#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABLIM2	84448	genome.wustl.edu	37	4	8034384	8034384	+	Intron	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr4:8034384C>T	ENST00000341937.5	-	11	1112				ABLIM2_ENST00000546334.1_Silent_p.T357T|ABLIM2_ENST00000361737.5_Silent_p.T357T|ABLIM2_ENST00000505872.1_Intron|ABLIM2_ENST00000407564.3_Intron|ABLIM2_ENST00000545242.1_Intron|ABLIM2_ENST00000318888.4_Silent_p.T114T|ABLIM2_ENST00000361581.5_Intron|ABLIM2_ENST00000447017.2_Intron|ABLIM2_ENST00000515079.1_Intron|ABLIM2_ENST00000428004.2_Silent_p.T357T|ABLIM2_ENST00000514025.1_Silent_p.T114T|ABLIM2_ENST00000296372.8_Intron	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2						actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						CCTCGGTCGGCGTTGGCGAGA	0.632																																						dbGAP											0													78.0	81.0	80.0					4																	8034384		1565	3578	5143	-	-	-	SO:0001627	intron_variant	0			AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.1048-2881G>A	4.37:g.8034384C>T			E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Silent	SNP	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.T357	ENST00000341937.5	37	c.1071	CCDS47013.1	4																																																																																			ABLIM2	-	NULL	ENSG00000163995		0.632	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABLIM2	HGNC	protein_coding	OTTHUMT00000358862.2	60	0.00	0	C	NM_001130083		8034384	8034384	-1	no_errors	ENST00000361737	ensembl	human	known	69_37n	silent	21	61.11	33	SNP	0.929	T
ACOXL	55289	genome.wustl.edu	37	2	111559229	111559229	+	Splice_Site	SNP	G	G	A	rs201679805		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr2:111559229G>A	ENST00000389811.4	+	8	772	c.548G>A	c.(547-549)gGt>gAt	p.G183D	ACOXL_ENST00000340561.4_Splice_Site_p.G183D|ACOXL_ENST00000439055.1_Splice_Site_p.G183D			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	183					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						TTCTTGCCAGGTCTGCATGGT	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		21290	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													136.0	126.0	129.0					2																	111559229		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.548-1G>A	2.37:g.111559229G>A			A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_Oxase/DH_1,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase	p.G183D	ENST00000389811.4	37	c.548		2	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	16.88	3.245152	0.59103	.	.	ENSG00000153093	ENST00000389811;ENST00000439055;ENST00000422487;ENST00000340561;ENST00000417074	D;D;D;D	0.99270	-5.66;-5.66;-5.66;-5.66	5.42	4.53	0.55603	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.137252	0.46758	D	0.000278	D	0.99597	0.9854	H	0.96970	3.915	0.45354	D	0.998341	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.97868	1.0284	9	.	.	.	.	13.223	0.59899	0.0:0.0:0.8394:0.1605	.	183;183;183	E9PB20;Q9NUZ1-2;Q9NUZ1	.;.;ACOXL_HUMAN	D	183;183;34;183;21	ENSP00000374461:G183D;ENSP00000407761:G183D;ENSP00000343717:G183D;ENSP00000387832:G21D	.	G	+	2	0	ACOXL	111275700	1.000000	0.71417	0.029000	0.17559	0.569000	0.35902	6.193000	0.72075	1.255000	0.44051	0.561000	0.74099	GGT	ACOXL	-	superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	ENSG00000153093		0.448	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	ACOXL	HGNC	protein_coding	OTTHUMT00000254024.2	111	0.00	0	G	NM_018308	Missense_Mutation	111559229	111559229	+1	no_errors	ENST00000439055	ensembl	human	known	69_37n	missense	86	25.86	30	SNP	0.930	A
ADARB2	105	genome.wustl.edu	37	10	1246063	1246063	+	Silent	SNP	G	G	A	rs560087481		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr10:1246063G>A	ENST00000381312.1	-	8	2032	c.1707C>T	c.(1705-1707)ggC>ggT	p.G569G	ADARB2_ENST00000381305.1_5'UTR|ADARB2_ENST00000381310.3_Silent_p.G78G	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	569	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		ACAGGAGCGCGCCCTGCAGCC	0.697													G|||	1	0.000199681	0.0	0.0	5008	,	,		16151	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													21.0	20.0	20.0					10																	1246063		2135	4194	6329	-	-	-	SO:0001819	synonymous_variant	0			AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1707C>T	10.37:g.1246063G>A			B2RPJ5|Q5VUT6|Q5VW42	Silent	SNP	pfam_A_deamin,pfam_Ds-RNA-bd,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_A_deamin	p.G569	ENST00000381312.1	37	c.1707	CCDS7058.1	10																																																																																			ADARB2	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000185736		0.697	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	HGNC	protein_coding	OTTHUMT00000046426.1	63	0.00	0	G	NM_018702		1246063	1246063	-1	no_errors	ENST00000381312	ensembl	human	known	69_37n	silent	70	30.00	30	SNP	0.002	A
AMMECR1L	83607	genome.wustl.edu	37	2	128622763	128622763	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr2:128622763C>T	ENST00000272647.5	-	8	1098	c.838G>A	c.(838-840)Gtg>Atg	p.V280M	AMMECR1L_ENST00000393001.1_Missense_Mutation_p.V280M	NM_001199140.1	NP_001186069.1	Q6DCA0	AMERL_HUMAN	AMMECR1-like	280	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	9	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		CTGATTGTCACCTTCTCACTT	0.463																																						dbGAP											0													146.0	127.0	133.0					2																	128622763		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2152.1	2q21	2012-11-15	2012-11-15		ENSG00000144233	ENSG00000144233			28658	protein-coding gene	gene with protein product			"""AMME chromosomal region gene 1-like"""				Standard	NM_001199140		Approved	MGC4268	uc002tpl.3	Q6DCA0	OTTHUMG00000131535	ENST00000272647.5:c.838G>A	2.37:g.128622763C>T	ENSP00000272647:p.Val280Met		B4E276	Missense_Mutation	SNP	pfam_AMMECR1_domain,pfscan_AMMECR1_domain,tigrfam_AMMECR1	p.V280M	ENST00000272647.5	37	c.838	CCDS2152.1	2	.	.	.	.	.	.	.	.	.	.	C	8.227	0.803737	0.16467	.	.	ENSG00000144233	ENST00000272647;ENST00000393001	.	.	.	5.94	5.94	0.96194	AMMECR1 domain (2);	0.000000	0.64402	D	0.000005	T	0.56321	0.1977	L	0.42632	1.34	0.58432	D	0.999998	B	0.21821	0.061	B	0.25759	0.063	T	0.53251	-0.8465	9	0.08179	T	0.78	-25.2564	20.3594	0.98849	0.0:1.0:0.0:0.0	.	280	Q6DCA0	AMERL_HUMAN	M	280	.	ENSP00000272647:V280M	V	-	1	0	AMMECR1L	128339233	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.745000	0.68672	2.816000	0.96949	0.563000	0.77884	GTG	AMMECR1L	-	pfam_AMMECR1_domain,pfscan_AMMECR1_domain	ENSG00000144233		0.463	AMMECR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMMECR1L	HGNC	protein_coding	OTTHUMT00000254392.1	36	0.00	0	C	NM_031445		128622763	128622763	-1	no_errors	ENST00000272647	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	1.000	T
ARHGAP40	343578	genome.wustl.edu	37	20	37258255	37258255	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr20:37258255C>T	ENST00000373345.4	+	5	754	c.586C>T	c.(586-588)Cgg>Tgg	p.R196W		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	196					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						CAGGCCATCCCGGGGAGGCAC	0.647																																						dbGAP											0													32.0	39.0	37.0					20																	37258255		692	1591	2283	-	-	-	SO:0001583	missense	0			AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.586C>T	20.37:g.37258255C>T	ENSP00000362442:p.Arg196Trp			Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R196W	ENST00000373345.4	37	c.586		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.81|11.81	1.749253|1.749253	0.30955|0.30955	.|.	.|.	ENSG00000124143|ENSG00000124143	ENST00000243967|ENST00000373345	.|T	.|0.07688	.|3.17	4.52|4.52	2.57|2.57	0.30868|0.30868	.|.	.|.	.|.	.|.	.|.	T|T	0.05364|0.05364	0.0142|0.0142	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.39272|0.39272	-0.9622|-0.9622	5|7	.|0.87932	.|D	.|0	.|.	7.4409|7.4409	0.27183|0.27183	0.0:0.7939:0.0:0.2061|0.0:0.7939:0.0:0.2061	.|.	.|.	.|.	.|.	L|W	136|196	.|ENSP00000362442:R196W	.|ENSP00000362442:R196W	P|R	+|+	2|1	0|2	ARHGAP40|ARHGAP40	36691669|36691669	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	0.931000|0.931000	0.28871|0.28871	0.461000|0.461000	0.27071|0.27071	-0.156000|-0.156000	0.13503|0.13503	CCG|CGG	ARHGAP40	-	NULL	ENSG00000124143		0.647	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP40	HGNC	protein_coding		35	0.00	0	C	XM_293123		37258255	37258255	+1	no_errors	ENST00000373345	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	0.001	T
BAP1	8314	genome.wustl.edu	37	3	52440864	52440865	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr3:52440864_52440865insA	ENST00000460680.1	-	8	1110_1111	c.639_640insT	c.(637-642)cgtatcfs	p.I214fs	BAP1_ENST00000296288.5_Frame_Shift_Ins_p.I214fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GCGAGGCCGATACGCTCCATGA	0.594			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)	dbGAP		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	0																																										-	-	-	SO:0001589	frameshift_variant	0			AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.640dupT	3.37:g.52440865_52440865dupA	ENSP00000417132:p.Ile214fs		B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Ins	INS	pfam_Peptidase_C12,prints_Peptidase_C12	p.I213fs	ENST00000460680.1	37	c.640_639	CCDS2853.1	3																																																																																			BAP1	-	pfam_Peptidase_C12	ENSG00000163930		0.594	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAP1	HGNC	protein_coding	OTTHUMT00000350895.1	57	0.00	0	-			52440864	52440865	-1	no_errors	ENST00000460680	ensembl	human	known	69_37n	frame_shift_ins	7	81.08	30	INS	1.000:0.846	A
ARHGEF26	26084	genome.wustl.edu	37	3	153943664	153943664	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr3:153943664C>T	ENST00000356448.4	+	11	2239	c.1955C>T	c.(1954-1956)tCt>tTt	p.S652F	ARHGEF26_ENST00000465817.1_Intron|ARHGEF26_ENST00000483068.1_3'UTR|ARHGEF26_ENST00000465093.1_Missense_Mutation_p.S652F	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	652					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						TTAGTCTCCTCTTCCCGGTGG	0.388																																					GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	dbGAP											0													169.0	145.0	152.0					3																	153943664		1844	4102	5946	-	-	-	SO:0001583	missense	0			BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1955C>T	3.37:g.153943664C>T	ENSP00000348828:p.Ser652Phe		B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.S652F	ENST00000356448.4	37	c.1955	CCDS46938.1	3	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833927	0.71373	.	.	ENSG00000114790	ENST00000356448;ENST00000465093	T;T	0.64618	-0.11;-0.11	5.54	4.67	0.58626	Pleckstrin homology-type (1);	0.110474	0.64402	D	0.000005	T	0.76849	0.4045	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79040	-0.1966	10	0.62326	D	0.03	-16.3541	14.3501	0.66694	0.0:0.9288:0.0:0.0712	.	652;652	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	F	652	ENSP00000348828:S652F;ENSP00000423418:S652F	ENSP00000348828:S652F	S	+	2	0	ARHGEF26	155426354	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.936000	0.70153	1.324000	0.45282	0.650000	0.86243	TCT	ARHGEF26	-	NULL	ENSG00000114790		0.388	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF26	HGNC	protein_coding	OTTHUMT00000353287.3	64	0.00	0	C	NM_015595		153943664	153943664	+1	no_errors	ENST00000356448	ensembl	human	known	69_37n	missense	106	12.40	15	SNP	1.000	T
BNC2	54796	genome.wustl.edu	37	9	16431421	16431421	+	Intron	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr9:16431421G>A	ENST00000380672.4	-	6	2697				BNC2_ENST00000380666.2_Intron|BNC2_ENST00000545497.1_Intron|BNC2_ENST00000380667.2_Intron	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TGACTATCACGCTCTCTTCAA	0.428																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.2639+4131C>T	9.37:g.16431421G>A				Silent	SNP	pfscan_Znf_C2H2	p.S315	ENST00000380672.4	37	c.945	CCDS6482.2	9																																																																																			BNC2	-	NULL	ENSG00000173068		0.428	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	51	0.00	0	G	NM_017637		16431421	16431421	-1	no_start_codon	ENST00000411752	ensembl	human	known	69_37n	silent	92	21.37	25	SNP	0.000	A
CACNA1E	777	genome.wustl.edu	37	1	181689359	181689359	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr1:181689359G>A	ENST00000367573.2	+	14	1769	c.1769G>A	c.(1768-1770)cGg>cAg	p.R590Q	CACNA1E_ENST00000357570.5_Missense_Mutation_p.R541Q|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R590Q|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R541Q|CACNA1E_ENST00000367570.1_Missense_Mutation_p.R590Q|CACNA1E_ENST00000367567.4_Missense_Mutation_p.R197Q|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R590Q	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	590					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCTTCCCTACGGAATTTGGTG	0.478																																						dbGAP											0													226.0	212.0	216.0					1																	181689359		2005	4163	6168	-	-	-	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1769G>A	1.37:g.181689359G>A	ENSP00000356545:p.Arg590Gln		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.R590Q	ENST00000367573.2	37	c.1769	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.435407	0.96150	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14;-5.14;-5.14	5.15	5.15	0.70609	.	0.097627	0.64402	D	0.000002	D	0.98937	0.9639	M	0.66378	2.025	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.75484	0.986;0.986	D	0.99902	1.1165	10	0.87932	D	0	.	18.2263	0.89918	0.0:0.0:1.0:0.0	.	590;590	Q15878-2;Q15878-3	.;.	Q	590;590;541;541;197;590;590	ENSP00000356542:R590Q;ENSP00000434814:R590Q;ENSP00000350183:R541Q;ENSP00000351101:R541Q;ENSP00000356539:R197Q;ENSP00000353222:R590Q;ENSP00000356545:R590Q	ENSP00000350183:R541Q	R	+	2	0	CACNA1E	179955982	1.000000	0.71417	0.990000	0.47175	0.973000	0.67179	9.731000	0.98807	2.391000	0.81399	0.563000	0.77884	CGG	CACNA1E	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000198216		0.478	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	53	0.00	0	G	NM_000721		181689359	181689359	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	missense	88	28.23	35	SNP	1.000	A
CARD9	64170	genome.wustl.edu	37	9	139258462	139258462	+	3'UTR	SNP	A	A	G	rs1135314|rs397839524	byFrequency	TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr9:139258462A>G	ENST00000371732.5	-	0	2068				CARD9_ENST00000460290.1_5'UTR|CARD9_ENST00000371734.3_3'UTR|DNLZ_ENST00000371739.3_5'Flank|DNLZ_ENST00000371738.3_5'Flank	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9						defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		CACTAATACAATGCATGCATG	0.562													A|||	1273	0.254193	0.233	0.5	5008	,	,		15181	0.0437		0.325	False		,,,				2504	0.2526					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.*292T>C	9.37:g.139258462A>G			Q5SXM5|Q5SXM6|Q9H854	RNA	SNP	-	NULL	ENST00000371732.5	37	NULL	CCDS6997.1	9																																																																																			CARD9	-	-	ENSG00000187796		0.562	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD9	HGNC	protein_coding	OTTHUMT00000055053.1	20	0.00	0	A	NM_052813		139258462	139258462	-1	no_errors	ENST00000460290	ensembl	human	known	69_37n	rna	22	18.52	5	SNP	0.000	G
CES1P1	51716	genome.wustl.edu	37	16	55794533	55794533	+	RNA	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr16:55794533C>T	ENST00000571348.1	+	0	23					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										CGCAGGCCCCCGGAACTGTCG	0.637																																						dbGAP											0																																										-	-	-			0			AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55794533C>T			A2RRL8|B9ZVS2	RNA	SNP	-	NULL	ENST00000571348.1	37	NULL		16																																																																																			CES1P1	-	-	ENSG00000228695		0.637	CES1P1-003	KNOWN	basic	processed_transcript	CES1P1	HGNC	pseudogene	OTTHUMT00000440035.1	99	0.00	0	C	NR_003276		55794533	55794533	+1	no_errors	ENST00000571348	ensembl	human	known	69_37n	rna	49	35.53	27	SNP	0.000	T
CGB1	114335	genome.wustl.edu	37	19	49538955	49538955	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr19:49538955G>T	ENST00000301407.7	-	3	484	c.380C>A	c.(379-381)aCc>aAc	p.T127N	CGB1_ENST00000391869.3_Missense_Mutation_p.T127N|CTB-60B18.6_ENST00000591656.1_Intron	NM_033377.1	NP_203695.2	A6NKQ9	CGB1_HUMAN	chorionic gonadotropin, beta polypeptide 1	159						extracellular region (GO:0005576)				liver(1)|lung(1)	2		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GTCATCACAGGTCAAGGGGTG	0.657																																						dbGAP											0													14.0	20.0	18.0					19																	49538955		2179	4274	6453	-	-	-	SO:0001583	missense	0			S80935	CCDS12751.2	19q13.32	2012-10-03				ENSG00000267631			16721	protein-coding gene	gene with protein product		608823				6194155	Standard	NM_033377		Approved		uc002plx.3	A6NKQ9	OTTHUMG00000150186	ENST00000301407.7:c.380C>A	19.37:g.49538955G>T	ENSP00000301407:p.Thr127Asn		A4FVC8|A8MUK6	Missense_Mutation	SNP	pfam_Cys_knot,smart_Gonadotropin_bsu	p.T127N	ENST00000301407.7	37	c.380	CCDS12751.2	19	.	.	.	.	.	.	.	.	.	.	G	8.726	0.915435	0.17907	.	.	ENSG00000213030	ENST00000301407;ENST00000391869	D;D	0.90900	-2.75;-2.75	1.8	1.8	0.24995	.	0.406796	0.26119	N	0.026221	D	0.84511	0.5488	.	.	.	0.22787	N	0.998736	B	0.33777	0.425	B	0.36504	0.226	T	0.76313	-0.3005	9	0.48119	T	0.1	-24.5242	7.1311	0.25502	0.0:0.0:1.0:0.0	.	127	A6NKQ9-2	.	N	127	ENSP00000301407:T127N;ENSP00000375742:T127N	ENSP00000301407:T127N	T	-	2	0	CGB1	54230767	0.938000	0.31826	0.801000	0.32222	0.167000	0.22549	1.450000	0.35134	1.318000	0.45170	0.194000	0.17425	ACC	CGB1	-	pfam_Cys_knot,smart_Gonadotropin_bsu	ENSG00000267631		0.657	CGB1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	CGB1	HGNC	protein_coding	OTTHUMT00000316746.4	83	0.00	0	G	NM_033377		49538955	49538955	-1	no_errors	ENST00000301407	ensembl	human	known	69_37n	missense	77	23.76	24	SNP	0.977	T
CHST9	83539	genome.wustl.edu	37	18	24510658	24510658	+	Intron	SNP	T	T	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr18:24510658T>A	ENST00000284224.8	-	6	518				AQP4-AS1_ENST00000579964.1_RNA|CHST9_ENST00000580774.1_Intron|AQP4-AS1_ENST00000578701.1_RNA|CHST9_ENST00000581714.1_Intron|AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000582605.1_RNA	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9						carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					gcactgatcctgaccttttgg	0.478																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.241-13344A>T	18.37:g.24510658T>A			Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	RNA	SNP	-	NULL	ENST00000284224.8	37	NULL	CCDS42422.1	18																																																																																			CHST9-AS1	-	-	ENSG00000260372		0.478	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST9-AS1	HGNC	protein_coding	OTTHUMT00000446549.1	46	0.00	0	T	NM_031422		24510658	24510658	+1	no_errors	ENST00000568797	ensembl	human	known	69_37n	rna	32	13.51	5	SNP	0.000	A
CLCN7	1186	genome.wustl.edu	37	16	1511617	1511617	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr16:1511617G>C	ENST00000382745.4	-	3	877	c.272C>G	c.(271-273)tCc>tGc	p.S91C	CLCN7_ENST00000262318.8_Missense_Mutation_p.S67C|CLCN7_ENST00000448525.1_Missense_Mutation_p.S67C	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	91					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				ATACTTGAGGGACAGGAGCTT	0.612																																						dbGAP											0													150.0	121.0	131.0					16																	1511617		2199	4300	6499	-	-	-	SO:0001583	missense	0			Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.272C>G	16.37:g.1511617G>C	ENSP00000372193:p.Ser91Cys		A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-7	p.S91C	ENST00000382745.4	37	c.272	CCDS32361.1	16	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226414	0.79576	.	.	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D	0.92299	-3.01;-3.01	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.94128	0.8117	L	0.52011	1.625	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.68192	0.894;0.956	D	0.93489	0.6834	10	0.37606	T	0.19	-41.4795	16.267	0.82593	0.0:0.0:1.0:0.0	.	67;91	E9PDB9;P51798	.;CLCN7_HUMAN	C	67;44;91;33	ENSP00000410907:S67C;ENSP00000372193:S91C	ENSP00000262318:S44C	S	-	2	0	CLCN7	1451618	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	6.403000	0.73264	2.163000	0.67991	0.467000	0.42956	TCC	CLCN7	-	prints_Cl_channel-7	ENSG00000103249		0.612	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN7	HGNC	protein_coding	OTTHUMT00000103598.2	54	0.00	0	G	NM_001287		1511617	1511617	-1	no_errors	ENST00000382745	ensembl	human	known	69_37n	missense	55	28.57	22	SNP	1.000	C
CNIH2	254263	genome.wustl.edu	37	11	66045953	66045953	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr11:66045953G>A	ENST00000311445.6	+	1	284	c.26G>A	c.(25-27)tGc>tAc	p.C9Y	RP11-867G23.3_ENST00000501708.1_lincRNA|RP11-867G23.4_ENST00000526951.1_RNA|RP11-867G23.4_ENST00000528650.1_RNA|CNIH2_ENST00000528852.1_Missense_Mutation_p.C9Y|CNIH2_ENST00000530519.1_3'UTR	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	9					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						GCCGCGTTCTGCTACATGCTC	0.771																																						dbGAP											0													24.0	18.0	20.0					11																	66045953		2190	4284	6474	-	-	-	SO:0001583	missense	0			BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.26G>A	11.37:g.66045953G>A	ENSP00000310003:p.Cys9Tyr			Missense_Mutation	SNP	pfam_Cornichon	p.C9Y	ENST00000311445.6	37	c.26	CCDS8131.1	11	.	.	.	.	.	.	.	.	.	.	g	15.98	2.992158	0.54041	.	.	ENSG00000174871	ENST00000528852;ENST00000311445	.	.	.	2.33	2.33	0.28932	.	0.000000	0.85682	U	0.000000	T	0.64638	0.2616	L	0.52364	1.645	0.80722	D	1	D;D	0.62365	0.977;0.991	P;D	0.66084	0.853;0.941	T	0.61028	-0.7145	9	0.25751	T	0.34	-2.5092	11.7969	0.52104	0.0:0.0:1.0:0.0	.	9;9	Q6PI25;E9PS15	CNIH2_HUMAN;.	Y	9	.	ENSP00000310003:C9Y	C	+	2	0	CNIH2	65802529	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.090000	0.89526	1.308000	0.44962	0.444000	0.29173	TGC	CNIH2	-	pfam_Cornichon	ENSG00000174871		0.771	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNIH2	HGNC	protein_coding	OTTHUMT00000391892.1	8	0.00	0	G	NM_182553		66045953	66045953	+1	no_errors	ENST00000311445	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	1.000	A
CPSF1	29894	genome.wustl.edu	37	8	145626185	145626185	+	Missense_Mutation	SNP	T	T	C			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr8:145626185T>C	ENST00000349769.3	-	7	660	c.566A>G	c.(565-567)tAc>tGc	p.Y189C	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	189					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GTCGATGATGTAGCTGGGCAG	0.647																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													86.0	69.0	75.0					8																	145626185		2202	4299	6501	-	-	-	SO:0001583	missense	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.566A>G	8.37:g.145626185T>C	ENSP00000339353:p.Tyr189Cys		Q96AF0	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.Y189C	ENST00000349769.3	37	c.566	CCDS34966.1	8	.	.	.	.	.	.	.	.	.	.	T	16.69	3.193232	0.58017	.	.	ENSG00000071894	ENST00000349769	T	0.50548	0.74	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.70334	0.3212	M	0.83118	2.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.987;1.0;0.997	T	0.75505	-0.3294	10	0.87932	D	0	-8.4712	13.3472	0.60580	0.0:0.0:0.0:1.0	.	189;111;189	B4DEF4;D3DWL9;Q10570	.;.;CPSF1_HUMAN	C	189	ENSP00000339353:Y189C	ENSP00000339353:Y189C	Y	-	2	0	CPSF1	145596993	1.000000	0.71417	1.000000	0.80357	0.339000	0.28857	5.883000	0.69721	2.051000	0.60960	0.528000	0.53228	TAC	CPSF1	-	NULL	ENSG00000071894		0.647	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	56	0.00	0	T	NM_013291		145626185	145626185	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	missense	43	46.91	38	SNP	1.000	C
DIP2A	23181	genome.wustl.edu	37	21	47983837	47983837	+	Silent	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr21:47983837C>T	ENST00000417564.2	+	35	4177	c.4156C>T	c.(4156-4158)Ctg>Ttg	p.L1386L	DIP2A_ENST00000318711.7_Silent_p.L1387L|DIP2A_ENST00000400274.1_Silent_p.L1382L|DIP2A_ENST00000479654.1_3'UTR			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1386					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		AGACTCACACCTGGGAGAGGT	0.547																																						dbGAP											0													46.0	48.0	47.0					21																	47983837		1914	4141	6055	-	-	-	SO:0001819	synonymous_variant	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.4156C>T	21.37:g.47983837C>T			A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.L1387	ENST00000417564.2	37	c.4159	CCDS46655.1	21																																																																																			DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.547	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	34	0.00	0	C	NM_015151		47983837	47983837	+1	no_errors	ENST00000318711	ensembl	human	known	69_37n	silent	30	38.78	19	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	31279129	31279129	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chrX:31279129C>T	ENST00000357033.4	-	63	9435	c.9229G>A	c.(9229-9231)Gag>Aag	p.E3077K	DMD_ENST00000378677.2_Missense_Mutation_p.E3073K|DMD_ENST00000378702.4_Missense_Mutation_p.E9K|DMD_ENST00000378680.2_Missense_Mutation_p.E9K|DMD_ENST00000343523.2_Missense_Mutation_p.E617K|DMD_ENST00000541735.1_Missense_Mutation_p.E617K|DMD_ENST00000474231.1_Missense_Mutation_p.E617K|DMD_ENST00000378707.3_Missense_Mutation_p.E617K|DMD_ENST00000359836.1_Missense_Mutation_p.E617K|DMD_ENST00000361471.4_Missense_Mutation_p.E9K|DMD_ENST00000378723.3_Missense_Mutation_p.E9K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3077	Interaction with SYNM. {ECO:0000250}.|WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTTTGAGTCTCGTGGCTAAAA	0.368																																						dbGAP											0													119.0	92.0	101.0					X																	31279129		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9229G>A	X.37:g.31279129C>T	ENSP00000354923:p.Glu3077Lys		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.E3077K	ENST00000357033.4	37	c.9229	CCDS14233.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.36|16.36	3.100464|3.100464	0.56183|0.56183	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680|ENST00000465285	T;D;D;D;D;D;D;D;T;D;T;T|.	0.83506|.	2.25;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;2.25;-1.73;2.24;2.25|.	5.74|5.74	4.87|4.87	0.63330|0.63330	WW/Rsp5/WWP (6);|.	0.000000|.	0.34002|.	U|.	0.004347|.	T|T	0.53948|0.53948	0.1828|0.1828	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999998|0.999998	B;P;P;P;P;P;B;B;B;P;P;B;B;B;B;B|.	0.51147|.	0.193;0.616;0.942;0.924;0.884;0.884;0.064;0.069;0.069;0.828;0.794;0.45;0.111;0.116;0.003;0.057|.	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B|.	0.38655|.	0.01;0.137;0.278;0.181;0.154;0.154;0.022;0.025;0.025;0.13;0.08;0.046;0.009;0.016;0.004;0.008|.	T|T	0.49485|0.49485	-0.8935|-0.8935	10|5	0.33141|.	T|.	0.24|.	.|.	14.4527|14.4527	0.67397|0.67397	0.0:0.8573:0.1427:0.0|0.0:0.8573:0.1427:0.0	.|.	9;3069;3077;3073;1736;1733;617;617;617;617;617;2954;9;9;9;9|.	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1|.	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.|.	K|Q	3069;1736;1733;9;773;3073;3077;617;617;3077;2954;617;617;9;617;9;9|805	ENSP00000367997:E9K;ENSP00000350765:E773K;ENSP00000367948:E3073K;ENSP00000354923:E3077K;ENSP00000352894:E617K;ENSP00000340057:E617K;ENSP00000367979:E617K;ENSP00000444119:E617K;ENSP00000367974:E9K;ENSP00000417123:E617K;ENSP00000354464:E9K;ENSP00000367951:E9K|.	ENSP00000340057:E617K|.	E|R	-|-	1|2	0|0	DMD|DMD	31189050|31189050	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.977000|0.977000	0.68977|0.68977	4.040000|4.040000	0.57333|0.57333	1.295000|1.295000	0.44724|0.44724	-0.343000|-0.343000	0.07986|0.07986	GAG|CGA	DMD	-	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pirsf_Dystrophin/utrophin,pfscan_WW_Rsp5_WWP	ENSG00000198947		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	38	0.00	0	C	NM_004006		31279129	31279129	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	25	40.48	17	SNP	1.000	T
SPATA31A6	389730	genome.wustl.edu	37	9	43628235	43628235	+	Missense_Mutation	SNP	G	G	A	rs199884594	byFrequency	TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr9:43628235G>A	ENST00000332857.6	-	4	480	c.452C>T	c.(451-453)cCg>cTg	p.P151L	SPATA31A6_ENST00000496386.1_5'UTR	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	151	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGAAGCTAACGGGGAGAGAAT	0.607													G|||	745	0.148762	0.1014	0.1729	5008	,	,		9168	0.1984		0.1471	False		,,,				2504	0.1462					dbGAP											0													1.0	1.0	1.0					9																	43628235		25	134	159	-	-	-	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.452C>T	9.37:g.43628235G>A	ENSP00000329825:p.Pro151Leu			Missense_Mutation	SNP	NULL	p.P151L	ENST00000332857.6	37	c.452	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	g	3.315	-0.140074	0.06669	.	.	ENSG00000185775	ENST00000332857	T	0.04551	3.6	1.93	-0.328	0.12690	.	0.929591	0.08817	N	0.889351	T	0.04543	0.0124	M	0.67397	2.05	0.80722	P	0.0	P	0.38582	0.638	B	0.28991	0.097	T	0.40251	-0.9573	9	0.18710	T	0.47	.	4.1931	0.10430	0.5006:0.0:0.4994:0.0	.	151	Q5VVP1	F75A6_HUMAN	L	151	ENSP00000329825:P151L	ENSP00000329825:P151L	P	-	2	0	FAM75A6	43568231	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.634000	0.02020	-0.086000	0.12550	-0.558000	0.04189	CCG	FAM75A6	-	NULL	ENSG00000185775		0.607	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	HGNC	protein_coding	OTTHUMT00000036987.1	9	0.00	0	G	NM_001145196		43628235	43628235	-1	no_errors	ENST00000332857	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.000	A
FBLN1	2192	genome.wustl.edu	37	22	45958895	45958895	+	Intron	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr22:45958895G>A	ENST00000327858.6	+	15	1792				FBLN1_ENST00000348697.2_Intron|FBLN1_ENST00000402984.3_Missense_Mutation_p.A639T|FBLN1_ENST00000262722.7_Missense_Mutation_p.A601T|FBLN1_ENST00000442170.2_Intron	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1						embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CCAAGCGCCCGCGGTGGTTTT	0.607																																						dbGAP											0													80.0	95.0	90.0					22																	45958895		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1698-11496G>A	22.37:g.45958895G>A			B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_Anaphylatoxin/fibulin,smart_Anaphylatoxin/fibulin,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibulin-1,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.A601T	ENST00000327858.6	37	c.1801	CCDS14067.1	22	.	.	.	.	.	.	.	.	.	.	G	11.00	1.511187	0.27036	.	.	ENSG00000077942	ENST00000402984;ENST00000262722	D;D	0.85955	-2.05;-1.91	4.86	4.86	0.63082	.	.	.	.	.	T	0.72128	0.3422	L	0.29908	0.895	0.80722	D	1	B;B	0.26002	0.068;0.139	B;B	0.20577	0.005;0.03	T	0.66002	-0.6031	9	0.23891	T	0.37	.	4.3854	0.11314	0.1761:0.0:0.6301:0.1938	.	639;601	B1AHL2;P23142-4	.;.	T	639;601	ENSP00000385521:A639T;ENSP00000262722:A601T	ENSP00000262722:A601T	A	+	1	0	FBLN1	44337559	1.000000	0.71417	0.998000	0.56505	0.643000	0.38383	5.641000	0.67881	2.240000	0.73641	0.313000	0.20887	GCG	FBLN1	-	pirsf_Fibulin-1	ENSG00000077942		0.607	FBLN1-001	KNOWN	basic|CCDS	protein_coding	FBLN1	HGNC	protein_coding	OTTHUMT00000322287.1	55	0.00	0	G	NM_006486		45958895	45958895	+1	no_errors	ENST00000262722	ensembl	human	known	69_37n	missense	44	34.33	23	SNP	1.000	A
FBXL19	54620	genome.wustl.edu	37	16	30939090	30939090	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr16:30939090C>T	ENST00000380310.2	+	5	651	c.493C>T	c.(493-495)Cgt>Tgt	p.R165C	FBXL19_ENST00000562319.1_Missense_Mutation_p.R145C|FBXL19_ENST00000565690.1_Intron|FBXL19_ENST00000471231.2_5'UTR|FBXL19_ENST00000338343.4_Missense_Mutation_p.R145C	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	165					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						GCCTGGCCGCCGTAGGGCCGA	0.706																																						dbGAP											0													6.0	9.0	8.0					16																	30939090		1887	3986	5873	-	-	-	SO:0001583	missense	0			AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.493C>T	16.37:g.30939090C>T	ENSP00000369666:p.Arg165Cys		A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.R165C	ENST00000380310.2	37	c.493	CCDS45465.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	17.44|17.44	3.390100|3.390100	0.61956|0.61956	.|.	.|.	ENSG00000099364|ENSG00000099364	ENST00000427128|ENST00000338343;ENST00000380310	.|T;T	.|0.27720	.|1.65;1.96	5.29|5.29	3.17|3.17	0.36434|0.36434	.|.	.|0.176015	.|0.25258	.|U	.|0.031962	T|T	0.30634|0.30634	0.0771|0.0771	L|L	0.29908|0.29908	0.895|0.895	0.47862|0.47862	D|D	0.999533|0.999533	.|D;D	.|0.71674	.|0.998;0.996	.|P;P	.|0.56563	.|0.801;0.682	T|T	0.04593|0.04593	-1.0940|-1.0940	5|10	.|0.87932	.|D	.|0	-16.1022|-16.1022	5.4014|5.4014	0.16299|0.16299	0.3028:0.5962:0.0:0.101|0.3028:0.5962:0.0:0.101	.|.	.|165;165	.|Q6PCT2;Q6PCT2-2	.|FXL19_HUMAN;.	L|C	99|145;165	.|ENSP00000339712:R145C;ENSP00000369666:R165C	.|ENSP00000339712:R145C	P|R	+|+	2|1	0|0	FBXL19|FBXL19	30846591|30846591	0.986000|0.986000	0.35501|0.35501	1.000000|1.000000	0.80357|0.80357	0.784000|0.784000	0.44337|0.44337	0.741000|0.741000	0.26202|0.26202	2.498000|2.498000	0.84270|0.84270	0.457000|0.457000	0.33378|0.33378	CCG|CGT	FBXL19	-	NULL	ENSG00000099364		0.706	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL19	HGNC	protein_coding		127	0.00	0	C	NM_019085		30939090	30939090	+1	no_errors	ENST00000380310	ensembl	human	known	69_37n	missense	144	19.55	35	SNP	1.000	T
FOXL2	668	genome.wustl.edu	37	3	138665358	138665358	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr3:138665358C>A	ENST00000330315.3	-	1	624	c.207G>T	c.(205-207)gaG>gaT	p.E69D	C3orf72_ENST00000383165.3_5'Flank|RP11-548O1.3_ENST00000495287.1_lincRNA	NM_023067.3	NP_075555.1	P58012	FOXL2_HUMAN	forkhead box L2	69			E -> K (in BPES; sporadic; nuclear aggregation; normal transactivation activity). {ECO:0000269|PubMed:18642388}.		apoptotic DNA fragmentation (GO:0006309)|cell differentiation (GO:0030154)|embryonic eye morphogenesis (GO:0048048)|extraocular skeletal muscle development (GO:0002074)|female somatic sex determination (GO:0019101)|granulosa cell differentiation (GO:0060014)|menstruation (GO:0042703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	cysteine-type endopeptidase regulator activity involved in apoptotic process (GO:0043028)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin conjugating enzyme binding (GO:0031624)			large_intestine(1)|lung(1)|ovary(333)|skin(1)	336						TCTCCGCGCTCTCGCGGATCG	0.637			Mis		granulosa-cell tumour of the ovary		"""Blepharophimosis, ptosis and epicanthus inversus Types I, II; Premature ovarian failure type III"""																															dbGAP		Dom	yes		3	3q23	668	forkhead box L2	yes	O	0													48.0	54.0	52.0					3																	138665358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF301906	CCDS3105.1	3q23	2008-04-10			ENSG00000183770	ENSG00000183770		"""Forkhead boxes"""	1092	protein-coding gene	gene with protein product		605597		BPES		1941972	Standard	NM_023067		Approved	BPES1	uc003esw.3	P58012	OTTHUMG00000159889	ENST00000330315.3:c.207G>T	3.37:g.138665358C>A	ENSP00000333188:p.Glu69Asp		Q4ZGJ3	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.E69D	ENST00000330315.3	37	c.207	CCDS3105.1	3	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413070	0.42817	.	.	ENSG00000183770	ENST00000330315;ENST00000542203	D	0.95412	-3.7	3.85	1.95	0.26073	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	U	0.000000	D	0.86648	0.5983	N	0.03253	-0.375	0.58432	D	0.999998	B	0.23377	0.084	B	0.27380	0.079	T	0.79524	-0.1768	10	0.33940	T	0.23	.	10.3419	0.43884	0.0:0.823:0.0:0.177	.	69	P58012	FOXL2_HUMAN	D	69	ENSP00000333188:E69D	ENSP00000333188:E69D	E	-	3	2	FOXL2	140148048	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	1.266000	0.33039	0.712000	0.32039	0.505000	0.49811	GAG	FOXL2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000183770		0.637	FOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXL2	HGNC	protein_coding	OTTHUMT00000357999.1	27	0.00	0	C			138665358	138665358	-1	no_errors	ENST00000330315	ensembl	human	known	69_37n	missense	63	13.70	10	SNP	1.000	A
GGN	199720	genome.wustl.edu	37	19	38876632	38876632	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr19:38876632C>A	ENST00000334928.6	-	3	1402	c.1270G>T	c.(1270-1272)Ggc>Tgc	p.G424C	GGN_ENST00000591809.1_Intron|AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	424	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ATGGGCTCGCCATTGGTGGGT	0.711																																						dbGAP											0													8.0	10.0	9.0					19																	38876632		2168	4253	6421	-	-	-	SO:0001583	missense	0			AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1270G>T	19.37:g.38876632C>A	ENSP00000334940:p.Gly424Cys		Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	NULL	p.G424C	ENST00000334928.6	37	c.1270	CCDS12516.1	19	.	.	.	.	.	.	.	.	.	.	C	8.622	0.891574	0.17613	.	.	ENSG00000179168	ENST00000334928	.	.	.	3.5	2.37	0.29283	.	0.000000	0.39909	N	0.001224	T	0.40743	0.1129	L	0.27053	0.805	0.31376	N	0.679586	D;D	0.69078	0.997;0.997	P;P	0.58210	0.835;0.835	T	0.43310	-0.9399	9	0.54805	T	0.06	-9.4285	8.7323	0.34507	0.0:0.768:0.232:0.0	.	341;424	Q86UU5-2;Q86UU5	.;GGN_HUMAN	C	424	.	ENSP00000334940:G424C	G	-	1	0	GGN	43568472	0.002000	0.14202	0.985000	0.45067	0.098000	0.18820	1.196000	0.32198	1.775000	0.52247	0.462000	0.41574	GGC	GGN	-	NULL	ENSG00000179168		0.711	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGN	HGNC	protein_coding	OTTHUMT00000459205.1	18	0.00	0	C	NM_152657		38876632	38876632	-1	no_errors	ENST00000334928	ensembl	human	known	69_37n	missense	7	74.07	20	SNP	0.855	A
GIGYF1	64599	genome.wustl.edu	37	7	100284299	100284299	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr7:100284299C>T	ENST00000275732.5	-	7	1876	c.667G>A	c.(667-669)Ggc>Agc	p.G223S	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	223					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CAGCGGTCGCCGTCTCGCCGG	0.692																																						dbGAP											0													27.0	32.0	31.0					7																	100284299		2198	4288	6486	-	-	-	SO:0001583	missense	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.667G>A	7.37:g.100284299C>T	ENSP00000275732:p.Gly223Ser		Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.G223S	ENST00000275732.5	37	c.667	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	18.41	3.618247	0.66787	.	.	ENSG00000146830	ENST00000275732	D	0.83419	-1.72	4.96	4.06	0.47325	.	0.062571	0.64402	D	0.000006	T	0.76111	0.3942	L	0.46157	1.445	0.45541	D	0.99849	B	0.29671	0.254	B	0.19946	0.027	T	0.73892	-0.3839	10	0.41790	T	0.15	-15.9972	13.0018	0.58681	0.0:0.8364:0.1636:0.0	.	223	O75420	PERQ1_HUMAN	S	223	ENSP00000275732:G223S	ENSP00000275732:G223S	G	-	1	0	GIGYF1	100122235	0.005000	0.15991	0.771000	0.31576	0.470000	0.32858	1.028000	0.30128	1.287000	0.44583	0.563000	0.77884	GGC	GIGYF1	-	NULL	ENSG00000146830		0.692	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2	49	0.00	0	C	NM_022574		100284299	100284299	-1	no_errors	ENST00000275732	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	0.994	T
HHIPL1	84439	genome.wustl.edu	37	14	100118715	100118715	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr14:100118715C>T	ENST00000330710.5	+	2	508	c.410C>T	c.(409-411)gCg>gTg	p.A137V	HHIPL1_ENST00000357223.2_Missense_Mutation_p.A137V	NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	137					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGCTCTGGGCGCTGGAGGGC	0.602																																						dbGAP											0													88.0	80.0	83.0					14																	100118715		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.410C>T	14.37:g.100118715C>T	ENSP00000330601:p.Ala137Val		A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	pfam_Srcr_rcpt,pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Srcr_rcpt-rel,superfamily_Quinoprot_gluc/sorb_DH,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.A137V	ENST00000330710.5	37	c.410	CCDS45162.1	14	.	.	.	.	.	.	.	.	.	.	c	15.08	2.726881	0.48833	.	.	ENSG00000182218	ENST00000330710;ENST00000357223	T;T	0.28069	1.63;1.63	4.98	4.98	0.66077	Folate receptor-like (1);	0.340189	0.27595	N	0.018661	T	0.39708	0.1088	L	0.58669	1.825	0.32756	N	0.505739	D;P	0.53619	0.961;0.928	P;B	0.47864	0.559;0.388	T	0.50955	-0.8766	10	0.31617	T	0.26	.	18.2712	0.90069	0.0:1.0:0.0:0.0	.	137;137	Q96JK4;Q96JK4-2	HIPL1_HUMAN;.	V	137	ENSP00000330601:A137V;ENSP00000349757:A137V	ENSP00000330601:A137V	A	+	2	0	HHIPL1	99188468	0.995000	0.38212	0.996000	0.52242	0.487000	0.33371	4.275000	0.58927	2.294000	0.77228	0.655000	0.94253	GCG	HHIPL1	-	pfam_Folate_rcpt-like	ENSG00000182218		0.602	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL1	HGNC	protein_coding	OTTHUMT00000413811.1	26	0.00	0	C	XM_041566		100118715	100118715	+1	no_errors	ENST00000330710	ensembl	human	known	69_37n	missense	18	47.06	16	SNP	0.903	T
HIST1H3B	8358	genome.wustl.edu	37	6	26032052	26032052	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr6:26032052G>T	ENST00000244661.2	-	1	236	c.237C>A	c.(235-237)ttC>ttA	p.F79L		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	79					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						GATCGGTCTTGAAGTCTTGGG	0.587																																						dbGAP											0													74.0	77.0	76.0					6																	26032052		2203	4300	6503	-	-	-	SO:0001583	missense	0			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.237C>A	6.37:g.26032052G>T	ENSP00000244661:p.Phe79Leu		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.F79L	ENST00000244661.2	37	c.237	CCDS4573.1	6	.	.	.	.	.	.	.	.	.	.	g	13.36	2.213365	0.39102	.	.	ENSG00000124693	ENST00000244661	T	0.41758	0.99	5.24	4.35	0.52113	.	.	.	.	.	T	0.48021	0.1477	.	.	.	0.37261	D	0.906994	.	.	.	.	.	.	T	0.52852	-0.8520	6	0.87932	D	0	.	13.8417	0.63444	0.0783:0.0:0.9217:0.0	.	.	.	.	L	79	ENSP00000244661:F79L	ENSP00000244661:F79L	F	-	3	2	HIST1H3B	26140031	1.000000	0.71417	1.000000	0.80357	0.412000	0.31113	6.254000	0.72460	2.595000	0.87683	0.561000	0.74099	TTC	HIST1H3B	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3	ENSG00000124693		0.587	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3B	HGNC	protein_coding	OTTHUMT00000040077.1	79	0.00	0	G	NM_003537		26032052	26032052	-1	no_errors	ENST00000244661	ensembl	human	known	69_37n	missense	133	25.70	46	SNP	1.000	T
HTR2C	3358	genome.wustl.edu	37	X	114141231	114141231	+	Silent	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chrX:114141231C>T	ENST00000276198.1	+	6	1358	c.630C>T	c.(628-630)aaC>aaT	p.N210N	HTR2C_ENST00000371951.1_Silent_p.N210N|HTR2C_ENST00000371950.3_Nonsense_Mutation_p.R179*	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	210					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GCGTGCTCAACGACCCAAATT	0.473																																						dbGAP											0													288.0	233.0	251.0					X																	114141231		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.630C>T	X.37:g.114141231C>T			B1AMW4|Q5VUF8|Q9NP28	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_5HT2C_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R179*	ENST00000276198.1	37	c.535	CCDS14564.1	X	.	.	.	.	.	.	.	.	.	.	C	40	8.401792	0.98796	.	.	ENSG00000147246	ENST00000371950	.	.	.	4.87	-1.62	0.08372	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	9.4847	0.38922	0.0:0.4609:0.0:0.5391	.	.	.	.	X	179	.	ENSP00000361018:R179X	R	+	1	2	HTR2C	114047487	0.000000	0.05858	0.995000	0.50966	0.992000	0.81027	-2.245000	0.01192	-0.287000	0.09064	0.538000	0.68166	CGA	HTR2C	-	NULL	ENSG00000147246		0.473	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2C	HGNC	protein_coding	OTTHUMT00000057962.1	103	0.00	0	C	NM_000868		114141231	114141231	+1	no_errors	ENST00000371950	ensembl	human	known	69_37n	nonsense	125	38.54	79	SNP	0.946	T
ITGA1	3672	genome.wustl.edu	37	5	52227951	52227951	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr5:52227951G>C	ENST00000282588.6	+	22	3304	c.2846G>C	c.(2845-2847)gGa>gCa	p.G949A	CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	949					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TATGAAGTTGGACTACAGTTT	0.418																																						dbGAP											0													77.0	76.0	76.0					5																	52227951		2203	4299	6502	-	-	-	SO:0001583	missense	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2846G>C	5.37:g.52227951G>C	ENSP00000282588:p.Gly949Ala		B2RNU0	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.G949A	ENST00000282588.6	37	c.2846	CCDS3955.1	5	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784001	0.49891	.	.	ENSG00000213949	ENST00000282588	T	0.42900	0.96	5.77	4.89	0.63831	Integrin alpha-2 (1);	0.327649	0.33401	N	0.004950	T	0.38639	0.1048	N	0.22421	0.69	0.39426	D	0.967006	P	0.35307	0.494	P	0.48921	0.595	T	0.11792	-1.0573	10	0.16420	T	0.52	.	11.2815	0.49197	0.0876:0.0:0.9124:0.0	.	949	P56199	ITA1_HUMAN	A	949	ENSP00000282588:G949A	ENSP00000282588:G949A	G	+	2	0	ITGA1	52263708	1.000000	0.71417	0.817000	0.32601	0.920000	0.55202	4.312000	0.59154	2.885000	0.99019	0.655000	0.94253	GGA	ITGA1	-	pfam_Integrin_alpha-2	ENSG00000213949		0.418	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3	59	0.00	0	G	NM_181501		52227951	52227951	+1	no_errors	ENST00000282588	ensembl	human	known	69_37n	missense	38	34.48	20	SNP	0.863	C
KIAA1328	57536	genome.wustl.edu	37	18	34647216	34647216	+	Missense_Mutation	SNP	C	C	T	rs536436186		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr18:34647216C>T	ENST00000280020.5	+	7	962	c.940C>T	c.(940-942)Cgt>Tgt	p.R314C	KIAA1328_ENST00000591619.1_Missense_Mutation_p.R310C|KIAA1328_ENST00000435985.2_Missense_Mutation_p.R30C|KIAA1328_ENST00000543923.1_Missense_Mutation_p.R206C|KIAA1328_ENST00000586135.1_Missense_Mutation_p.R30C|KIAA1328_ENST00000586501.1_Missense_Mutation_p.R30C	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328	314										central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		TGCTGCAGATCGTGTTCATGA	0.458																																						dbGAP											0													111.0	106.0	108.0					18																	34647216		2099	4216	6315	-	-	-	SO:0001583	missense	0			AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.940C>T	18.37:g.34647216C>T	ENSP00000280020:p.Arg314Cys		Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	NULL	p.R314C	ENST00000280020.5	37	c.940	CCDS45855.1	18	.	.	.	.	.	.	.	.	.	.	C	3.092	-0.186584	0.06340	.	.	ENSG00000150477	ENST00000543923;ENST00000280020;ENST00000383055;ENST00000435985	T;T;T	0.46819	0.86;0.86;0.86	6.17	4.36	0.52297	.	0.662643	0.14649	N	0.306705	T	0.30603	0.0770	N	0.19112	0.55	0.09310	N	0.999999	B;B;B;B	0.11235	0.0;0.0;0.0;0.004	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.17107	-1.0380	10	0.38643	T	0.18	.	6.9295	0.24434	0.0:0.6592:0.182:0.1589	.	30;314;30;314	Q86T90-4;A8K8C3;Q86T90-3;Q86T90	.;.;.;K1328_HUMAN	C	206;314;314;30	ENSP00000441359:R206C;ENSP00000280020:R314C;ENSP00000390515:R30C	ENSP00000280020:R314C	R	+	1	0	KIAA1328	32901214	0.084000	0.21492	0.136000	0.22124	0.029000	0.11900	0.470000	0.22084	0.899000	0.36444	0.655000	0.94253	CGT	KIAA1328	-	NULL	ENSG00000150477		0.458	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1328	HGNC	protein_coding	OTTHUMT00000440455.1	62	0.00	0	C	NM_020776		34647216	34647216	+1	no_errors	ENST00000280020	ensembl	human	known	69_37n	missense	41	25.45	14	SNP	0.290	T
LILRA5	353514	genome.wustl.edu	37	19	54823368	54823368	+	Missense_Mutation	SNP	G	G	A	rs568171861		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr19:54823368G>A	ENST00000301219.3	-	4	294	c.175C>T	c.(175-177)Cgg>Tgg	p.R59W	LILRA5_ENST00000446712.3_Missense_Mutation_p.R47W|LILRA5_ENST00000346508.3_Missense_Mutation_p.R47W|LILRA5_ENST00000432233.3_Missense_Mutation_p.R59W|AC008984.2_ENST00000507363.1_RNA	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	59	Ig-like C2-type 1.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GAGTTCCCCCGGCTGATCACA	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		17485	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													88.0	88.0	88.0					19																	54823368		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.175C>T	19.37:g.54823368G>A	ENSP00000301219:p.Arg59Trp		A6NHI3	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2	p.R59W	ENST00000301219.3	37	c.175	CCDS12888.1	19	.	.	.	.	.	.	.	.	.	.	G	6.012	0.370620	0.11409	.	.	ENSG00000187116	ENST00000301219;ENST00000346508;ENST00000446712;ENST00000432233	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	3.45	-6.37	0.01963	Immunoglobulin subtype 2 (1);Immunoglobulin-like fold (1);	2.887380	0.01817	N	0.033798	T	0.05868	0.0153	N	0.03294	-0.36	0.09310	N	1	B;B;B;B	0.18741	0.004;0.024;0.001;0.03	B;B;B;B	0.26202	0.008;0.009;0.008;0.067	T	0.35025	-0.9805	10	0.42905	T	0.14	.	4.7254	0.12938	0.2226:0.0:0.4897:0.2876	.	47;59;47;59	A6NI73-4;A6NI73-3;A6NI73-2;A6NI73	.;.;.;LIRA5_HUMAN	W	59;47;47;59	ENSP00000301219:R59W;ENSP00000302948:R47W;ENSP00000389499:R47W;ENSP00000404236:R59W	ENSP00000301219:R59W	R	-	1	2	LILRA5	59515180	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.964000	0.00671	-0.893000	0.03930	-0.745000	0.03516	CGG	LILRA5	-	smart_Ig_sub,smart_Ig_sub2	ENSG00000187116		0.607	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA5	HGNC	protein_coding	OTTHUMT00000140231.1	45	0.00	0	G	NM_181985		54823368	54823368	-1	no_errors	ENST00000301219	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	0.000	A
LINC00200	399706	genome.wustl.edu	37	10	1208631	1208631	+	lincRNA	SNP	A	A	G	rs114595250	byFrequency	TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr10:1208631A>G	ENST00000425630.1	+	0	453					NR_015376.2				long intergenic non-protein coding RNA 200																		AAACAGCAGAAGCTGCTGGCC	0.552													A|||	295	0.0589058	0.1944	0.0115	5008	,	,		21181	0.0159		0.0	False		,,,				2504	0.0143					dbGAP											0																																										-	-	-			0			AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1208631A>G				RNA	SNP	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			LINC00200	-	-	ENSG00000229205		0.552	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	HGNC	lincRNA	OTTHUMT00000046417.2	8	0.00	0	A	NR_015376		1208631	1208631	+1	no_errors	ENST00000425630	ensembl	human	known	69_37n	rna	13	50.00	13	SNP	0.001	G
LTK	4058	genome.wustl.edu	37	15	41797455	41797455	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr15:41797455C>T	ENST00000263800.6	-	15	1972	c.1876G>A	c.(1876-1878)Gac>Aac	p.D626N	LTK_ENST00000561619.1_Missense_Mutation_p.D324N|LTK_ENST00000355166.5_Missense_Mutation_p.D565N|LTK_ENST00000453182.2_Missense_Mutation_p.D496N	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	626	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TGGGCTATGTCCTGGGCCAGT	0.607										TSP Lung(18;0.14)																												dbGAP											0													55.0	50.0	52.0					15																	41797455		2203	4300	6503	-	-	-	SO:0001583	missense	0			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1876G>A	15.37:g.41797455C>T	ENSP00000263800:p.Asp626Asn		A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D626N	ENST00000263800.6	37	c.1876	CCDS10077.1	15	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417136	0.62511	.	.	ENSG00000062524	ENST00000355166;ENST00000263800;ENST00000453182	D;D;T	0.89939	-2.59;-2.59;-0.06	4.04	2.13	0.27403	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.92606	0.7651	M	0.76002	2.32	0.52501	D	0.999955	D;P;D;D	0.89917	1.0;0.789;1.0;1.0	D;B;D;D	0.97110	1.0;0.418;1.0;1.0	D	0.90867	0.4743	9	0.87932	D	0	.	8.2401	0.31654	0.0:0.7517:0.1578:0.0905	.	496;496;565;626	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	N	565;626;496	ENSP00000347293:D565N;ENSP00000263800:D626N;ENSP00000392196:D496N	ENSP00000263800:D626N	D	-	1	0	LTK	39584747	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.509000	0.53386	0.366000	0.24427	0.462000	0.41574	GAC	LTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000062524		0.607	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2	37	0.00	0	C			41797455	41797455	-1	no_errors	ENST00000263800	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	1.000	T
LUZP2	338645	genome.wustl.edu	37	11	24759771	24759771	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr11:24759771G>T	ENST00000336930.6	+	4	322	c.256G>T	c.(256-258)Gaa>Taa	p.E86*	LUZP2_ENST00000531187.1_3'UTR|LUZP2_ENST00000533227.1_5'UTR			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	86						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						AAATAGAGAAGAAATGAAGTC	0.353																																						dbGAP											0													58.0	62.0	60.0					11																	24759771		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.256G>T	11.37:g.24759771G>T	ENSP00000336817:p.Glu86*		A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Nonsense_Mutation	SNP	NULL	p.E86*	ENST00000336930.6	37	c.256	CCDS31446.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.303818	0.95601	.	.	ENSG00000187398	ENST00000336930;ENST00000529015	.	.	.	5.76	4.85	0.62838	.	0.117343	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-16.4057	12.9366	0.58319	0.0:0.2388:0.7612:0.0	.	.	.	.	X	86	.	ENSP00000336817:E86X	E	+	1	0	LUZP2	24716347	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.709000	0.68384	1.445000	0.47624	0.650000	0.86243	GAA	LUZP2	-	NULL	ENSG00000187398		0.353	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP2	HGNC	protein_coding	OTTHUMT00000387861.1	60	0.00	0	G	NM_001009909		24759771	24759771	+1	no_errors	ENST00000336930	ensembl	human	known	69_37n	nonsense	38	29.63	16	SNP	1.000	T
MAEL	84944	genome.wustl.edu	37	1	166959030	166959030	+	Silent	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr1:166959030C>T	ENST00000367872.4	+	2	433	c.189C>T	c.(187-189)gcC>gcT	p.A63A	MAEL_ENST00000367870.2_Intron	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	63					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						AATGGAGGGCCGCTCAGGGAA	0.517																																						dbGAP											0													28.0	33.0	31.0					1																	166959030		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.189C>T	1.37:g.166959030C>T			B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Silent	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,superfamily_CH-domain	p.A63	ENST00000367872.4	37	c.189	CCDS1257.1	1																																																																																			MAEL	-	pfam_HMG_superfamily,superfamily_HMG_superfamily	ENSG00000143194		0.517	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	HGNC	protein_coding	OTTHUMT00000083239.1	42	0.00	0	C	NM_032858		166959030	166959030	+1	no_errors	ENST00000367872	ensembl	human	known	69_37n	silent	52	14.75	9	SNP	0.934	T
MAN1B1	11253	genome.wustl.edu	37	9	139998223	139998223	+	Intron	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr9:139998223C>T	ENST00000371589.4	+	8	1327				MAN1B1_ENST00000474902.1_Intron|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		GTTACATTCACACTGTTGCAG	0.542																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1254+2099C>T	9.37:g.139998223C>T			Q5VSG3|Q9BRS9|Q9Y5K7	RNA	SNP	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			MAN1B1	-	-	ENSG00000177239		0.542	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	151	0.66	1	C	NM_016219		139998223	139998223	+1	no_errors	ENST00000540391	ensembl	human	known	69_37n	rna	158	14.13	26	SNP	0.521	T
MAVS	57506	genome.wustl.edu	37	20	3846631	3846631	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr20:3846631C>T	ENST00000428216.2	+	7	1588	c.1460C>T	c.(1459-1461)gCg>gTg	p.A487V	MAVS_ENST00000416600.2_Missense_Mutation_p.A346V|MAVS_ENST00000358134.6_3'UTR	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	487					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						GGGCCACCTGCGGACCCGGAT	0.662																																						dbGAP											0													28.0	33.0	31.0					20																	3846631		2203	4300	6503	-	-	-	SO:0001583	missense	0			DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.1460C>T	20.37:g.3846631C>T	ENSP00000401980:p.Ala487Val		A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	NULL	p.A487V	ENST00000428216.2	37	c.1460	CCDS33437.1	20	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469800	0.26423	.	.	ENSG00000088888	ENST00000416600;ENST00000428216	T;T	0.35048	1.33;2.45	4.41	0.0244	0.14141	.	1.516590	0.03741	N	0.254986	T	0.25975	0.0633	L	0.46157	1.445	0.09310	N	1	P	0.38745	0.645	B	0.28232	0.087	T	0.21724	-1.0237	10	0.48119	T	0.1	-1.4084	3.2023	0.06653	0.1692:0.4068:0.3291:0.0949	.	487	Q7Z434	MAVS_HUMAN	V	346;487	ENSP00000413749:A346V;ENSP00000401980:A487V	ENSP00000413749:A346V	A	+	2	0	MAVS	3794631	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.383000	0.07398	0.052000	0.16007	0.655000	0.94253	GCG	MAVS	-	NULL	ENSG00000088888		0.662	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAVS	HGNC	protein_coding	OTTHUMT00000077784.3	34	0.00	0	C	NM_020746		3846631	3846631	+1	no_errors	ENST00000428216	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	0.000	T
MCF2L2	23101	genome.wustl.edu	37	3	182947467	182947467	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr3:182947467C>T	ENST00000328913.3	-	17	2329	c.2032G>A	c.(2032-2034)Gaa>Aaa	p.E678K	MCF2L2_ENST00000447025.2_Missense_Mutation_p.E678K|MCF2L2_ENST00000473233.1_Missense_Mutation_p.E678K	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	678	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E678K(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TTGTGAAATTCGTAAAGTTCT	0.328																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											91.0	97.0	95.0					3																	182947467		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2032G>A	3.37:g.182947467C>T	ENSP00000328118:p.Glu678Lys		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E678K	ENST00000328913.3	37	c.2032	CCDS3243.1	3	.	.	.	.	.	.	.	.	.	.	C	18.53	3.643942	0.67244	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025	T;T;T	0.62788	0.0;0.0;0.0	5.06	5.06	0.68205	Dbl homology (DH) domain (5);	0.136757	0.48767	D	0.000177	T	0.69169	0.3081	L	0.41356	1.27	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.63703	0.917;0.913	T	0.70528	-0.4847	10	0.52906	T	0.07	.	13.9585	0.64164	0.0:1.0:0.0:0.0	.	678;678	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	K	678	ENSP00000328118:E678K;ENSP00000420070:E678K;ENSP00000388190:E678K	ENSP00000328118:E678K	E	-	1	0	MCF2L2	184430161	0.979000	0.34478	0.989000	0.46669	0.626000	0.37791	2.595000	0.46197	2.350000	0.79820	0.655000	0.94253	GAA	MCF2L2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000053524		0.328	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	HGNC	protein_coding	OTTHUMT00000350868.1	19	0.00	0	C	NM_015078		182947467	182947467	-1	no_errors	ENST00000328913	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.998	T
MCU	90550	genome.wustl.edu	37	10	74451957	74451958	+	In_Frame_Ins	INS	-	-	GGC			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr10:74451957_74451958insGGC	ENST00000373053.3	+	1	69_70	c.48_49insGGC	c.(49-51)ggc>GGCggc	p.17_17G>GG	MCU_ENST00000536019.1_5'Flank|MCU_ENST00000357157.6_In_Frame_Ins_p.17_17G>GG	NM_138357.2	NP_612366.1	Q8NE86	MCU_HUMAN	mitochondrial calcium uniporter	17					calcium ion transmembrane import into mitochondrion (GO:0036444)|calcium-mediated signaling (GO:0019722)|glucose homeostasis (GO:0042593)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein complex oligomerization (GO:0035786)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|uniplex complex (GO:1990246)	calcium channel activity (GO:0005262)|uniporter activity (GO:0015292)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(1)	14						TCTCCTCTCGGggcggcggcgg	0.767																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			BC034235	CCDS7317.1, CCDS59218.1, CCDS59219.1	10q22.2	2011-06-23	2011-06-23	2011-06-23	ENSG00000156026	ENSG00000156026			23526	protein-coding gene	gene with protein product		614197	"""coiled-coil domain containing 109A"""	C10orf42, CCDC109A		21685886, 21685888	Standard	NM_138357		Approved	FLJ46135	uc001jtc.3	Q8NE86	OTTHUMG00000018443	ENST00000373053.3:c.58_60dupGGC	10.37:g.74451964_74451966dupGGC	ENSP00000362144:p.Gly22dup		B2RDF3|B3KXV7|Q96FL3	In_Frame_Ins	INS	pfam_Coiled-coil-dom_prot_109_C	p.20in_frame_insG	ENST00000373053.3	37	c.48_49	CCDS7317.1	10																																																																																			MCU	-	NULL	ENSG00000156026		0.767	MCU-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCU	HGNC	protein_coding	OTTHUMT00000048594.1	8	0.00	0	-	NM_138357		74451957	74451958	+1	no_errors	ENST00000373053	ensembl	human	known	69_37n	in_frame_ins	11	35.29	6	INS	1.000:0.997	GGC
MLLT4	4301	genome.wustl.edu	37	6	168363149	168363149	+	Missense_Mutation	SNP	G	G	C			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr6:168363149G>C	ENST00000447894.2	+	30	4849	c.4849G>C	c.(4849-4851)Gaa>Caa	p.E1617Q	MLLT4_ENST00000344191.4_Missense_Mutation_p.E1629Q|MLLT4_ENST00000366806.2_Missense_Mutation_p.E1617Q|MLLT4_ENST00000400822.3_Missense_Mutation_p.E1627Q|MLLT4_ENST00000392108.3_Missense_Mutation_p.E1615Q|MLLT4_ENST00000351017.4_Missense_Mutation_p.E1624Q|MLLT4_ENST00000392112.1_Missense_Mutation_p.E1600Q			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1617					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GCAGCAGTTAGAAGAGATGCG	0.557			T	MLL	AL																																	dbGAP		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													59.0	75.0	70.0					6																	168363149		2050	4192	6242	-	-	-	SO:0001583	missense	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.4849G>C	6.37:g.168363149G>C	ENSP00000404595:p.Glu1617Gln		O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.E1617Q	ENST00000447894.2	37	c.4849		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.0|27.0	4.794783|4.794783	0.90453|0.90453	.|.	.|.	ENSG00000130396|ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894|ENST00000507704;ENST00000476946	T;T;T;T;T;T;T|.	0.71934|.	3.69;0.75;3.47;0.75;0.75;-0.61;0.75|.	4.37|4.37	4.37|4.37	0.52481|0.52481	.|.	0.407546|.	0.23712|.	N|.	0.045312|.	T|.	0.67924|.	0.2945|.	M|M	0.70595|0.70595	2.14|2.14	0.53005|0.53005	D|D	0.999965|0.999965	D;D;P|.	0.71674|.	0.997;0.998;0.906|.	D;D;P|.	0.80764|.	0.986;0.994;0.602|.	T|.	0.69022|.	-0.5255|.	10|.	0.59425|.	D|.	0.04|.	-0.1143|-0.1143	17.2812|17.2812	0.87129|0.87129	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1617;1627;1615|.	P55196;P55196-5;P55196-6|.	AFAD_HUMAN;.;.|.	Q|Y	1629;1624;1615;1617;1600;1629;1627;1617|105;92	ENSP00000341118:E1629Q;ENSP00000252692:E1624Q;ENSP00000375956:E1615Q;ENSP00000355771:E1617Q;ENSP00000375960:E1600Q;ENSP00000383623:E1627Q;ENSP00000404595:E1617Q|.	ENSP00000345834:E1629Q|.	E|X	+|+	1|3	0|2	MLLT4|MLLT4	168105998|168105998	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.959000|0.959000	0.62525|0.62525	6.549000|6.549000	0.73900|0.73900	2.134000|2.134000	0.65973|0.65973	0.591000|0.591000	0.81541|0.81541	GAA|TAG	MLLT4	-	NULL	ENSG00000130396		0.557	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	79	0.00	0	G	NM_005936		168363149	168363149	+1	no_errors	ENST00000366806	ensembl	human	known	69_37n	missense	93	12.26	13	SNP	1.000	C
MOSPD1	56180	genome.wustl.edu	37	X	134033520	134033520	+	5'UTR	SNP	G	G	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chrX:134033520G>T	ENST00000370783.3	-	0	130				MOSPD1_ENST00000370777.1_5'UTR|MOSPD1_ENST00000491609.1_5'UTR|MOSPD1_ENST00000370779.4_5'UTR	NM_019556.1	NP_062456.1	Q9UJG1	MSPD1_HUMAN	motile sperm domain containing 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	9	Acute lymphoblastic leukemia(192;0.000127)					ATCTATTTTGGACTTTTCTTA	0.353																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			Z83826	CCDS14645.1	Xq26.3	2008-02-05			ENSG00000101928	ENSG00000101928			25235	protein-coding gene	gene with protein product		300674				15533722	Standard	XM_005262446		Approved	dJ473B4	uc004eyb.3	Q9UJG1	OTTHUMG00000035315	ENST00000370783.3:c.-57C>A	X.37:g.134033520G>T			B2RE62|D3DTG5|Q5H9C5|Q5H9C7	RNA	SNP	-	NULL	ENST00000370783.3	37	NULL	CCDS14645.1	X																																																																																			MOSPD1	-	-	ENSG00000101928		0.353	MOSPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MOSPD1	HGNC	protein_coding	OTTHUMT00000085439.1	64	0.00	0	G	NM_019556		134033520	134033520	-1	no_errors	ENST00000462060	ensembl	human	known	69_37n	rna	77	14.44	13	SNP	0.726	T
MSX2	4488	genome.wustl.edu	37	5	174156477	174156477	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr5:174156477C>T	ENST00000239243.6	+	2	822	c.695C>T	c.(694-696)gCa>gTa	p.A232V		NM_002449.4	NP_002440.2	P35548	MSX2_HUMAN	msh homeobox 2	232					activation of meiosis (GO:0090427)|anagen (GO:0042640)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone trabecula formation (GO:0060346)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte development (GO:0002063)|cranial suture morphogenesis (GO:0060363)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|enamel mineralization (GO:0070166)|endochondral bone growth (GO:0003416)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|frontal suture morphogenesis (GO:0060364)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of catagen (GO:0051795)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of osteoblast differentiation (GO:0045669)|signal transduction involved in regulation of gene expression (GO:0023019)|wound healing, spreading of epidermal cells (GO:0035313)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCCCTGCAGGCAGCGTCCATA	0.562																																						dbGAP											0													65.0	64.0	64.0					5																	174156477		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26145	CCDS4392.1	5q35.2	2011-06-20	2006-11-21		ENSG00000120149	ENSG00000120149		"""Homeoboxes / ANTP class : NKL subclass"""	7392	protein-coding gene	gene with protein product	"""craniosynostosis, type 2"""	123101	"""msh (Drosophila) homeo box homolog 2"", ""parietal foramina 1"", ""msh homeobox homolog 2 (Drosophila)"""	PFM1		8668339, 8786091	Standard	XM_006714868		Approved	CRS2, FPP, HOX8, MSH, PFM	uc003mcy.3	P35548	OTTHUMG00000130556	ENST00000239243.6:c.695C>T	5.37:g.174156477C>T	ENSP00000239243:p.Ala232Val		D3DQN1|Q53XM4|Q9UD60	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.A232V	ENST00000239243.6	37	c.695	CCDS4392.1	5	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346633	0.61073	.	.	ENSG00000120149	ENST00000239243	D	0.91792	-2.91	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.91891	0.7433	L	0.58428	1.81	0.80722	D	1	D	0.53151	0.958	P	0.45138	0.471	D	0.91231	0.5014	10	0.40728	T	0.16	-9.7264	19.843	0.96697	0.0:1.0:0.0:0.0	.	232	P35548	MSX2_HUMAN	V	232	ENSP00000239243:A232V	ENSP00000239243:A232V	A	+	2	0	MSX2	174089083	1.000000	0.71417	0.928000	0.36995	0.646000	0.38490	5.774000	0.68906	2.679000	0.91253	0.655000	0.94253	GCA	MSX2	-	NULL	ENSG00000120149		0.562	MSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSX2	HGNC	protein_coding	OTTHUMT00000252981.3	65	0.00	0	C			174156477	174156477	+1	no_errors	ENST00000239243	ensembl	human	known	69_37n	missense	26	45.83	22	SNP	0.996	T
MUS81	80198	genome.wustl.edu	37	11	65633368	65633368	+	Intron	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr11:65633368G>A	ENST00000308110.4	+	15	1938				EFEMP2_ENST00000532648.1_5'Flank|MUS81_ENST00000533035.1_Intron|MUS81_ENST00000525006.1_Intron	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit						DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		CTACAGAGGTGAGGGCAAGAG	0.652								Homologous recombination																														dbGAP											0													85.0	88.0	87.0					11																	65633368		2201	4296	6497	-	-	-	SO:0001627	intron_variant	0				CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.1589+3G>A	11.37:g.65633368G>A			Q9H7D9	Silent	SNP	NULL	p.*64	ENST00000308110.4	37	c.191	CCDS8115.1	11																																																																																			MUS81	-	NULL	ENSG00000172732		0.652	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUS81	HGNC	protein_coding	OTTHUMT00000390941.3	66	0.00	0	G	NM_025128		65633368	65633368	+1	no_start_codon	ENST00000529742	ensembl	human	putative	69_37n	silent	46	25.40	16	SNP	1.000	A
NBPF1	55672	genome.wustl.edu	37	1	16901044	16901044	+	Missense_Mutation	SNP	T	T	G			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr1:16901044T>G	ENST00000430580.2	-	21	3223	c.2336A>C	c.(2335-2337)gAc>gCc	p.D779A	NBPF1_ENST00000420031.2_5'UTR|NBPF1_ENST00000287968.8_Missense_Mutation_p.D144A|NBPF1_ENST00000432949.1_Missense_Mutation_p.D237A	NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	779	NBPF 3. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GAGAGTTGAGTCGACTTTGTC	0.453																																						dbGAP											0													2.0	3.0	3.0					1																	16901044		962	1808	2770	-	-	-	SO:0001583	missense	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2336A>C	1.37:g.16901044T>G	ENSP00000474456:p.Asp779Ala		Q8N4E8|Q9C0H0	RNA	SNP	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.453	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	237	0.00	0	T	NM_017940		16901044	16901044	-1	no_errors	ENST00000287968	ensembl	human	known	69_37n	rna	144	12.05	20	SNP	0.000	G
NLRX1	79671	genome.wustl.edu	37	11	119043620	119043620	+	Missense_Mutation	SNP	C	C	T	rs544880461		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr11:119043620C>T	ENST00000409109.1	+	4	738	c.151C>T	c.(151-153)Cgc>Tgc	p.R51C	NLRX1_ENST00000474751.2_3'UTR|NLRX1_ENST00000525863.1_Missense_Mutation_p.R51C|NLRX1_ENST00000409265.4_Missense_Mutation_p.R51C|NLRX1_ENST00000292199.2_Missense_Mutation_p.R51C|NLRX1_ENST00000409991.1_Missense_Mutation_p.R51C	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	51					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGCCTTTATACGCCACCACGG	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16742	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													75.0	71.0	72.0					11																	119043620		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.151C>T	11.37:g.119043620C>T	ENSP00000387334:p.Arg51Cys		A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.R51C	ENST00000409109.1	37	c.151	CCDS8416.1	11	.	.	.	.	.	.	.	.	.	.	C	14.25	2.480777	0.44044	.	.	ENSG00000160703	ENST00000454811;ENST00000449394;ENST00000422249;ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T;T;T;T	0.74209	1.04;1.05;1.06;-0.7;-0.7;-0.82;-0.7;-0.82	5.4	3.37	0.38596	.	0.235943	0.28442	N	0.015329	T	0.75481	0.3855	L	0.29908	0.895	0.09310	N	1	D;D	0.89917	1.0;0.999	D;P	0.63703	0.917;0.745	T	0.66806	-0.5830	10	0.72032	D	0.01	.	11.2498	0.49020	0.3267:0.6733:0.0:0.0	.	51;51	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	C	51	ENSP00000400268:R51C;ENSP00000402801:R51C;ENSP00000402381:R51C;ENSP00000386851:R51C;ENSP00000292199:R51C;ENSP00000386858:R51C;ENSP00000387334:R51C;ENSP00000433442:R51C	ENSP00000292199:R51C	R	+	1	0	NLRX1	118548830	0.059000	0.20769	0.029000	0.17559	0.075000	0.17131	1.487000	0.35540	1.367000	0.46095	0.591000	0.81541	CGC	NLRX1	-	NULL	ENSG00000160703		0.607	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NLRX1	HGNC	protein_coding	OTTHUMT00000335403.1	32	0.00	0	C	NM_170722		119043620	119043620	+1	no_errors	ENST00000292199	ensembl	human	known	69_37n	missense	26	25.71	9	SNP	0.061	T
NTN5	126147	genome.wustl.edu	37	19	49164994	49164996	+	In_Frame_Del	DEL	CTC	CTC	-	rs570196205	byFrequency	TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr19:49164994_49164996delCTC	ENST00000270235.4	-	7	1503_1505	c.1408_1410delGAG	c.(1408-1410)gagdel	p.E470del	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	470	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.					extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CTCCGGCGCGCTCCTCCTGCTGC	0.724														6	0.00119808	0.0045	0.0	5008	,	,		8925	0.0		0.0	False		,,,				2504	0.0					dbGAP											0										10,2970		2,6,1482						4.2	0.9			6	4,6168		0,4,3082	no	coding	NTN5	NM_145807.1		2,10,4564	A1A1,A1R,RR		0.0648,0.3356,0.153				14,9138				-	-	-	SO:0001651	inframe_deletion	0				CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1408_1410delGAG	19.37:g.49164997_49164999delCTC	ENSP00000270235:p.Glu470del		Q8N4X9|Q8WU63	In_Frame_Del	DEL	pfam_Netrin_module_non-TIMP,pfam_EGF_laminin,superfamily_TIMP-like_OB-fold,smart_EGF_laminin,smart_Netrin_module_non-TIMP,pfscan_EGF_laminin,pfscan_Netrin_domain	p.E470in_frame_del	ENST00000270235.4	37	c.1410_1408	CCDS33068.1	19																																																																																			NTN5	-	superfamily_TIMP-like_OB-fold,pfscan_Netrin_domain	ENSG00000142233		0.724	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN5	HGNC	protein_coding	OTTHUMT00000466176.1	9	0.00	0	CTC	NM_145807		49164994	49164996	-1	no_errors	ENST00000270235	ensembl	human	known	69_37n	in_frame_del	2	66.67	4	DEL	0.961:1.000:1.000	-
OAS2	4939	genome.wustl.edu	37	12	113425098	113425098	+	Missense_Mutation	SNP	G	G	A	rs568482198		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr12:113425098G>A	ENST00000342315.4	+	2	647	c.433G>A	c.(433-435)Gcc>Acc	p.A145T	OAS2_ENST00000449768.2_Missense_Mutation_p.A145T|OAS2_ENST00000392583.2_Missense_Mutation_p.A145T|RP1-71H24.1_ENST00000552784.1_RNA	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	145	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GGTGCTGGCCGCCTTCAACGC	0.498																																					Pancreas(199;709 2232 18410 33584 35052)	dbGAP											0													51.0	54.0	53.0					12																	113425098		2203	4300	6503	-	-	-	SO:0001583	missense	0			M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.433G>A	12.37:g.113425098G>A	ENSP00000342278:p.Ala145Thr		A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.A145T	ENST00000342315.4	37	c.433	CCDS31906.1	12	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807327	0.50421	.	.	ENSG00000111335	ENST00000342315;ENST00000392583;ENST00000449768	T;T;T	0.18657	2.2;2.2;2.2	3.13	3.13	0.36017	.	.	.	.	.	T	0.27663	0.0680	M	0.80982	2.52	0.25966	N	0.982566	P;P;P	0.51351	0.926;0.944;0.58	B;B;B	0.41988	0.264;0.372;0.077	T	0.24119	-1.0169	9	0.56958	D	0.05	-13.3987	10.0017	0.41933	0.0:0.0:1.0:0.0	.	145;145;145	P29728;P29728-2;Q6PJ33	OAS2_HUMAN;.;.	T	145	ENSP00000342278:A145T;ENSP00000376362:A145T;ENSP00000411763:A145T	ENSP00000342278:A145T	A	+	1	0	OAS2	111909481	0.167000	0.22975	0.768000	0.31515	0.051000	0.14879	1.121000	0.31283	2.054000	0.61138	0.655000	0.94253	GCC	OAS2	-	NULL	ENSG00000111335		0.498	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OAS2	HGNC	protein_coding	OTTHUMT00000405937.1	23	0.00	0	G			113425098	113425098	+1	no_errors	ENST00000342315	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.871	A
TENM3	55714	genome.wustl.edu	37	4	183720880	183720880	+	Silent	SNP	C	C	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr4:183720880C>A	ENST00000511685.1	+	28	7599	c.7476C>A	c.(7474-7476)gtC>gtA	p.V2492V	TENM3_ENST00000406950.2_Silent_p.V2492V			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2492					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCGCCACGGTCAAGTCGCTGA	0.692																																						dbGAP											0													11.0	14.0	13.0					4																	183720880		2159	4201	6360	-	-	-	SO:0001819	synonymous_variant	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.7476C>A	4.37:g.183720880C>A			Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c_dom,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.V2492	ENST00000511685.1	37	c.7476	CCDS47165.1	4																																																																																			ODZ3	-	NULL	ENSG00000218336		0.692	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	HGNC	protein_coding	OTTHUMT00000361734.1	26	0.00	0	C			183720880	183720880	+1	no_errors	ENST00000406950	ensembl	human	known	69_37n	silent	16	27.27	6	SNP	0.997	A
OGFRL1	79627	genome.wustl.edu	37	6	72011241	72011241	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr6:72011241A>G	ENST00000370435.4	+	7	979	c.845A>G	c.(844-846)tAt>tGt	p.Y282C	RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000450998.1_RNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000587036.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	282						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						GCTCTAGAGTATTTTGTTTAT	0.393																																						dbGAP											0													67.0	76.0	73.0					6																	72011241		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.845A>G	6.37:g.72011241A>G	ENSP00000359464:p.Tyr282Cys		Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	pfam_OGF_rcpt	p.Y282C	ENST00000370435.4	37	c.845	CCDS34482.1	6	.	.	.	.	.	.	.	.	.	.	A	18.40	3.614686	0.66672	.	.	ENSG00000119900	ENST00000370435	T	0.65178	-0.14	6.04	6.04	0.98038	Opioid growth factor receptor (OGFr) conserved domain (1);	0.056719	0.64402	D	0.000001	T	0.75428	0.3848	M	0.76170	2.325	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.79042	-0.1965	10	0.87932	D	0	-20.2427	16.5885	0.84745	1.0:0.0:0.0:0.0	.	282	Q5TC84	OGRL1_HUMAN	C	282	ENSP00000359464:Y282C	ENSP00000359464:Y282C	Y	+	2	0	OGFRL1	72067962	1.000000	0.71417	1.000000	0.80357	0.410000	0.31052	9.339000	0.96797	2.317000	0.78254	0.460000	0.39030	TAT	OGFRL1	-	pfam_OGF_rcpt	ENSG00000119900		0.393	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFRL1	HGNC	protein_coding	OTTHUMT00000041153.2	58	0.00	0	A	NM_024576		72011241	72011241	+1	no_errors	ENST00000370435	ensembl	human	known	69_37n	missense	84	14.29	14	SNP	1.000	G
OR2Y1	134083	genome.wustl.edu	37	5	180166345	180166345	+	Silent	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr5:180166345C>T	ENST00000307832.2	-	1	754	c.714G>A	c.(712-714)ggG>ggA	p.G238G		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACCCACAAGTCCCAAAAGCCT	0.488																																						dbGAP											0													114.0	122.0	119.0					5																	180166345		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.714G>A	5.37:g.180166345C>T			B9EIP1|Q6IFB1|Q96R16	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G238	ENST00000307832.2	37	c.714	CCDS34323.1	5																																																																																			OR2Y1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000174339		0.488	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Y1	HGNC	protein_coding	OTTHUMT00000368059.2	25	0.00	0	C	XM_068682		180166345	180166345	-1	no_errors	ENST00000307832	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	0.039	T
OR52A5	390054	genome.wustl.edu	37	11	5153189	5153189	+	Silent	SNP	G	G	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr11:5153189G>T	ENST00000307388.1	-	1	683	c.684C>A	c.(682-684)gtC>gtA	p.V228V		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	228					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		GCAGCTGAAAGACAGTGATAA	0.408																																						dbGAP											0													90.0	84.0	86.0					11																	5153189		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.684C>A	11.37:g.5153189G>T				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V228	ENST00000307388.1	37	c.684	CCDS31373.1	11																																																																																			OR52A5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171944		0.408	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52A5	HGNC	protein_coding	OTTHUMT00000142823.1	26	0.00	0	G	NM_001005160		5153189	5153189	-1	no_errors	ENST00000307388	ensembl	human	known	69_37n	silent	23	20.69	6	SNP	0.000	T
PALLD	23022	genome.wustl.edu	37	4	169611772	169611772	+	Missense_Mutation	SNP	G	G	A	rs187404166		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr4:169611772G>A	ENST00000505667.1	+	7	1527	c.1354G>A	c.(1354-1356)Gtg>Atg	p.V452M	PALLD_ENST00000335742.7_Missense_Mutation_p.V70M|PALLD_ENST00000512127.1_Missense_Mutation_p.V70M|PALLD_ENST00000261509.6_Missense_Mutation_p.V452M|PALLD_ENST00000333488.4_Missense_Mutation_p.V329M			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	452	Ig-like C2-type 2.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		AAACACAGCCGTGGCGGAAGG	0.502									Pancreatic Cancer, Familial Clustering of				G|||	1	0.000199681	0.0	0.0	5008	,	,		17242	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(109;1482 1532 18347 40239 51172)	dbGAP											0													82.0	96.0	92.0					4																	169611772		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1354G>A	4.37:g.169611772G>A	ENSP00000425556:p.Val452Met		B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V452M	ENST00000505667.1	37	c.1354	CCDS54818.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	17.94	3.511930	0.64522	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000508898;ENST00000333488;ENST00000504519;ENST00000512127;ENST00000513245;ENST00000503457	T;T;T;T;T;T;T;T	0.75050	-0.63;-0.63;-0.63;-0.63;-0.63;-0.9;-0.63;-0.63	5.87	4.16	0.48862	.	0.266451	0.19408	U	0.115018	D	0.86952	0.6057	M	0.91872	3.25	0.19775	N	0.99996	D;P;P	0.71674	0.998;0.702;0.81	P;B;P	0.61592	0.891;0.193;0.505	T	0.80446	-0.1379	10	0.72032	D	0.01	.	12.7672	0.57399	0.1328:0.0:0.8672:0.0	.	452;70;452	B7ZMM5;B3KTG2;B2RTX2	.;.;.	M	452;70;452;431;329;70;70;70;70	ENSP00000261509:V452M;ENSP00000336735:V70M;ENSP00000425556:V452M;ENSP00000423063:V431M;ENSP00000328945:V329M;ENSP00000424121:V70M;ENSP00000426947:V70M;ENSP00000424288:V70M	ENSP00000261509:V452M	V	+	1	0	PALLD	169848347	1.000000	0.71417	0.002000	0.10522	0.001000	0.01503	7.364000	0.79526	0.828000	0.34709	0.650000	0.86243	GTG	PALLD	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000129116		0.502	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PALLD	HGNC	protein_coding	OTTHUMT00000363762.1	59	0.00	0	G	NM_016081		169611772	169611772	+1	no_errors	ENST00000261509	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.692	A
PLEKHA6	22874	genome.wustl.edu	37	1	204199663	204199663	+	Missense_Mutation	SNP	C	C	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr1:204199663C>A	ENST00000272203.3	-	18	2777	c.2461G>T	c.(2461-2463)Gtg>Ttg	p.V821L	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.V841L	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	821										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TGCTCCTCCACGCTCATCTTG	0.647																																						dbGAP											0													41.0	33.0	36.0					1																	204199663		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2461G>T	1.37:g.204199663C>A	ENSP00000272203:p.Val821Leu		A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V821L	ENST00000272203.3	37	c.2461	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275936	0.59649	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.15834	2.39;2.85	5.24	4.26	0.50523	.	0.065728	0.64402	D	0.000014	T	0.20047	0.0482	M	0.67953	2.075	0.48040	D	0.999576	P	0.35192	0.489	B	0.30029	0.11	T	0.08269	-1.0730	10	0.72032	D	0.01	-22.9466	14.9093	0.70743	0.0:0.8561:0.1439:0.0	.	821	Q9Y2H5	PKHA6_HUMAN	L	821;841	ENSP00000272203:V821L;ENSP00000402046:V841L	ENSP00000272203:V821L	V	-	1	0	PLEKHA6	202466286	0.999000	0.42202	0.998000	0.56505	0.492000	0.33523	4.191000	0.58372	2.435000	0.82474	0.462000	0.41574	GTG	PLEKHA6	-	NULL	ENSG00000143850		0.647	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	58	0.00	0	C	NM_014935		204199663	204199663	-1	no_errors	ENST00000272203	ensembl	human	known	69_37n	missense	56	47.66	51	SNP	0.998	A
PLEKHF1	79156	genome.wustl.edu	37	19	30165101	30165101	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr19:30165101C>T	ENST00000436066.3	+	2	821	c.355C>T	c.(355-357)Cgc>Tgc	p.R119C	PLEKHF1_ENST00000592810.1_Missense_Mutation_p.R119C	NM_024310.4	NP_077286.3	Q96S99	PKHF1_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 1	119	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic process (GO:0006915)|endosome organization (GO:0007032)|positive regulation of autophagy (GO:0010508)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein localization to plasma membrane (GO:0072659)|vesicle organization (GO:0016050)	endosome membrane (GO:0010008)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(1)|lung(3)|ovary(1)|prostate(1)	6	Ovarian(5;0.000567)|Breast(6;0.0602)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0623)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.225)			CGCTACGGAGCGCCAGGAATG	0.667																																						dbGAP											0													39.0	39.0	39.0					19																	30165101		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF434818	CCDS12417.1	19q11	2013-01-10				ENSG00000166289		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20764	protein-coding gene	gene with protein product		615200					Standard	NM_024310		Approved	APPD, MGC4090, PHAFIN1, ZFYVE15	uc002nsh.4	Q96S99		ENST00000436066.3:c.355C>T	19.37:g.30165101C>T	ENSP00000389787:p.Arg119Cys		Q96K11|Q9BUB9	Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Pleckstrin_homology,superfamily_Znf_FYVE_PHD,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel	p.R119C	ENST00000436066.3	37	c.355	CCDS12417.1	19	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775413	0.70107	.	.	ENSG00000166289	ENST00000436066	T	0.78003	-1.14	5.32	3.18	0.36537	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.094804	0.64402	N	0.000002	D	0.85720	0.5762	M	0.81682	2.555	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.985	D	0.84525	0.0630	10	0.87932	D	0	0.0685	7.312	0.26479	0.4152:0.505:0.0:0.0798	.	204;119	B4DWN9;Q96S99	.;PKHF1_HUMAN	C	119	ENSP00000389787:R119C	ENSP00000389787:R119C	R	+	1	0	PLEKHF1	34856941	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	3.615000	0.54167	0.620000	0.30215	0.561000	0.74099	CGC	PLEKHF1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000166289		0.667	PLEKHF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHF1	HGNC	protein_coding	OTTHUMT00000459323.1	54	0.00	0	C	NM_024310		30165101	30165101	+1	no_errors	ENST00000436066	ensembl	human	known	69_37n	missense	55	23.61	17	SNP	1.000	T
PNISR	25957	genome.wustl.edu	37	6	99848141	99848141	+	3'UTR	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr6:99848141C>T	ENST00000369239.5	-	0	2897				PNISR_ENST00000438806.1_3'UTR	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein							cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TCATGGCATTCTTGCCACATC	0.338																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.*275G>A	6.37:g.99848141C>T			A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	RNA	SNP	-	NULL	ENST00000369239.5	37	NULL	CCDS5043.1	6																																																																																			PNISR	-	-	ENSG00000132424		0.338	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1	40	0.00	0	C	NM_032870		99848141	99848141	-1	no_errors	ENST00000481229	ensembl	human	known	69_37n	rna	80	10.11	9	SNP	0.999	T
RBM3	5935	genome.wustl.edu	37	X	48434060	48434060	+	Intron	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chrX:48434060G>A	ENST00000376759.3	+	3	273				RBM3_ENST00000430348.2_5'UTR|RBM3_ENST00000354480.2_5'Flank|RBM3_ENST00000376755.1_Intron|AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000466764.1_Intron	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3						positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						GGAGAGGTGGGGCCTCCTATC	0.572																																						dbGAP											0													56.0	47.0	50.0					X																	48434060		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.210+5G>A	X.37:g.48434060G>A				RNA	SNP	-	NULL	ENST00000376759.3	37	NULL	CCDS14301.1	X																																																																																			RBM3	-	-	ENSG00000102317		0.572	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM3	HGNC	protein_coding	OTTHUMT00000060755.1	66	0.00	0	G	NM_006743		48434060	48434060	+1	no_errors	ENST00000485213	ensembl	human	known	69_37n	rna	79	22.55	23	SNP	0.995	A
SALL1	6299	genome.wustl.edu	37	16	51173053	51173053	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr16:51173053C>T	ENST00000251020.4	-	2	3113	c.3080G>A	c.(3079-3081)aGa>aAa	p.R1027K	SALL1_ENST00000440970.1_Missense_Mutation_p.R930K|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1027					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AATAAATGGTCTCTCTTTGGT	0.428																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													90.0	88.0	89.0					16																	51173053		2198	4300	6498	-	-	-	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3080G>A	16.37:g.51173053C>T	ENSP00000251020:p.Arg1027Lys		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1027K	ENST00000251020.4	37	c.3080	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	C	13.11	2.137916	0.37728	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.12361	2.69;2.69	5.83	5.83	0.93111	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.18341	0.0440	N	0.12961	0.28	0.80722	D	1	D	0.60160	0.987	D	0.64321	0.924	T	0.01748	-1.1282	10	0.02654	T	1	-16.6376	20.1337	0.98010	0.0:1.0:0.0:0.0	.	1027	Q9NSC2	SALL1_HUMAN	K	1027;930;991	ENSP00000251020:R1027K;ENSP00000407914:R930K	ENSP00000251020:R1027K	R	-	2	0	SALL1	49730554	1.000000	0.71417	0.999000	0.59377	0.186000	0.23388	7.818000	0.86416	2.753000	0.94483	0.650000	0.86243	AGA	SALL1	-	pfscan_Znf_C2H2	ENSG00000103449		0.428	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	35	0.00	0	C	NM_002968		51173053	51173053	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	1.000	T
SEL1L3	23231	genome.wustl.edu	37	4	25750062	25750062	+	Silent	SNP	C	C	T	rs535461601		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr4:25750062C>T	ENST00000399878.3	-	24	3506	c.3384G>A	c.(3382-3384)ccG>ccA	p.P1128P	SEL1L3_ENST00000502949.1_Silent_p.P975P|SEL1L3_ENST00000264868.5_Silent_p.P1093P	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	1128						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						CACGTGGCTCCGGGTTATTAG	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		18623	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													56.0	56.0	56.0					4																	25750062		2069	4235	6304	-	-	-	SO:0001819	synonymous_variant	0			BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.3384G>A	4.37:g.25750062C>T			A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Silent	SNP	pfam_Sel1-like,superfamily_ConA-like_lec_gl,smart_Sel1-like	p.P1128	ENST00000399878.3	37	c.3384	CCDS47037.1	4																																																																																			SEL1L3	-	NULL	ENSG00000091490		0.562	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L3	HGNC	protein_coding	OTTHUMT00000360261.1	73	0.00	0	C	NM_015187		25750062	25750062	-1	no_errors	ENST00000399878	ensembl	human	known	69_37n	silent	31	56.34	40	SNP	0.001	T
SEZ6	124925	genome.wustl.edu	37	17	27296881	27296881	+	Missense_Mutation	SNP	G	G	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr17:27296881G>T	ENST00000317338.12	-	4	1376	c.948C>A	c.(946-948)ttC>ttA	p.F316L	PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000335960.6_Missense_Mutation_p.F316L|SEZ6_ENST00000442608.3_Missense_Mutation_p.F316L|SEZ6_ENST00000360295.9_Missense_Mutation_p.F316L			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	316					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			CCCGCAGCAGGAAAGACTGGT	0.647																																						dbGAP											0													25.0	32.0	29.0					17																	27296881		1885	4098	5983	-	-	-	SO:0001583	missense	0			AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.948C>A	17.37:g.27296881G>T	ENSP00000312942:p.Phe316Leu		B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.F316L	ENST00000317338.12	37	c.948	CCDS45639.1	17	.	.	.	.	.	.	.	.	.	.	G	6.261	0.416280	0.11870	.	.	ENSG00000063015	ENST00000442608;ENST00000360295;ENST00000317338;ENST00000335960;ENST00000541381	T;T;T	0.50001	0.76;0.76;0.76	5.44	4.41	0.53225	CUB (2);	0.131591	0.50627	D	0.000107	T	0.21022	0.0506	N	0.10733	0.035	0.26666	N	0.971819	B;B;B	0.29627	0.0;0.252;0.003	B;B;B	0.29785	0.002;0.107;0.005	T	0.26985	-1.0087	10	0.06365	T	0.9	.	6.9737	0.24662	0.0911:0.1768:0.7321:0.0	.	316;316;316	F5GZF9;Q53EL9-3;Q53EL9	.;.;SEZ6_HUMAN	L	316;316;191;316;316	ENSP00000403784:F316L;ENSP00000353440:F316L;ENSP00000337407:F316L	ENSP00000312942:F191L	F	-	3	2	SEZ6	24321007	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.921000	0.28718	2.574000	0.86865	0.555000	0.69702	TTC	SEZ6	-	superfamily_CUB	ENSG00000063015		0.647	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6	HGNC	protein_coding	OTTHUMT00000397475.3	101	0.00	0	G			27296881	27296881	-1	no_errors	ENST00000317338	ensembl	human	known	69_37n	missense	15	80.26	61	SNP	0.998	T
TEAD3	7005	genome.wustl.edu	37	6	35442832	35442832	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr6:35442832C>T	ENST00000402886.3	-	11	1270	c.1117G>A	c.(1117-1119)Gtc>Atc	p.V373I	TEAD3_ENST00000338863.7_Missense_Mutation_p.V433I			Q99594	TEAD3_HUMAN	TEA domain family member 3	433	Transcriptional activation. {ECO:0000255}.				female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						TAGTCTTTGACGAGCTTGTAG	0.602																																						dbGAP											0													37.0	43.0	41.0					6																	35442832		2101	4248	6349	-	-	-	SO:0001583	missense	0			X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.1117G>A	6.37:g.35442832C>T	ENSP00000384577:p.Val373Ile		O95910|Q5BJG7|Q8N6Y4	Missense_Mutation	SNP	pfam_TEA/ATTS,pirsf_TEF	p.V373I	ENST00000402886.3	37	c.1117		6	.	.	.	.	.	.	.	.	.	.	C	11.34	1.608709	0.28623	.	.	ENSG00000007866	ENST00000338863;ENST00000402886;ENST00000373905	T;T	0.60299	0.29;0.2	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	L	0.41079	1.255	0.80722	D	1	B;B;B	0.27997	0.197;0.001;0.042	B;B;B	0.10450	0.005;0.001;0.004	T	0.16837	-1.0389	10	0.23891	T	0.37	-29.4229	17.6446	0.88145	0.0:1.0:0.0:0.0	.	373;449;433	B5MCM0;Q7Z6V0;Q99594	.;.;TEAD3_HUMAN	I	433;373;449	ENSP00000345772:V433I;ENSP00000384577:V373I	ENSP00000345772:V433I	V	-	1	0	TEAD3	35550810	0.981000	0.34729	0.996000	0.52242	0.282000	0.26991	2.557000	0.45871	2.422000	0.82143	0.650000	0.86243	GTC	TEAD3	-	pirsf_TEF	ENSG00000007866		0.602	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	TEAD3	HGNC	protein_coding	OTTHUMT00000316961.2	53	0.00	0	C			35442832	35442832	-1	no_errors	ENST00000402886	ensembl	human	novel	69_37n	missense	95	14.41	16	SNP	1.000	T
TGM6	343641	genome.wustl.edu	37	20	2413157	2413157	+	Silent	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr20:2413157G>A	ENST00000202625.2	+	13	2050	c.1989G>A	c.(1987-1989)caG>caA	p.Q663Q	TGM6_ENST00000381423.1_Missense_Mutation_p.G619R	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	663					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	TGGAGCCTCAGGAGAGGGCCT	0.607																																						dbGAP											0													96.0	81.0	86.0					20																	2413157		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1989G>A	20.37:g.2413157G>A			Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G619R	ENST00000202625.2	37	c.1855	CCDS13025.1	20	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558538	0.65538	.	.	ENSG00000166948	ENST00000381423	D	0.83163	-1.69	4.87	1.8	0.24995	.	.	.	.	.	T	0.69958	0.3169	.	.	.	0.31866	N	0.6203	B	0.11235	0.004	B	0.12156	0.007	T	0.63585	-0.6604	8	0.28530	T	0.3	-18.5181	5.9879	0.19444	0.3311:0.0:0.6689:0.0	.	619	O95932-2	.	R	619	ENSP00000370831:G619R	ENSP00000370831:G619R	G	+	1	0	TGM6	2361157	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	0.680000	0.25306	0.714000	0.32081	0.655000	0.94253	GGA	TGM6	-	NULL	ENSG00000166948		0.607	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	HGNC	protein_coding	OTTHUMT00000077581.2	42	0.00	0	G	NM_198994		2413157	2413157	+1	no_errors	ENST00000381423	ensembl	human	known	69_37n	missense	12	47.83	11	SNP	1.000	A
TMEM100	55273	genome.wustl.edu	37	17	53798216	53798216	+	Silent	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr17:53798216G>A	ENST00000575734.1	-	4	1024	c.216C>T	c.(214-216)acC>acT	p.T72T	TMEM100_ENST00000424486.2_Silent_p.T72T|TMEM100_ENST00000570586.1_5'Flank	NM_001099640.1	NP_001093110.1	Q9NV29	TM100_HUMAN	transmembrane protein 100	72					angiogenesis (GO:0001525)|arterial endothelial cell differentiation (GO:0060842)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of vasculogenesis (GO:2001214)|protein kinase B signaling (GO:0043491)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	11						AAGCCACCGCGGTGACCACGA	0.522																																						dbGAP											0													101.0	97.0	98.0					17																	53798216		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001832	CCDS11587.1	17q23.1	2005-12-16				ENSG00000166292			25607	protein-coding gene	gene with protein product							Standard	NM_018286		Approved	FLJ10970, FLJ37856	uc002iuj.4	Q9NV29		ENST00000575734.1:c.216C>T	17.37:g.53798216G>A			D3DTY7|I3L214|Q96FZ0	Silent	SNP	NULL	p.T72	ENST00000575734.1	37	c.216	CCDS11587.1	17																																																																																			TMEM100	-	NULL	ENSG00000166292		0.522	TMEM100-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM100	HGNC	protein_coding	OTTHUMT00000439266.2	54	0.00	0	G	NM_018286		53798216	53798216	-1	no_errors	ENST00000424486	ensembl	human	known	69_37n	silent	6	88.24	45	SNP	0.181	A
TMEM132C	92293	genome.wustl.edu	37	12	129180413	129180413	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr12:129180413G>A	ENST00000435159.2	+	7	1694	c.1694G>A	c.(1693-1695)cGg>cAg	p.R565Q	TMEM132C_ENST00000537538.1_5'UTR|TMEM132C_ENST00000315208.8_Missense_Mutation_p.R181Q	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	565						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GAGGAGGAGCGGCGGGGCCGG	0.637																																						dbGAP											0													10.0	20.0	17.0					12																	129180413		691	1589	2280	-	-	-	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1694G>A	12.37:g.129180413G>A	ENSP00000410852:p.Arg565Gln		Q69YX8	Missense_Mutation	SNP	NULL	p.R565Q	ENST00000435159.2	37	c.1694		12	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333190	0.41297	.	.	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.50001	0.76;0.76	4.82	3.91	0.45181	.	0.098661	0.41712	N	0.000838	T	0.39937	0.1097	L	0.48986	1.54	0.36892	D	0.889958	B	0.30326	0.276	B	0.27500	0.08	T	0.40289	-0.9571	10	0.28530	T	0.3	.	12.0969	0.53761	0.0851:0.0:0.9149:0.0	.	565	Q8N3T6	T132C_HUMAN	Q	565;181	ENSP00000410852:R565Q;ENSP00000324458:R181Q	ENSP00000324458:R181Q	R	+	2	0	TMEM132C	127746366	1.000000	0.71417	0.900000	0.35374	0.383000	0.30230	4.366000	0.59492	0.981000	0.38548	0.655000	0.94253	CGG	TMEM132C	-	NULL	ENSG00000181234		0.637	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		62	0.00	0	G	XM_044062		129180413	129180413	+1	no_errors	ENST00000435159	ensembl	human	known	69_37n	missense	36	40.98	25	SNP	0.816	A
TNXB	7148	genome.wustl.edu	37	6	32020477	32020477	+	Missense_Mutation	SNP	C	C	T	rs543265032		TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr6:32020477C>T	ENST00000375244.3	-	26	9286	c.9085G>A	c.(9085-9087)Gtg>Atg	p.V3029M	TNXB_ENST00000375247.2_Missense_Mutation_p.V3027M			P22105	TENX_HUMAN	tenascin XB	3074	Fibronectin type-III 22. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.V3105M(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						ACTGGGCCCACGCGCTGCCCC	0.647													c|||	1	0.000199681	0.0	0.0	5008	,	,		14953	0.0		0.0	False		,,,				2504	0.001					dbGAP											1	Substitution - Missense(1)	large_intestine(1)											55.0	62.0	59.0					6																	32020477		1390	2616	4006	-	-	-	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.9085G>A	6.37:g.32020477C>T	ENSP00000364393:p.Val3029Met		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.V3027M	ENST00000375244.3	37	c.9079		6	.	.	.	.	.	.	.	.	.	.	c	11.76	1.735094	0.30774	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.04454	3.62;3.62	4.42	3.55	0.40652	.	0.284575	0.19181	U	0.120664	T	0.03390	0.0098	M	0.76170	2.325	0.23232	N	0.998076	P	0.45283	0.855	B	0.42462	0.388	T	0.31833	-0.9929	10	0.35671	T	0.21	.	11.2008	0.48741	0.0:0.6407:0.3593:0.0	.	3027	P22105-3	.	M	3029;3027	ENSP00000364393:V3029M;ENSP00000364396:V3027M	ENSP00000364393:V3029M	V	-	1	0	TNXB	32128455	0.000000	0.05858	0.714000	0.30535	0.035000	0.12851	-0.170000	0.09897	0.829000	0.34733	-0.218000	0.12543	GTG	TNXB	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.647	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	57	0.00	0	C	NM_019105		32020477	32020477	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	missense	80	20.00	20	SNP	0.725	T
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000420246.2_Missense_Mutation_p.I195T|TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)											100.0	89.0	93.0					17																	7578265		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I195T	ENST00000269305.4	37	c.584	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	45	0.00	0	A	NM_000546		7578265	7578265	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	12	72.09	31	SNP	1.000	G
TXNDC11	51061	genome.wustl.edu	37	16	11782284	11782284	+	Missense_Mutation	SNP	A	A	C			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr16:11782284A>C	ENST00000356957.3	-	10	2106	c.1999T>G	c.(1999-2001)Ttc>Gtc	p.F667V	TXNDC11_ENST00000283033.5_Missense_Mutation_p.F640V|TXNDC11_ENST00000570917.1_5'UTR			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	667	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						AGAACGCTGAAGTTTTGAATA	0.378																																						dbGAP											0													45.0	47.0	46.0					16																	11782284		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.1999T>G	16.37:g.11782284A>C	ENSP00000349439:p.Phe667Val		O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.F667V	ENST00000356957.3	37	c.1999		16	.	.	.	.	.	.	.	.	.	.	A	18.28	3.589255	0.66105	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.21191	2.02;2.02	5.97	5.97	0.96955	Thioredoxin-like fold (1);	0.098588	0.64402	D	0.000001	T	0.20901	0.0503	N	0.25245	0.725	0.58432	D	0.999999	B;B	0.23854	0.092;0.061	B;B	0.34242	0.178;0.022	T	0.06250	-1.0837	10	0.87932	D	0	-23.2994	15.6112	0.76721	1.0:0.0:0.0:0.0	.	667;640	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	V	667;640	ENSP00000349439:F667V;ENSP00000283033:F640V	ENSP00000283033:F640V	F	-	1	0	TXNDC11	11689785	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.330000	0.90019	2.283000	0.76528	0.533000	0.62120	TTC	TXNDC11	-	NULL	ENSG00000153066		0.378	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC11	HGNC	protein_coding	OTTHUMT00000437057.1	29	0.00	0	A	NM_015914		11782284	11782284	-1	no_errors	ENST00000356957	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	1.000	C
USP32P2	220594	genome.wustl.edu	37	17	18415379	18415382	+	RNA	DEL	TATT	TATT	-	rs547797129	byFrequency	TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	TATT	TATT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr17:18415379_18415382delTATT	ENST00000425211.1	-	0	3887_3890				USP32P2_ENST00000412260.1_RNA																							CAGTCTTGAATATTTAGAGGAAAA	0.221																																						dbGAP											0																																										-	-	-			0																															17.37:g.18415379_18415382delTATT				RNA	DEL	-	NULL	ENST00000425211.1	37	NULL		17																																																																																			USP32P2	-	-	ENSG00000233327		0.221	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	USP32P2	HGNC	processed_transcript	OTTHUMT00000473021.1	29	0.00	0	TATT			18415379	18415382	-1	no_errors	ENST00000412260	ensembl	human	known	69_37n	rna	14	22.22	4	DEL	0.702:0.636:0.550:0.518	-
WDFY4	57705	genome.wustl.edu	37	10	49998825	49998825	+	Missense_Mutation	SNP	G	G	A			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr10:49998825G>A	ENST00000325239.5	+	22	4147	c.4120G>A	c.(4120-4122)Ggg>Agg	p.G1374R	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1374						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTTCATTGGCGGGCCTGCCAT	0.542																																						dbGAP											0													83.0	71.0	75.0					10																	49998825		692	1591	2283	-	-	-	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.4120G>A	10.37:g.49998825G>A	ENSP00000320563:p.Gly1374Arg		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1374R	ENST00000325239.5	37	c.4120	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.4|23.4	4.415783|4.415783	0.83449|0.83449	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002	D|.	0.95205|.	-3.64|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73885|0.73885	0.3644|0.3644	M|M	0.69523|0.69523	2.12|2.12	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.73490|0.73490	-0.3966|-0.3966	9|5	.|.	.|.	.|.	.|.	16.2117|16.2117	0.82165|0.82165	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1374|.	Q6ZS81|.	WDFY4_HUMAN|.	R|Q	1374|464	ENSP00000320563:G1374R|.	.|.	G|R	+|+	1|2	0|0	WDFY4|WDFY4	49668831|49668831	1.000000|1.000000	0.71417|0.71417	0.380000|0.380000	0.26093|0.26093	0.995000|0.995000	0.86356|0.86356	8.018000|8.018000	0.88722|0.88722	2.567000|2.567000	0.86603|0.86603	0.557000|0.557000	0.71058|0.71058	GGG|CGG	WDFY4	-	NULL	ENSG00000128815		0.542	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		56	0.00	0	G	XM_033379		49998825	49998825	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	missense	73	16.09	14	SNP	0.907	A
ZNF541	84215	genome.wustl.edu	37	19	48058876	48058876	+	Missense_Mutation	SNP	C	C	T			TCGA-AC-A62X-01A-11D-A29N-09	TCGA-AC-A62X-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c16a9047-5cff-4096-902f-de7ceca1c349	495a1629-20ff-41e2-b82f-c7d17da58369	g.chr19:48058876C>T	ENST00000391901.3	-	1	237	c.238G>A	c.(238-240)Ggg>Agg	p.G80R	ZNF541_ENST00000448976.1_Missense_Mutation_p.G80R|ZNF541_ENST00000314121.4_Missense_Mutation_p.G80R			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	80					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						CTGTCCTTCCCGGAGTACAGG	0.592																																						dbGAP											0													64.0	59.0	61.0					19																	48058876		692	1591	2283	-	-	-	SO:0001583	missense	0			AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.238G>A	19.37:g.48058876C>T	ENSP00000375770:p.Gly80Arg		Q8NDK8	Missense_Mutation	SNP	pfam_ELM2_dom,pfam_Znf_C2H2,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.G80R	ENST00000391901.3	37	c.238		19	.	.	.	.	.	.	.	.	.	.	C	21.4	4.149993	0.78001	.	.	ENSG00000118156	ENST00000391901;ENST00000314121;ENST00000448976	T;T;T	0.16073	2.45;2.38;2.37	6.07	6.07	0.98685	.	.	.	.	.	T	0.27663	0.0680	L	0.27053	0.805	0.29876	N	0.826437	D	0.89917	1.0	D	0.69654	0.965	T	0.07790	-1.0754	9	0.62326	D	0.03	-23.8284	11.4725	0.50278	0.0:0.919:0.0:0.081	.	80	Q9H0D2	ZN541_HUMAN	R	80	ENSP00000375770:G80R;ENSP00000313258:G80R;ENSP00000410847:G80R	ENSP00000313258:G80R	G	-	1	0	ZNF541	52750688	0.933000	0.31639	0.972000	0.41901	0.869000	0.49853	2.187000	0.42602	2.884000	0.98904	0.655000	0.94253	GGG	ZNF541	-	NULL	ENSG00000118156		0.592	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF541	HGNC	protein_coding	OTTHUMT00000280415.1	36	0.00	0	C	NM_032255		48058876	48058876	-1	no_errors	ENST00000314121	ensembl	human	known	69_37n	missense	44	35.29	24	SNP	0.972	T
