#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTB	60	genome.wustl.edu	37	7	5567149	5567149	+	3'UTR	DEL	A	A	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr7:5567149delA	ENST00000331789.5	-	0	1549				ACTB_ENST00000464611.1_5'UTR|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta						adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		AAAAAACAACAATGTGCAATC	0.463																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.*230T>-	7.37:g.5567149delA			A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	RNA	DEL	-	NULL	ENST00000331789.5	37	NULL	CCDS5341.1	7																																																																																			ACTB	-	-	ENSG00000075624		0.463	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	HGNC	protein_coding	OTTHUMT00000059589.4	32	0.00	0	A	NM_001101		5567149	5567149	-1	no_errors	ENST00000464611	ensembl	human	known	69_37n	rna	24	58.21	39	DEL	1.000	-
ACTG1	71	genome.wustl.edu	37	17	79479298	79479298	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr17:79479298C>A	ENST00000575842.1	-	1	509	c.83G>T	c.(82-84)cGa>cTa	p.R28L	ACTG1_ENST00000575087.1_Missense_Mutation_p.R28L|ACTG1_ENST00000573283.1_Missense_Mutation_p.R28L|RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.R28L|AC139149.1_ENST00000584254.1_RNA			P63261	ACTG_HUMAN	actin, gamma 1	28					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			AAACACGGCTCGGGGAGCGTC	0.642																																						dbGAP											0													56.0	64.0	62.0					17																	79479298		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.83G>T	17.37:g.79479298C>A	ENSP00000458162:p.Arg28Leu		A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R28L	ENST00000575842.1	37	c.83	CCDS11782.1	17	.	.	.	.	.	.	.	.	.	.	C	11.78	1.739907	0.30865	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.95001	-3.58	3.99	3.99	0.46301	.	0.083622	0.49305	U	0.000159	D	0.95497	0.8537	M	0.93763	3.455	0.53005	D	0.999969	B	0.02656	0.0	B	0.04013	0.001	D	0.95131	0.8255	10	0.87932	D	0	.	15.0358	0.71744	0.0:1.0:0.0:0.0	.	28	P63261	ACTG_HUMAN	L	28	ENSP00000331514:R28L	ENSP00000331514:R28L	R	-	2	0	ACTG1	77093893	1.000000	0.71417	0.883000	0.34634	0.204000	0.24138	7.168000	0.77570	2.066000	0.61787	0.563000	0.77884	CGA	ACTG1	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like	ENSG00000184009		0.642	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACTG1	HGNC	protein_coding	OTTHUMT00000439935.2	49	0.00	0	C	NM_001614		79479298	79479298	-1	no_errors	ENST00000331925	ensembl	human	known	69_37n	missense	67	24.72	22	SNP	1.000	A
ADNP2	22850	genome.wustl.edu	37	18	77896057	77896057	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr18:77896057G>T	ENST00000262198.4	+	4	3216	c.2761G>T	c.(2761-2763)Gtc>Ttc	p.V921F		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	921					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CTGCTGTGGGGTCTACACGGG	0.597																																						dbGAP											0													92.0	88.0	90.0					18																	77896057		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2761G>T	18.37:g.77896057G>T	ENSP00000262198:p.Val921Phe		A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.V921F	ENST00000262198.4	37	c.2761	CCDS32853.1	18	.	.	.	.	.	.	.	.	.	.	G	21.0	4.089049	0.76756	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000010	T	0.78780	0.4337	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78460	-0.2195	8	.	.	.	-27.7567	18.5466	0.91048	0.0:0.0:1.0:0.0	.	921	Q6IQ32	ADNP2_HUMAN	F	921	.	.	V	+	1	0	ADNP2	75997048	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	8.487000	0.90454	2.612000	0.88384	0.655000	0.94253	GTC	ADNP2	-	NULL	ENSG00000101544		0.597	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	HGNC	protein_coding	OTTHUMT00000418979.1	29	0.00	0	G	NM_014913		77896057	77896057	+1	no_errors	ENST00000262198	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	1.000	T
ALOX12	239	genome.wustl.edu	37	17	6913322	6913322	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr17:6913322G>A	ENST00000251535.6	+	13	1742	c.1689G>A	c.(1687-1689)atG>atA	p.M563I	AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000573939.1_Intron|AC027763.2_ENST00000399540.2_Intron|AC027763.2_ENST00000574377.1_Intron|RNASEK_ENST00000548577.1_5'Flank|RP11-589P10.7_ENST00000572547.1_RNA|RNASEK_ENST00000402093.1_5'Flank	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	563	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CAATGCGGATGCCCCCACCCA	0.552																																						dbGAP											0													107.0	90.0	96.0					17																	6913322		2203	4300	6503	-	-	-	SO:0001583	missense	0			M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1689G>A	17.37:g.6913322G>A	ENSP00000251535:p.Met563Ile		O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C,pfscan_LipOase_LH2	p.M563I	ENST00000251535.6	37	c.1689	CCDS11084.1	17	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034785	0.54896	.	.	ENSG00000108839	ENST00000251535;ENST00000406228	T	0.77620	-1.11	5.17	4.18	0.49190	Lipoxygenase, C-terminal (3);	0.358052	0.29551	N	0.011823	T	0.68348	0.2991	L	0.33485	1.01	0.38348	D	0.944245	P	0.37276	0.589	B	0.39771	0.309	T	0.69266	-0.5190	10	0.33141	T	0.24	-5.8081	11.8286	0.52282	0.0868:0.0:0.9132:0.0	.	563	P18054	LOX12_HUMAN	I	563;33	ENSP00000251535:M563I	ENSP00000251535:M563I	M	+	3	0	ALOX12	6854046	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	1.795000	0.38784	2.706000	0.92434	0.557000	0.71058	ATG	ALOX12	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000108839		0.552	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12	HGNC	protein_coding	OTTHUMT00000219922.2	26	0.00	0	G			6913322	6913322	+1	no_errors	ENST00000251535	ensembl	human	known	69_37n	missense	14	25.00	5	SNP	1.000	A
ANKRD36BP2	645784	genome.wustl.edu	37	2	89076051	89076051	+	RNA	DEL	G	G	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr2:89076051delG	ENST00000393525.3	+	0	435									ankyrin repeat domain 36B pseudogene 2																		CAGTTCAAAAGTAGCCATAAG	0.328																																						dbGAP											0																																										-	-	-			0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89076051delG				RNA	DEL	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			ANKRD36BP2	-	-	ENSG00000230006		0.328	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1	45	0.00	0	G			89076051	89076051	+1	no_errors	ENST00000393515	ensembl	human	known	69_37n	rna	72	23.23	23	DEL	0.000	-
ARHGEF2	9181	genome.wustl.edu	37	1	155917712	155917712	+	3'UTR	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:155917712G>A	ENST00000361247.4	-	0	3081				ARHGEF2_ENST00000368316.1_3'UTR|ARHGEF2_ENST00000368315.4_3'UTR|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313695.7_3'UTR|ARHGEF2_ENST00000462460.2_3'UTR	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2						actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GTGGGGCACGGGGCAGGGGGG	0.572																																					Melanoma(178;35 2768 6610 28839)	dbGAP											0													3.0	3.0	3.0					1																	155917712		1709	3160	4869	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.*21C>T	1.37:g.155917712G>A			D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	RNA	SNP	-	NULL	ENST00000361247.4	37	NULL	CCDS53376.1	1																																																																																			ARHGEF2	-	-	ENSG00000116584		0.572	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	12	0.00	0	G	NM_004723		155917712	155917712	-1	no_errors	ENST00000470541	ensembl	human	known	69_37n	rna	43	18.87	10	SNP	0.001	A
ATP2B4	493	genome.wustl.edu	37	1	203696643	203696643	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:203696643G>T	ENST00000357681.5	+	20	4376	c.3253G>T	c.(3253-3255)Gag>Tag	p.E1085*	SNORA77_ENST00000408716.1_RNA|ATP2B4_ENST00000391954.2_Nonsense_Mutation_p.E1049*|ATP2B4_ENST00000341360.2_Nonsense_Mutation_p.E1085*|ATP2B4_ENST00000367218.3_Nonsense_Mutation_p.E1085*|ATP2B4_ENST00000367219.3_Nonsense_Mutation_p.E1073*|ATP2B4_ENST00000466407.1_3'UTR	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1085					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGCTGAGATGGAGCTGCGCCG	0.577																																						dbGAP											0													159.0	146.0	151.0					1																	203696643		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3253G>T	1.37:g.203696643G>T	ENSP00000350310:p.Glu1085*		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.E1085*	ENST00000357681.5	37	c.3253	CCDS1440.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	46|46	12.823649|12.823649	0.99699|0.99699	.|.	.|.	ENSG00000058668|ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360|ENST00000458092;ENST00000356729	.|.	.|.	.|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.000000|.	0.50627|.	D|.	0.000118|.	.|T	.|0.79799	.|0.4508	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77619	.|-0.2520	.|3	0.33940|.	T|.	0.23|.	-33.9223|-33.9223	19.5934|19.5934	0.95525|0.95525	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|C	1085;1085;1073;1049;1085|71;49	.|.	ENSP00000340930:E1085X|.	E|W	+|+	1|3	0|0	ATP2B4|ATP2B4	201963266|201963266	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	9.863000|9.863000	0.99569|0.99569	2.724000|2.724000	0.93272|0.93272	0.561000|0.561000	0.74099|0.74099	GAG|TGG	ATP2B4	-	NULL	ENSG00000058668		0.577	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	95	0.00	0	G	NM_001001396		203696643	203696643	+1	no_errors	ENST00000357681	ensembl	human	known	69_37n	nonsense	107	29.41	45	SNP	1.000	T
ATP4A	495	genome.wustl.edu	37	19	36051279	36051279	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr19:36051279G>A	ENST00000262623.3	-	6	801	c.773C>T	c.(772-774)aCc>aTc	p.T258I		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	258					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	AAGGCACATGGTGGAGAAGAA	0.627																																						dbGAP											0													92.0	96.0	95.0					19																	36051279		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.773C>T	19.37:g.36051279G>A	ENSP00000262623:p.Thr258Ile		O00738	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATPase_P-typ_H/K-transp_N,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.T258I	ENST00000262623.3	37	c.773	CCDS12467.1	19	.	.	.	.	.	.	.	.	.	.	g	23.5	4.422686	0.83559	.	.	ENSG00000105675	ENST00000262623	D	0.93659	-3.26	4.25	4.25	0.50352	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.64402	D	0.000002	D	0.98083	0.9368	H	0.98754	4.32	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.98948	1.0793	10	0.87932	D	0	.	14.5256	0.67887	0.0:0.0:1.0:0.0	.	258	P20648	ATP4A_HUMAN	I	258	ENSP00000262623:T258I	ENSP00000262623:T258I	T	-	2	0	ATP4A	40743119	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.766000	0.85320	2.362000	0.80069	0.556000	0.70494	ACC	ATP4A	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000105675		0.627	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4A	HGNC	protein_coding	OTTHUMT00000109470.2	52	0.00	0	G	NM_000704		36051279	36051279	-1	no_errors	ENST00000262623	ensembl	human	known	69_37n	missense	65	24.42	21	SNP	1.000	A
ATP6V0A4	50617	genome.wustl.edu	37	7	138437430	138437430	+	Silent	SNP	G	G	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr7:138437430G>C	ENST00000310018.2	-	11	1251	c.969C>G	c.(967-969)gcC>gcG	p.A323A	ATP6V0A4_ENST00000393054.1_Silent_p.A323A|ATP6V0A4_ENST00000353492.4_Silent_p.A323A	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	323					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						ACCAGATCTCGGCGATGACAC	0.577																																						dbGAP											0													106.0	84.0	91.0					7																	138437430		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.969C>G	7.37:g.138437430G>C			A4D1R4|A8KA80|Q32M47	Silent	SNP	pfam_ATPase_V0/A0_a	p.A323	ENST00000310018.2	37	c.969	CCDS5849.1	7																																																																																			ATP6V0A4	-	pfam_ATPase_V0/A0_a	ENSG00000105929		0.577	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A4	HGNC	protein_coding	OTTHUMT00000347514.1	65	0.00	0	G	NM_020632		138437430	138437430	-1	no_errors	ENST00000310018	ensembl	human	known	69_37n	silent	43	17.31	9	SNP	0.097	C
BLOC1S2	282991	genome.wustl.edu	37	10	102045902	102045902	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr10:102045902G>A	ENST00000370372.2	-	2	176	c.124C>T	c.(124-126)Cgg>Tgg	p.R42W	BLOC1S2_ENST00000441611.1_5'UTR|BLOC1S2_ENST00000361832.2_5'UTR	NM_173809.4	NP_776170.2	Q6QNY1	BL1S2_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 2	42					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|melanosome organization (GO:0032438)|microtubule nucleation (GO:0007020)|mitochondrial outer membrane permeabilization (GO:0097345)|neuron projection development (GO:0031175)|platelet dense granule organization (GO:0060155)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	BLOC-1 complex (GO:0031083)|centrosome (GO:0005813)|gamma-tubulin complex (GO:0000930)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	gamma-tubulin binding (GO:0043015)|protein C-terminus binding (GO:0008022)			large_intestine(1)|lung(2)|ovary(1)	4		Colorectal(252;0.117)		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)		AACATGTCCCGGCAGAGCTCA	0.607																																						dbGAP											0													118.0	103.0	108.0					10																	102045902		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054697	CCDS7490.1, CCDS73179.1	10q24.31	2012-08-01	2008-08-11		ENSG00000196072	ENSG00000196072		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20984	protein-coding gene	gene with protein product	"""centrosome protein oncogene"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 2"", ""BLOC-1 subunit 2"""	609768				11483580, 15102850	Standard	NM_173809		Approved	MGC10120, FLJ30135, BLOS2	uc001kqw.2	Q6QNY1	OTTHUMG00000018908	ENST00000370372.2:c.124C>T	10.37:g.102045902G>A	ENSP00000359398:p.Arg42Trp		B4DQV2|Q5W040|Q8WUI8	Missense_Mutation	SNP	pfam_BLOC1_su2	p.R42W	ENST00000370372.2	37	c.124	CCDS7490.1	10	.	.	.	.	.	.	.	.	.	.	-	27.1	4.804791	0.90623	.	.	ENSG00000196072	ENST00000358848	.	.	.	5.58	4.62	0.57501	.	0.227351	0.41605	D	0.000845	T	0.51856	0.1699	N	0.19112	0.55	0.46061	D	0.998841	D	0.76494	0.999	P	0.59889	0.865	T	0.55029	-0.8204	9	0.66056	D	0.02	-9.1413	11.4941	0.50398	0.0:0.0:0.6801:0.3199	.	42	Q6QNY1	BL1S2_HUMAN	W	42	.	ENSP00000351716:R42W	R	-	1	2	BLOC1S2	102035892	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.331000	0.52075	2.632000	0.89209	0.550000	0.68814	CGG	BLOC1S2	-	pfam_BLOC1_su2	ENSG00000196072		0.607	BLOC1S2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S2	HGNC	protein_coding	OTTHUMT00000049861.2	56	0.00	0	G	NM_173809		102045902	102045902	-1	no_errors	ENST00000370372	ensembl	human	known	69_37n	missense	40	42.25	30	SNP	1.000	A
CCDC15	80071	genome.wustl.edu	37	11	124857093	124857093	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr11:124857093G>T	ENST00000344762.5	+	8	1230	c.971G>T	c.(970-972)gGc>gTc	p.G324V	CCDC15_ENST00000529051.1_Missense_Mutation_p.G324V	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	324						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		CATTTTGAGGGCCTTCAGGAT	0.383																																						dbGAP											0													79.0	74.0	75.0					11																	124857093		1804	4079	5883	-	-	-	SO:0001583	missense	0			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.971G>T	11.37:g.124857093G>T	ENSP00000341684:p.Gly324Val		Q9H8U7	Missense_Mutation	SNP	NULL	p.G324V	ENST00000344762.5	37	c.971	CCDS44756.1	11	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362255	0.41902	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.33438	1.41;1.41	3.15	1.24	0.21308	.	1.665360	0.02649	N	0.106185	T	0.28333	0.0700	L	0.44542	1.39	0.09310	N	1	P	0.35982	0.531	B	0.35470	0.203	T	0.26883	-1.0090	10	0.72032	D	0.01	-0.0032	5.2699	0.15618	0.276:0.0:0.724:0.0	.	324	Q0P6D6	CCD15_HUMAN	V	324	ENSP00000435403:G324V;ENSP00000341684:G324V	ENSP00000341684:G324V	G	+	2	0	CCDC15	124362303	0.000000	0.05858	0.001000	0.08648	0.435000	0.31806	-0.573000	0.05874	0.364000	0.24374	0.313000	0.20887	GGC	CCDC15	-	NULL	ENSG00000149548		0.383	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC15	HGNC	protein_coding	OTTHUMT00000387131.1	23	0.00	0	G	NM_025004		124857093	124857093	+1	no_errors	ENST00000344762	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.000	T
CIDECP	152302	genome.wustl.edu	37	3	10057103	10057103	+	RNA	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr3:10057103G>T	ENST00000432401.1	-	0	612									cell death-inducing DFFA-like effector c pseudogene																		TGAGGCTCAAGCTCCTTTGCT	0.587																																						dbGAP											0																																										-	-	-			0			AF279614		3p25.3	2007-07-26			ENSG00000186162	ENSG00000186162			24230	pseudogene	pseudogene							Standard	NR_002786		Approved	CICE			OTTHUMG00000155323		3.37:g.10057103G>T				RNA	SNP	-	NULL	ENST00000432401.1	37	NULL		3																																																																																			CIDECP	-	-	ENSG00000186162		0.587	CIDECP-001	KNOWN	basic	processed_transcript	CIDECP	HGNC	pseudogene	OTTHUMT00000339463.1	46	0.00	0	G			10057103	10057103	-1	no_errors	ENST00000335507	ensembl	human	known	69_37n	rna	19	17.39	4	SNP	0.000	T
CNN1	1264	genome.wustl.edu	37	19	11658612	11658612	+	Splice_Site	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr19:11658612G>T	ENST00000252456.2	+	5	602	c.391G>T	c.(391-393)Gcg>Tcg	p.A131S	CNN1_ENST00000544952.1_Splice_Site_p.A111S|CNN1_ENST00000535659.2_Splice_Site_p.A81S|CNN1_ENST00000592923.1_Splice_Site_p.A81S	NM_001299.4	NP_001290.2	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	131	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actomyosin structure organization (GO:0031032)|regulation of smooth muscle contraction (GO:0006940)	cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9						CCCCACCTAGGCGAAGACGAA	0.547																																						dbGAP											0													136.0	99.0	112.0					19																	11658612		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U37019	CCDS12263.1	19p13.2-p13.1	2008-07-16				ENSG00000130176			2155	protein-coding gene	gene with protein product		600806				8526917, 9332369	Standard	XM_005259741		Approved	SMCC, Sm-Calp	uc002msc.1	P51911		ENST00000252456.2:c.391-1G>T	19.37:g.11658612G>T			B2R868|B4DUX6|O00638|Q15416|Q8IY93|Q99438	Missense_Mutation	SNP	pfam_Calponin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,pfscan_Calponin_repeat,prints_SM22_calponin,prints_Calponin	p.A131S	ENST00000252456.2	37	c.391	CCDS12263.1	19	.	.	.	.	.	.	.	.	.	.	G	24.0	4.476759	0.84640	.	.	ENSG00000130176	ENST00000252456;ENST00000535659;ENST00000544952	T;T;T	0.60424	0.19;0.19;0.19	4.76	4.76	0.60689	Calponin homology domain (3);	0.292472	0.37261	N	0.002176	T	0.76414	0.3984	M	0.88512	2.96	0.80722	D	1	B	0.19706	0.038	P	0.45913	0.497	T	0.75703	-0.3225	9	.	.	.	-25.0998	16.5726	0.84629	0.0:0.0:1.0:0.0	.	131	P51911	CNN1_HUMAN	S	131;81;111	ENSP00000252456:A131S;ENSP00000442031:A81S;ENSP00000437470:A111S	.	A	+	1	0	CNN1	11519612	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	9.271000	0.95698	2.214000	0.71695	0.536000	0.68110	GCG	CNN1	-	superfamily_CH-domain,pfscan_CH-domain,prints_SM22_calponin	ENSG00000130176		0.547	CNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN1	HGNC	protein_coding	OTTHUMT00000458854.1	37	0.00	0	G	NM_001299	Missense_Mutation	11658612	11658612	+1	no_errors	ENST00000252456	ensembl	human	known	69_37n	missense	74	21.28	20	SNP	1.000	T
CTNNBL1	56259	genome.wustl.edu	37	20	36361305	36361305	+	Missense_Mutation	SNP	C	C	T	rs112045085		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr20:36361305C>T	ENST00000361383.6	+	2	172	c.55C>T	c.(55-57)Cgg>Tgg	p.R19W	CTNNBL1_ENST00000405275.2_5'UTR	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	19					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				AAAACGTCCCCGGGATGATGA	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		19824	0.0		0.0	False		,,,				2504	0.001				Ovarian(184;582 2038 3273 4106 42608)	dbGAP											0													67.0	65.0	66.0					20																	36361305		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.55C>T	20.37:g.36361305C>T	ENSP00000355050:p.Arg19Trp		B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	pfam_DUF1716_euk,superfamily_ARM-type_fold	p.R19W	ENST00000361383.6	37	c.55	CCDS13298.1	20	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346973	0.82022	.	.	ENSG00000132792	ENST00000361383	T	0.47528	0.84	5.04	5.04	0.67666	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.59569	0.2203	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	P	0.54759	0.76	T	0.58399	-0.7643	10	0.38643	T	0.18	-17.3586	17.5428	0.87853	0.0:1.0:0.0:0.0	rs11549312	19	Q8WYA6	CTBL1_HUMAN	W	19	ENSP00000355050:R19W	ENSP00000355050:R19W	R	+	1	2	CTNNBL1	35794719	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.455000	0.60075	2.606000	0.88127	0.561000	0.74099	CGG	CTNNBL1	-	NULL	ENSG00000132792		0.502	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CTNNBL1	HGNC	protein_coding	OTTHUMT00000079125.1	37	0.00	0	C	NM_030877		36361305	36361305	+1	no_errors	ENST00000361383	ensembl	human	putative	69_37n	missense	35	16.67	7	SNP	1.000	T
CYP4B1	1580	genome.wustl.edu	37	1	47279654	47279654	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:47279654T>C	ENST00000271153.4	+	6	727	c.691T>C	c.(691-693)Tac>Cac	p.Y231H	CYP4B1_ENST00000371919.4_Missense_Mutation_p.Y217H|CYP4B1_ENST00000371923.4_Missense_Mutation_p.Y232H|CYP4B1_ENST00000452782.2_Missense_Mutation_p.Y69H			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	231					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	GTCCTTCCAGTACCATAATGA	0.582																																						dbGAP											0													186.0	164.0	172.0					1																	47279654		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.691T>C	1.37:g.47279654T>C	ENSP00000271153:p.Tyr231His		Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.Y232H	ENST00000271153.4	37	c.694	CCDS542.1	1	.	.	.	.	.	.	.	.	.	.	T	11.55	1.671868	0.29693	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919;ENST00000526297;ENST00000452782;ENST00000468637	T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;0.85;-0.33;-0.33	5.26	5.26	0.73747	.	0.121237	0.64402	N	0.000019	T	0.71273	0.3320	L	0.42686	1.345	0.47065	D	0.999301	D;D;B;B	0.89917	1.0;1.0;0.16;0.193	D;D;B;B	0.81914	0.99;0.995;0.091;0.147	T	0.66610	-0.5880	10	0.13853	T	0.58	.	10.4003	0.44225	0.0:0.0769:0.0:0.9231	.	69;217;232;231	E7EME6;Q8IZB0;P13584-2;P13584	.;.;.;CP4B1_HUMAN	H	232;231;217;69;69;68	ENSP00000360991:Y232H;ENSP00000271153:Y231H;ENSP00000360987:Y217H;ENSP00000438995:Y69H;ENSP00000400413:Y69H;ENSP00000437670:Y68H	ENSP00000271153:Y231H	Y	+	1	0	CYP4B1	47052241	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	3.932000	0.56537	1.990000	0.58119	0.402000	0.26972	TAC	CYP4B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000142973		0.582	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4B1	HGNC	protein_coding	OTTHUMT00000021911.1	47	0.00	0	T	NM_000779		47279654	47279654	+1	no_errors	ENST00000371923	ensembl	human	known	69_37n	missense	8	60.00	12	SNP	1.000	C
CYTIP	9595	genome.wustl.edu	37	2	158272420	158272420	+	Silent	SNP	C	C	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr2:158272420C>T	ENST00000264192.3	-	8	970	c.849G>A	c.(847-849)gaG>gaA	p.E283E	CYTIP_ENST00000540637.1_Silent_p.E177E	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	283	Ser-rich.				regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						GGATAAAGCACTCATCATCTG	0.537																																						dbGAP											0													105.0	98.0	101.0					2																	158272420		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.849G>A	2.37:g.158272420C>T			B4DWH9|Q15630|Q8NE32	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E283	ENST00000264192.3	37	c.849	CCDS2204.1	2																																																																																			CYTIP	-	NULL	ENSG00000115165		0.537	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTIP	HGNC	protein_coding	OTTHUMT00000254926.1	38	0.00	0	C	NM_004288		158272420	158272420	-1	no_errors	ENST00000264192	ensembl	human	known	69_37n	silent	34	10.26	4	SNP	1.000	T
DLX6	1750	genome.wustl.edu	37	7	96635420	96635421	+	In_Frame_Ins	INS	-	-	GCC	rs527616759|rs570498188|rs559903070|rs374304439	byFrequency	TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr7:96635420_96635421insGCC	ENST00000518156.2	+	1	561_562	c.131_132insGCC	c.(130-135)cagccg>caGCCgccg	p.53_54insP	DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6_ENST00000007660.5_Intron|DLX6-AS1_ENST00000431497.2_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000430027.3_RNA|DLX6_ENST00000555308.1_5'Flank|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000452769.2_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	0					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					caacagcaacagccgccgccgc	0.698														532	0.10623	0.0076	0.0893	5008	,	,		7133	0.0685		0.1948	False		,,,				2504	0.1994					dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0				CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.156_158dupGCC	7.37:g.96635427_96635429dupGCC	ENSP00000428480:p.Pro54_Pro55dup		A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	In_Frame_Ins	INS	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa,pfscan_Homeodomain	p.48in_frame_insP	ENST00000518156.2	37	c.131_132	CCDS47647.2	7																																																																																			DLX6	-	NULL	ENSG00000006377		0.698	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLX6	HGNC	protein_coding	OTTHUMT00000334373.4	33	0.00	0	-	NM_005222		96635420	96635421	+1	no_errors	ENST00000518156	ensembl	human	known	69_37n	in_frame_ins	41	14.58	7	INS	0.990:1.000	GCC
DMRT3	58524	genome.wustl.edu	37	9	990339	990339	+	Silent	SNP	G	G	A	rs184249595		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr9:990339G>A	ENST00000190165.2	+	2	791	c.753G>A	c.(751-753)ccG>ccA	p.P251P		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	251					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		ACAGACCGCCGCTTGAAGTGT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18298	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													60.0	66.0	64.0					9																	990339		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.753G>A	9.37:g.990339G>A			Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Silent	SNP	pfam_DM_DNA-bd,pfam_DMA,superfamily_DM_DNA-bd,superfamily_UBA-like,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.P251	ENST00000190165.2	37	c.753	CCDS6443.1	9																																																																																			DMRT3	-	pfam_DMA,superfamily_UBA-like	ENSG00000064218		0.577	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT3	HGNC	protein_coding	OTTHUMT00000051490.1	32	0.00	0	G	NM_021240		990339	990339	+1	no_errors	ENST00000190165	ensembl	human	known	69_37n	silent	72	20.00	18	SNP	0.077	A
DNM1P34	729809	genome.wustl.edu	37	15	75593829	75593829	+	RNA	SNP	G	G	C	rs200831236		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr15:75593829G>C	ENST00000567292.1	-	0	740							Q6PK57	DMP34_HUMAN	DNM1 pseudogene 34							microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										GGGCATGGAGGCTGTTCCAAG	0.607																																						dbGAP											0																																										-	-	-			0			AJ576251		15q24.2	2013-04-25			ENSG00000260357	ENSG00000260357			35181	pseudogene	pseudogene				DNM1DN8@			Standard	NG_009143		Approved	DNM1DN8-1, DNM1DN8-5	uc002azx.1	Q6PK57	OTTHUMG00000172673		15.37:g.75593829G>C				RNA	SNP	-	NULL	ENST00000567292.1	37	NULL		15																																																																																			DNM1P34	-	-	ENSG00000260357		0.607	DNM1P34-001	KNOWN	basic	processed_transcript	DNM1P34	HGNC	pseudogene	OTTHUMT00000419799.1	8	0.00	0	G	NG_009143		75593829	75593829	-1	no_errors	ENST00000567292	ensembl	human	known	69_37n	rna	6	40.00	4	SNP	0.488	C
DOCK8	81704	genome.wustl.edu	37	9	377122	377122	+	Missense_Mutation	SNP	G	G	A	rs376140410		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr9:377122G>A	ENST00000453981.1	+	20	2463	c.2351G>A	c.(2350-2352)cGc>cAc	p.R784H	DOCK8_ENST00000382329.1_Missense_Mutation_p.R251H|DOCK8_ENST00000469391.1_Missense_Mutation_p.R716H|DOCK8_ENST00000382331.1_Missense_Mutation_p.R86H|DOCK8_ENST00000432829.2_Missense_Mutation_p.R716H			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	784					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AACTCCTCCCGCCTGGAGCCG	0.602																																						dbGAP											0													49.0	36.0	40.0					9																	377122		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2351G>A	9.37:g.377122G>A	ENSP00000408464:p.Arg784His		A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.R784H	ENST00000453981.1	37	c.2351	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624010	0.87560	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382331;ENST00000382329	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.61	5.61	0.85477	.	0.159582	0.56097	D	0.000028	T	0.52805	0.1757	L	0.53249	1.67	0.47341	D	0.999395	D;P;P;D	0.89917	1.0;0.937;0.937;0.977	D;P;P;P	0.68621	0.959;0.512;0.512;0.512	T	0.50792	-0.8786	10	0.62326	D	0.03	.	19.6289	0.95691	0.0:0.0:1.0:0.0	.	86;716;251;784	A2A370;E9PH09;A2A369;Q8NF50	.;.;.;DOCK8_HUMAN	H	784;784;716;716;86;251	ENSP00000408464:R784H;ENSP00000394888:R716H;ENSP00000419438:R716H;ENSP00000371768:R86H;ENSP00000371766:R251H	ENSP00000287364:R784H	R	+	2	0	DOCK8	367122	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.515000	0.60489	2.633000	0.89246	0.655000	0.94253	CGC	DOCK8	-	NULL	ENSG00000107099		0.602	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	27	0.00	0	G	XM_036307		377122	377122	+1	no_errors	ENST00000453981	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	A
DSPP	1834	genome.wustl.edu	37	4	88537027	88537027	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr4:88537027C>A	ENST00000282478.7	+	4	3246	c.3213C>A	c.(3211-3213)gaC>gaA	p.D1071E	DSPP_ENST00000399271.1_Missense_Mutation_p.D1071E|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1071	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.542																																						dbGAP											0													56.0	66.0	63.0					4																	88537027		1577	2848	4425	-	-	-	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3213C>A	4.37:g.88537027C>A	ENSP00000282478:p.Asp1071Glu		A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.D1071E	ENST00000282478.7	37	c.3213	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	c	2.636	-0.285341	0.05605	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88124	-2.34;-2.34	1.15	-2.31	0.06765	.	.	.	.	.	T	0.69196	0.3084	L	0.38175	1.15	0.09310	N	1	P	0.46952	0.887	B	0.36766	0.232	T	0.66364	-0.5942	9	0.02654	T	1	.	2.058	0.03586	0.2533:0.3578:0.0:0.3889	.	1071	Q9NZW4	DSPP_HUMAN	E	1071	ENSP00000382213:D1071E;ENSP00000282478:D1071E	ENSP00000282478:D1071E	D	+	3	2	DSPP	88756051	0.029000	0.19370	0.018000	0.16275	0.040000	0.13550	-0.117000	0.10708	-0.986000	0.03498	0.282000	0.19409	GAC	DSPP	-	NULL	ENSG00000152591		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	69	0.00	0	C	NM_014208		88537027	88537027	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	0.431	A
DYNC1H1	1778	genome.wustl.edu	37	14	102502958	102502958	+	Missense_Mutation	SNP	C	C	A	rs141133453	byFrequency	TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr14:102502958C>A	ENST00000360184.4	+	57	11051	c.10887C>A	c.(10885-10887)ttC>ttA	p.F3629L	DYNC1H1_ENST00000556791.1_3'UTR|RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3629	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CACTGAGATTCGGTAACCCCC	0.443																																						dbGAP											0													145.0	128.0	133.0					14																	102502958		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10887C>A	14.37:g.102502958C>A	ENSP00000348965:p.Phe3629Leu		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.F3629L	ENST00000360184.4	37	c.10887	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	C	16.48	3.133952	0.56828	.	.	ENSG00000197102	ENST00000360184	T	0.20881	2.04	5.83	-9.42	0.00610	.	0.000000	0.85682	D	0.000000	T	0.43010	0.1228	M	0.81802	2.56	0.52501	D	0.999956	D	0.89917	1.0	D	0.97110	1.0	T	0.73704	-0.3899	10	0.45353	T	0.12	.	21.1965	0.99948	0.0:0.2229:0.0:0.7771	.	3629	Q14204	DYHC1_HUMAN	L	3629	ENSP00000348965:F3629L	ENSP00000348965:F3629L	F	+	3	2	DYNC1H1	101572711	0.110000	0.22057	0.004000	0.12327	0.335000	0.28730	-0.519000	0.06260	-2.439000	0.00551	-1.851000	0.00568	TTC	DYNC1H1	-	NULL	ENSG00000197102		0.443	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	57	0.00	0	C	NM_001376		102502958	102502958	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	0.154	A
RSPH10B2	728194	genome.wustl.edu	37	7	6836437	6836437	+	Intron	SNP	G	G	T	rs2528352	byFrequency	TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr7:6836437G>T	ENST00000403107.1	+	19	2819				RSPH10B2_ENST00000433859.2_Intron|RSPH10B2_ENST00000404077.1_Intron|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000359718.3_Intron|RSPH10B2_ENST00000297186.3_Intron|CCZ1B_ENST00000597208.1_5'UTR			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)											breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						CCAGCTGCTCGCTCTCTTCCT	0.537													.|||	1395	0.278554	0.1679	0.2061	5008	,	,		7726	0.5417		0.1471	False		,,,				2504	0.3436					dbGAP											0													79.0	85.0	83.0					7																	6836437		1696	3682	5378	-	-	-	SO:0001627	intron_variant	0				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.2432+40G>T	7.37:g.6836437G>T			A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	RNA	SNP	-	NULL	ENST00000403107.1	37	NULL	CCDS43552.1	7																																																																																			AC073343.11	-	-	ENSG00000226150		0.537	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000226150	Clone_based_vega_gene	protein_coding	OTTHUMT00000324184.4	57	0.00	0	G	NM_001099697		6836437	6836437	-1	no_errors	ENST00000429267	ensembl	human	known	69_37n	rna	58	12.12	8	SNP	0.001	T
ESRP1	54845	genome.wustl.edu	37	8	95718295	95718295	+	3'UTR	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr8:95718295G>T	ENST00000433389.2	+	0	2414				ESRP1_ENST00000358397.5_3'UTR|ESRP1_ENST00000454170.2_3'UTR|ESRP1_ENST00000523347.1_3'UTR|ESRP1_ENST00000423620.2_3'UTR	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1						mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						ATCTTTTGGTGGAGTGAAAAA	0.418																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.*178G>T	8.37:g.95718295G>T			A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	RNA	SNP	-	NULL	ENST00000433389.2	37	NULL	CCDS47897.1	8																																																																																			ESRP1	-	-	ENSG00000104413		0.418	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	HGNC	protein_coding	OTTHUMT00000379326.1	18	0.00	0	G	NM_017697		95718295	95718295	+1	no_errors	ENST00000523347	ensembl	human	known	69_37n	rna	38	31.58	18	SNP	1.000	T
EVI5	7813	genome.wustl.edu	37	1	93159433	93159433	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:93159433A>T	ENST00000370331.1	-	9	1164	c.1155T>A	c.(1153-1155)caT>caA	p.H385Q	EVI5_ENST00000543509.1_Missense_Mutation_p.H385Q|EVI5_ENST00000540033.1_Missense_Mutation_p.H385Q	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	385	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CATCAAACTGATGTGGAATGA	0.294																																						dbGAP											0													117.0	126.0	123.0					1																	93159433		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1155T>A	1.37:g.93159433A>T	ENSP00000359356:p.His385Gln		A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.H385Q	ENST00000370331.1	37	c.1155	CCDS30774.1	1	.	.	.	.	.	.	.	.	.	.	A	11.91	1.778663	0.31502	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	T;T;T	0.21031	2.03;2.03;2.03	5.23	4.11	0.48088	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.18964	0.0455	L	0.41236	1.265	0.50039	D	0.999843	D;P	0.67145	0.996;0.945	D;P	0.66979	0.948;0.621	T	0.02275	-1.1184	10	0.39692	T	0.17	-12.5141	8.1048	0.30879	0.8441:0.0:0.1559:0.0	.	385;385	F5H4R0;O60447	.;EVI5_HUMAN	Q	385;385;385;24	ENSP00000359356:H385Q;ENSP00000440826:H385Q;ENSP00000445019:H385Q	ENSP00000345500:H24Q	H	-	3	2	EVI5	92932021	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.571000	0.53841	0.837000	0.34925	0.379000	0.24179	CAT	EVI5	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000067208		0.294	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVI5	HGNC	protein_coding	OTTHUMT00000030047.1	19	0.00	0	A	NM_005665		93159433	93159433	-1	no_errors	ENST00000543509	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	1.000	T
AMER3	205147	genome.wustl.edu	37	2	131520327	131520327	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr2:131520327delT	ENST00000423981.1	+	2	792	c.682delT	c.(682-684)tttfs	p.F228fs	AMER3_ENST00000321420.4_Frame_Shift_Del_p.F228fs	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	228					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										CGATGCATCCTTTGGTCTCTG	0.672																																						dbGAP											0													49.0	56.0	54.0					2																	131520327		2201	4299	6500	-	-	-	SO:0001589	frameshift_variant	0			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.682delT	2.37:g.131520327delT	ENSP00000392700:p.Phe228fs		B7ZLH6	Frame_Shift_Del	DEL	pfam_Uncharacterised_FAM123	p.F228fs	ENST00000423981.1	37	c.682	CCDS2164.1	2																																																																																			FAM123C	-	pfam_Uncharacterised_FAM123	ENSG00000178171		0.672	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123C	HGNC	protein_coding	OTTHUMT00000254531.3	26	0.00	0	T	NM_152698		131520327	131520327	+1	no_errors	ENST00000321420	ensembl	human	known	69_37n	frame_shift_del	37	13.95	6	DEL	0.591	-
FAM135B	51059	genome.wustl.edu	37	8	139323125	139323125	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr8:139323125C>A	ENST00000395297.1	-	3	286	c.116G>T	c.(115-117)aGg>aTg	p.R39M		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	39										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GTGGGGGATCCTTGAAGACAC	0.507										HNSCC(54;0.14)																												dbGAP											0													85.0	80.0	82.0					8																	139323125		1976	4153	6129	-	-	-	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.116G>T	8.37:g.139323125C>A	ENSP00000378710:p.Arg39Met		B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.R39M	ENST00000395297.1	37	c.116	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823304	0.71143	.	.	ENSG00000147724	ENST00000395297;ENST00000160713;ENST00000520380	T	0.16457	2.34	5.1	4.22	0.49857	.	0.000000	0.52532	U	0.000068	T	0.34193	0.0889	M	0.77820	2.39	0.37786	D	0.927193	D	0.67145	0.996	P	0.57371	0.819	T	0.37619	-0.9698	10	0.66056	D	0.02	-9.0779	9.5272	0.39171	0.0:0.9043:0.0:0.0957	.	39	Q49AJ0	F135B_HUMAN	M	39	ENSP00000378710:R39M	ENSP00000160713:R39M	R	-	2	0	FAM135B	139392307	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	2.301000	0.43628	1.510000	0.48803	0.655000	0.94253	AGG	FAM135B	-	NULL	ENSG00000147724		0.507	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	24	0.00	0	C	NM_015912		139323125	139323125	-1	no_errors	ENST00000395297	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.999	A
FCGBP	8857	genome.wustl.edu	37	19	40377034	40377034	+	Silent	SNP	G	G	A	rs201304305	byFrequency	TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr19:40377034G>A	ENST00000221347.6	-	24	11395	c.11388C>T	c.(11386-11388)aaC>aaT	p.N3796N	FCGBP_ENST00000595713.1_5'UTR	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3796	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGGGGTCGCCGTTGTAGTTCC	0.597																																						dbGAP											0													4.0	4.0	4.0					19																	40377034		1716	3539	5255	-	-	-	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11388C>T	19.37:g.40377034G>A			O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.N3796	ENST00000221347.6	37	c.11388	CCDS12546.1	19																																																																																			FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	20	0.00	0	G	NM_003890		40377034	40377034	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	silent	115	17.27	24	SNP	0.470	A
LINC00951	401260	genome.wustl.edu	37	6	40313783	40313783	+	lincRNA	SNP	T	T	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr6:40313783T>C	ENST00000373171.2	-	0	107				TDRG1_ENST00000448559.1_RNA|TDRG1_ENST00000451810.1_RNA	NR_038887.1				long intergenic non-protein coding RNA 951																		TGTGGTGGTGTGGTGTGGTCA	0.532																																						dbGAP											0																																										-	-	-			0			AK123643, BC132805		6p21.2	2013-07-23			ENSG00000204092	ENSG00000204092		"""Long non-coding RNAs"""	48662	non-coding RNA	RNA, long non-coding						23872665	Standard	NR_038887		Approved	lincRNA-uc003opf.1, FLJ41649			OTTHUMG00000014658		6.37:g.40313783T>C				RNA	SNP	-	NULL	ENST00000373171.2	37	NULL		6																																																																																			RP11-552E20.3	-	-	ENSG00000204092		0.532	LINC00951-001	KNOWN	basic|exp_conf	lincRNA	FLJ41649	Clone_based_vega_gene	lincRNA	OTTHUMT00000040481.1	378	0.00	0	T			40313783	40313783	-1	no_errors	ENST00000373171	ensembl	human	putative	69_37n	rna	595	16.90	121	SNP	0.000	C
FOS	2353	genome.wustl.edu	37	14	75746765	75746765	+	Silent	SNP	T	T	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr14:75746765T>G	ENST00000303562.4	+	2	536	c.327T>G	c.(325-327)gcT>gcG	p.A109A	FOS_ENST00000555686.1_5'UTR|FOS_ENST00000554617.1_Silent_p.A109A|FOS_ENST00000555242.1_Silent_p.A109A|FOS_ENST00000555347.1_5'Flank|FOS_ENST00000535987.1_Silent_p.A109A	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	109					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	ACTCCAGGGCTGGCGTTGTGA	0.647																																						dbGAP											0													38.0	43.0	42.0					14																	75746765		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.327T>G	14.37:g.75746765T>G			A8K4E2|B4DQ65|P18849	Missense_Mutation	SNP	NULL	p.W100G	ENST00000303562.4	37	c.298	CCDS9841.1	14	.	.	.	.	.	.	.	.	.	.	T	1.777	-0.482945	0.04383	.	.	ENSG00000170345	ENST00000554212;ENST00000557139	T	0.75938	-0.98	5.95	-6.98	0.01611	.	.	.	.	.	T	0.56470	0.1987	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51012	-0.8759	5	.	.	.	-5.3924	0.4984	0.00575	0.2164:0.2301:0.2678:0.2857	.	.	.	.	G	100;29	ENSP00000451786:W29G	.	W	+	1	0	FOS	74816518	0.003000	0.15002	0.069000	0.20011	0.009000	0.06853	-2.016000	0.01446	-1.633000	0.01539	-1.098000	0.02139	TGG	FOS	-	NULL	ENSG00000170345		0.647	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOS	HGNC	protein_coding	OTTHUMT00000415044.1	49	0.00	0	T	NM_005252		75746765	75746765	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000554212	ensembl	human	novel	69_37n	missense	17	60.47	26	SNP	0.096	G
FREM2	341640	genome.wustl.edu	37	13	39343763	39343763	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr13:39343763G>C	ENST00000280481.7	+	4	5675	c.5459G>C	c.(5458-5460)gGc>gCc	p.G1820A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1820	Calx-beta 1.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GACTTCAAGGGCAAAGCACAG	0.443																																						dbGAP											0													110.0	97.0	101.0					13																	39343763		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5459G>C	13.37:g.39343763G>C	ENSP00000280481:p.Gly1820Ala		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.G1820A	ENST00000280481.7	37	c.5459	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845534	0.71603	.	.	ENSG00000150893	ENST00000280481	T	0.27402	1.67	5.01	5.01	0.66863	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.44850	0.1313	M	0.70842	2.15	0.80722	D	1	D	0.54601	0.967	P	0.54706	0.759	T	0.43048	-0.9415	10	0.06236	T	0.91	.	18.3414	0.90307	0.0:0.0:1.0:0.0	.	1820	Q5SZK8	FREM2_HUMAN	A	1820	ENSP00000280481:G1820A	ENSP00000280481:G1820A	G	+	2	0	FREM2	38241763	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	8.020000	0.88740	2.320000	0.78422	0.591000	0.81541	GGC	FREM2	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000150893		0.443	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	35	0.00	0	G	NM_207361		39343763	39343763	+1	no_errors	ENST00000280481	ensembl	human	known	69_37n	missense	4	80.00	16	SNP	1.000	C
FXYD3	5349	genome.wustl.edu	37	19	35613692	35613692	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr19:35613692G>C	ENST00000344013.6	+	6	317	c.121G>C	c.(121-123)Ggg>Cgg	p.G41R	FXYD3_ENST00000605550.1_Missense_Mutation_p.G41R|FXYD3_ENST00000346446.5_Missense_Mutation_p.G41R|FXYD3_ENST00000406242.3_Missense_Mutation_p.G41R|FXYD3_ENST00000604621.1_Missense_Mutation_p.G41R|FXYD3_ENST00000406988.1_Missense_Mutation_p.G41R|FXYD3_ENST00000535103.1_Missense_Mutation_p.G98R|FXYD3_ENST00000604404.1_Missense_Mutation_p.G41R|FXYD3_ENST00000603524.1_Missense_Mutation_p.G70R|FXYD3_ENST00000604255.1_Missense_Mutation_p.G98R|FXYD3_ENST00000435734.2_Missense_Mutation_p.G41R|FXYD3_ENST00000603181.1_Missense_Mutation_p.G41R|LGI4_ENST00000493050.1_5'Flank|FXYD3_ENST00000605677.1_Missense_Mutation_p.G41R|FXYD3_ENST00000604804.1_Missense_Mutation_p.G70R			Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3	41					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of catalytic activity (GO:0050790)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			endometrium(1)|lung(2)|prostate(1)	4	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCAGGTTGGCGGGCTCATCTG	0.627																																						dbGAP											0													82.0	87.0	85.0					19																	35613692		2203	4300	6503	-	-	-	SO:0001583	missense	0			X93036	CCDS12442.1, CCDS12443.1, CCDS46048.1, CCDS46049.1, CCDS46050.1	19q13.11-q13.12	2008-05-14	2002-01-14			ENSG00000089356			4027	protein-coding gene	gene with protein product		604996	"""FXYD domain-containing ion transport regulator 3"""	PLML		7836447, 10950925	Standard	NM_005971		Approved	MAT-8	uc010xsm.2	Q14802		ENST00000344013.6:c.121G>C	19.37:g.35613692G>C	ENSP00000339499:p.Gly41Arg		A6NDE0|C9JDU2|F5H174|F8WB34|Q13211|Q6IB59	Missense_Mutation	SNP	pfam_Ion-transport_regulator_FXYD	p.G98R	ENST00000344013.6	37	c.292	CCDS12442.1	19	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753871	0.69648	.	.	ENSG00000089356	ENST00000406242;ENST00000435734;ENST00000346446;ENST00000344013;ENST00000406988;ENST00000535103	D;D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94;-3.94	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.97362	0.9137	M	0.77712	2.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97875	1.0288	10	0.87932	D	0	-4.5663	13.7237	0.62745	0.0:0.0:1.0:0.0	.	98;41;41;41	F5H174;F8WB34;Q14802-2;Q14802	.;.;.;FXYD3_HUMAN	R	41;98;41;41;41;98	ENSP00000385412:G41R;ENSP00000328259:G41R;ENSP00000339499:G41R;ENSP00000385200:G41R;ENSP00000443953:G98R	ENSP00000339499:G41R	G	+	1	0	FXYD3	40305532	0.999000	0.42202	0.960000	0.40013	0.554000	0.35429	4.940000	0.63533	2.307000	0.77673	0.650000	0.86243	GGG	FXYD3	-	pfam_Ion-transport_regulator_FXYD	ENSG00000089356		0.627	FXYD3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FXYD3	HGNC	protein_coding	OTTHUMT00000468985.1	38	0.00	0	G	NM_021910		35613692	35613692	+1	no_errors	ENST00000435734	ensembl	human	known	69_37n	missense	30	31.11	14	SNP	0.949	C
HBP1	26959	genome.wustl.edu	37	7	106830713	106830713	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr7:106830713C>A	ENST00000222574.4	+	8	1204	c.1018C>A	c.(1018-1020)Ccc>Acc	p.P340T	HBP1_ENST00000461963.1_Intron|HBP1_ENST00000485846.1_Missense_Mutation_p.P340T|HBP1_ENST00000468410.1_Missense_Mutation_p.P340T|CTA-363E19.2_ENST00000607036.1_RNA	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	340	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						TCCTGGACACCCCGATGCCAT	0.363																																						dbGAP											0													251.0	223.0	233.0					7																	106830713		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.1018C>A	7.37:g.106830713C>A	ENSP00000222574:p.Pro340Thr		B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_HMG_superfamily,superfamily_Ataxin-1_HBP1,superfamily_HMG_superfamily,smart_Ataxin_AXH_dom,smart_HMG_superfamily,pfscan_Ataxin-1_HBP1,pfscan_HMG_superfamily	p.P340T	ENST00000222574.4	37	c.1018	CCDS5741.1	7	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973205	0.92919	.	.	ENSG00000105856	ENST00000468410;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.99032	-5.35;-5.35;-5.35	5.37	5.37	0.77165	Ataxin, AXH domain (1);Ataxin-1/HBP1 module (AXH) (2);	0.051337	0.85682	D	0.000000	D	0.98937	0.9639	L	0.56769	1.78	0.80722	D	1	P;P;P	0.47302	0.893;0.733;0.774	P;P;P	0.58820	0.846;0.603;0.724	D	0.99894	1.1143	10	0.66056	D	0.02	-13.7284	19.1082	0.93305	0.0:1.0:0.0:0.0	.	350;340;340	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	T	340;340;340;332	ENSP00000420500:P340T;ENSP00000222574:P340T;ENSP00000418738:P340T	ENSP00000222574:P340T	P	+	1	0	HBP1	106617949	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.770000	0.85390	2.524000	0.85096	0.561000	0.74099	CCC	HBP1	-	superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	ENSG00000105856		0.363	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBP1	HGNC	protein_coding	OTTHUMT00000349297.1	91	0.00	0	C	NM_012257		106830713	106830713	+1	no_errors	ENST00000222574	ensembl	human	known	69_37n	missense	98	19.67	24	SNP	1.000	A
HCAR3	8843	genome.wustl.edu	37	12	123200527	123200527	+	Missense_Mutation	SNP	T	T	C	rs118091133	byFrequency	TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:123200527T>C	ENST00000528880.2	-	1	912	c.758A>G	c.(757-759)cAc>cGc	p.H253R	RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	253			H -> R. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7505609, ECO:0000269|Ref.2}.		G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	CCAGAAGATGTGGATCCGCAC	0.537																																						dbGAP											0													43.0	46.0	45.0					12																	123200527		2157	4258	6415	-	-	-	SO:0001583	missense	0			D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.758A>G	12.37:g.123200527T>C	ENSP00000436714:p.His253Arg		A8K4G5|B2R830|E9PI97|Q8NGE4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.H253R	ENST00000528880.2	37	c.758	CCDS53842.1	12	943	0.4317765567765568	257	0.5223577235772358	148	0.4088397790055249	251	0.4388111888111888	287	0.3786279683377309	N	0.024	-1.384870	0.01194	.	.	ENSG00000255398	ENST00000528880	T	0.36699	1.24	3.26	1.35	0.21983	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.48007	-0.9072	7	0.22109	T	0.4	.	6.4625	0.21964	0.0:0.5221:0.0:0.4779	rs2454726;rs3825144;rs17884272	253	E9PI97	.	R	253	ENSP00000436714:H253R	ENSP00000436714:H253R	H	-	2	0	HCAR3	121766480	0.000000	0.05858	0.041000	0.18516	0.077000	0.17291	-0.023000	0.12456	-0.236000	0.09753	-1.160000	0.01791	CAC	HCAR3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000255398		0.537	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR3	HGNC	protein_coding	OTTHUMT00000387549.2	12	0.00	0	T	NM_006018		123200527	123200527	-1	no_errors	ENST00000528880	ensembl	human	known	69_37n	missense	3	75.00	9	SNP	0.000	C
HERC2P4	100289574	genome.wustl.edu	37	16	32163393	32163393	+	IGR	SNP	A	A	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr16:32163393A>T								RP11-1166P10.6 (67287 upstream) : HERC2P4 (17911 downstream)																							GTGTAAAGCCAATTTCCCTTA	0.458																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.32163393A>T				RNA	SNP	-	NULL		37	NULL		16																																																																																			HERC2P4	-	-	ENSG00000230267	0	0.458					HERC2P4	HGNC			40	0.00	0	A			32163393	32163393	-1	no_errors	ENST00000563904	ensembl	human	known	69_37n	rna	22	53.19	25	SNP	0.001	T
PRAC1	84366	genome.wustl.edu	37	17	46801725	46801725	+	5'Flank	DEL	G	G	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr17:46801725delG	ENST00000290294.3	-	0	0				PRAC2_ENST00000432056.1_RNA|MIR3185_ENST00000583892.1_RNA|PRAC2_ENST00000422730.2_RNA	NM_032391.2	NP_115767.1	Q96KF2	PRAC1_HUMAN	prostate cancer susceptibility candidate 1							nucleus (GO:0005634)											AAGTGTGTGTGGGGGGGTCCA	0.453											OREG0024525	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AF331165	CCDS11535.1	17q21	2013-08-29	2013-08-29	2013-08-29	ENSG00000159182	ENSG00000159182			30591	protein-coding gene	gene with protein product	"""prostate, rectum and colon"""	609819	"""chromosome 17 open reading frame 92"", ""prostate cancer susceptibility candidate"""	C17orf92, PRAC		11340635	Standard	NM_032391		Approved		uc002iny.3	Q96KF2	OTTHUMG00000159899		17.37:g.46801725delG	Exception_encountered	942		RNA	DEL	-	NULL	ENST00000290294.3	37	NULL	CCDS11535.1	17																																																																																			HOXB-AS5	-	-	ENSG00000229637		0.453	PRAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB-AS5	HGNC	protein_coding	OTTHUMT00000358086.1	18	0.00	0	G	NM_032391		46801725	46801725	+1	no_errors	ENST00000422730	ensembl	human	known	69_37n	rna	16	34.62	9	DEL	0.000	-
HSP90AA6P	441051	genome.wustl.edu	37	4	171526014	171526014	+	RNA	SNP	G	G	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr4:171526014G>C	ENST00000325407.4	-	0	121									heat shock protein 90kDa alpha (cytosolic), class A member 6, pseudogene																		TATGTTTTCAGAGAACTGCTC	0.368																																						dbGAP											0																																										-	-	-			0			AY956762		4q33	2014-02-12	2011-04-15			ENSG00000181359			32536	pseudogene	pseudogene						16269234	Standard	NG_025183		Approved						4.37:g.171526014G>C				RNA	SNP	-	NULL	ENST00000325407.4	37	NULL		4																																																																																			HSP90AA6P	-	-	ENSG00000181359		0.368	HSP90AA6P-002	KNOWN	basic	processed_transcript	HSP90AA6P	HGNC	pseudogene	OTTHUMT00000366140.1	50	0.00	0	G			171526014	171526014	-1	no_errors	ENST00000325407	ensembl	human	known	69_37n	rna	30	28.57	12	SNP	0.191	C
IL17B	27190	genome.wustl.edu	37	5	148754154	148754154	+	Silent	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr5:148754154G>A	ENST00000261796.3	-	3	371	c.321C>T	c.(319-321)caC>caT	p.H107H	RP11-394O4.3_ENST00000521756.1_RNA|IL17B_ENST00000505432.1_5'UTR	NM_014443.2	NP_055258.1	Q9UHF5	IL17B_HUMAN	interleukin 17B	107					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|urinary_tract(1)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCTGGGGTCGTGGTTGATGC	0.612																																						dbGAP											0													22.0	22.0	22.0					5																	148754154		2199	4289	6488	-	-	-	SO:0001819	synonymous_variant	0			AF184969	CCDS4297.1	5q33.1	2011-07-14			ENSG00000127743	ENSG00000127743		"""Interleukins and interleukin receptors"""	5982	protein-coding gene	gene with protein product	"""neuronal interleukin-17-related factor"""	604627				10639155	Standard	NM_014443		Approved	IL-17B, ZCYTO7, IL-20, MGC138900, MGC138901, NIRF	uc003lqo.3	Q9UHF5	OTTHUMG00000130051	ENST00000261796.3:c.321C>T	5.37:g.148754154G>A			Q14CE5	Silent	SNP	pfam_Interleukin-17,prints_Interleukin-17_chordata	p.H107	ENST00000261796.3	37	c.321	CCDS4297.1	5																																																																																			IL17B	-	pfam_Interleukin-17,prints_Interleukin-17_chordata	ENSG00000127743		0.612	IL17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17B	HGNC	protein_coding	OTTHUMT00000252330.1	19	0.00	0	G	NM_014443		148754154	148754154	-1	no_errors	ENST00000261796	ensembl	human	known	69_37n	silent	2	85.71	12	SNP	0.965	A
INHA	3623	genome.wustl.edu	37	2	220439596	220439596	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr2:220439596C>G	ENST00000243786.2	+	2	629	c.449C>G	c.(448-450)cCc>cGc	p.P150R	INHA_ENST00000489456.1_3'UTR	NM_002191.3	NP_002182.1	P05111	INHA_HUMAN	inhibin, alpha	150					cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|erythrocyte differentiation (GO:0030218)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|ovarian follicle development (GO:0001541)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|response to external stimulus (GO:0009605)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|inhibin A complex (GO:0043512)|inhibin-betaglycan-ActRII complex (GO:0034673)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		AGCTCTGAGCCCCTGCTAGGC	0.667																																						dbGAP											0													43.0	40.0	41.0					2																	220439596		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2444.1	2q35	2013-09-19			ENSG00000123999	ENSG00000123999			6065	protein-coding gene	gene with protein product		147380				3345731	Standard	NM_002191		Approved		uc002vmk.2	P05111	OTTHUMG00000059237	ENST00000243786.2:c.449C>G	2.37:g.220439596C>G	ENSP00000243786:p.Pro150Arg		A8K8H5	Missense_Mutation	SNP	pfam_TGF-b_C,smart_TGF-b_C,pirsf_Inhibin_asu_subgr,prints_Inhibin_asu	p.P150R	ENST00000243786.2	37	c.449	CCDS2444.1	2	.	.	.	.	.	.	.	.	.	.	C	14.77	2.635214	0.47049	.	.	ENSG00000123999	ENST00000243786	D	0.85258	-1.96	4.96	4.08	0.47627	.	0.294729	0.36815	N	0.002382	D	0.86611	0.5974	M	0.77820	2.39	0.09310	N	0.999994	D	0.54964	0.969	P	0.55923	0.787	T	0.76244	-0.3030	10	0.22109	T	0.4	-11.2793	3.2416	0.06783	0.1417:0.5656:0.1376:0.1551	.	150	P05111	INHA_HUMAN	R	150	ENSP00000243786:P150R	ENSP00000243786:P150R	P	+	2	0	INHA	220147840	0.000000	0.05858	0.240000	0.24138	0.963000	0.63663	0.763000	0.26517	1.306000	0.44926	0.561000	0.74099	CCC	INHA	-	pirsf_Inhibin_asu_subgr	ENSG00000123999		0.667	INHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHA	HGNC	protein_coding	OTTHUMT00000131425.1	78	0.00	0	C			220439596	220439596	+1	no_errors	ENST00000243786	ensembl	human	known	69_37n	missense	29	47.27	26	SNP	0.002	G
IRAK2	3656	genome.wustl.edu	37	3	10276205	10276205	+	Silent	SNP	C	C	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr3:10276205C>T	ENST00000256458.4	+	11	1425	c.1335C>T	c.(1333-1335)ggC>ggT	p.G445G		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	445	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						GGAAGACGGGCGTGGAGAACG	0.612																																						dbGAP											0													86.0	79.0	81.0					3																	10276205		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.1335C>T	3.37:g.10276205C>T			B4DQZ6|Q08AG6|Q5K546	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G445	ENST00000256458.4	37	c.1335	CCDS33697.1	3																																																																																			IRAK2	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000134070		0.612	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	HGNC	protein_coding	OTTHUMT00000339623.1	61	0.00	0	C			10276205	10276205	+1	no_errors	ENST00000256458	ensembl	human	known	69_37n	silent	2	88.24	15	SNP	0.000	T
ITFG2	55846	genome.wustl.edu	37	12	2932053	2932053	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:2932053G>T	ENST00000228799.2	+	10	1181	c.1042G>T	c.(1042-1044)Gaa>Taa	p.E348*	ITFG2_ENST00000542548.1_Nonsense_Mutation_p.E236*|ITFG2_ENST00000419778.2_Nonsense_Mutation_p.E171*	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	348					germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CCAAGTGGATGAAAATATCCG	0.532																																						dbGAP											0													139.0	104.0	116.0					12																	2932053		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.1042G>T	12.37:g.2932053G>T	ENSP00000228799:p.Glu348*		A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	Nonsense_Mutation	SNP	pfam_FG-GAP,superfamily_WD40_repeat_dom	p.E348*	ENST00000228799.2	37	c.1042	CCDS8513.1	12	.	.	.	.	.	.	.	.	.	.	G	39	7.549578	0.98352	.	.	ENSG00000111203	ENST00000228799;ENST00000419778;ENST00000542548	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-2.3834	17.0354	0.86473	0.0:0.0:1.0:0.0	.	.	.	.	X	348;171;236	.	ENSP00000228799:E348X	E	+	1	0	ITFG2	2802314	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	9.860000	0.99555	2.268000	0.75426	0.561000	0.74099	GAA	ITFG2	-	superfamily_WD40_repeat_dom	ENSG00000111203		0.532	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG2	HGNC	protein_coding	OTTHUMT00000253091.1	53	0.00	0	G	NM_018463		2932053	2932053	+1	no_errors	ENST00000228799	ensembl	human	known	69_37n	nonsense	44	25.42	15	SNP	1.000	T
KIAA2018	205717	genome.wustl.edu	37	3	113380216	113380216	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr3:113380216G>A	ENST00000478658.1	-	5	330	c.313C>T	c.(313-315)Cga>Tga	p.R105*	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Nonsense_Mutation_p.R105*			Q68DE3	K2018_HUMAN	KIAA2018	105						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TCAATATATCGGCCATTTTCT	0.299																																						dbGAP											0													78.0	76.0	76.0					3																	113380216		1797	4065	5862	-	-	-	SO:0001587	stop_gained	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.313C>T	3.37:g.113380216G>A	ENSP00000420721:p.Arg105*		Q7Z3L9|Q8IVF3|Q9H8T4	Nonsense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.R105*	ENST00000478658.1	37	c.313	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117903	0.77323	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	.	.	.	5.81	5.81	0.92471	.	0.180578	0.38326	N	0.001740	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0613	15.7285	0.77784	0.0:0.0:0.8552:0.1448	.	.	.	.	X	105	.	ENSP00000320794:R105X	R	-	1	2	KIAA2018	114862906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.458000	0.80787	2.745000	0.94114	0.655000	0.94253	CGA	KIAA2018	-	NULL	ENSG00000176542		0.299	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	30	0.00	0	G	NM_001009899		113380216	113380216	-1	no_errors	ENST00000316407	ensembl	human	known	69_37n	nonsense	76	20.83	20	SNP	1.000	A
KIF26B	55083	genome.wustl.edu	37	1	245530213	245530213	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:245530213C>G	ENST00000407071.2	+	3	983	c.543C>G	c.(541-543)gaC>gaG	p.D181E	KIF26B_ENST00000479506.1_3'UTR	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	181					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ACGACCGGGACAACCGCTGTG	0.582																																						dbGAP											0													59.0	61.0	60.0					1																	245530213		2180	4262	6442	-	-	-	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.543C>G	1.37:g.245530213C>G	ENSP00000385545:p.Asp181Glu		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D181E	ENST00000407071.2	37	c.543	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	C	8.437	0.850010	0.17034	.	.	ENSG00000162849	ENST00000407071	T	0.76709	-1.04	5.44	3.58	0.41010	.	.	.	.	.	T	0.61502	0.2352	L	0.31926	0.97	0.80722	D	1	B	0.31599	0.33	B	0.28784	0.094	T	0.56463	-0.7975	9	0.02654	T	1	.	12.1442	0.54014	0.0:0.861:0.0:0.139	.	181	Q2KJY2	KI26B_HUMAN	E	181	ENSP00000385545:D181E	ENSP00000385545:D181E	D	+	3	2	KIF26B	243596836	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.330000	0.43885	0.786000	0.33708	0.650000	0.86243	GAC	KIF26B	-	NULL	ENSG00000162849		0.582	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	45	0.00	0	C	XM_371354		245530213	245530213	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	missense	67	15.19	12	SNP	1.000	G
KRT38	8687	genome.wustl.edu	37	17	39596721	39596721	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr17:39596721G>C	ENST00000246646.3	-	1	452	c.453C>G	c.(451-453)taC>taG	p.Y151*		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	151	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				AGTAAGACTGGTAGTCGGGGC	0.602																																						dbGAP											0													115.0	100.0	105.0					17																	39596721		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.453C>G	17.37:g.39596721G>C	ENSP00000246646:p.Tyr151*		A2RRM5|Q6A164	Nonsense_Mutation	SNP	pfam_F,prints_Keratin_I	p.Y151*	ENST00000246646.3	37	c.453	CCDS11392.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168256	0.78339	.	.	ENSG00000171360	ENST00000246646	.	.	.	4.45	1.41	0.22369	.	0.000000	0.44483	D	0.000444	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.1146	0.25409	0.356:0.0:0.644:0.0	.	.	.	.	X	151	.	ENSP00000246646:Y151X	Y	-	3	2	KRT38	36850247	0.063000	0.20901	0.983000	0.44433	0.770000	0.43624	0.253000	0.18296	0.167000	0.19631	-0.142000	0.14014	TAC	KRT38	-	pfam_F	ENSG00000171360		0.602	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT38	HGNC	protein_coding	OTTHUMT00000257307.2	89	0.00	0	G	NM_006771		39596721	39596721	-1	no_errors	ENST00000246646	ensembl	human	known	69_37n	nonsense	45	29.69	19	SNP	1.000	C
KRTAP10-2	386679	genome.wustl.edu	37	21	45970945	45970945	+	Missense_Mutation	SNP	A	A	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr21:45970945A>T	ENST00000391621.1	-	1	443	c.397T>A	c.(397-399)Tct>Act	p.S133T	KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	133	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						CAGGAGGAAGAGGCACAGCAA	0.622																																						dbGAP											0													100.0	107.0	105.0					21																	45970945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.397T>A	21.37:g.45970945A>T	ENSP00000375479:p.Ser133Thr		Q70LJ5	Missense_Mutation	SNP	NULL	p.S133T	ENST00000391621.1	37	c.397	CCDS42955.1	21	.	.	.	.	.	.	.	.	.	.	a	7.524	0.657312	0.14580	.	.	ENSG00000205445	ENST00000391621	T	0.00711	5.8	3.62	-3.33	0.04958	.	.	.	.	.	T	0.01489	0.0048	L	0.56396	1.775	0.09310	N	1	P	0.47841	0.901	P	0.49637	0.617	T	0.30937	-0.9961	9	0.31617	T	0.26	.	10.4321	0.44413	0.4051:0.0:0.5949:0.0	.	133	P60368	KR102_HUMAN	T	133	ENSP00000375479:S133T	ENSP00000375479:S133T	S	-	1	0	KRTAP10-2	44795373	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.571000	0.05889	-0.702000	0.05056	-0.487000	0.04747	TCT	KRTAP10-2	-	NULL	ENSG00000205445		0.622	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-2	HGNC	protein_coding	OTTHUMT00000128027.1	129	0.77	1	A			45970945	45970945	-1	no_errors	ENST00000391621	ensembl	human	known	69_37n	missense	71	46.62	62	SNP	0.000	T
L3MBTL1	26013	genome.wustl.edu	37	20	42163513	42163513	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr20:42163513G>A	ENST00000427442.2	+	16	1849	c.1690G>A	c.(1690-1692)Gct>Act	p.A564T	L3MBTL1_ENST00000444063.1_Missense_Mutation_p.A496T|L3MBTL1_ENST00000373134.1_Missense_Mutation_p.A496T|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.A496T|L3MBTL1_ENST00000418998.1_Missense_Mutation_p.A564T			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	496					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.A496T(1)		breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CTGGATCGACGCTGACCACCC	0.577																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											84.0	70.0	75.0					20																	42163513		2203	4300	6503	-	-	-	SO:0001583	missense	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1690G>A	20.37:g.42163513G>A	ENSP00000402107:p.Ala564Thr		B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	pfam_Mbt,pfam_Znf_C2HC,superfamily_SAM/pointed,smart_Mbt,pfscan_Mbt	p.A564T	ENST00000427442.2	37	c.1690	CCDS46602.2	20	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807150	0.50421	.	.	ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861;ENST00000373133	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47	5.85	3.68	0.42216	.	0.169417	0.52532	D	0.000067	T	0.38692	0.1050	M	0.65677	2.01	0.38515	D	0.948562	P;P;D;P	0.56035	0.851;0.818;0.974;0.889	B;B;P;P	0.51079	0.205;0.191;0.658;0.508	T	0.40924	-0.9537	10	0.08599	T	0.76	.	14.8369	0.70190	0.0:0.0:0.6874:0.3126	.	564;148;496;496	Q9Y468-5;Q9Y468-3;Q9Y468-2;Q9Y468-1	.;.;.;.	T	564;564;496;496;496;282;148	ENSP00000402107:A564T;ENSP00000398516:A564T;ENSP00000362227:A496T;ENSP00000403316:A496T;ENSP00000362226:A496T;ENSP00000410139:A282T	ENSP00000362225:A148T	A	+	1	0	L3MBTL1	41596927	0.999000	0.42202	0.741000	0.31004	0.992000	0.81027	2.580000	0.46068	1.434000	0.47414	0.655000	0.94253	GCT	L3MBTL1	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000185513		0.577	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL1	HGNC	protein_coding	OTTHUMT00000079300.3	55	0.00	0	G	NM_032107		42163513	42163513	+1	no_errors	ENST00000418998	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.945	A
LARP4B	23185	genome.wustl.edu	37	10	860733	860733	+	Silent	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr10:860733G>A	ENST00000316157.3	-	16	1918	c.1878C>T	c.(1876-1878)tcC>tcT	p.S626S	LARP4B_ENST00000469487.1_5'UTR	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	626					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						CAGTGAGGGCGGAAGGAAGTC	0.572																																						dbGAP											0													105.0	68.0	81.0					10																	860733		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1878C>T	10.37:g.860733G>A			A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	NULL	p.R192C	ENST00000316157.3	37	c.574	CCDS31131.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.202|0.202	-1.043629|-1.043629	0.01997|0.01997	.|.	.|.	ENSG00000107929|ENSG00000107929	ENST00000440895|ENST00000448368	.|.	.|.	.|.	6.07|6.07	-2.96|-2.96	0.05547|0.05547	.|.	.|.	.|.	.|.	.|.	T|T	0.21307|0.21307	0.0513|0.0513	.|.	.|.	.|.	0.27901|0.27901	N|N	0.938987|0.938987	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.30909|0.30909	-0.9962|-0.9962	4|4	.|.	.|.	.|.	-1.6469|-1.6469	4.0763|4.0763	0.09906|0.09906	0.4899:0.0:0.2789:0.2312|0.4899:0.0:0.2789:0.2312	.|.	.|.	.|.	.|.	L|C	102|192	.|.	.|.	P|R	-|-	2|1	0|0	LARP4B|LARP4B	850733|850733	0.156000|0.156000	0.22821|0.22821	0.005000|0.005000	0.12908|0.12908	0.003000|0.003000	0.03518|0.03518	0.515000|0.515000	0.22801|0.22801	-0.705000|-0.705000	0.05035|0.05035	-1.839000|-1.839000	0.00587|0.00587	CCG|CGC	LARP4B	-	NULL	ENSG00000107929		0.572	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	16	0.00	0	G	NM_015155		860733	860733	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000448368	ensembl	human	known	69_37n	missense	11	52.17	12	SNP	0.030	A
LINC00521	256369	genome.wustl.edu	37	14	94467524	94467524	+	RNA	SNP	T	T	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr14:94467524T>A	ENST00000444118.1	+	0	602					NR_024182.1		Q8NCU1	CN048_HUMAN	long intergenic non-protein coding RNA 521																		GAGGAGGTGCTGGTGGAGGCC	0.667																																						dbGAP											0													53.0	43.0	46.0					14																	94467524		2203	4300	6503	-	-	-			0			BI463117		14q32.12	2012-10-12	2011-11-29	2011-11-29	ENSG00000175699	ENSG00000175699		"""Long non-coding RNAs"""	19860	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 48"""	C14orf48			Standard	NR_024182		Approved		uc001ycg.1	Q8NCU1	OTTHUMG00000156974		14.37:g.94467524T>A			Q8N7S1	RNA	SNP	-	NULL	ENST00000444118.1	37	NULL		14																																																																																			LINC00521	-	-	ENSG00000175699		0.667	LINC00521-003	KNOWN	basic	processed_transcript	LINC00521	HGNC	processed_transcript	OTTHUMT00000346916.1	89	0.00	0	T			94467524	94467524	+1	no_errors	ENST00000314629	ensembl	human	known	69_37n	rna	5	90.00	45	SNP	0.000	A
MCF2L2	23101	genome.wustl.edu	37	3	182897388	182897388	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr3:182897388delT	ENST00000328913.3	-	29	3495	c.3198delA	c.(3196-3198)aaafs	p.K1066fs	MCF2L2_ENST00000473233.1_Frame_Shift_Del_p.K1066fs|MCF2L2_ENST00000468976.1_5'Flank	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	1066							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CGCGTTCTTCTTTTTCTCCCT	0.557																																						dbGAP											0													109.0	125.0	120.0					3																	182897388		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.3198delA	3.37:g.182897388delT	ENSP00000328118:p.Lys1066fs		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Frame_Shift_Del	DEL	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E1067fs	ENST00000328913.3	37	c.3198	CCDS3243.1	3																																																																																			MCF2L2	-	NULL	ENSG00000053524		0.557	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	HGNC	protein_coding	OTTHUMT00000350868.1	40	0.00	0	T	NM_015078		182897388	182897388	-1	no_errors	ENST00000328913	ensembl	human	known	69_37n	frame_shift_del	36	41.27	26	DEL	0.000	-
MCF2L2	23101	genome.wustl.edu	37	3	182897394	182897395	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr3:182897394_182897395TC>AT	ENST00000328913.3	-	29	3488_3489	c.3191_3192GA>AT	c.(3190-3192)gGA>gAT	p.G1064D	MCF2L2_ENST00000473233.1_Missense_Mutation_p.G1064D|MCF2L2_ENST00000468976.1_5'Flank	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	1064							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CTTCTTTTTCTCCCTGGCTGCT	0.554																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.3191_3192delinsAT	3.37:g.182897394_182897395delinsAT	ENSP00000328118:p.Gly1064Asp		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Silent|Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G1064|p.G1064E	ENST00000328913.3	37	c.3192|c.3191	CCDS3243.1	3																																																																																			MCF2L2	-	NULL	ENSG00000053524		0.554	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	HGNC	protein_coding	OTTHUMT00000350868.1	38|39	0.00	0	T|C	NM_015078		182897394|182897395	182897394|182897395	-1	no_errors	ENST00000328913	ensembl	human	known	69_37n	silent|missense	29|30	50.00	29|30	SNP	0.002|0.004	A|T
MKI67	4288	genome.wustl.edu	37	10	129899951	129899951	+	Silent	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr10:129899951G>A	ENST00000368654.3	-	14	9651	c.9276C>T	c.(9274-9276)cgC>cgT	p.R3092R	MKI67_ENST00000368653.3_Silent_p.R2732R	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	3092					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGCGTCTGGAGCGCAGGGATA	0.363																																						dbGAP											0													53.0	55.0	54.0					10																	129899951		2169	4282	6451	-	-	-	SO:0001819	synonymous_variant	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.9276C>T	10.37:g.129899951G>A			Q5VWH2	Silent	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.R3092	ENST00000368654.3	37	c.9276	CCDS7659.1	10																																																																																			MKI67	-	NULL	ENSG00000148773		0.363	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	19	0.00	0	G	NM_002417		129899951	129899951	-1	no_errors	ENST00000368654	ensembl	human	known	69_37n	silent	22	35.29	12	SNP	0.000	A
MLC1	23209	genome.wustl.edu	37	22	50518441	50518441	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr22:50518441T>C	ENST00000311597.5	-	5	935	c.329A>G	c.(328-330)aAc>aGc	p.N110S	MLC1_ENST00000538737.1_Intron|MLC1_ENST00000395876.2_Missense_Mutation_p.N110S|MLC1_ENST00000450140.2_Intron|MLC1_ENST00000535444.1_Missense_Mutation_p.N31S|MLC1_ENST00000431262.2_Missense_Mutation_p.N80S	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	110					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		TATCTGAAAGTTGGGAATCTG	0.373																																						dbGAP											0													121.0	108.0	112.0					22																	50518441		2203	4300	6503	-	-	-	SO:0001583	missense	0			D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.329A>G	22.37:g.50518441T>C	ENSP00000310375:p.Asn110Ser		B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	NULL	p.N110S	ENST00000311597.5	37	c.329	CCDS14083.1	22	.	.	.	.	.	.	.	.	.	.	T	16.14	3.039236	0.55003	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000431262;ENST00000535444;ENST00000442311	D;D;D;D;D	0.94537	-2.64;-2.64;-3.0;-2.64;-3.45	5.07	1.74	0.24563	.	0.156558	0.56097	D	0.000029	D	0.91233	0.7237	L	0.59436	1.845	0.35512	D	0.800744	B;B	0.16396	0.017;0.017	B;B	0.15484	0.013;0.013	D	0.87852	0.2658	10	0.66056	D	0.02	-18.953	8.7756	0.34760	0.0:0.2229:0.0:0.7771	.	80;110	B7Z659;Q15049	.;MLC1_HUMAN	S	110;110;80;31;80	ENSP00000379216:N110S;ENSP00000310375:N110S;ENSP00000415877:N80S;ENSP00000438910:N31S;ENSP00000401385:N80S	ENSP00000310375:N110S	N	-	2	0	MLC1	48860568	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.137000	0.42130	0.284000	0.22305	0.459000	0.35465	AAC	MLC1	-	NULL	ENSG00000100427		0.373	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	HGNC	protein_coding	OTTHUMT00000316979.2	32	0.00	0	T	NM_015166		50518441	50518441	-1	no_errors	ENST00000311597	ensembl	human	known	69_37n	missense	46	31.34	21	SNP	1.000	C
KMT2D	8085	genome.wustl.edu	37	12	49425787	49425788	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:49425787_49425788delCT	ENST00000301067.7	-	39	12699_12700	c.12700_12701delAG	c.(12700-12702)agtfs	p.S4234fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4234	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TACTGCCTGACTCTGCTGCAGC	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.12700_12701delAG	12.37:g.49425789_49425790delCT	ENSP00000301067:p.Ser4234fs		O14687	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q4235fs	ENST00000301067.7	37	c.12701_12700	CCDS44873.1	12																																																																																			MLL2	-	NULL	ENSG00000167548		0.639	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	36	0.00	0	CT			49425787	49425788	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	frame_shift_del	18	75.32	58	DEL	1.000:0.998	-
MPHOSPH8	54737	genome.wustl.edu	37	13	20220772	20220772	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr13:20220772G>T	ENST00000361479.5	+	3	627	c.559G>T	c.(559-561)Gag>Tag	p.E187*	MPHOSPH8_ENST00000414242.2_Nonsense_Mutation_p.E187*	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	187	Lys-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		ACCAGACCTGGAGAGCTCCTT	0.378																																						dbGAP											0													30.0	33.0	32.0					13																	20220772		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.559G>T	13.37:g.20220772G>T	ENSP00000355388:p.Glu187*		B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.E187*	ENST00000361479.5	37	c.559	CCDS9287.1	13	.	.	.	.	.	.	.	.	.	.	G	37	6.197709	0.97367	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	.	.	.	6.02	6.02	0.97574	.	0.586946	0.18496	N	0.139494	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.5373	0.99239	0.0:0.0:1.0:0.0	.	.	.	.	X	187	.	ENSP00000355388:E187X	E	+	1	0	MPHOSPH8	19118772	1.000000	0.71417	0.854000	0.33618	0.912000	0.54170	5.654000	0.67974	2.857000	0.98124	0.650000	0.86243	GAG	MPHOSPH8	-	NULL	ENSG00000196199		0.378	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	39	0.00	0	G	NM_017520		20220772	20220772	+1	no_errors	ENST00000414242	ensembl	human	known	69_37n	nonsense	32	11.11	4	SNP	0.975	T
MYBPC3	4607	genome.wustl.edu	37	11	47361303	47361303	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr11:47361303G>T	ENST00000545968.1	-	21	2020	c.1966C>A	c.(1966-1968)Cca>Aca	p.P656T	MYBPC3_ENST00000256993.4_Missense_Mutation_p.P655T|MYBPC3_ENST00000399249.2_Missense_Mutation_p.P656T	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	656	Ig-like C2-type 5.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		ATGGTGTCTGGTATGCGGCCT	0.557																																						dbGAP											0													93.0	96.0	95.0					11																	47361303		1983	4146	6129	-	-	-	SO:0001583	missense	0			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.1966C>A	11.37:g.47361303G>T	ENSP00000442795:p.Pro656Thr		A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P656T	ENST00000545968.1	37	c.1966	CCDS53621.1	11	.	.	.	.	.	.	.	.	.	.	G	9.683	1.149839	0.21371	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.78364	-1.17;-1.17;-1.17	4.67	1.74	0.24563	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.73024	0.3534	L	0.58510	1.815	0.36874	D	0.889041	B	0.26120	0.142	B	0.34824	0.19	T	0.68644	-0.5354	9	0.49607	T	0.09	.	6.4368	0.21827	0.1542:0.2819:0.5639:0.0	.	655	Q14896	MYPC3_HUMAN	T	656;656;655	ENSP00000442795:P656T;ENSP00000382193:P656T;ENSP00000256993:P655T	ENSP00000256993:P655T	P	-	1	0	MYBPC3	47317879	0.440000	0.25618	0.104000	0.21259	0.336000	0.28762	1.105000	0.31086	0.200000	0.20447	0.561000	0.74099	CCA	MYBPC3	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000134571		0.557	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	HGNC	protein_coding	OTTHUMT00000392271.3	46	0.00	0	G			47361303	47361303	-1	no_errors	ENST00000399249	ensembl	human	known	69_37n	missense	86	18.87	20	SNP	0.798	T
MYEOV	26579	genome.wustl.edu	37	11	69063371	69063371	+	Missense_Mutation	SNP	T	T	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr11:69063371T>A	ENST00000308946.3	+	3	904	c.454T>A	c.(454-456)Tct>Act	p.S152T	MYEOV_ENST00000535407.1_Missense_Mutation_p.S94T|MYEOV_ENST00000441339.2_Missense_Mutation_p.S152T	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	152										endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		GAACAGGAATTCTGGGAGTCA	0.617																																						dbGAP											0													222.0	215.0	217.0					11																	69063371		2200	4294	6494	-	-	-	SO:0001583	missense	0			AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.454T>A	11.37:g.69063371T>A	ENSP00000308330:p.Ser152Thr		Q9UGN6|Q9UGN7	Missense_Mutation	SNP	NULL	p.S152T	ENST00000308946.3	37	c.454	CCDS8190.1	11	.	.	.	.	.	.	.	.	.	.	T	6.890	0.533741	0.13188	.	.	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.23147	1.93;1.93;1.92	1.51	0.368	0.16146	.	.	.	.	.	T	0.14570	0.0352	N	0.08118	0	0.09310	N	1	D	0.58620	0.983	P	0.48598	0.583	T	0.11372	-1.0590	9	0.87932	D	0	.	3.123	0.06397	0.0:0.2534:0.0:0.7466	.	152	Q96EZ4	MYEOV_HUMAN	T	152;152;94	ENSP00000412482:S152T;ENSP00000308330:S152T;ENSP00000438100:S94T	ENSP00000308330:S152T	S	+	1	0	MYEOV	68819947	0.003000	0.15002	0.001000	0.08648	0.023000	0.10783	0.314000	0.19432	0.086000	0.17137	0.402000	0.26972	TCT	MYEOV	-	NULL	ENSG00000172927		0.617	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	MYEOV	HGNC	protein_coding	OTTHUMT00000396548.1	50	0.00	0	T			69063371	69063371	+1	no_errors	ENST00000308946	ensembl	human	known	69_37n	missense	13	80.00	52	SNP	0.001	A
NKX2-6	137814	genome.wustl.edu	37	8	23560355	23560355	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr8:23560355G>T	ENST00000325017.3	-	2	514	c.515C>A	c.(514-516)aCg>aAg	p.T172K	NKX2-6_ENST00000418222.1_Missense_Mutation_p.T90K	NM_001136271.2	NP_001129743.2	A6NCS4	NKX26_HUMAN	NK2 homeobox 6	172					atrial cardiac muscle cell development (GO:0055014)|cell differentiation (GO:0030154)|digestive tract development (GO:0048565)|embryonic heart tube development (GO:0035050)|hypothalamus development (GO:0021854)|negative regulation of apoptotic process (GO:0043066)|pericardium development (GO:0060039)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle cell development (GO:0055015)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CTGCGTGGACGTGAGCTGCAG	0.647																																						dbGAP											0													40.0	37.0	38.0					8																	23560355		692	1591	2283	-	-	-	SO:0001583	missense	0			CN272646		8p21.2	2012-03-09	2011-06-01			ENSG00000180053		"""Homeoboxes / ANTP class : NKL subclass"""	32940	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	611770	"""NK2 transcription factor related, locus 6 (Drosophila)"""			15649947	Standard	NM_001136271		Approved	CSX2, NKX4-2	uc011kzy.3	A6NCS4		ENST00000325017.3:c.515C>A	8.37:g.23560355G>T	ENSP00000320089:p.Thr172Lys			Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	p.T90K	ENST00000325017.3	37	c.269		8	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719174	0.89205	.	.	ENSG00000180053	ENST00000325017;ENST00000418222	D;D	0.96200	-3.94;-3.94	4.04	4.04	0.47022	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.51477	D	0.000091	D	0.97498	0.9181	M	0.83953	2.67	0.44762	D	0.997769	D	0.89917	1.0	D	0.91635	0.999	D	0.98095	1.0411	10	0.87932	D	0	.	13.7202	0.62723	0.0:0.0:1.0:0.0	.	172	A6NCS4	NKX26_HUMAN	K	172;90	ENSP00000320089:T172K;ENSP00000402231:T90K	ENSP00000320089:T172K	T	-	2	0	NKX2-6	23616300	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.273000	0.65564	2.078000	0.62432	0.313000	0.20887	ACG	NKX2-6	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	ENSG00000180053		0.647	NKX2-6-001	KNOWN	basic|appris_principal	protein_coding	NKX2-6	HGNC	protein_coding	OTTHUMT00000376057.4	76	0.00	0	G	NM_001136271		23560355	23560355	-1	no_errors	ENST00000418222	ensembl	human	known	69_37n	missense	48	42.86	36	SNP	1.000	T
NPAS4	266743	genome.wustl.edu	37	11	66192195	66192195	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr11:66192195delC	ENST00000311034.2	+	7	2010	c.1834delC	c.(1834-1836)cctfs	p.P612fs		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	612					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CCTGCTCACACCTGAGGCCTC	0.587																																						dbGAP											0													81.0	88.0	86.0					11																	66192195		2200	4295	6495	-	-	-	SO:0001589	frameshift_variant	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1834delC	11.37:g.66192195delC	ENSP00000311196:p.Pro612fs		B7ZL81|Q8N8S5|Q8N9Q9	Frame_Shift_Del	DEL	pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.P612fs	ENST00000311034.2	37	c.1834	CCDS8138.1	11																																																																																			NPAS4	-	NULL	ENSG00000174576		0.587	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	24	0.00	0	C	NM_178864		66192195	66192195	+1	no_errors	ENST00000311034	ensembl	human	known	69_37n	frame_shift_del	3	90.00	27	DEL	1.000	-
OR2T27	403239	genome.wustl.edu	37	1	248814106	248814106	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:248814106A>G	ENST00000344889.3	-	1	79	c.80T>C	c.(79-81)cTc>cCc	p.L27P		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAGGGCAAAGAGAAGCCAGGG	0.502																																						dbGAP											0													123.0	110.0	114.0					1																	248814106		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.80T>C	1.37:g.248814106A>G	ENSP00000342008:p.Leu27Pro			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L27P	ENST00000344889.3	37	c.80	CCDS31124.1	1	.	.	.	.	.	.	.	.	.	.	.	9.976	1.226847	0.22542	.	.	ENSG00000187701	ENST00000344889	T	0.17691	2.26	3.3	3.3	0.37823	.	0.221822	0.22857	N	0.054781	T	0.44603	0.1301	M	0.91717	3.235	0.33521	D	0.592371	D	0.63880	0.993	P	0.62014	0.897	T	0.66284	-0.5962	10	0.87932	D	0	.	11.0943	0.48134	1.0:0.0:0.0:0.0	.	27	Q8NH04	O2T27_HUMAN	P	27	ENSP00000342008:L27P	ENSP00000342008:L27P	L	-	2	0	OR2T27	246880729	0.833000	0.29383	0.015000	0.15790	0.115000	0.19883	1.361000	0.34136	1.511000	0.48818	0.163000	0.16589	CTC	OR2T27	-	prints_7TM_GPCR_Rhodpsn	ENSG00000187701		0.502	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T27	HGNC	protein_coding	OTTHUMT00000097124.1	175	0.00	0	A	NM_001001824		248814106	248814106	-1	no_errors	ENST00000344889	ensembl	human	known	69_37n	missense	186	11.74	25	SNP	0.479	G
OR52J3	119679	genome.wustl.edu	37	11	5068440	5068440	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr11:5068440C>G	ENST00000380370.1	+	1	685	c.685C>G	c.(685-687)Ctc>Gtc	p.L229V		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTCTTCCGCCTCCCATCACA	0.443																																						dbGAP											0													318.0	285.0	296.0					11																	5068440		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.685C>G	11.37:g.5068440C>G	ENSP00000369728:p.Leu229Val		Q6IFE4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L229V	ENST00000380370.1	37	c.685	CCDS31370.1	11	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057219	0.36277	.	.	ENSG00000205495	ENST00000380370	T	0.00107	8.72	4.19	2.26	0.28386	GPCR, rhodopsin-like superfamily (1);	0.167794	0.28225	N	0.016129	T	0.00384	0.0012	M	0.81497	2.545	0.25938	N	0.982904	D	0.89917	1.0	D	0.91635	0.999	T	0.38134	-0.9675	10	0.87932	D	0	.	5.6463	0.17592	0.0:0.6517:0.1613:0.187	.	229	Q8NH60	O52J3_HUMAN	V	229	ENSP00000369728:L229V	ENSP00000369728:L229V	L	+	1	0	OR52J3	5025016	0.000000	0.05858	0.210000	0.23637	0.614000	0.37383	-0.163000	0.09997	0.968000	0.38212	0.655000	0.94253	CTC	OR52J3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000205495		0.443	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52J3	HGNC	protein_coding	OTTHUMT00000142807.1	175	0.00	0	C	NM_001001916		5068440	5068440	+1	no_errors	ENST00000380370	ensembl	human	known	69_37n	missense	10	82.46	47	SNP	0.614	G
OTC	5009	genome.wustl.edu	37	X	38268240	38268240	+	Silent	SNP	C	C	A	rs72558454		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chrX:38268240C>A	ENST00000039007.4	+	8	981	c.829C>A	c.(829-831)Cgg>Agg	p.R277R	TM4SF2_ENST00000465127.1_Intron	NM_000531.5	NP_000522.3	P00480	OTC_HUMAN	ornithine carbamoyltransferase	277			R -> Q (in OTCD; late onset). {ECO:0000269|PubMed:7951259, ECO:0000269|PubMed:8081373}.|R -> W (in OTCD; late onset). {ECO:0000269|PubMed:2347583}.		ammonia homeostasis (GO:0097272)|arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|liver development (GO:0001889)|midgut development (GO:0007494)|ornithine catabolic process (GO:0006593)|protein homotrimerization (GO:0070207)|response to biotin (GO:0070781)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|ornithine carbamoyltransferase activity (GO:0004585)|phosphate ion binding (GO:0042301)|phospholipid binding (GO:0005543)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22					L-Citrulline(DB00155)|L-Ornithine(DB00129)	GAAGAAAAAGCGGCTCCAGGC	0.433																																						dbGAP											0			GRCh37	CM900175	OTC	M	rs72558454						77.0	71.0	73.0					X																	38268240		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			K02100	CCDS14247.1	Xp21.1	2014-06-28			ENSG00000036473	ENSG00000036473	2.1.3.3		8512	protein-coding gene	gene with protein product		300461					Standard	NM_000531		Approved		uc004def.4	P00480	OTTHUMG00000022727	ENST00000039007.4:c.829C>A	X.37:g.38268240C>A			A8K9P2|D3DWB0|Q3KNR1|Q6B0I1|Q9NYJ5	Silent	SNP	pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_Asp/Orn_carbamoyltranf_P-bd,superfamily_Asp/Orn_carbamoylTrfase,prints_Orn/put_carbamltrans,prints_Asp/Orn_carbamoylTrfase,prints_Asp_carbamoyltransf_euk,tigrfam_Orn/put_carbamltrans	p.R277	ENST00000039007.4	37	c.829	CCDS14247.1	X																																																																																			OTC	-	pfam_Asp_carbamoyltransf_Asp/Orn-bd,superfamily_Asp/Orn_carbamoylTrfase,tigrfam_Orn/put_carbamltrans	ENSG00000036473		0.433	OTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTC	HGNC	protein_coding	OTTHUMT00000059006.2	44	0.00	0	C			38268240	38268240	+1	no_errors	ENST00000039007	ensembl	human	known	69_37n	silent	2	88.89	16	SNP	1.000	A
PAPPA2	60676	genome.wustl.edu	37	1	176668662	176668662	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:176668662A>G	ENST00000367662.3	+	8	4337	c.3173A>G	c.(3172-3174)gAt>gGt	p.D1058G		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1058					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GTTCTCCGCGATCCCCCATTT	0.552																																						dbGAP											0													116.0	119.0	118.0					1																	176668662		2046	4196	6242	-	-	-	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.3173A>G	1.37:g.176668662A>G	ENSP00000356634:p.Asp1058Gly		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.D1058G	ENST00000367662.3	37	c.3173	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.904542	0.52333	.	.	ENSG00000116183	ENST00000367662	T	0.44083	0.93	5.38	5.38	0.77491	Fibronectin, type III (2);	0.382558	0.31909	N	0.006868	T	0.42154	0.1190	L	0.55990	1.75	0.80722	D	1	P	0.38048	0.616	B	0.37601	0.254	T	0.46638	-0.9177	10	0.87932	D	0	-14.0809	15.2247	0.73342	1.0:0.0:0.0:0.0	.	1058	Q9BXP8	PAPP2_HUMAN	G	1058	ENSP00000356634:D1058G	ENSP00000356634:D1058G	D	+	2	0	PAPPA2	174935285	1.000000	0.71417	0.943000	0.38184	0.213000	0.24496	8.448000	0.90335	2.254000	0.74563	0.533000	0.62120	GAT	PAPPA2	-	superfamily_Fibronectin_type3	ENSG00000116183		0.552	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	105	0.00	0	A			176668662	176668662	+1	no_errors	ENST00000367662	ensembl	human	known	69_37n	missense	178	14.83	31	SNP	0.998	G
PHF3	23469	genome.wustl.edu	37	6	64395494	64395494	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr6:64395494A>G	ENST00000262043.3	+	4	2211	c.1871A>G	c.(1870-1872)cAg>cGg	p.Q624R	PHF3_ENST00000393387.1_Missense_Mutation_p.Q624R|PHF3_ENST00000509330.1_Missense_Mutation_p.Q624R			Q92576	PHF3_HUMAN	PHD finger protein 3	624					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			CATTCTAGCCAGAAACAGTGT	0.453																																					GBM(135;136 1820 29512 34071 46235)	dbGAP											0													92.0	82.0	86.0					6																	64395494		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.1871A>G	6.37:g.64395494A>G	ENSP00000262043:p.Gln624Arg		A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.Q624R	ENST00000262043.3	37	c.1871	CCDS4966.1	6	.	.	.	.	.	.	.	.	.	.	A	5.165	0.216015	0.09810	.	.	ENSG00000118482	ENST00000506783;ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387	T;T;T;T;T;T	0.52754	1.9;1.56;1.99;1.6;0.65;1.99	5.77	5.77	0.91146	.	0.000000	0.37483	N	0.002070	T	0.51024	0.1650	L	0.59436	1.845	0.42236	D	0.99191	P;D	0.63046	0.792;0.992	B;P	0.57101	0.255;0.813	T	0.57294	-0.7836	10	0.72032	D	0.01	-4.8151	14.6669	0.68915	1.0:0.0:0.0:0.0	.	624;624	Q92576;D6R9X2	PHF3_HUMAN;.	R	438;536;624;577;624;624	ENSP00000424694:Q438R;ENSP00000425227:Q536R;ENSP00000262043:Q624R;ENSP00000424078:Q577R;ENSP00000422841:Q624R;ENSP00000377048:Q624R	ENSP00000262043:Q624R	Q	+	2	0	PHF3	64453453	1.000000	0.71417	0.998000	0.56505	0.095000	0.18619	7.056000	0.76662	2.203000	0.70933	0.482000	0.46254	CAG	PHF3	-	NULL	ENSG00000118482		0.453	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF3	HGNC	protein_coding	OTTHUMT00000041086.2	22	0.00	0	A			64395494	64395494	+1	no_errors	ENST00000262043	ensembl	human	known	69_37n	missense	9	52.63	10	SNP	1.000	G
PLCH1	23007	genome.wustl.edu	37	3	155200812	155200812	+	Silent	SNP	C	C	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr3:155200812C>A	ENST00000340059.7	-	23	3026	c.3027G>T	c.(3025-3027)ggG>ggT	p.G1009G	PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000414191.1_Silent_p.G971G|PLCH1-AS2_ENST00000472913.1_RNA|PLCH1_ENST00000460012.1_Silent_p.G971G|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Silent_p.G971G	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1009					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TACTTGCTTTCCCTTTTCTTC	0.393																																						dbGAP											0													141.0	149.0	146.0					3																	155200812		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.3027G>T	3.37:g.155200812C>A			Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.G1009	ENST00000340059.7	37	c.3027	CCDS46939.1	3																																																																																			PLCH1	-	NULL	ENSG00000114805		0.393	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	32	0.00	0	C	NM_014996		155200812	155200812	-1	no_errors	ENST00000340059	ensembl	human	known	69_37n	silent	40	50.00	41	SNP	0.000	A
PNO1	56902	genome.wustl.edu	37	2	68388819	68388819	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr2:68388819G>C	ENST00000263657.2	+	3	453	c.362G>C	c.(361-363)tGt>tCt	p.C121S	RP11-474G23.1_ENST00000406334.3_Intron	NM_020143.2	NP_064528.1	Q9NRX1	PNO1_HUMAN	partner of NOB1 homolog (S. cerevisiae)	121						nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						TAACAGACTTGTAAAGAAACC	0.358																																					NSCLC(83;642 1410 13044 32832 40058)	dbGAP											0													100.0	103.0	102.0					2																	68388819		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF164799	CCDS1885.1	2p14	2010-07-06			ENSG00000115946	ENSG00000115946			32790	protein-coding gene	gene with protein product	"""RNA binding protein"""		"""KH-type RNA binding protein 1"", ""KH-type RNA-binding protein 1"""	KHRBP1		15497447	Standard	NM_020143		Approved	RRP20	uc002seh.3	Q9NRX1	OTTHUMG00000129563	ENST00000263657.2:c.362G>C	2.37:g.68388819G>C	ENSP00000263657:p.Cys121Ser		A8K6Q0|Q53G13|Q8WVB8	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom	p.C121S	ENST00000263657.2	37	c.362	CCDS1885.1	2	.	.	.	.	.	.	.	.	.	.	G	8.025	0.760474	0.15914	.	.	ENSG00000115946	ENST00000263657	T	0.40476	1.03	5.83	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.22399	0.0540	N	0.11023	0.085	0.80722	D	1	B	0.14805	0.011	B	0.16722	0.016	T	0.07947	-1.0746	10	0.02654	T	1	-28.4053	15.3408	0.74296	0.0679:0.0:0.9321:0.0	.	121	Q9NRX1	PNO1_HUMAN	S	121	ENSP00000263657:C121S	ENSP00000263657:C121S	C	+	2	0	PNO1	68242323	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.664000	0.98607	2.755000	0.94549	0.650000	0.86243	TGT	PNO1	-	NULL	ENSG00000115946		0.358	PNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNO1	HGNC	protein_coding	OTTHUMT00000251756.1	45	0.00	0	G	NM_020143		68388819	68388819	+1	no_errors	ENST00000263657	ensembl	human	known	69_37n	missense	38	54.22	45	SNP	1.000	C
POM121L4P	266697	genome.wustl.edu	37	22	21045667	21045667	+	RNA	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr22:21045667G>A	ENST00000412250.3	+	0	1287									POM121 transmembrane nucleoporin-like 4 pseudogene											breast(2)	2						CGGAAGAGGCGCCAGCCTCAT	0.602																																						dbGAP											0																																										-	-	-			0					22q11.2	2012-03-13	2012-03-13		ENSG00000217261	ENSG00000217261			19326	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 4 pseudogene (rat)"", ""POM121 membrane glycoprotein-like 4 pseudogene"""				Standard	NR_024592		Approved		uc002zsw.2		OTTHUMG00000150756		22.37:g.21045667G>A				Missense_Mutation	SNP	NULL	p.R450H	ENST00000412250.3	37	c.1349		22	.	.	.	.	.	.	.	.	.	.	G	7.261	0.605107	0.14002	.	.	ENSG00000217261	ENST00000412250	.	.	.	0.656	0.656	0.17844	.	.	.	.	.	T	0.28067	0.0692	.	.	.	0.09310	N	1	B	0.26445	0.149	B	0.04013	0.001	T	0.24083	-1.0170	6	0.87932	D	0	.	.	.	.	.	450	F5H5H7	.	H	450	.	ENSP00000443399:R450H	R	+	2	0	POM121L4P	19375667	0.019000	0.18553	0.001000	0.08648	0.057000	0.15508	0.203000	0.17315	0.631000	0.30412	0.163000	0.16589	CGC	POM121L4P	-	NULL	ENSG00000217261		0.602	POM121L4P-002	KNOWN	basic|exp_conf	processed_transcript	POM121L4P	HGNC	pseudogene	OTTHUMT00000468456.1	111	0.00	0	G			21045667	21045667	+1	no_errors	ENST00000412250	ensembl	human	known	69_37n	missense	113	29.38	47	SNP	0.001	A
PRDM9	56979	genome.wustl.edu	37	5	23527481	23527481	+	Missense_Mutation	SNP	C	C	G	rs58945509	byFrequency	TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr5:23527481C>G	ENST00000296682.3	+	11	2466	c.2284C>G	c.(2284-2286)Cac>Gac	p.H762D		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	762					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CGATAAGTCACACCTCCTCAG	0.557										HNSCC(3;0.000094)			A|||	41	0.0081869	0.0272	0.0	5008	,	,		11956	0.001		0.0	False		,,,				2504	0.0041					dbGAP											0													59.0	82.0	74.0					5																	23527481		2149	4294	6443	-	-	-	SO:0001583	missense	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.2284C>G	5.37:g.23527481C>G	ENSP00000296682:p.His762Asp		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.H762D	ENST00000296682.3	37	c.2284	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	A	0.001	-5.277477	0.00000	.	.	ENSG00000164256	ENST00000296682	T	0.16743	2.32	2.95	-5.91	0.02269	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08088	0.0202	N	0.20401	0.57	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13469	-1.0508	9	0.27785	T	0.31	.	4.9186	0.13858	0.2152:0.5188:0.1627:0.1033	.	762	Q9NQV7	PRDM9_HUMAN	D	762	ENSP00000296682:H762D	ENSP00000296682:H762D	H	+	1	0	PRDM9	23563238	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-20.000000	0.00000	-4.225000	0.00063	-2.765000	0.00121	CAC	PRDM9	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164256		0.557	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	22	0.00	0	C	NM_020227		23527481	23527481	+1	no_errors	ENST00000296682	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	0.000	G
PROS1	5627	genome.wustl.edu	37	3	93617363	93617363	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr3:93617363G>T	ENST00000394236.3	-	8	1094	c.778C>A	c.(778-780)Cct>Act	p.P260T	PROS1_ENST00000407433.1_Missense_Mutation_p.P129T	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	260	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TAACCTCCAGGGTAATTGACA	0.378																																						dbGAP											0													98.0	90.0	93.0					3																	93617363		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.778C>A	3.37:g.93617363G>T	ENSP00000377783:p.Pro260Thr		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd,pfam_GLA_domain,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.P260T	ENST00000394236.3	37	c.778	CCDS2923.1	3	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671860	0.67928	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	D;D	0.92805	-3.11;-3.11	4.26	4.26	0.50523	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.389077	0.26719	N	0.022841	D	0.95658	0.8588	M	0.89658	3.05	0.45762	D	0.998659	D	0.55172	0.97	P	0.54346	0.749	D	0.96542	0.9401	10	0.62326	D	0.03	.	17.2047	0.86914	0.0:0.0:1.0:0.0	.	260	P07225	PROS_HUMAN	T	260;129	ENSP00000377783:P260T;ENSP00000385794:P129T	ENSP00000377783:P260T	P	-	1	0	PROS1	95100053	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	3.733000	0.55029	2.374000	0.81015	0.585000	0.79938	CCT	PROS1	-	smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000184500		0.378	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROS1	HGNC	protein_coding	OTTHUMT00000317762.1	65	0.00	0	G	NM_000313		93617363	93617363	-1	no_errors	ENST00000394236	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	0.994	T
RNF111	54778	genome.wustl.edu	37	15	59347900	59347900	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr15:59347900C>T	ENST00000557998.1	+	4	1314	c.1027C>T	c.(1027-1029)Cac>Tac	p.H343Y	RNF111_ENST00000559209.1_Missense_Mutation_p.H343Y|RNF111_ENST00000348370.4_Missense_Mutation_p.H343Y|RNF111_ENST00000561186.1_Missense_Mutation_p.H343Y|RNF111_ENST00000434298.1_Missense_Mutation_p.H343Y	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	343	Interaction with AXIN1.|Ser-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		AACCCTTGGACACTCCAGATC	0.418																																					NSCLC(72;983 1365 10746 34387 47081)	dbGAP											0													50.0	44.0	46.0					15																	59347900		2192	4291	6483	-	-	-	SO:0001583	missense	0			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1027C>T	15.37:g.59347900C>T	ENSP00000452732:p.His343Tyr		C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H343Y	ENST00000557998.1	37	c.1027	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	C	28.7	4.940184	0.92526	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.14766	2.48;2.48	5.68	5.68	0.88126	.	0.050321	0.85682	D	0.000000	T	0.28067	0.0692	L	0.44542	1.39	0.58432	D	0.999995	D;D;D	0.62365	0.991;0.985;0.991	P;P;P	0.56751	0.805;0.643;0.805	T	0.00333	-1.1810	10	0.87932	D	0	-3.9882	19.7763	0.96395	0.0:1.0:0.0:0.0	.	343;343;343	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	Y	343	ENSP00000288199:H343Y;ENSP00000393641:H343Y	ENSP00000288199:H343Y	H	+	1	0	RNF111	57135192	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	6.275000	0.72594	2.678000	0.91216	0.591000	0.81541	CAC	RNF111	-	NULL	ENSG00000157450		0.418	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	HGNC	protein_coding	OTTHUMT00000416012.1	59	0.00	0	C	NM_017610		59347900	59347900	+1	no_errors	ENST00000434298	ensembl	human	known	69_37n	missense	9	72.22	26	SNP	1.000	T
RUFY3	22902	genome.wustl.edu	37	4	71668838	71668838	+	Intron	SNP	A	A	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr4:71668838A>G	ENST00000381006.3	+	16	2229				RUFY3_ENST00000512331.1_Intron|RUFY3_ENST00000502653.1_Intron	NM_001037442.2	NP_001032519.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3						negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			CCCTGAACAAATATGTATTGC	0.408																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000381006.3:c.1650+138A>G	4.37:g.71668838A>G			B3KM25|B4DYW7|D9N163|O94948|Q9UI00	RNA	SNP	-	NULL	ENST00000381006.3	37	NULL	CCDS34001.1	4																																																																																			RUFY3	-	-	ENSG00000018189		0.408	RUFY3-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	RUFY3	HGNC	protein_coding	OTTHUMT00000252162.1	20	0.00	0	A	NM_014961		71668838	71668838	+1	no_errors	ENST00000515442	ensembl	human	known	69_37n	rna	12	45.45	10	SNP	0.012	G
SHE	126669	genome.wustl.edu	37	1	154456753	154456753	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:154456753G>T	ENST00000304760.2	-	6	1446	c.1360C>A	c.(1360-1362)Ctg>Atg	p.L454M	RP11-350G8.9_ENST00000607963.1_RNA	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	454	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.									breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GTCTGATTCAGTGTGTATTTG	0.433																																						dbGAP											0													170.0	125.0	140.0					1																	154456753		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.1360C>A	1.37:g.154456753G>T	ENSP00000307369:p.Leu454Met		Q8TEQ5	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.L454M	ENST00000304760.2	37	c.1360	CCDS30877.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523396	0.85600	.	.	ENSG00000169291	ENST00000304760	T	0.60920	0.15	5.05	5.05	0.67936	SH2 motif (4);	0.000000	0.64402	D	0.000002	T	0.78419	0.4280	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.83318	-0.0019	10	0.87932	D	0	-10.2665	17.1509	0.86778	0.0:0.0:1.0:0.0	.	454	Q5VZ18	SHE_HUMAN	M	454	ENSP00000307369:L454M	ENSP00000307369:L454M	L	-	1	2	SHE	152723377	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	7.195000	0.77798	2.614000	0.88457	0.655000	0.94253	CTG	SHE	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000169291		0.433	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHE	HGNC	protein_coding	OTTHUMT00000087910.2	88	0.00	0	G	NM_001010846		154456753	154456753	-1	no_errors	ENST00000304760	ensembl	human	known	69_37n	missense	168	22.94	50	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237947087	237947087	+	Silent	SNP	T	T	C	rs570554092		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr1:237947087T>C	ENST00000366574.2	+	90	12392	c.12075T>C	c.(12073-12075)gaT>gaC	p.D4025D	RYR2_ENST00000360064.6_Silent_p.D4031D|RYR2_ENST00000542537.1_Silent_p.D4009D|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4025					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACTAAAGGATTTGACGTCGT	0.413													T|||	1	0.000199681	0.0	0.0	5008	,	,		17456	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													57.0	53.0	54.0					1																	237947087		1853	4104	5957	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12075T>C	1.37:g.237947087T>C			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.D4031	ENST00000366574.2	37	c.12093	CCDS55691.1	1																																																																																			RYR2	-	pfscan_EF_HAND_2	ENSG00000198626		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	28	0.00	0	T	NM_001035		237947087	237947087	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	72	13.25	11	SNP	1.000	C
SLC16A5	9121	genome.wustl.edu	37	17	73089910	73089910	+	Frame_Shift_Del	DEL	C	C	-	rs143194994		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr17:73089910delC	ENST00000450736.2	+	2	594	c.179delC	c.(178-180)acgfs	p.T60fs	SLC16A5_ENST00000580123.1_Frame_Shift_Del_p.T60fs|SLC16A5_ENST00000538213.2_Frame_Shift_Del_p.T100fs|SLC16A5_ENST00000585293.1_3'UTR|SLC16A5_ENST00000329783.4_Frame_Shift_Del_p.T60fs			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	60					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	TCCATCCTCACGGCTGTGCTC	0.602																																						dbGAP											0													124.0	109.0	114.0					17																	73089910		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.179delC	17.37:g.73089910delC	ENSP00000390564:p.Thr60fs		B4E288	Frame_Shift_Del	DEL	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.T60fs	ENST00000450736.2	37	c.179	CCDS11713.1	17																																																																																			SLC16A5	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	ENSG00000170190		0.602	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	HGNC	protein_coding	OTTHUMT00000445547.1	44	0.00	0	C	NM_004695		73089910	73089910	+1	no_errors	ENST00000329783	ensembl	human	known	69_37n	frame_shift_del	54	24.66	18	DEL	0.001	-
SLC46A2	57864	genome.wustl.edu	37	9	115641997	115641997	+	3'UTR	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr9:115641997G>A	ENST00000374228.4	-	0	1704				SNX30_ENST00000604751.1_3'UTR	NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2						negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						GTCTTCTGGGGGCCTGGCCAT	0.498																																						dbGAP											0													95.0	87.0	90.0					9																	115641997		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.*45C>T	9.37:g.115641997G>A			B1ALK1|Q86VT0|Q96NE2	RNA	SNP	-	NULL	ENST00000374228.4	37	NULL	CCDS6786.1	9																																																																																			SLC46A2	-	-	ENSG00000119457		0.498	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC46A2	HGNC	protein_coding	OTTHUMT00000053702.1	62	0.00	0	G	NM_033051		115641997	115641997	-1	no_errors	ENST00000491462	ensembl	human	known	69_37n	rna	35	37.50	21	SNP	0.000	A
SPDYE2B	100310812	genome.wustl.edu	37	7	102294074	102294074	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr7:102294074T>C	ENST00000507450.1	+	3	811	c.337T>C	c.(337-339)Tcc>Ccc	p.S113P	SPDYE2B_ENST00000455020.2_5'Flank|POLR2J2_ENST00000591000.1_Intron|POLR2J2_ENST00000476151.1_Intron|SPDYE2B_ENST00000436228.2_Missense_Mutation_p.S113P|POLR2J2_ENST00000333432.6_Intron	NM_001166339.1	NP_001159811.1	A6NHP3	SPE2B_HUMAN	speedy/RINGO cell cycle regulator family member E2B	113																	GCGAGTGTCATCCATCCTCCC	0.542																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59507.1	7q22.1	2013-05-08			ENSG00000173678	ENSG00000173678		"""Speedy homologs"""	48334	protein-coding gene	gene with protein product							Standard	NM_001166339		Approved			A6NHP3	OTTHUMG00000158393	ENST00000507450.1:c.337T>C	7.37:g.102294074T>C	ENSP00000424058:p.Ser113Pro		D6RBN0	Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.S113P	ENST00000507450.1	37	c.337	CCDS59507.1	7	.	.	.	.	.	.	.	.	.	.	c	0	-2.811089	0.00074	.	.	ENSG00000173678	ENST00000540965;ENST00000507450;ENST00000436228	.	.	.	.	.	.	.	.	.	.	.	T	0.12732	0.0309	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15350	-1.0440	6	0.27082	T	0.32	.	.	.	.	.	113	A6NHP3	SPE2L_HUMAN	P	113	.	ENSP00000440393:S113P	S	+	1	0	RP11-577H5.4	102081310	0.724000	0.28038	0.002000	0.10522	0.002000	0.02628	-0.913000	0.04042	-1.655000	0.01497	-1.635000	0.00777	TCC	SPDYE6	-	NULL	ENSG00000173678		0.542	SPDYE2B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SPDYE6	HGNC	protein_coding	OTTHUMT00000350899.3	11	0.00	0	T			102294074	102294074	+1	no_errors	ENST00000436228	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.002	C
STAB1	23166	genome.wustl.edu	37	3	52550707	52550707	+	Splice_Site	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr3:52550707G>A	ENST00000321725.6	+	41	4362		c.e41-1			NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		ACCCCTCCCAGCTGCGTGCAG	0.682																																						dbGAP											0													24.0	29.0	28.0					3																	52550707		2202	4298	6500	-	-	-	SO:0001630	splice_region_variant	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.4287-1G>A	3.37:g.52550707G>A			A7E297|Q8IUH0|Q8IUH1|Q93072	Splice_Site	SNP	-	e41-1	ENST00000321725.6	37	c.4287-1	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	G	12.47	1.948567	0.34377	.	.	ENSG00000010327	ENST00000321725	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0983	0.59206	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB1	52525747	1.000000	0.71417	0.999000	0.59377	0.165000	0.22458	4.215000	0.58534	2.222000	0.72286	0.462000	0.41574	.	STAB1	-	-	ENSG00000010327		0.682	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	27	0.00	0	G	NM_015136	Intron	52550707	52550707	+1	no_errors	ENST00000321725	ensembl	human	known	69_37n	splice_site	8	57.89	11	SNP	1.000	A
STAT6	6778	genome.wustl.edu	37	12	57498293	57498293	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:57498293G>T	ENST00000300134.3	-	11	1491	c.1166C>A	c.(1165-1167)tCt>tAt	p.S389Y	STAT6_ENST00000543873.2_Missense_Mutation_p.S389Y|STAT6_ENST00000454075.3_Missense_Mutation_p.S389Y|STAT6_ENST00000537215.2_Missense_Mutation_p.S279Y|STAT6_ENST00000556155.1_Missense_Mutation_p.S389Y|STAT6_ENST00000538913.2_Missense_Mutation_p.S279Y	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	389					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						GAAGCTGGCAGAGAAGAGCAC	0.612																																						dbGAP											0													87.0	73.0	78.0					12																	57498293		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1166C>A	12.37:g.57498293G>T	ENSP00000300134:p.Ser389Tyr		A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.S389Y	ENST00000300134.3	37	c.1166	CCDS8931.1	12	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082728	0.36758	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000542516	D;D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27;-2.27	4.44	4.44	0.53790	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.366803	0.28977	N	0.013539	D	0.86016	0.5832	N	0.21194	0.64	0.09310	N	1	D;P	0.65815	0.995;0.773	D;P	0.63597	0.916;0.678	T	0.77199	-0.2675	10	0.72032	D	0.01	-13.3485	8.2296	0.31590	0.1053:0.0:0.8947:0.0	.	389;389	A8K4S9;P42226	.;STAT6_HUMAN	Y	389;279;279;389;389;279;389;279;389	ENSP00000300134:S389Y;ENSP00000445409:S279Y;ENSP00000438451:S389Y;ENSP00000451742:S389Y;ENSP00000444530:S279Y;ENSP00000401486:S389Y	ENSP00000300134:S389Y	S	-	2	0	STAT6	55784560	1.000000	0.71417	0.938000	0.37757	0.241000	0.25554	4.018000	0.57174	2.296000	0.77279	0.655000	0.94253	TCT	STAT6	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000166888		0.612	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT6	HGNC	protein_coding	OTTHUMT00000412248.3	41	0.00	0	G	NM_003153		57498293	57498293	-1	no_errors	ENST00000300134	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.007	T
STAU2	27067	genome.wustl.edu	37	8	74332341	74332341	+	IGR	SNP	G	G	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr8:74332341G>C	ENST00000524300.1	-	0	3065				STAU2-AS1_ENST00000517604.1_lincRNA	NM_001164380.1|NM_001164381.1	NP_001157852.1|NP_001157853.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2						transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			ATGTTGGGTCGAGCAGTTAGA	0.433																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499		8.37:g.74332341G>C			B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	RNA	SNP	-	NULL	ENST00000524300.1	37	NULL	CCDS55247.1	8																																																																																			STAU2-AS1	-	-	ENSG00000253302		0.433	STAU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAU2-AS1	HGNC	protein_coding	OTTHUMT00000379000.2	38	0.00	0	G	NM_001164380		74332341	74332341	+1	no_errors	ENST00000517604	ensembl	human	known	69_37n	rna	70	12.50	10	SNP	0.991	C
SUSD1	64420	genome.wustl.edu	37	9	114865431	114865431	+	Intron	SNP	G	G	A	rs571955150		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr9:114865431G>A	ENST00000374270.3	-	9	1344				SUSD1_ENST00000374263.3_Intron|SUSD1_ENST00000374264.2_Intron	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1							integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						TATTTCTCCCGTGGGAGTTTC	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		18380	0.001		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1172-866C>T	9.37:g.114865431G>A			A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.T210M	ENST00000374270.3	37	c.629	CCDS6783.1	9	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.105998	0.00356	.	.	ENSG00000106868	ENST00000415074	.	.	.	4.22	-0.136	0.13473	.	.	.	.	.	T	0.24275	0.0588	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27400	-1.0075	4	.	.	.	.	4.9279	0.13903	0.5324:0.3639:0.1037:0.0	.	.	.	.	M	210	.	.	T	-	2	0	SUSD1	113905252	0.000000	0.05858	0.011000	0.14972	0.004000	0.04260	0.075000	0.14686	-0.058000	0.13177	-1.512000	0.00943	ACG	SUSD1	-	NULL	ENSG00000106868		0.348	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD1	HGNC	protein_coding	OTTHUMT00000053668.3	11	0.00	0	G	NM_022486		114865431	114865431	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000415074	ensembl	human	novel	69_37n	missense	29	38.30	18	SNP	0.008	A
SYNE2	23224	genome.wustl.edu	37	14	64675643	64675643	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr14:64675643G>A	ENST00000344113.4	+	101	18581	c.18369G>A	c.(18367-18369)atG>atA	p.M6123I	SYNE2_ENST00000357395.3_Missense_Mutation_p.M2508I|SYNE2_ENST00000554584.1_Missense_Mutation_p.M6085I|SYNE2_ENST00000358025.3_Missense_Mutation_p.M6123I|SYNE2_ENST00000555002.1_Missense_Mutation_p.M2757I|SYNE2_ENST00000554805.1_5'Flank|SYNE2_ENST00000555022.1_Start_Codon_SNP_p.M1I|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000394768.2_Missense_Mutation_p.M2508I	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6123					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.M6123I(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTTGTGCCATGTCCATGGAGC	0.537																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											77.0	57.0	64.0					14																	64675643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.18369G>A	14.37:g.64675643G>A	ENSP00000341781:p.Met6123Ile		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.M6123I	ENST00000344113.4	37	c.18369	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	27.8	4.867929	0.91587	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000556906;ENST00000555022	T;T;T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;2.03;3.13	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000016	T	0.79399	0.4439	L	0.41027	1.25	0.80722	D	1	P;P;P;P;P	0.44659	0.562;0.616;0.782;0.581;0.84	B;P;B;P;P	0.54499	0.437;0.449;0.366;0.754;0.706	T	0.78275	-0.2267	10	0.48119	T	0.1	.	19.7468	0.96255	0.0:0.0:1.0:0.0	.	2508;511;6085;6123;6123	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	I	6123;2508;6123;6085;6091;2757;2508;93;1	ENSP00000350719:M6123I;ENSP00000349969:M2508I;ENSP00000341781:M6123I;ENSP00000452570:M6085I;ENSP00000450831:M2757I;ENSP00000378249:M2508I;ENSP00000452298:M93I;ENSP00000451009:M1I	ENSP00000261678:M6091I	M	+	3	0	SYNE2	63745396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.831000	0.86748	2.678000	0.91216	0.563000	0.77884	ATG	SYNE2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000054654		0.537	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	63	0.00	0	G	NM_182914		64675643	64675643	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	19	54.76	23	SNP	1.000	A
SYNPO	11346	genome.wustl.edu	37	5	150028533	150028533	+	Silent	SNP	C	C	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr5:150028533C>T	ENST00000394243.1	+	3	1802	c.1428C>T	c.(1426-1428)ccC>ccT	p.P476P	SYNPO_ENST00000522122.1_Silent_p.P476P|SYNPO_ENST00000307662.4_Silent_p.P232P|SYNPO_ENST00000519664.1_Silent_p.P232P	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	476					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGCCAAGCCCCCATCAGTGG	0.602																																						dbGAP											0													94.0	93.0	94.0					5																	150028533		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.1428C>T	5.37:g.150028533C>T			A5PKZ8|D3DQG8|O15271|Q9UPX1	Silent	SNP	NULL	p.P476	ENST00000394243.1	37	c.1428	CCDS54937.1	5																																																																																			SYNPO	-	NULL	ENSG00000171992		0.602	SYNPO-002	KNOWN	basic|CCDS	protein_coding	SYNPO	HGNC	protein_coding	OTTHUMT00000252371.1	28	0.00	0	C	NM_007286		150028533	150028533	+1	no_errors	ENST00000394243	ensembl	human	known	69_37n	silent	16	15.79	3	SNP	0.008	T
TAS2R43	259289	genome.wustl.edu	37	12	11244166	11244166	+	Silent	SNP	G	G	C	rs35720106	byFrequency	TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:11244166G>C	ENST00000531678.1	-	1	746	c.663C>G	c.(661-663)acC>acG	p.T221T	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	221					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.T221T(1)		endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TGTGGACCTTGGTGCTGGGAT	0.398													.|||	3199	0.638778	0.1218	0.7205	5008	,	,		13366	0.9405		0.7793	False		,,,				2504	0.8241					dbGAP											1	Substitution - coding silent(1)	prostate(1)											130.0	112.0	118.0					12																	11244166		2176	4249	6425	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.663C>G	12.37:g.11244166G>C			P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.T221	ENST00000531678.1	37	c.663	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	49	0.00	0	G	NM_176884		11244166	11244166	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	22	12.00	3	SNP	0.185	C
TAS2R43	259289	genome.wustl.edu	37	12	11244634	11244634	+	Silent	SNP	G	G	A	rs200893955		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:11244634G>A	ENST00000531678.1	-	1	278	c.195C>T	c.(193-195)aaC>aaT	p.N65N	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	65					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TTGAATACCAGTTTAATAATA	0.408																																						dbGAP											0													52.0	46.0	48.0					12																	11244634		1928	3963	5891	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.195C>T	12.37:g.11244634G>A			P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.N65	ENST00000531678.1	37	c.195	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.408	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	22	0.00	0	G	NM_176884		11244634	11244634	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	2	87.50	14	SNP	0.001	A
TAS2R14	50840	genome.wustl.edu	37	12	11230520	11230520	+	Intron	SNP	G	G	A	rs78599991		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:11230520G>A	ENST00000381852.4	-	2	152				TAS2R64P_ENST00000534866.1_RNA|PRR4_ENST00000536668.1_Intron			Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						GCAATCTTGAGCAAATAAAAT	0.378																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000381852.4:c.1511-30733C>T	12.37:g.11230520G>A			Q645X3	RNA	SNP	-	NULL	ENST00000381852.4	37	NULL		12																																																																																			TAS2R64P	-	-	ENSG00000256274		0.378	TAS2R14-002	KNOWN	basic	processed_transcript	TAS2R64P	HGNC	protein_coding	OTTHUMT00000402305.1	23	0.00	0	G	NM_023922		11230520	11230520	-1	no_errors	ENST00000534866	ensembl	human	known	69_37n	rna	3	75.00	9	SNP	0.004	A
TAS2R14	50840	genome.wustl.edu	37	12	11230544	11230544	+	Intron	SNP	C	C	T	rs76043722		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:11230544C>T	ENST00000381852.4	-	2	152				TAS2R64P_ENST00000534866.1_RNA|PRR4_ENST00000536668.1_Intron			Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						CTGAGGCTAGCAGCAAGCCAG	0.368																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000381852.4:c.1511-30757G>A	12.37:g.11230544C>T			Q645X3	RNA	SNP	-	NULL	ENST00000381852.4	37	NULL		12																																																																																			TAS2R64P	-	-	ENSG00000256274		0.368	TAS2R14-002	KNOWN	basic	processed_transcript	TAS2R64P	HGNC	protein_coding	OTTHUMT00000402305.1	18	0.00	0	C	NM_023922		11230544	11230544	-1	no_errors	ENST00000534866	ensembl	human	known	69_37n	rna	2	77.78	7	SNP	0.000	T
TAS2R43	259289	genome.wustl.edu	37	12	11244646	11244646	+	Silent	SNP	T	T	C	rs201583586		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr12:11244646T>C	ENST00000531678.1	-	1	266	c.183A>G	c.(181-183)gtA>gtG	p.V61V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	61					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TTAATAATAATACCCAGAGCA	0.393																																						dbGAP											0													52.0	47.0	49.0					12																	11244646		1950	3985	5935	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.183A>G	12.37:g.11244646T>C			P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.V61	ENST00000531678.1	37	c.183	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.393	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	22	0.00	0	T	NM_176884		11244646	11244646	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	3	82.35	14	SNP	0.001	C
TBX20	57057	genome.wustl.edu	37	7	35280490	35280490	+	Splice_Site	SNP	C	C	A	rs3999940		TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr7:35280490C>A	ENST00000408931.3	-	5	1340		c.e5+1			NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20						aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TGTACACTCACCAGTTGATTC	0.398																																						dbGAP											0													70.0	65.0	67.0					7																	35280490		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.813+1G>T	7.37:g.35280490C>A			A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Splice_Site	SNP	-	e5+1	ENST00000408931.3	37	c.813+1	CCDS43568.1	7	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083046	0.76642	.	.	ENSG00000164532	ENST00000408931	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6717	0.95914	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TBX20	35247015	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	7.818000	0.86416	2.648000	0.89879	0.591000	0.81541	.	TBX20	-	-	ENSG00000164532		0.398	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX20	HGNC	protein_coding	OTTHUMT00000216870.2	55	0.00	0	C	NM_020417	Intron	35280490	35280490	-1	no_errors	ENST00000408931	ensembl	human	known	69_37n	splice_site	38	45.71	32	SNP	1.000	A
GVQW1	101362076	genome.wustl.edu	37	9	32567215	32567215	+	Silent	SNP	T	T	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr9:32567215T>A	ENST00000451672.1	+	1	429	c.153T>A	c.(151-153)tcT>tcA	p.S51S	TOPORS-AS1_ENST00000425533.1_RNA|NDUFB6_ENST00000350021.2_Intron|NDUFB6_ENST00000379847.3_Intron|TOPORS-AS1_ENST00000458036.1_RNA			Q8N7I0	GVQW1_HUMAN	GVQW motif containing 1	51																	CACAGGGCTCTACACCAGGTG	0.597																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK098413		9p21.1	2014-01-30	2013-04-08	2013-04-08	ENSG00000241043	ENSG00000241043			31424	protein-coding gene	gene with protein product			"""tigger transposable element derived 1-like 2"""	TIGD1L2			Standard			Approved	bA205M20.5		Q8N7I0	OTTHUMG00000019744	ENST00000451672.1:c.153T>A	9.37:g.32567215T>A				Silent	SNP	NULL	p.S51	ENST00000451672.1	37	c.153		9																																																																																			TIGD1L2	-	NULL	ENSG00000241043		0.597	GVQW1-001	PUTATIVE	basic|appris_principal	protein_coding	TIGD1L2	HGNC	protein_coding	OTTHUMT00000052009.1	52	0.00	0	T			32567215	32567215	+1	no_errors	ENST00000451672	ensembl	human	known	69_37n	silent	107	22.46	31	SNP	0.005	A
TMEM184A	202915	genome.wustl.edu	37	7	1589818	1589818	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr7:1589818C>T	ENST00000297477.5	-	5	809	c.493G>A	c.(493-495)Ggc>Agc	p.G165S		NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	165					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		CAGCAGGTGCCGTACAAGCAG	0.706																																						dbGAP											0													12.0	16.0	15.0					7																	1589818		2100	4240	6340	-	-	-	SO:0001583	missense	0				CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.493G>A	7.37:g.1589818C>T	ENSP00000297477:p.Gly165Ser		Q8TBQ6	Missense_Mutation	SNP	pfam_Ost-alpha	p.G165S	ENST00000297477.5	37	c.493	CCDS43537.1	7	.	.	.	.	.	.	.	.	.	.	C	11.68	1.709573	0.30322	.	.	ENSG00000164855	ENST00000297477;ENST00000319010;ENST00000414730	T;T;T	0.39997	1.09;1.09;1.05	4.66	3.78	0.43462	.	0.000000	0.85682	U	0.000000	T	0.42675	0.1213	L	0.52266	1.64	0.80722	D	1	P	0.51057	0.941	P	0.49226	0.603	T	0.17899	-1.0354	10	0.17832	T	0.49	0.0022	12.456	0.55704	0.0:0.918:0.0:0.082	.	165	Q6ZMB5	T184A_HUMAN	S	165	ENSP00000297477:G165S;ENSP00000325945:G165S;ENSP00000398382:G165S	ENSP00000297477:G165S	G	-	1	0	TMEM184A	1556344	0.998000	0.40836	0.805000	0.32314	0.301000	0.27625	3.829000	0.55760	0.940000	0.37473	0.205000	0.17691	GGC	TMEM184A	-	pfam_Ost-alpha	ENSG00000164855		0.706	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM184A	HGNC	protein_coding	OTTHUMT00000239229.4	21	0.00	0	C	NM_152689		1589818	1589818	-1	no_errors	ENST00000297477	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	1.000	T
TNFSF14	8740	genome.wustl.edu	37	19	6665222	6665222	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr19:6665222C>G	ENST00000599359.1	-	5	819	c.438G>C	c.(436-438)aaG>aaC	p.K146N	TNFSF14_ENST00000326176.9_Missense_Mutation_p.K110N|TNFSF14_ENST00000245912.3_Missense_Mutation_p.K110N			O43557	TNF14_HUMAN	tumor necrosis factor (ligand) superfamily, member 14	146					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of T cell chemotaxis (GO:0010820)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|receptor binding (GO:0005102)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18						CCAGCTGCACCTTGGAGTAGA	0.647																																						dbGAP											0													48.0	40.0	43.0					19																	6665222		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF036581	CCDS12171.1, CCDS45939.1	19p13.3	2008-02-05				ENSG00000125735		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11930	protein-coding gene	gene with protein product		604520				9462508	Standard	NM_172014		Approved	LIGHT, LTg, HVEM-L, CD258	uc002mfk.2	O43557		ENST00000599359.1:c.438G>C	19.37:g.6665222C>G	ENSP00000469049:p.Lys146Asn		A8K7M2|C9J5H4|O75476|Q6FHA1|Q8WVF8|Q96LD2	Missense_Mutation	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,pfscan_TNF,prints_TNF_a/b/c	p.K146N	ENST00000599359.1	37	c.438	CCDS12171.1	19	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100211	0.56183	.	.	ENSG00000125735	ENST00000245912;ENST00000326176	T	0.32988	1.43	4.96	-1.57	0.08506	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.000000	0.85682	D	0.000000	T	0.40862	0.1134	L	0.47716	1.5	0.31685	N	0.642682	D;D	0.89917	1.0;1.0	D;D	0.73708	0.977;0.981	T	0.47459	-0.9116	10	0.72032	D	0.01	-14.3416	9.4933	0.38974	0.0:0.5694:0.0:0.4306	.	146;110	O43557;O43557-2	TNF14_HUMAN;.	N	146;110	ENSP00000326940:K110N	ENSP00000245912:K146N	K	-	3	2	TNFSF14	6616222	0.996000	0.38824	0.994000	0.49952	0.622000	0.37654	0.192000	0.17096	-0.234000	0.09782	-0.258000	0.10820	AAG	TNFSF14	-	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,pfscan_TNF	ENSG00000125735		0.647	TNFSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF14	HGNC	protein_coding	OTTHUMT00000457863.1	35	0.00	0	C			6665222	6665222	-1	no_errors	ENST00000245912	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	0.998	G
TRAM2	9697	genome.wustl.edu	37	6	52369477	52369477	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr6:52369477G>C	ENST00000182527.3	-	10	950	c.951C>G	c.(949-951)caC>caG	p.H317Q	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	317	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					ATTCCCGCCAGTGCCGCAGCT	0.627																																						dbGAP											0													37.0	33.0	35.0					6																	52369477		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.951C>G	6.37:g.52369477G>C	ENSP00000182527:p.His317Gln		A8K6T6	Missense_Mutation	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.H317Q	ENST00000182527.3	37	c.951	CCDS34477.1	6	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836894	0.50951	.	.	ENSG00000065308	ENST00000182527	.	.	.	5.53	4.66	0.58398	TRAM/LAG1/CLN8 homology domain (2);	0.043957	0.85682	D	0.000000	T	0.21550	0.0519	L	0.34521	1.04	0.36102	D	0.844203	B	0.31125	0.309	B	0.19666	0.026	T	0.09509	-1.0671	9	0.39692	T	0.17	.	10.3784	0.44096	0.071:0.1339:0.795:0.0	.	317	Q15035	TRAM2_HUMAN	Q	317	.	ENSP00000182527:H317Q	H	-	3	2	TRAM2	52477436	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.900000	0.39828	1.463000	0.47967	0.655000	0.94253	CAC	TRAM2	-	smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	ENSG00000065308		0.627	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM2	HGNC	protein_coding	OTTHUMT00000040910.1	50	0.00	0	G	NM_012288		52369477	52369477	-1	no_errors	ENST00000182527	ensembl	human	known	69_37n	missense	82	25.45	28	SNP	1.000	C
TSPAN32	10077	genome.wustl.edu	37	11	2337500	2337500	+	Silent	SNP	G	G	A			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr11:2337500G>A	ENST00000182290.4	+	7	722	c.585G>A	c.(583-585)caG>caA	p.Q195Q	TSPAN32_ENST00000451520.2_Silent_p.Q184Q|TSPAN32_ENST00000381121.3_Silent_p.Q195Q	NM_139022.2	NP_620591.3	Q96QS1	TSN32_HUMAN	tetraspanin 32	195					cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|defense response to protozoan (GO:0042832)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|platelet aggregation (GO:0070527)|regulation of defense response to virus (GO:0050688)	cell surface (GO:0009986)|integrin alphaIIb-beta3 complex (GO:0070442)|intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|lung(4)|ovary(1)|skin(1)	8		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		GGACACACCAGCAGGTCGCCT	0.687																																						dbGAP											0													58.0	48.0	51.0					11																	2337500		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AF176070	CCDS7733.1	11p15	2013-02-14	2005-08-16	2005-08-16	ENSG00000064201	ENSG00000064201		"""Tetraspanins"""	13410	protein-coding gene	gene with protein product		603853	"""pan-hematopoietic expression"""	TSSC6, PHEMX		10072438, 10950922	Standard	NM_139022		Approved		uc001lvy.1	Q96QS1	OTTHUMG00000009762	ENST00000182290.4:c.585G>A	11.37:g.2337500G>A			Q96KX4|Q9HC50|Q9HC51|Q9Y5U1	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	p.Q195	ENST00000182290.4	37	c.585	CCDS7733.1	11																																																																																			TSPAN32	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000064201		0.687	TSPAN32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSPAN32	HGNC	protein_coding	OTTHUMT00000026912.2	99	1.00	1	G	NM_139024		2337500	2337500	+1	no_errors	ENST00000182290	ensembl	human	known	69_37n	silent	29	32.56	14	SNP	0.000	A
WBP1	23559	genome.wustl.edu	37	2	74687542	74687543	+	Frame_Shift_Ins	INS	-	-	C	rs547055147	byFrequency	TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr2:74687542_74687543insC	ENST00000233615.2	+	4	818_819	c.544_545insC	c.(544-546)gccfs	p.A182fs	WBP1_ENST00000494741.1_3'UTR|WBP1_ENST00000409737.1_Frame_Shift_Ins_p.A179fs|MOGS_ENST00000462443.1_5'Flank|WBP1_ENST00000393972.3_Frame_Shift_Ins_p.A216fs	NM_012477.3	NP_036609.1	Q96G27	WBP1_HUMAN	WW domain binding protein 1	182							WW domain binding (GO:0050699)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	8						CCACCAGAGTGCCCCCCCTCAT	0.604													CCCCCCc|CCCCCCC|CCCCCCCC|insertion	4	0.000798722	0.0015	0.0	5008	,	,		17122	0.001		0.0	False		,,,				2504	0.001					dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U79457	CCDS1943.1	2p12	2012-04-20			ENSG00000239779	ENSG00000239779			12737	protein-coding gene	gene with protein product		606961				7644498	Standard	NM_012477		Approved	WBP-1	uc002slj.2	Q96G27	OTTHUMG00000129958	ENST00000233615.2:c.551dupC	2.37:g.74687549_74687549dupC	ENSP00000233615:p.Ala182fs		B2RE02|O95637	Frame_Shift_Ins	INS	pfam_Uncharacterised_WW-bd	p.H185fs	ENST00000233615.2	37	c.544_545	CCDS1943.1	2																																																																																			WBP1	-	NULL	ENSG00000239779		0.604	WBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WBP1	HGNC	protein_coding	OTTHUMT00000252221.2	93	0.00	0	-	NM_012477		74687542	74687543	+1	no_errors	ENST00000233615	ensembl	human	known	69_37n	frame_shift_ins	119	11.85	16	INS	0.963:0.962	C
TTN	7273	genome.wustl.edu	37	2	179444796	179444796	+	Silent	SNP	A	A	C			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr2:179444796A>C	ENST00000591111.1	-	268	62519	c.62295T>G	c.(62293-62295)acT>acG	p.T20765T	TTN-AS1_ENST00000591332.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000342175.6_Silent_p.T13533T|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Silent_p.T13466T|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342992.6_Silent_p.T19838T|TTN_ENST00000589042.1_Silent_p.T22406T|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.T13341T			Q8WZ42	TITIN_HUMAN	titin	20765	Fibronectin type-III 50. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGAGCACTCAGTTGTCACTG	0.458																																						dbGAP											0													188.0	181.0	183.0					2																	179444796		1908	4134	6042	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62295T>G	2.37:g.179444796A>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.T19838	ENST00000591111.1	37	c.59514		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	25	0.00	0	A	NM_133378		179444796	179444796	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	22	37.14	13	SNP	0.828	C
ZDHHC8	29801	genome.wustl.edu	37	22	20130398	20130398	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr22:20130398delG	ENST00000334554.7	+	10	1386	c.1245delG	c.(1243-1245)ccgfs	p.P416fs	ZDHHC8_ENST00000405930.3_Frame_Shift_Del_p.P416fs|ZDHHC8_ENST00000320602.7_Frame_Shift_Del_p.P324fs	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	416					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					CAGCCTACCCGCCATCCCCAC	0.687																																						dbGAP											0													27.0	24.0	25.0					22																	20130398		2200	4295	6495	-	-	-	SO:0001589	frameshift_variant	0			AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.1245delG	22.37:g.20130398delG	ENSP00000334490:p.Pro416fs		Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Frame_Shift_Del	DEL	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.P416fs	ENST00000334554.7	37	c.1245	CCDS13776.1	22																																																																																			ZDHHC8	-	NULL	ENSG00000099904		0.687	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC8	HGNC	protein_coding	OTTHUMT00000318564.1	16	0.00	0	G	NM_013373		20130398	20130398	+1	no_errors	ENST00000405930	ensembl	human	known	69_37n	frame_shift_del	9	18.18	2	DEL	0.996	-
ZFP30	22835	genome.wustl.edu	37	19	38125951	38125951	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr19:38125951C>G	ENST00000351218.2	-	6	2048	c.1491G>C	c.(1489-1491)aaG>aaC	p.K497N	ZFP30_ENST00000392144.1_Missense_Mutation_p.K497N|ZFP30_ENST00000514101.2_Missense_Mutation_p.K497N|ZFP30_ENST00000589018.1_Intron	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTTACATTCCTTACATTTGT	0.338																																						dbGAP											0													74.0	71.0	72.0					19																	38125951		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.1491G>C	19.37:g.38125951C>G	ENSP00000343581:p.Lys497Asn		Q58EY8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K497N	ENST00000351218.2	37	c.1491	CCDS33005.1	19	.	.	.	.	.	.	.	.	.	.	C	8.771	0.926032	0.18056	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	T;T;T	0.19669	2.13;2.13;2.13	3.89	0.385	0.16249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.476187	0.15517	N	0.258245	T	0.14313	0.0346	N	0.11870	0.19	0.09310	N	0.999999	P;P	0.45283	0.855;0.855	P;P	0.54210	0.745;0.745	T	0.12941	-1.0528	10	0.20046	T	0.44	.	2.2625	0.04070	0.1539:0.5253:0.1504:0.1704	.	497;497	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	N	497;497;497;412	ENSP00000343581:K497N;ENSP00000422930:K497N;ENSP00000375988:K497N	ENSP00000343581:K497N	K	-	3	2	ZFP30	42817791	0.000000	0.05858	0.989000	0.46669	0.997000	0.91878	-3.286000	0.00526	0.074000	0.16767	0.585000	0.79938	AAG	ZFP30	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000120784		0.338	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP30	HGNC	protein_coding	OTTHUMT00000109601.2	22	0.00	0	C	NM_014898		38125951	38125951	-1	no_errors	ENST00000351218	ensembl	human	known	69_37n	missense	61	25.61	21	SNP	0.262	G
ZIC3	7547	genome.wustl.edu	37	X	136648985	136648987	+	In_Frame_Del	DEL	CGC	CGC	-			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	CGC	CGC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chrX:136648985_136648987delCGC	ENST00000287538.5	+	1	685_687	c.135_137delCGC	c.(133-138)cacgcc>cac	p.A55del	RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_In_Frame_Del_p.A55del|RP1-137H15.2_ENST00000456631.1_RNA	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	55	Poly-Ala.				anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					ACTCAACCCAcgccgccgccgcc	0.719																																						dbGAP											0										60,940		22,10,6,431,68						4.2	1.0			3	130,2214		24,44,38,840,490	no	coding	ZIC3	NM_003413.3		46,54,44,1271,558	A1A1,A1R,A1,RR,R		5.5461,6.0,5.6818				190,3154				-	-	-	SO:0001651	inframe_deletion	0			AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.135_137delCGC	X.37:g.136648994_136648996delCGC	ENSP00000287538:p.Ala55del		B2CNW4|Q14DE5|Q5JY75	In_Frame_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A49in_frame_del	ENST00000287538.5	37	c.135_137	CCDS14663.1	X																																																																																			ZIC3	-	NULL	ENSG00000156925		0.719	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC3	HGNC	protein_coding	OTTHUMT00000058526.1	28	0.00	0	CGC			136648985	136648987	+1	no_errors	ENST00000287538	ensembl	human	known	69_37n	in_frame_del	10	16.67	2	DEL	1.000:1.000:1.000	-
ZNF407	55628	genome.wustl.edu	37	18	72775958	72775958	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr18:72775958C>T	ENST00000299687.5	+	8	6281	c.6281C>T	c.(6280-6282)gCc>gTc	p.A2094V		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2094					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ACGGCCGCGGCCGGCCAGTTG	0.647																																						dbGAP											0													32.0	39.0	37.0					18																	72775958		2133	4229	6362	-	-	-	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6281C>T	18.37:g.72775958C>T	ENSP00000299687:p.Ala2094Val		B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.A2094V	ENST00000299687.5	37	c.6281	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	C	13.23	2.176279	0.38413	.	.	ENSG00000215421	ENST00000299687	T	0.17691	2.26	4.67	4.67	0.58626	.	.	.	.	.	T	0.35682	0.0940	M	0.72894	2.215	0.80722	D	1	D	0.64830	0.994	P	0.54706	0.759	T	0.01444	-1.1353	9	0.87932	D	0	.	15.7626	0.78096	0.0:1.0:0.0:0.0	.	2094	Q9C0G0	ZN407_HUMAN	V	2094	ENSP00000299687:A2094V	ENSP00000299687:A2094V	A	+	2	0	ZNF407	70904946	1.000000	0.71417	0.264000	0.24511	0.042000	0.13812	6.728000	0.74769	-0.504000	0.06577	0.462000	0.41574	GCC	ZNF407	-	NULL	ENSG00000215421		0.647	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	70	0.00	0	C	NM_017757		72775958	72775958	+1	no_errors	ENST00000299687	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	0.957	T
ZNF526	116115	genome.wustl.edu	37	19	42730398	42730398	+	Missense_Mutation	SNP	C	C	G			TCGA-AC-A2BK-01A-11D-A21Q-09	TCGA-AC-A2BK-11A-13D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bfa13c0e-cc3d-4a4d-9307-75571f89c37f	8f640fe4-aa25-444a-95b1-ca7a17baeb52	g.chr19:42730398C>G	ENST00000301215.3	+	3	2068	c.1843C>G	c.(1843-1845)Cca>Gca	p.P615A		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	615	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				TGCCCCACCCCCACCTCCAGA	0.622																																						dbGAP											0													89.0	89.0	89.0					19																	42730398		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1843C>G	19.37:g.42730398C>G	ENSP00000301215:p.Pro615Ala		B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P615A	ENST00000301215.3	37	c.1843	CCDS12598.1	19	.	.	.	.	.	.	.	.	.	.	C	4.704	0.130917	0.08981	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.08458	3.09	4.38	4.38	0.52667	.	0.381500	0.19298	N	0.117720	T	0.03959	0.0111	N	0.08118	0	0.09310	N	1	B	0.23316	0.083	B	0.21917	0.037	T	0.40776	-0.9545	10	0.07813	T	0.8	-7.0381	10.6436	0.45606	0.0:0.8051:0.1949:0.0	.	615	Q8TF50	ZN526_HUMAN	A	471;615	ENSP00000301215:P615A	ENSP00000301215:P615A	P	+	1	0	ZNF526	47422238	0.000000	0.05858	0.049000	0.19019	0.020000	0.10135	0.528000	0.23002	2.445000	0.82738	0.467000	0.42956	CCA	ZNF526	-	NULL	ENSG00000167625		0.622	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF526	HGNC	protein_coding	OTTHUMT00000463681.2	51	0.00	0	C	XM_057401		42730398	42730398	+1	no_errors	ENST00000301215	ensembl	human	known	69_37n	missense	49	27.94	19	SNP	0.153	G
