrier family 17, member 2	132					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						TAAAGAGGGTGAGAAGGGAAG	0.463																																						dbGAP											0													144.0	128.0	133.0					6																	25921485		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.396C>T	6.37:g.25921485G>A			A6NK81|A6NLD6|Q5TB84|Q76P85	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L132	ENST00000265425.3	37	c.396		6																																																																																			SLC17A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000112337		0.463	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	SLC17A2	HGNC	protein_coding	OTTHUMT00000040075.1	212	0.00	0	G			25921485	25921485	-1	no_errors	ENST00000377850	ensembl	human	known	69_37n	silent	217	17.18	45	SNP	1.000	A
SLC35A5	55032	genome.wustl.edu	37	3	112300106	112300106	+	Missense_Mutation	SNP	C	C	T	rs372446123		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr3:112300106C>T	ENST00000492406.1	+	6	1425	c.1142C>T	c.(1141-1143)cCg>cTg	p.P381L	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	381					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						CCTCAAGTTCCGGAATACGCA	0.468																																						dbGAP											0													47.0	52.0	51.0					3																	112300106		2197	4283	6480	-	-	-	SO:0001583	missense	0			AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.1142C>T	3.37:g.112300106C>T	ENSP00000417654:p.Pro381Leu		D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pfam_DMT,pfam_DUF250,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.P381L	ENST00000492406.1	37	c.1142	CCDS2967.1	3	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381544	0.24944	.	.	ENSG00000138459	ENST00000492406	T	0.45276	0.9	5.77	3.38	0.38709	.	0.631448	0.17100	N	0.187026	T	0.17534	0.0421	N	0.04508	-0.205	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.20009	-1.0288	10	0.20519	T	0.43	2.404	5.067	0.14587	0.1338:0.1434:0.0:0.7228	.	381	Q9BS91	S35A5_HUMAN	L	381	ENSP00000417654:P381L	ENSP00000417654:P381L	P	+	2	0	SLC35A5	113782796	0.000000	0.05858	0.689000	0.30133	0.190000	0.23558	0.094000	0.15107	0.522000	0.28464	-0.482000	0.04802	CCG	SLC35A5	-	pirsf_UDP/CMP-sugar_transptr	ENSG00000138459		0.468	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A5	HGNC	protein_coding	OTTHUMT00000354184.1	165	0.00	0	C	NM_017945		112300106	112300106	+1	no_errors	ENST00000492406	ensembl	human	known	69_37n	missense	183	13.27	28	SNP	0.118	T
SMEK2	57223	genome.wustl.edu	37	2	55808732	55808732	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr2:55808732delC	ENST00000345102.5	-	8	1637	c.1336delG	c.(1336-1338)gatfs	p.D446fs	SMEK2_ENST00000407823.3_Frame_Shift_Del_p.D446fs|SMEK2_ENST00000272313.5_Frame_Shift_Del_p.D446fs	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	446					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TTCTCTGGATCAATTAGAGTA	0.358																																						dbGAP											0													142.0	139.0	140.0					2																	55808732		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1336delG	2.37:g.55808732delC	ENSP00000339769:p.Asp446fs		Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Frame_Shift_Del	DEL	pfam_DUF625,superfamily_ARM-type_fold	p.D446fs	ENST00000345102.5	37	c.1336	CCDS46289.1	2																																																																																			SMEK2	-	superfamily_ARM-type_fold	ENSG00000138041		0.358	SMEK2-002	NOVEL	basic|CCDS	protein_coding	SMEK2	HGNC	protein_coding	OTTHUMT00000251483.1	279	0.00	0	C	NM_020463		55808732	55808732	-1	no_errors	ENST00000272313	ensembl	human	known	69_37n	frame_shift_del	225	13.26	35	DEL	1.000	-
SYNE2	23224	genome.wustl.edu	37	14	64681163	64681164	+	In_Frame_Ins	INS	-	-	TAT			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr14:64681163_64681164insTAT	ENST00000344113.4	+	106	19520_19521	c.19308_19309insTAT	c.(19309-19311)ggc>TATggc	p.6436_6437insY	SYNE2_ENST00000441438.2_5'Flank|SYNE2_ENST00000458046.2_In_Frame_Ins_p.70_71insY|SYNE2_ENST00000555002.1_In_Frame_Ins_p.3070_3071insY|SYNE2_ENST00000358025.3_In_Frame_Ins_p.6436_6437insY|SYNE2_ENST00000554805.1_In_Frame_Ins_p.219_220insY|SYNE2_ENST00000555022.1_In_Frame_Ins_p.314_315insY|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_In_Frame_Ins_p.2821_2822insY|SYNE2_ENST00000394768.2_In_Frame_Ins_p.2821_2822insY|SYNE2_ENST00000554584.1_In_Frame_Ins_p.6378_6379insY	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6436					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGGACGAGGAGGGCCCATACTA	0.619																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	Exception_encountered	14.37:g.64681163_64681164insTAT	ENSP00000341781:p.Glu6436_Gly6437insTyr		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	In_Frame_Ins	INS	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.6436in_frame_insY	ENST00000344113.4	37	c.19308_19309	CCDS41963.1	14																																																																																			SYNE2	-	NULL	ENSG00000054654		0.619	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	63	0.00	0	-	NM_182914		64681163	64681164	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	in_frame_ins	27	25.00	9	INS	0.966:0.974	TAT
TACC2	10579	genome.wustl.edu	37	10	123985898	123985898	+	Silent	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr10:123985898G>A	ENST00000369005.1	+	13	7966	c.7626G>A	c.(7624-7626)ccG>ccA	p.P2542P	TACC2_ENST00000369004.3_Silent_p.P632P|TACC2_ENST00000360561.3_Silent_p.P620P|TACC2_ENST00000515603.1_Silent_p.P2497P|TACC2_ENST00000515273.1_Silent_p.P2546P|TACC2_ENST00000260733.3_Silent_p.P620P|TACC2_ENST00000369000.1_Silent_p.P242P|TACC2_ENST00000369001.1_Silent_p.P246P|TACC2_ENST00000453444.2_Silent_p.P2546P|TACC2_ENST00000358010.1_Silent_p.P688P|TACC2_ENST00000368999.1_Silent_p.P632P|TACC2_ENST00000513429.1_Silent_p.P688P|TACC2_ENST00000334433.3_Silent_p.P2542P	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2542					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				ACGATGCCCCGAAGAAGCAGG	0.537																																						dbGAP											0													145.0	109.0	121.0					10																	123985898		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.7626G>A	10.37:g.123985898G>A			Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	pfam_TACC	p.P2542	ENST00000369005.1	37	c.7626	CCDS7626.1	10																																																																																			TACC2	-	NULL	ENSG00000138162		0.537	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	55	0.00	0	G			123985898	123985898	+1	no_errors	ENST00000334433	ensembl	human	known	69_37n	silent	60	15.49	11	SNP	0.999	A
TAS2R13	50838	genome.wustl.edu	37	12	11061556	11061556	+	Missense_Mutation	SNP	G	G	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr12:11061556G>C	ENST00000390677.2	-	1	605	c.342C>G	c.(340-342)ttC>ttG	p.F114L	PRR4_ENST00000536668.1_Intron	NM_023920.2	NP_076409.1	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	114					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						CAGGGCTAGAGAAACTCGCTA	0.338																																						dbGAP											0													54.0	59.0	57.0					12																	11061556		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227137	CCDS8635.1	12p13	2012-08-22			ENSG00000212128	ENSG00000212128		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14919	protein-coding gene	gene with protein product		604792				10761934, 10766242	Standard	NM_023920		Approved	T2R13, TRB3	uc001qzg.1	Q9NYV9		ENST00000390677.2:c.342C>G	12.37:g.11061556G>C	ENSP00000375095:p.Phe114Leu		Q4G0I5|Q502V8|Q645X2	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.F114L	ENST00000390677.2	37	c.342	CCDS8635.1	12	.	.	.	.	.	.	.	.	.	.	G	6.979	0.550622	0.13374	.	.	ENSG00000212128	ENST00000390677	T	0.36699	1.24	3.3	-2.08	0.07254	.	0.412785	0.21935	U	0.066979	T	0.56848	0.2013	H	0.94306	3.52	0.09310	N	1	P	0.37708	0.606	P	0.51016	0.656	T	0.57562	-0.7790	10	0.87932	D	0	.	7.506	0.27545	0.5687:0.0:0.4313:0.0	.	114	Q9NYV9	T2R13_HUMAN	L	114	ENSP00000375095:F114L	ENSP00000375095:F114L	F	-	3	2	TAS2R13	10952823	0.019000	0.18553	0.003000	0.11579	0.263000	0.26337	-0.243000	0.08915	-0.708000	0.05015	-0.136000	0.14681	TTC	TAS2R13	-	pfam_TAS2_rcpt	ENSG00000212128		0.338	TAS2R13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R13	HGNC	protein_coding	OTTHUMT00000400229.1	201	0.00	0	G			11061556	11061556	-1	no_errors	ENST00000390677	ensembl	human	known	69_37n	missense	266	18.15	59	SNP	0.011	C
TNKS1BP1	85456	genome.wustl.edu	37	11	57075876	57075876	+	Missense_Mutation	SNP	C	C	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr11:57075876C>T	ENST00000532437.1	-	5	4620	c.4309G>A	c.(4309-4311)Gga>Aga	p.G1437R	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.G1437R|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1437	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.G1437*(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TACCTTGCTCCGAAGCTGAGG	0.542																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											265.0	270.0	269.0					11																	57075876		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.4309G>A	11.37:g.57075876C>T	ENSP00000437271:p.Gly1437Arg		A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	NULL	p.G1437R	ENST00000532437.1	37	c.4309	CCDS7951.1	11	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733025	0.48939	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.31247	1.5;1.5	4.63	4.63	0.57726	.	0.538223	0.16823	N	0.198074	T	0.50565	0.1623	M	0.62723	1.935	0.36734	D	0.881873	D	0.89917	1.0	D	0.70716	0.97	T	0.54820	-0.8236	10	0.40728	T	0.16	-5.1097	13.3352	0.60515	0.0:1.0:0.0:0.0	.	1437	Q9C0C2	TB182_HUMAN	R	1437	ENSP00000350990:G1437R;ENSP00000437271:G1437R	ENSP00000350990:G1437R	G	-	1	0	TNKS1BP1	56832452	0.072000	0.21174	0.994000	0.49952	0.036000	0.12997	0.848000	0.27710	2.279000	0.76181	0.561000	0.74099	GGA	TNKS1BP1	-	NULL	ENSG00000149115		0.542	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TNKS1BP1	HGNC	protein_coding	OTTHUMT00000392455.1	795	0.00	0	C	NM_033396		57075876	57075876	-1	no_errors	ENST00000358252	ensembl	human	known	69_37n	missense	362	34.66	192	SNP	0.963	T
TRAF3IP3	80342	genome.wustl.edu	37	1	209954787	209954787	+	Missense_Mutation	SNP	A	A	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:209954787A>C	ENST00000367024.1	+	16	2063	c.1547A>C	c.(1546-1548)cAg>cCg	p.Q516P	TRAF3IP3_ENST00000367026.3_Missense_Mutation_p.Q496P|TRAF3IP3_ENST00000367025.3_Missense_Mutation_p.Q516P|TRAF3IP3_ENST00000467830.1_3'UTR|TRAF3IP3_ENST00000010338.4_Missense_Mutation_p.Q496P|TRAF3IP3_ENST00000477431.1_Intron			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3	516						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		AACCAGAGCCAGCAGCTGCCT	0.488																																						dbGAP											0													96.0	94.0	95.0					1																	209954787		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.1547A>C	1.37:g.209954787A>C	ENSP00000355991:p.Gln516Pro		A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Missense_Mutation	SNP	NULL	p.Q516P	ENST00000367024.1	37	c.1547	CCDS1490.2	1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.482894	0.44147	.	.	ENSG00000009790	ENST00000367025;ENST00000367026;ENST00000367024;ENST00000010338	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.29	1.59	0.23543	.	0.538685	0.18090	N	0.152006	T	0.37785	0.1016	L	0.56769	1.78	0.26304	N	0.977939	B;B	0.14438	0.01;0.01	B;B	0.14023	0.01;0.01	T	0.40515	-0.9559	10	0.87932	D	0	-0.8265	2.5531	0.04753	0.6116:0.1567:0.0817:0.1499	.	516;496	Q9Y228;Q9Y228-2	T3JAM_HUMAN;.	P	516;496;516;496	ENSP00000355992:Q516P;ENSP00000355993:Q496P;ENSP00000355991:Q516P;ENSP00000010338:Q496P	ENSP00000010338:Q496P	Q	+	2	0	TRAF3IP3	208021410	0.958000	0.32768	0.985000	0.45067	0.906000	0.53458	1.011000	0.29911	0.018000	0.15052	0.533000	0.62120	CAG	TRAF3IP3	-	NULL	ENSG00000009790		0.488	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRAF3IP3	HGNC	protein_coding	OTTHUMT00000088734.2	295	0.34	1	A			209954787	209954787	+1	no_errors	ENST00000367024	ensembl	human	known	69_37n	missense	239	24.21	77	SNP	0.993	C
TRAM2	9697	genome.wustl.edu	37	6	52370468	52370468	+	Silent	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:52370468G>A	ENST00000182527.3	-	9	803	c.804C>T	c.(802-804)ggC>ggT	p.G268G	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	268	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					CCAGTCCAAAGCCAATGGCCA	0.532																																						dbGAP											0													109.0	108.0	108.0					6																	52370468		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.804C>T	6.37:g.52370468G>A			A8K6T6	Silent	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.G268	ENST00000182527.3	37	c.804	CCDS34477.1	6																																																																																			TRAM2	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	ENSG00000065308		0.532	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM2	HGNC	protein_coding	OTTHUMT00000040910.1	132	0.00	0	G	NM_012288		52370468	52370468	-1	no_errors	ENST00000182527	ensembl	human	known	69_37n	silent	89	34.07	46	SNP	1.000	A
TRIM49C	642612	genome.wustl.edu	37	11	89774252	89774252	+	Missense_Mutation	SNP	G	G	A	rs201409537		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr11:89774252G>A	ENST00000448984.1	+	8	1222	c.893G>A	c.(892-894)aGt>aAt	p.S298N	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	298	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S298N(4)		endometrium(3)|kidney(1)|lung(4)	8						GAAGCCAACAGTGATATCTTT	0.323																																						dbGAP											4	Substitution - Missense(4)	endometrium(2)|kidney(2)																																								-	-	-	SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.893G>A	11.37:g.89774252G>A	ENSP00000388299:p.Ser298Asn		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S298N	ENST00000448984.1	37	c.893	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	g	0.625	-0.819420	0.02776	.	.	ENSG00000204449	ENST00000448984	T	0.04809	3.55	0.823	-0.634	0.11516	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.04452	0.0122	L	0.52206	1.635	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.43605	-0.9381	8	.	.	.	.	3.2016	0.06651	0.4432:0.0:0.5568:0.0	rs672762;rs9666958;rs16912727;rs672762	298	P0CI26	T49L2_HUMAN	N	298	ENSP00000388299:S298N	.	S	+	2	0	TRIM49L2	89413900	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	-1.058000	0.03482	-0.239000	0.09710	0.305000	0.20034	AGT	TRIM49C	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000204449		0.323	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	187	0.53	1	G	NM_001195234		89774252	89774252	+1	no_errors	ENST00000448984	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.001	A
TRIM63	84676	genome.wustl.edu	37	1	26386771	26386771	+	Missense_Mutation	SNP	G	G	C	rs200823488		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:26386771G>C	ENST00000374272.3	-	4	721	c.583C>G	c.(583-585)Cgt>Ggt	p.R195G	TRIM63_ENST00000483052.1_5'Flank	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	195	Interaction with TTN.				cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		GTCACTCGACGGGAATCCTCC	0.572																																						dbGAP											0													116.0	108.0	111.0					1																	26386771		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.583C>G	1.37:g.26386771G>C	ENSP00000363390:p.Arg195Gly		B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.R195G	ENST00000374272.3	37	c.583	CCDS273.1	1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196632	0.38806	.	.	ENSG00000158022	ENST00000374272	T	0.41065	1.01	5.21	1.39	0.22231	.	0.128263	0.85682	D	0.000000	T	0.17365	0.0417	N	0.03608	-0.345	0.27573	N	0.949816	B	0.06786	0.001	B	0.06405	0.002	T	0.12604	-1.0541	10	0.52906	T	0.07	.	6.1043	0.20065	0.6795:0.0:0.0703:0.2503	.	195	Q969Q1	TRI63_HUMAN	G	195	ENSP00000363390:R195G	ENSP00000363390:R195G	R	-	1	0	TRIM63	26259358	1.000000	0.71417	0.999000	0.59377	0.790000	0.44656	5.145000	0.64839	0.021000	0.15133	-0.605000	0.04089	CGT	TRIM63	-	NULL	ENSG00000158022		0.572	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM63	HGNC	protein_coding	OTTHUMT00000019750.1	59	0.00	0	G	NM_032588		26386771	26386771	-1	no_errors	ENST00000374272	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	C
TRIP12	9320	genome.wustl.edu	37	2	230656625	230656625	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr2:230656625G>A	ENST00000283943.5	-	28	4325	c.4147C>T	c.(4147-4149)Cct>Tct	p.P1383S	TRIP12_ENST00000389044.4_Missense_Mutation_p.P1431S|TRIP12_ENST00000389045.3_Missense_Mutation_p.P1113S	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1383					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CTGCCTAGAGGATTGCTCTCA	0.383																																						dbGAP											0													196.0	190.0	192.0					2																	230656625		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4147C>T	2.37:g.230656625G>A	ENSP00000283943:p.Pro1383Ser		D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.P1383S	ENST00000283943.5	37	c.4147	CCDS33391.1	2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.439063	0.83885	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.46063	0.89;1.25;0.88	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.56352	0.1979	L	0.33339	1.005	0.80722	D	1	D;D;D	0.63880	0.993;0.982;0.993	D;D;D	0.72982	0.979;0.939;0.979	T	0.54912	-0.8222	10	0.51188	T	0.08	.	19.762	0.96323	0.0:0.0:1.0:0.0	.	1113;1431;1383	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	S	1383;1113;1431	ENSP00000283943:P1383S;ENSP00000373697:P1113S;ENSP00000373696:P1431S	ENSP00000283943:P1383S	P	-	1	0	TRIP12	230364869	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.421000	0.97455	2.652000	0.90054	0.585000	0.79938	CCT	TRIP12	-	NULL	ENSG00000153827		0.383	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	395	0.00	0	G	NM_004238		230656625	230656625	-1	no_errors	ENST00000283943	ensembl	human	known	69_37n	missense	264	21.66	73	SNP	1.000	A
TRPM4	54795	genome.wustl.edu	37	19	49703867	49703867	+	Splice_Site	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr19:49703867G>A	ENST00000252826.5	+	19	2904		c.e19-1		TRPM4_ENST00000355712.5_Splice_Site|TRPM4_ENST00000427978.2_Splice_Site	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4						calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TCTCCCCACAGATGAAGGACG	0.612																																						dbGAP											0													55.0	50.0	52.0					19																	49703867		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.2779-1G>A	19.37:g.49703867G>A			A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Splice_Site	SNP	-	e19-1	ENST00000252826.5	37	c.2779-1	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	G	14.35	2.510628	0.44660	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8577	0.86009	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRPM4	54395679	1.000000	0.71417	0.913000	0.36048	0.190000	0.23558	9.294000	0.96088	2.358000	0.79984	0.491000	0.48974	.	TRPM4	-	-	ENSG00000130529		0.612	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	HGNC	protein_coding	OTTHUMT00000465543.2	17	0.00	0	G	NM_017636	Intron	49703867	49703867	+1	no_errors	ENST00000252826	ensembl	human	known	69_37n	splice_site	32	17.95	7	SNP	1.000	A
TTC25	83538	genome.wustl.edu	37	17	40095238	40095238	+	RNA	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr17:40095238G>A	ENST00000591658.1	+	0	939							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				TGGCAGTGCTGAAGGGAGTCT	0.512																																						dbGAP											0													42.0	40.0	41.0					17																	40095238		1966	4172	6138	-	-	-			0			AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40095238G>A			Q6NX40|Q6PJ04|Q9H0K5	RNA	SNP	-	NULL	ENST00000591658.1	37	NULL		17																																																																																			TTC25	-	-	ENSG00000204815		0.512	TTC25-001	KNOWN	basic	processed_transcript	TTC25	HGNC	processed_transcript	OTTHUMT00000449237.1	18	0.00	0	G	NM_031421		40095238	40095238	+1	no_errors	ENST00000591658	ensembl	human	known	69_37n	rna	30	26.83	11	SNP	0.949	A
TTF2	8458	genome.wustl.edu	37	1	117617614	117617614	+	Silent	SNP	T	T	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:117617614T>A	ENST00000369466.4	+	5	452	c.408T>A	c.(406-408)gcT>gcA	p.A136A		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	136					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		AAGAACCAGCTCTCTGGAAAC	0.408																																						dbGAP											0													73.0	75.0	74.0					1																	117617614		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.408T>A	1.37:g.117617614T>A			A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A136	ENST00000369466.4	37	c.408	CCDS892.1	1																																																																																			TTF2	-	NULL	ENSG00000116830		0.408	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	301	0.00	0	T			117617614	117617614	+1	no_errors	ENST00000369466	ensembl	human	known	69_37n	silent	369	13.95	60	SNP	0.012	A
TULP4	56995	genome.wustl.edu	37	6	158923752	158923753	+	Frame_Shift_Ins	INS	-	-	G	rs369044012		TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:158923752_158923753insG	ENST00000367097.3	+	13	4414_4415	c.3057_3058insG	c.(3058-3060)gggfs	p.G1020fs	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1020					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V1022fs*80(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		AGGGCGGGCCCGGGGGGGTGGT	0.723																																						dbGAP											1	Insertion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.3064dupG	6.37:g.158923759_158923759dupG	ENSP00000356064:p.Gly1020fs		Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Frame_Shift_Ins	INS	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V1021fs	ENST00000367097.3	37	c.3057_3058	CCDS34561.1	6																																																																																			TULP4	-	NULL	ENSG00000130338		0.723	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1	8	0.00	0	-	NM_020245		158923752	158923753	+1	no_errors	ENST00000367097	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.001:0.001	G
TXNIP	10628	genome.wustl.edu	37	1	145438841	145438841	+	Silent	SNP	C	C	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:145438841C>A	ENST00000369317.4	+	1	373	c.39C>A	c.(37-39)gtC>gtA	p.V13V	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	13					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTGAGGTGGTCTTTAACGACC	0.458																																						dbGAP											0													112.0	106.0	108.0					1																	145438841		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.39C>A	1.37:g.145438841C>A			B4E3D3|Q16226|Q6PML0|Q9BXG9	Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.V13	ENST00000369317.4	37	c.39	CCDS913.1	1																																																																																			TXNIP	-	pfam_Arrestin-like_N	ENSG00000117289		0.458	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNIP	HGNC	protein_coding	OTTHUMT00000038547.1	120	0.00	0	C	NM_006472		145438841	145438841	+1	no_errors	ENST00000369317	ensembl	human	known	69_37n	silent	69	40.52	47	SNP	1.000	A
VCL	7414	genome.wustl.edu	37	10	75860849	75860849	+	Silent	SNP	A	A	C			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr10:75860849A>C	ENST00000211998.4	+	14	2110	c.2016A>C	c.(2014-2016)acA>acC	p.T672T	VCL_ENST00000417648.2_Intron|VCL_ENST00000478896.2_3'UTR|VCL_ENST00000372755.3_Silent_p.T672T	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	672	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GAGAACTCACACCCCAGGTTG	0.463																																						dbGAP											0													46.0	43.0	44.0					10																	75860849		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.2016A>C	10.37:g.75860849A>C			Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.T672	ENST00000211998.4	37	c.2016	CCDS7341.1	10																																																																																			VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.463	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		47	0.00	0	A	NM_003373, NM_014000		75860849	75860849	+1	no_errors	ENST00000211998	ensembl	human	known	69_37n	silent	31	55.71	39	SNP	0.542	C
VSX2	338917	genome.wustl.edu	37	14	74726397	74726397	+	Silent	SNP	C	C	T			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr14:74726397C>T	ENST00000261980.2	+	4	762	c.672C>T	c.(670-672)gcC>gcT	p.A224A		NM_182894.2	NP_878314.1	P58304	VSX2_HUMAN	visual system homeobox 2	224	CVC. {ECO:0000255|PROSITE- ProRule:PRU00829}.				cell fate commitment (GO:0045165)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7				BRCA - Breast invasive adenocarcinoma(234;0.00154)		TCTACGGGGCCATGGTGCGGC	0.637																																						dbGAP											0													125.0	101.0	110.0					14																	74726397		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC005519	CCDS9827.1	14q24.3	2011-06-20	2007-08-21	2007-08-21		ENSG00000119614		"""Homeoboxes / PRD class"""	1975	protein-coding gene	gene with protein product		142993	"""C elegans ceh-10 homeo domain-containing homolog"", ""ceh-10 homeo domain containing homolog (C. elegans)"", ""ceh-10 homeodomain containing homolog (C. elegans)"""	HOX10, CHX10		1973146	Standard	NM_182894		Approved	RET1	uc001xpq.3	P58304		ENST00000261980.2:c.672C>T	14.37:g.74726397C>T			A1A4X6	Silent	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.A224	ENST00000261980.2	37	c.672	CCDS9827.1	14																																																																																			VSX2	-	NULL	ENSG00000119614		0.637	VSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX2	HGNC	protein_coding	OTTHUMT00000412323.1	48	0.00	0	C	NM_182894		74726397	74726397	+1	no_errors	ENST00000261980	ensembl	human	known	69_37n	silent	18	25.00	6	SNP	1.000	T
WHSC1L1	54904	genome.wustl.edu	37	8	38172281	38172281	+	Missense_Mutation	SNP	C	C	G			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr8:38172281C>G	ENST00000317025.8	-	12	2643	c.2126G>C	c.(2125-2127)aGc>aCc	p.S709T	WHSC1L1_ENST00000433384.2_Missense_Mutation_p.S709T|WHSC1L1_ENST00000525081.1_5'Flank|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.S709T	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	709					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			GTCACCAGAGCTTTCACAAAT	0.468			T	NUP98	AML																																	dbGAP		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	0													59.0	57.0	58.0					8																	38172281		1892	4120	6012	-	-	-	SO:0001583	missense	0			AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.2126G>C	8.37:g.38172281C>G	ENSP00000313983:p.Ser709Thr		B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.S709T	ENST00000317025.8	37	c.2126	CCDS43729.1	8	.	.	.	.	.	.	.	.	.	.	C	13.86	2.362731	0.41902	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502	D;D;D	0.95069	-3.6;-3.6;-3.6	5.52	4.63	0.57726	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.212960	0.32444	U	0.006087	D	0.90137	0.6918	L	0.29908	0.895	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	D	0.86183	0.1607	10	0.51188	T	0.08	.	13.4581	0.61210	0.0:0.9235:0.0:0.0765	.	709;709;709	B7ZL11;Q9BZ95-2;Q9BZ95	.;.;NSD3_HUMAN	T	709;709;646;709	ENSP00000393284:S709T;ENSP00000313983:S709T;ENSP00000434730:S709T	ENSP00000313983:S709T	S	-	2	0	WHSC1L1	38291438	0.994000	0.37717	0.998000	0.56505	0.980000	0.70556	0.538000	0.23160	1.298000	0.44778	0.585000	0.79938	AGC	WHSC1L1	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000147548		0.468	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1L1	HGNC	protein_coding	OTTHUMT00000381924.3	89	0.00	0	C	NM_023034		38172281	38172281	-1	no_errors	ENST00000317025	ensembl	human	known	69_37n	missense	117	15.83	22	SNP	1.000	G
WLS	79971	genome.wustl.edu	37	1	68564426	68564426	+	Silent	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr1:68564426G>A	ENST00000354777.2	-	12	1766	c.1521C>T	c.(1519-1521)ctC>ctT	p.L507L	WLS_ENST00000540432.1_Silent_p.L509L|GNG12-AS1_ENST00000420587.1_RNA|GNG12-AS1_ENST00000413628.1_RNA	NM_001002292.3	NP_001002292.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	508					anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						atttacatgggagttgcattc	0.353																																						dbGAP											0													86.0	81.0	83.0					1																	68564426		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000354777.2:c.1521C>T	1.37:g.68564426G>A			B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Silent	SNP	NULL	p.L509	ENST00000354777.2	37	c.1527	CCDS30750.1	1																																																																																			WLS	-	NULL	ENSG00000116729		0.353	WLS-003	KNOWN	basic|CCDS	protein_coding	WLS	HGNC	protein_coding	OTTHUMT00000025370.1	177	0.00	0	G	NM_024911		68564426	68564426	-1	no_errors	ENST00000540432	ensembl	human	known	69_37n	silent	177	15.71	33	SNP	0.001	A
WWC2	80014	genome.wustl.edu	37	4	184204028	184204028	+	Missense_Mutation	SNP	G	G	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr4:184204028G>A	ENST00000403733.3	+	18	3051	c.2852G>A	c.(2851-2853)aGa>aAa	p.R951K	WWC2_ENST00000504005.1_Missense_Mutation_p.R633K|WWC2_ENST00000448232.2_Missense_Mutation_p.R975K|WWC2_ENST00000513834.1_Missense_Mutation_p.R902K|WWC2_ENST00000508747.1_Missense_Mutation_p.R79K	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	951					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		AAAGACCTCAGAAGTCAGCCA	0.463																																						dbGAP											0													76.0	67.0	70.0					4																	184204028		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.2852G>A	4.37:g.184204028G>A	ENSP00000384222:p.Arg951Lys		Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.R975K	ENST00000403733.3	37	c.2924	CCDS34109.2	4	.	.	.	.	.	.	.	.	.	.	G	2.287	-0.363426	0.05103	.	.	ENSG00000151718	ENST00000403733;ENST00000513834;ENST00000448232;ENST00000504005;ENST00000508747	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	4.81	2.94	0.34122	.	0.834640	0.10348	N	0.685391	T	0.20373	0.0490	N	0.12182	0.205	0.09310	N	1	B;B;B;B	0.19200	0.016;0.0;0.034;0.013	B;B;B;B	0.13407	0.009;0.003;0.009;0.009	T	0.23440	-1.0188	10	0.05620	T	0.96	-4.3787	7.7232	0.28744	0.0914:0.3146:0.5939:0.0	.	975;951;79;902	Q6AWC2-6;Q6AWC2;Q6AWC2-7;Q6AWC2-4	.;WWC2_HUMAN;.;.	K	951;902;975;633;79	ENSP00000384222:R951K;ENSP00000425054:R902K;ENSP00000398577:R975K;ENSP00000427569:R633K;ENSP00000420835:R79K	ENSP00000384222:R951K	R	+	2	0	WWC2	184441022	0.000000	0.05858	0.003000	0.11579	0.207000	0.24258	0.074000	0.14662	1.195000	0.43115	0.655000	0.94253	AGA	WWC2	-	NULL	ENSG00000151718		0.463	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2	HGNC	protein_coding	OTTHUMT00000319608.1	50	0.00	0	G	NM_024949		184204028	184204028	+1	no_errors	ENST00000448232	ensembl	human	known	69_37n	missense	45	10.00	5	SNP	0.000	A
ZSCAN9	7746	genome.wustl.edu	37	6	28195034	28195034	+	Missense_Mutation	SNP	C	C	A			TCGA-A8-A09M-01A-11W-A019-09	TCGA-A8-A09M-10A-01W-A021-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	8e92515a-8049-4ebb-9117-a137c06e5d04	e689f01f-e944-408f-9dbe-894b816b09ce	g.chr6:28195034C>A	ENST00000252207.5	+	2	320	c.172C>A	c.(172-174)Ctg>Atg	p.L58M	ZSCAN9_ENST00000531981.1_Missense_Mutation_p.L58M|ZSCAN9_ENST00000527436.1_Missense_Mutation_p.L58M|ZSCAN9_ENST00000425468.2_Missense_Mutation_p.L58M|ZSCAN9_ENST00000531979.1_Missense_Mutation_p.L58M	NM_006299.4	NP_006290.1	O15535	ZSC9_HUMAN	zinc finger and SCAN domain containing 9	58	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CTTTCGACAGCTGTGCTACCA	0.502																																						dbGAP											0													77.0	71.0	73.0					6																	28195034		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62392	CCDS4646.1, CCDS56407.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000137185	ENSG00000137185		"""-"", ""Zinc fingers, C2H2-type"""	12984	protein-coding gene	gene with protein product		602246	"""zinc finger protein 193"""	ZNF193			Standard	NM_001199479		Approved	PRD51	uc003nkq.2	O15535	OTTHUMG00000014515	ENST00000252207.5:c.172C>A	6.37:g.28195034C>A	ENSP00000252207:p.Leu58Met		B4E1W6|E7EVQ2|Q2TTR1	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L58M	ENST00000252207.5	37	c.172	CCDS4646.1	6	.	.	.	.	.	.	.	.	.	.	C	12.67	2.007137	0.35415	.	.	ENSG00000137185	ENST00000425468;ENST00000252207;ENST00000531979;ENST00000527436;ENST00000527844	T;T;T;T;T	0.05513	3.43;3.43;3.43;3.43;3.43	3.07	0.201	0.15186	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.10508	0.0257	M	0.84585	2.705	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.76071	0.987;0.958	T	0.07501	-1.0769	9	0.72032	D	0.01	.	3.1679	0.06542	0.0:0.5002:0.2298:0.27	.	58;58	E7EVQ2;O15535	.;ZN193_HUMAN	M	58	ENSP00000404074:L58M;ENSP00000252207:L58M;ENSP00000433402:L58M;ENSP00000433468:L58M;ENSP00000436166:L58M	ENSP00000252207:L58M	L	+	1	2	ZNF193	28303013	0.002000	0.14202	0.087000	0.20705	0.687000	0.40016	-0.442000	0.06871	0.010000	0.14839	0.561000	0.74099	CTG	ZNF193	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000137185		0.502	ZSCAN9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF193	HGNC	protein_coding	OTTHUMT00000040183.2	157	0.00	0	C	NM_006299		28195034	28195034	+1	no_errors	ENST00000252207	ensembl	human	known	69_37n	missense	117	17.61	25	SNP	0.114	A
