#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABR	29	genome.wustl.edu	37	17	953786	953786	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr17:953786C>A	ENST00000302538.5	-	15	1796	c.1650G>T	c.(1648-1650)aaG>aaT	p.K550N	ABR_ENST00000291107.2_Missense_Mutation_p.K513N|ABR_ENST00000574437.1_Missense_Mutation_p.K504N|ABR_ENST00000536794.2_Missense_Mutation_p.K332N|ABR_ENST00000544583.2_Missense_Mutation_p.K504N	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	550	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CCTCATCCCACTTGGGCTCCG	0.617																																					Esophageal Squamous(197;2016 2115 4129 29033 46447)	dbGAP											0													103.0	92.0	95.0					17																	953786		2203	4300	6503	-	-	-	SO:0001583	missense	0			L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1650G>T	17.37:g.953786C>A	ENSP00000303909:p.Lys550Asn		B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RhoGAP_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.K550N	ENST00000302538.5	37	c.1650	CCDS10999.1	17	.	.	.	.	.	.	.	.	.	.	C	9.083	0.999746	0.19121	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	4.73	-1.93	0.07594	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.351109	0.29396	N	0.012261	T	0.32734	0.0839	N	0.02315	-0.6	0.35439	D	0.794751	B;B;B	0.25609	0.001;0.13;0.0	B;B;B	0.24701	0.008;0.055;0.005	T	0.18745	-1.0327	10	0.15066	T	0.55	.	9.4453	0.38693	0.0:0.5525:0.0:0.4475	.	332;513;550	B7Z683;Q12979-2;Q12979	.;.;ABR_HUMAN	N	550;504;513;332	ENSP00000303909:K550N;ENSP00000442048:K504N;ENSP00000291107:K513N;ENSP00000437429:K332N	ENSP00000291107:K513N	K	-	3	2	ABR	900536	0.595000	0.26857	0.977000	0.42913	0.961000	0.63080	-0.018000	0.12568	-0.516000	0.06470	-0.258000	0.10820	AAG	ABR	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000159842		0.617	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	HGNC	protein_coding	OTTHUMT00000206675.4	76	0.00	0	C			953786	953786	-1	no_errors	ENST00000302538	ensembl	human	known	69_37n	missense	47	34.72	25	SNP	0.996	A
ACTB	60	genome.wustl.edu	37	7	5568037	5568037	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr7:5568037delT	ENST00000331789.5	-	4	868	c.677delA	c.(676-678)gagfs	p.E226fs	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	226					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CGTGGCCATCTCTTGCTCGAA	0.617																																						dbGAP											0													64.0	66.0	65.0					7																	5568037		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.677delA	7.37:g.5568037delT	ENSP00000349960:p.Glu226fs		A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Frame_Shift_Del	DEL	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.E226fs	ENST00000331789.5	37	c.677	CCDS5341.1	7																																																																																			ACTB	-	pfam_Actin-like,smart_Actin-like	ENSG00000075624		0.617	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	HGNC	protein_coding	OTTHUMT00000059589.4	28	0.00	0	T	NM_001101		5568037	5568037	-1	no_errors	ENST00000331789	ensembl	human	known	69_37n	frame_shift_del	38	38.10	24	DEL	1.000	-
ADAMTS16	170690	genome.wustl.edu	37	5	5186343	5186343	+	Silent	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr5:5186343C>T	ENST00000274181.7	+	5	1080	c.942C>T	c.(940-942)taC>taT	p.Y314Y	ADAMTS16_ENST00000511368.1_Silent_p.Y314Y	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	314	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TCACCACCTACGTGCTCACGA	0.478																																						dbGAP											0													91.0	93.0	93.0					5																	5186343		2071	4208	6279	-	-	-	SO:0001819	synonymous_variant	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.942C>T	5.37:g.5186343C>T			C6G490|Q8IVE2	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Y314	ENST00000274181.7	37	c.942	CCDS43299.1	5																																																																																			ADAMTS16	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000145536		0.478	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	35	0.00	0	C	NM_139056		5186343	5186343	+1	no_errors	ENST00000274181	ensembl	human	known	69_37n	silent	41	21.15	11	SNP	0.891	T
AGFG2	3268	genome.wustl.edu	37	7	100151824	100151824	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr7:100151824G>A	ENST00000300176.4	+	5	816	c.694G>A	c.(694-696)Gac>Aac	p.D232N	AGFG2_ENST00000474713.1_3'UTR|AGFG2_ENST00000262935.4_Intron	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	232					regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CATCGGTGGAGACCCCTTTGC	0.587																																						dbGAP											0													90.0	77.0	82.0					7																	100151824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.694G>A	7.37:g.100151824G>A	ENSP00000300176:p.Asp232Asn		O75429|Q96AB9|Q96GL4	Missense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.D232N	ENST00000300176.4	37	c.694	CCDS5697.1	7	.	.	.	.	.	.	.	.	.	.	G	28.1	4.889909	0.91889	.	.	ENSG00000106351	ENST00000300176	T	0.25749	1.78	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.46908	0.1417	M	0.72894	2.215	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.25117	-1.0141	10	0.26408	T	0.33	-24.3361	13.2485	0.60036	0.0:0.0:1.0:0.0	.	232	O95081	AGFG2_HUMAN	N	232	ENSP00000300176:D232N	ENSP00000300176:D232N	D	+	1	0	AGFG2	99989760	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	6.969000	0.76092	2.583000	0.87209	0.650000	0.86243	GAC	AGFG2	-	NULL	ENSG00000106351		0.587	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGFG2	HGNC	protein_coding	OTTHUMT00000342769.1	144	0.00	0	G	NM_006076		100151824	100151824	+1	no_errors	ENST00000300176	ensembl	human	known	69_37n	missense	38	51.28	40	SNP	1.000	A
AHRR	57491	genome.wustl.edu	37	5	428000	428000	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr5:428000C>T	ENST00000505113.1	+	8	843	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W	AHRR_ENST00000512529.1_Missense_Mutation_p.R113W|AHRR_ENST00000506456.1_Missense_Mutation_p.R123W|AHRR_ENST00000316418.5_Missense_Mutation_p.R285W	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	267					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			GCTCCCGCCGCGGCTGTCGCT	0.557																																						dbGAP											0													24.0	29.0	27.0					5																	428000		1899	4107	6006	-	-	-	SO:0001583	missense	0			AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.799C>T	5.37:g.428000C>T	ENSP00000424601:p.Arg267Trp		A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Missense_Mutation	SNP	pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pfscan_PAS,pfscan_HLH_DNA-bd	p.R285W	ENST00000505113.1	37	c.853	CCDS56355.1	5	.	.	.	.	.	.	.	.	.	.	c	15.29	2.789836	0.50102	.	.	ENSG00000063438	ENST00000505113;ENST00000316418;ENST00000512529;ENST00000506456	T;T;T;T	0.24538	2.19;2.16;1.85;1.86	4.88	3.95	0.45737	.	0.179927	0.49916	D	0.000137	T	0.47820	0.1466	M	0.73598	2.24	0.38934	D	0.958005	D;D;D	0.89917	1.0;0.992;0.998	D;P;P	0.69824	0.966;0.632;0.707	T	0.55062	-0.8199	10	0.87932	D	0	.	11.6173	0.51096	0.179:0.821:0.0:0.0	.	123;267;285	D6RE68;A9YTQ3;A9YTQ3-2	.;AHRR_HUMAN;.	W	267;285;113;123	ENSP00000424601:R267W;ENSP00000323816:R285W;ENSP00000424880:R113W;ENSP00000426932:R123W	ENSP00000323816:R285W	R	+	1	2	AHRR	481000	0.994000	0.37717	0.030000	0.17652	0.002000	0.02628	3.242000	0.51384	2.244000	0.73946	0.580000	0.79431	CGG	AHRR	-	NULL	ENSG00000063438		0.557	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AHRR	HGNC	protein_coding	OTTHUMT00000367720.1	72	0.00	0	C	NM_020731		428000	428000	+1	no_errors	ENST00000316418	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	0.948	T
AMPD1	270	genome.wustl.edu	37	1	115226821	115226821	+	Splice_Site	SNP	T	T	C	rs544976637		TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:115226821T>C	ENST00000520113.2	-	5	660	c.645A>G	c.(643-645)ccA>ccG	p.P215P	AMPD1_ENST00000353928.6_Splice_Site_p.P182P|AMPD1_ENST00000369538.3_Splice_Site_p.P211P			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	215					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	AATTGTTACCTGGATAGAAGC	0.328													T|||	1	0.000199681	0.0	0.0	5008	,	,		17055	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													94.0	89.0	90.0					1																	115226821		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.646+1A>G	1.37:g.115226821T>C			A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.P215	ENST00000520113.2	37	c.645	CCDS876.2	1																																																																																			AMPD1	-	pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116748		0.328	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	164	0.00	0	T		Silent	115226821	115226821	-1	no_errors	ENST00000520113	ensembl	human	known	69_37n	silent	74	31.48	34	SNP	1.000	C
ANO1	55107	genome.wustl.edu	37	11	69957859	69957859	+	Silent	SNP	A	A	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr11:69957859A>G	ENST00000355303.5	+	7	1151	c.846A>G	c.(844-846)ccA>ccG	p.P282P	ANO1_ENST00000531349.1_Silent_p.P17P|ANO1_ENST00000530676.1_Silent_p.P166P|ANO1_ENST00000398543.2_Silent_p.P166P|ANO1_ENST00000316296.5_Silent_p.P254P|ANO1_ENST00000538023.1_Silent_p.P282P	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	282					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CTGCATACCCACTGCACGATG	0.572																																						dbGAP											0													170.0	176.0	174.0					11																	69957859		2011	4186	6197	-	-	-	SO:0001819	synonymous_variant	0			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.846A>G	11.37:g.69957859A>G			A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	pfam_Anoctamin	p.H147R	ENST00000355303.5	37	c.440	CCDS44663.1	11	.	.	.	.	.	.	.	.	.	.	A	5.790	0.330035	0.10956	.	.	ENSG00000131620	ENST00000530480	.	.	.	5.26	-10.5	0.00291	.	.	.	.	.	T	0.30823	0.0777	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39643	-0.9604	4	.	.	.	.	0.7132	0.00928	0.316:0.2728:0.1137:0.2975	.	.	.	.	R	147	.	.	H	+	2	0	ANO1	69635507	0.000000	0.05858	0.401000	0.26359	0.430000	0.31655	-2.976000	0.00665	-2.486000	0.00520	-0.464000	0.05259	CAC	ANO1	-	NULL	ENSG00000131620		0.572	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO1	HGNC	protein_coding	OTTHUMT00000393685.1	117	0.00	0	A	NM_018043		69957859	69957859	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000530480	ensembl	human	novel	69_37n	missense	70	13.58	11	SNP	0.015	G
APOBR	55911	genome.wustl.edu	37	16	28507283	28507283	+	Silent	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr16:28507283G>A	ENST00000431282.1	+	2	931	c.921G>A	c.(919-921)ggG>ggA	p.G307G	CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000328423.5_Silent_p.G307G|APOBR_ENST00000564831.1_Silent_p.G307G			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	307	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						TCTCAGGCGGGGAGGAGGCTG	0.647																																						dbGAP											0													23.0	24.0	24.0					16																	28507283		1925	4115	6040	-	-	-	SO:0001819	synonymous_variant	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.921G>A	16.37:g.28507283G>A			H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	NULL	p.G307	ENST00000431282.1	37	c.921		16																																																																																			APOBR	-	NULL	ENSG00000184730		0.647	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		106	0.00	0	G	NM_182804		28507283	28507283	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	silent	66	39.45	43	SNP	0.000	A
ARHGEF26	26084	genome.wustl.edu	37	3	153943651	153943651	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr3:153943651C>T	ENST00000356448.4	+	11	2226	c.1942C>T	c.(1942-1944)Cct>Tct	p.P648S	ARHGEF26_ENST00000465817.1_Intron|ARHGEF26_ENST00000465093.1_Missense_Mutation_p.P648S|ARHGEF26_ENST00000483068.1_3'UTR	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	648					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						GTAGCCTTTTCCTTTAGTCTC	0.378																																					GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	dbGAP											0													176.0	148.0	157.0					3																	153943651		1837	4094	5931	-	-	-	SO:0001583	missense	0			BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1942C>T	3.37:g.153943651C>T	ENSP00000348828:p.Pro648Ser		B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.P648S	ENST00000356448.4	37	c.1942	CCDS46938.1	3	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198104	0.79015	.	.	ENSG00000114790	ENST00000356448;ENST00000465093	T;T	0.64803	-0.12;-0.12	5.54	4.67	0.58626	Pleckstrin homology-type (1);	0.113510	0.64402	D	0.000008	T	0.69079	0.3071	M	0.77820	2.39	0.80722	D	1	D;P	0.54207	0.965;0.8	P;B	0.47528	0.549;0.352	T	0.74725	-0.3568	10	0.66056	D	0.02	-15.8954	14.3501	0.66694	0.0:0.9288:0.0:0.0712	.	648;648	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	S	648	ENSP00000348828:P648S;ENSP00000423418:P648S	ENSP00000348828:P648S	P	+	1	0	ARHGEF26	155426341	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.707000	0.84623	1.324000	0.45282	0.650000	0.86243	CCT	ARHGEF26	-	NULL	ENSG00000114790		0.378	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF26	HGNC	protein_coding	OTTHUMT00000353287.3	299	0.33	1	C	NM_015595		153943651	153943651	+1	no_errors	ENST00000356448	ensembl	human	known	69_37n	missense	78	39.06	50	SNP	1.000	T
ATP6V0D2	245972	genome.wustl.edu	37	8	87165053	87165053	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr8:87165053G>C	ENST00000285393.3	+	8	1042	c.900G>C	c.(898-900)atG>atC	p.M300I	CTD-3118D11.2_ENST00000524253.1_RNA|CTD-3118D11.2_ENST00000522679.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	300					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)			breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						AGGTACAAATGAATGTGCTGG	0.358																																						dbGAP											0													158.0	146.0	151.0					8																	87165053		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.900G>C	8.37:g.87165053G>C	ENSP00000285393:p.Met300Ile			Missense_Mutation	SNP	pfam_ATPase_V0/A0-cplx_csu/dsu,superfamily_ATPase_V0/A0-cplx_csu/dsu,pirsf_ATPase_V0-cplx_dsu	p.M300I	ENST00000285393.3	37	c.900	CCDS6241.1	8	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792620	0.31685	.	.	ENSG00000147614	ENST00000285393	T	0.28454	1.61	6.06	5.16	0.70880	.	0.181318	0.51477	N	0.000092	T	0.20495	0.0493	N	0.16656	0.425	0.41800	D	0.98991	B	0.02656	0.0	B	0.08055	0.003	T	0.03433	-1.1037	10	0.33940	T	0.23	-3.548	13.4993	0.61445	0.0786:0.0:0.9214:0.0	.	300	Q8N8Y2	VA0D2_HUMAN	I	300	ENSP00000285393:M300I	ENSP00000285393:M300I	M	+	3	0	ATP6V0D2	87234169	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	5.454000	0.66651	1.481000	0.48307	-0.355000	0.07637	ATG	ATP6V0D2	-	pfam_ATPase_V0/A0-cplx_csu/dsu,superfamily_ATPase_V0/A0-cplx_csu/dsu,pirsf_ATPase_V0-cplx_dsu	ENSG00000147614		0.358	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0D2	HGNC	protein_coding	OTTHUMT00000374651.1	164	0.00	0	G	NM_152565		87165053	87165053	+1	no_errors	ENST00000285393	ensembl	human	known	69_37n	missense	133	37.85	81	SNP	1.000	C
BAIAP2L1	55971	genome.wustl.edu	37	7	97984400	97984400	+	Silent	SNP	G	G	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr7:97984400G>C	ENST00000005260.8	-	3	383	c.168C>G	c.(166-168)gcC>gcG	p.A56A	BAIAP2L1_ENST00000462558.1_5'UTR	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	56	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			CACCGATCTTGGCCACTCCAT	0.498																																						dbGAP											0													112.0	90.0	97.0					7																	97984400		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.168C>G	7.37:g.97984400G>C			A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Silent	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.A56	ENST00000005260.8	37	c.168	CCDS34687.1	7																																																																																			BAIAP2L1	-	pfam_IRSp53/MIM_homology_IMD	ENSG00000006453		0.498	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L1	HGNC	protein_coding	OTTHUMT00000334681.1	122	0.00	0	G	NM_018842		97984400	97984400	-1	no_errors	ENST00000005260	ensembl	human	known	69_37n	silent	56	18.84	13	SNP	1.000	C
BCAN	63827	genome.wustl.edu	37	1	156622303	156622303	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:156622303C>T	ENST00000329117.5	+	8	1897	c.1561C>T	c.(1561-1563)Cca>Tca	p.P521S	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.P521S	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	521	O-glycosylated at two sites.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGGTGCATCACCACTTCCTGA	0.642																																						dbGAP											0													24.0	23.0	23.0					1																	156622303		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1561C>T	1.37:g.156622303C>T	ENSP00000331210:p.Pro521Ser		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EGF-like,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like	p.P521S	ENST00000329117.5	37	c.1561	CCDS1149.1	1	.	.	.	.	.	.	.	.	.	.	C	4.166	0.029285	0.08054	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000361588	T;T	0.14766	2.48;3.07	4.13	1.18	0.20946	.	0.247381	0.24534	N	0.037692	T	0.02380	0.0073	L	0.32530	0.975	0.09310	N	1	B;B	0.15473	0.002;0.013	B;B	0.14578	0.004;0.011	T	0.45454	-0.9260	10	0.26408	T	0.33	-0.1067	3.9149	0.09219	0.0:0.5758:0.2006:0.2237	.	521;521	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	S	460;521;521	ENSP00000331210:P521S;ENSP00000354925:P521S	ENSP00000255029:P460S	P	+	1	0	BCAN	154888927	0.001000	0.12720	0.001000	0.08648	0.647000	0.38526	0.313000	0.19415	0.064000	0.16427	0.455000	0.32223	CCA	BCAN	-	NULL	ENSG00000132692		0.642	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	HGNC	protein_coding	OTTHUMT00000081844.2	98	0.00	0	C	NM_021948		156622303	156622303	+1	no_errors	ENST00000329117	ensembl	human	known	69_37n	missense	40	71.83	102	SNP	0.001	T
BCR	613	genome.wustl.edu	37	22	23524047	23524047	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr22:23524047G>C	ENST00000305877.8	+	1	1651	c.900G>C	c.(898-900)caG>caC	p.Q300H	BCR_ENST00000359540.3_Missense_Mutation_p.Q300H|BCR_ENST00000398512.5_Missense_Mutation_p.Q300H	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	300	Binding to ABL SH2-domain.|Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	TGCGCAGCCAGAGCACCTCTG	0.672			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																	dbGAP		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													26.0	29.0	28.0					22																	23524047		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.900G>C	22.37:g.23524047G>C	ENSP00000303507:p.Gln300His		P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_Ca-dep,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RhoGAP_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.Q300H	ENST00000305877.8	37	c.900	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431800	0.43122	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000398512;ENST00000290956;ENST00000292697;ENST00000420248	T;T;T	0.45668	1.7;1.7;0.89	4.67	4.67	0.58626	.	0.500716	0.19418	N	0.114770	T	0.33059	0.0850	N	0.25647	0.755	0.33761	D	0.621795	B;P	0.39964	0.002;0.697	B;B	0.38500	0.003;0.275	T	0.50792	-0.8786	10	0.46703	T	0.11	.	15.1112	0.72359	0.0:0.0:1.0:0.0	.	300;300	P11274-2;P11274	.;BCR_HUMAN	H	300	ENSP00000303507:Q300H;ENSP00000352535:Q300H;ENSP00000381524:Q300H	ENSP00000290956:Q300H	Q	+	3	2	BCR	21854047	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	1.321000	0.33678	2.315000	0.78130	0.557000	0.71058	CAG	BCR	-	NULL	ENSG00000186716		0.672	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	22	0.00	0	G	NM_004327		23524047	23524047	+1	no_errors	ENST00000305877	ensembl	human	known	69_37n	missense	2	83.33	10	SNP	1.000	C
C15orf52	388115	genome.wustl.edu	37	15	40627724	40627724	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr15:40627724C>G	ENST00000559313.1	-	11	1255	c.1240G>C	c.(1240-1242)Gag>Cag	p.E414Q	C15orf52_ENST00000397536.2_Missense_Mutation_p.E204Q	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	414							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		AAGTCAGGCTCCTGTGGAGAG	0.697																																						dbGAP											0													9.0	11.0	10.0					15																	40627724		2185	4286	6471	-	-	-	SO:0001583	missense	0			AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.1240G>C	15.37:g.40627724C>G	ENSP00000453969:p.Glu414Gln		B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Missense_Mutation	SNP	NULL	p.E414Q	ENST00000559313.1	37	c.1240	CCDS10055.2	15	.	.	.	.	.	.	.	.	.	.	C	3.400	-0.122408	0.06795	.	.	ENSG00000188549	ENST00000382688;ENST00000397536	.	.	.	5.11	-4.3	0.03710	.	1.948050	0.02555	N	0.096036	T	0.30541	0.0768	L	0.29908	0.895	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.002	T	0.19943	-1.0290	9	0.36615	T	0.2	0.8187	8.8687	0.35303	0.0:0.1526:0.5709:0.2765	.	204;414	Q6ZUT6-2;Q6ZUT6	.;CO052_HUMAN	Q	414;204	.	ENSP00000372135:E414Q	E	-	1	0	C15orf52	38415016	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.240000	0.08952	-1.206000	0.02641	0.563000	0.77884	GAG	C15orf52	-	NULL	ENSG00000188549		0.697	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf52	HGNC	protein_coding	OTTHUMT00000319567.2	43	0.00	0	C	NM_207380		40627724	40627724	-1	no_errors	ENST00000559313	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.000	G
BNC1	646	genome.wustl.edu	37	15	83926275	83926275	+	Silent	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr15:83926275C>T	ENST00000345382.2	-	5	2989	c.2904G>A	c.(2902-2904)tcG>tcA	p.S968S	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Silent_p.S961S	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	968					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TGCGAACAGACGAAAACATGG	0.498																																						dbGAP											0													158.0	151.0	153.0					15																	83926275		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2904G>A	15.37:g.83926275C>T			Q15840	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S968	ENST00000345382.2	37	c.2904	CCDS10324.1	15																																																																																			BNC1	-	smart_Znf_C2H2-like	ENSG00000169594		0.498	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	115	0.00	0	C	NM_001717		83926275	83926275	-1	no_errors	ENST00000345382	ensembl	human	known	69_37n	silent	49	36.36	28	SNP	0.308	T
C9orf91	203197	genome.wustl.edu	37	9	117405515	117405516	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr9:117405515_117405516insC	ENST00000288502.4	+	9	1388_1389	c.951_952insC	c.(952-954)ccgfs	p.P318fs	C9orf91_ENST00000374049.4_Frame_Shift_Ins_p.P319fs			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91	318						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						ACACGAACTCTCCGAGAATTCC	0.584																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.953dupC	9.37:g.117405517_117405517dupC	ENSP00000288502:p.Pro318fs		A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	Frame_Shift_Ins	INS	NULL	p.R319fs	ENST00000288502.4	37	c.954_955	CCDS6808.1	9																																																																																			C9orf91	-	NULL	ENSG00000157693		0.584	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C9orf91	HGNC	protein_coding	OTTHUMT00000053780.1	147	0.00	0	-	NM_153045		117405515	117405516	+1	no_errors	ENST00000374049	ensembl	human	known	69_37n	frame_shift_ins	69	22.47	20	INS	0.004:0.001	C
CAMSAP2	23271	genome.wustl.edu	37	1	200816774	200816774	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:200816774T>G	ENST00000236925.4	+	11	1281	c.1232T>G	c.(1231-1233)aTt>aGt	p.I411S	CAMSAP2_ENST00000413307.2_Missense_Mutation_p.I384S|CAMSAP2_ENST00000358823.2_Missense_Mutation_p.I400S			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	411					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										GAAGGAGGAATTAGAAGGTCT	0.308																																						dbGAP											0													152.0	147.0	149.0					1																	200816774		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.1232T>G	1.37:g.200816774T>G	ENSP00000236925:p.Ile411Ser		B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.I411S	ENST00000236925.4	37	c.1232		1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.102677	0.76983	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.15372	2.43;2.46;2.43	5.73	5.73	0.89815	.	0.044941	0.85682	D	0.000000	T	0.31638	0.0803	L	0.53249	1.67	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.66351	0.943;0.91;0.943	T	0.07539	-1.0767	10	0.06494	T	0.89	-26.8864	16.0152	0.80434	0.0:0.0:0.0:1.0	.	384;411;400	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	S	400;384;411	ENSP00000351684:I400S;ENSP00000416800:I384S;ENSP00000236925:I411S	ENSP00000236925:I411S	I	+	2	0	CAMSAP1L1	199083397	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.478000	0.81082	2.180000	0.69256	0.533000	0.62120	ATT	CAMSAP2	-	NULL	ENSG00000118200		0.308	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	HGNC	protein_coding	OTTHUMT00000086956.2	112	0.00	0	T	NM_203459		200816774	200816774	+1	no_errors	ENST00000236925	ensembl	human	known	69_37n	missense	189	11.68	25	SNP	1.000	G
CBL	867	genome.wustl.edu	37	11	119103359	119103359	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr11:119103359T>C	ENST00000264033.4	+	2	773	c.397T>C	c.(397-399)Ttc>Ctc	p.F133L		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	133	4H.|Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|Sufficient for interaction with EPHB1.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CATAAGCCTCTTCAAGGAGGG	0.388			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																													dbGAP		"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	0													86.0	85.0	85.0					11																	119103359		2199	4295	6494	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.397T>C	11.37:g.119103359T>C	ENSP00000264033:p.Phe133Leu		A3KMP8	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.F133L	ENST00000264033.4	37	c.397	CCDS8418.1	11	.	.	.	.	.	.	.	.	.	.	T	21.7	4.192654	0.78902	.	.	ENSG00000110395	ENST00000264033	D	0.81499	-1.5	5.91	5.91	0.95273	Adaptor protein Cbl, N-terminal helical (3);Adaptor protein Cbl, PTB domain (1);	0.000000	0.85682	D	0.000000	D	0.86493	0.5946	L	0.48174	1.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85537	0.1213	10	0.38643	T	0.18	-21.2927	16.3433	0.83110	0.0:0.0:0.0:1.0	.	133	P22681	CBL_HUMAN	L	133	ENSP00000264033:F133L	ENSP00000264033:F133L	F	+	1	0	CBL	118608569	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.974000	0.88039	2.254000	0.74563	0.533000	0.62120	TTC	CBL	-	pfam_Adaptor_Cbl_N_hlx,superfamily_Adaptor_Cbl_N_hlx	ENSG00000110395		0.388	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4	113	0.00	0	T	NM_005188		119103359	119103359	+1	no_errors	ENST00000264033	ensembl	human	known	69_37n	missense	56	21.13	15	SNP	1.000	C
CCDC171	203238	genome.wustl.edu	37	9	15744698	15744698	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr9:15744698C>A	ENST00000380701.3	+	17	2805	c.2477C>A	c.(2476-2478)aCc>aAc	p.T826N	CCDC171_ENST00000297641.3_Missense_Mutation_p.T826N	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	826																	TCTCTTTTTACCTGGATGGAG	0.393																																						dbGAP											0													62.0	61.0	62.0					9																	15744698		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2477C>A	9.37:g.15744698C>A	ENSP00000370077:p.Thr826Asn		B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	superfamily_STAT_TF_coiled-coil	p.T826N	ENST00000380701.3	37	c.2477	CCDS6481.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.71|19.71	3.878152|3.878152	0.72294|0.72294	.|.	.|.	ENSG00000164989|ENSG00000164989	ENST00000449575|ENST00000297641;ENST00000380689;ENST00000380701	.|T;T	.|0.16743	.|2.33;2.32	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.213993	.|0.45606	.|D	.|0.000343	T|T	0.26159|0.26159	0.0638|0.0638	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.63046	.|0.992;0.992;0.986;0.992	.|P;P;P;P	.|0.57720	.|0.826;0.826;0.541;0.73	T|T	0.01309|0.01309	-1.1389|-1.1389	5|10	.|0.18276	.|T	.|0.48	-8.5277|-8.5277	19.6798|19.6798	0.95958|0.95958	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|834;826;93;826	.|B7ZM22;Q6TFL3-3;A6NK04;Q6TFL3	.|.;.;.;CI093_HUMAN	T|N	66|826;93;826	.|ENSP00000297641:T826N;ENSP00000370077:T826N	.|ENSP00000297641:T826N	P|T	+|+	1|2	0|0	C9orf93|C9orf93	15734698|15734698	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	5.317000|5.317000	0.65822|0.65822	2.733000|2.733000	0.93635|0.93635	0.467000|0.467000	0.42956|0.42956	CCT|ACC	CCDC171	-	NULL	ENSG00000164989		0.393	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4	90	0.00	0	C	NM_173550		15744698	15744698	+1	no_errors	ENST00000380701	ensembl	human	known	69_37n	missense	69	27.08	26	SNP	1.000	A
CD5L	922	genome.wustl.edu	37	1	157805682	157805682	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:157805682C>G	ENST00000368174.4	-	3	415	c.319G>C	c.(319-321)Gag>Cag	p.E107Q	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	107	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.E107*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCTTCTTGCTCACACTGAGCC	0.483																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											200.0	202.0	201.0					1																	157805682		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.319G>C	1.37:g.157805682C>G	ENSP00000357156:p.Glu107Gln		A8K7M5|Q6UX63	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.E107Q	ENST00000368174.4	37	c.319	CCDS1171.1	1	.	.	.	.	.	.	.	.	.	.	C	4.730	0.135812	0.09032	.	.	ENSG00000073754	ENST00000368174	T	0.35605	1.3	4.68	0.697	0.18081	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.895686	0.09313	N	0.819302	T	0.11580	0.0282	L	0.28776	0.89	0.09310	N	1	P	0.41345	0.746	P	0.45167	0.472	T	0.24190	-1.0167	10	0.14656	T	0.56	.	7.3414	0.26640	0.0:0.5325:0.0:0.4675	.	107	O43866	CD5L_HUMAN	Q	107	ENSP00000357156:E107Q	ENSP00000357156:E107Q	E	-	1	0	CD5L	156072306	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-1.619000	0.02048	-0.029000	0.13827	0.563000	0.77884	GAG	CD5L	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000073754		0.483	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5L	HGNC	protein_coding	OTTHUMT00000058346.1	73	0.00	0	C	NM_005894		157805682	157805682	-1	no_errors	ENST00000368174	ensembl	human	known	69_37n	missense	58	45.79	49	SNP	0.003	G
CD9	928	genome.wustl.edu	37	12	6344725	6344725	+	Silent	SNP	C	C	G	rs80271009	byFrequency	TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr12:6344725C>G	ENST00000382518.1	+	7	967	c.531C>G	c.(529-531)acC>acG	p.T177T	CD9_ENST00000009180.4_Silent_p.T177T|CD9_ENST00000382515.2_Silent_p.T108T|CD9_ENST00000481267.1_3'UTR|Y_RNA_ENST00000365448.1_RNA			P21926	CD9_HUMAN	CD9 molecule	177					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						AAACCTTCACCGTGAAGGTAA	0.542																																						dbGAP											0													123.0	105.0	111.0					12																	6344725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.531C>G	12.37:g.6344725C>G			D3DUQ9|Q5J7W6|Q96ES4	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T177	ENST00000382518.1	37	c.531	CCDS8540.1	12	.	.	.	.	.	.	.	.	.	.	C	4.495	0.091866	0.08632	.	.	ENSG00000010278	ENST00000425469	.	.	.	5.39	-10.8	0.00216	.	.	.	.	.	T	0.13670	0.0331	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10894	-1.0610	7	0.22109	T	0.4	.	3.0663	0.06215	0.1762:0.4518:0.2142:0.1578	.	227	B4DK09	.	G	177	.	ENSP00000388933:R177G	R	+	1	0	CD9	6214986	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.283000	0.00527	-1.414000	0.02025	-0.182000	0.12963	CGT	CD9	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000010278		0.542	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	CD9	HGNC	protein_coding	OTTHUMT00000103348.1	190	0.00	0	C			6344725	6344725	+1	no_errors	ENST00000009180	ensembl	human	known	69_37n	silent	96	45.81	82	SNP	0.000	G
CHL1	10752	genome.wustl.edu	37	3	430976	430976	+	Silent	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr3:430976C>T	ENST00000256509.2	+	20	2931	c.2289C>T	c.(2287-2289)taC>taT	p.Y763Y	CHL1_ENST00000397491.2_Silent_p.Y747Y	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		gcctagagtacagagtgacct	0.498																																						dbGAP											0													86.0	78.0	81.0					3																	430976		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2289C>T	3.37:g.430976C>T			Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Y763	ENST00000256509.2	37	c.2289	CCDS2556.1	3																																																																																			CHL1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134121		0.498	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2	143	0.00	0	C	NM_006614		430976	430976	+1	no_errors	ENST00000256509	ensembl	human	known	69_37n	silent	89	14.42	15	SNP	1.000	T
CNNM2	54805	genome.wustl.edu	37	10	104816684	104816684	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr10:104816684G>A	ENST00000369878.4	+	4	2224	c.2036G>A	c.(2035-2037)cGc>cAc	p.R679H	CNNM2_ENST00000433628.2_Missense_Mutation_p.R679H	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	679					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CTCTACCAGCGCAACAAGCCA	0.433																																						dbGAP											0													120.0	131.0	128.0					10																	104816684		2106	4262	6368	-	-	-	SO:0001583	missense	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.2036G>A	10.37:g.104816684G>A	ENSP00000358894:p.Arg679His		Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.R680H	ENST00000369878.4	37	c.2039	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982698	0.93044	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369878;ENST00000345419	T	0.75154	-0.91	5.83	5.83	0.93111	RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	D	0.85665	0.5749	M	0.86097	2.795	0.58432	D	0.999999	D;D	0.59767	0.986;0.976	P;P	0.54815	0.761;0.581	D	0.87415	0.2378	10	0.87932	D	0	.	20.1218	0.97964	0.0:0.0:1.0:0.0	.	679;679	Q9H8M5-2;Q9H8M5	.;CNNM2_HUMAN	H	680;680;679;679	ENSP00000358894:R679H	ENSP00000286899:R679H	R	+	2	0	CNNM2	104806674	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	8.062000	0.89475	2.763000	0.94921	0.561000	0.74099	CGC	CNNM2	-	superfamily_cNMP-bd-like	ENSG00000148842		0.433	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	171	0.00	0	G	NM_017649		104816684	104816684	+1	no_errors	ENST00000457502	ensembl	human	known	69_37n	missense	87	12.12	12	SNP	1.000	A
COLEC12	81035	genome.wustl.edu	37	18	357409	357409	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr18:357409C>A	ENST00000400256.3	-	3	379	c.172G>T	c.(172-174)Gga>Tga	p.G58*		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	58					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CCTTTATATCCCAAAATGGCT	0.303																																						dbGAP											0													90.0	90.0	90.0					18																	357409		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.172G>T	18.37:g.357409C>A	ENSP00000383115:p.Gly58*		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Nonsense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.G58*	ENST00000400256.3	37	c.172	CCDS32782.1	18	.	.	.	.	.	.	.	.	.	.	C	38	6.698448	0.97772	.	.	ENSG00000158270	ENST00000400256	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.592	19.817	0.96573	0.0:1.0:0.0:0.0	.	.	.	.	X	58	.	ENSP00000383115:G58X	G	-	1	0	COLEC12	347409	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.440000	0.80464	2.678000	0.91216	0.655000	0.94253	GGA	COLEC12	-	NULL	ENSG00000158270		0.303	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	HGNC	protein_coding	OTTHUMT00000440746.1	191	0.00	0	C			357409	357409	-1	no_errors	ENST00000400256	ensembl	human	known	69_37n	nonsense	186	14.68	32	SNP	1.000	A
CRAMP1L	57585	genome.wustl.edu	37	16	1724028	1724028	+	Silent	SNP	C	C	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr16:1724028C>G	ENST00000397412.3	+	21	3891	c.3792C>G	c.(3790-3792)gtC>gtG	p.V1264V	CRAMP1L_ENST00000436138.3_Silent_p.V1261V|LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000262317.4_Silent_p.V639V|CRAMP1L_ENST00000293925.5_Silent_p.V1264V			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	1264						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						GCCCCGCTGTCAGTGACCTGT	0.567																																						dbGAP											0													40.0	41.0	41.0					16																	1724028		2027	4191	6218	-	-	-	SO:0001819	synonymous_variant	0			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.3792C>G	16.37:g.1724028C>G			A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Silent	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.V1264	ENST00000397412.3	37	c.3792	CCDS10440.2	16																																																																																			CRAMP1L	-	NULL	ENSG00000007545		0.567	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAMP1L	HGNC	protein_coding	OTTHUMT00000157297.4	33	0.00	0	C			1724028	1724028	+1	no_errors	ENST00000293925	ensembl	human	known	69_37n	silent	11	62.07	18	SNP	0.000	G
CTDSP1	58190	genome.wustl.edu	37	2	219266840	219266840	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr2:219266840C>T	ENST00000273062.2	+	3	559	c.223C>T	c.(223-225)Cca>Tca	p.P75S	RP11-378A13.2_ENST00000608367.1_RNA|MIR26B_ENST00000362251.2_RNA|CTDSP1_ENST00000488627.1_3'UTR|CTDSP1_ENST00000443891.1_Missense_Mutation_p.P74S	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	75					negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACAGCAGACCCCAGTCCAATA	0.647																																						dbGAP											0													38.0	34.0	36.0					2																	219266840		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.223C>T	2.37:g.219266840C>T	ENSP00000273062:p.Pro75Ser		C9IYG0|Q7Z5Q3|Q7Z5Q4	Missense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.P75S	ENST00000273062.2	37	c.223	CCDS2416.1	2	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797995	0.31777	.	.	ENSG00000144579	ENST00000443891;ENST00000273062	T;T	0.15139	2.48;2.45	5.11	4.23	0.50019	.	0.198759	0.43416	D	0.000562	T	0.13670	0.0331	L	0.49571	1.57	0.58432	D	0.999991	B;B	0.13594	0.008;0.004	B;B	0.15484	0.013;0.002	T	0.16897	-1.0387	10	0.51188	T	0.08	-21.0257	2.3367	0.04250	0.1558:0.5253:0.1508:0.1681	.	75;74	Q9GZU7;C9IYG0	CTDS1_HUMAN;.	S	74;75	ENSP00000392248:P74S;ENSP00000273062:P75S	ENSP00000273062:P75S	P	+	1	0	CTDSP1	218975084	0.051000	0.20477	1.000000	0.80357	0.507000	0.33981	0.829000	0.27449	1.139000	0.42245	0.561000	0.74099	CCA	CTDSP1	-	NULL	ENSG00000144579		0.647	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSP1	HGNC	protein_coding	OTTHUMT00000256774.1	45	0.00	0	C	NM_182642, NM_021198		219266840	219266840	+1	no_errors	ENST00000273062	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	1.000	T
CYP2S1	29785	genome.wustl.edu	37	19	41704619	41704619	+	Silent	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr19:41704619C>T	ENST00000310054.4	+	5	876	c.660C>T	c.(658-660)taC>taT	p.Y220Y	CYP2S1_ENST00000542619.1_Intron	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	220					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						CACAGACCTACGAGATGTTCT	0.632																																						dbGAP											0													92.0	78.0	83.0					19																	41704619		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.660C>T	19.37:g.41704619C>T			Q9BZ66	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450_E_grp-I_CYP2B-like,prints_Cyt_P450_B	p.Y220	ENST00000310054.4	37	c.660	CCDS12573.1	19																																																																																			CYP2S1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I_CYP2B-like,prints_Cyt_P450_B	ENSG00000167600		0.632	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2S1	HGNC	protein_coding	OTTHUMT00000463287.1	389	0.00	0	C			41704619	41704619	+1	no_errors	ENST00000310054	ensembl	human	known	69_37n	silent	249	29.26	103	SNP	0.025	T
DDX58	23586	genome.wustl.edu	37	9	32481365	32481365	+	Silent	SNP	G	G	C	rs150568623	byFrequency	TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr9:32481365G>C	ENST00000379883.2	-	11	1768	c.1611C>G	c.(1609-1611)gcC>gcG	p.A537A	DDX58_ENST00000542096.1_Silent_p.A466A|DDX58_ENST00000379868.1_Silent_p.A334A|DDX58_ENST00000379882.1_Silent_p.A492A|DDX58_ENST00000545044.1_Silent_p.A334A	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	537	Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ATAAAAACAGGGCTTTACAAA	0.433																																						dbGAP											0													154.0	129.0	138.0					9																	32481365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.1611C>G	9.37:g.32481365G>C			A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Silent	SNP	pfam_RIG-I_C-RD,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_DEATH-like,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A537	ENST00000379883.2	37	c.1611	CCDS6526.1	9																																																																																			DDX58	-	NULL	ENSG00000107201		0.433	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	HGNC	protein_coding	OTTHUMT00000052011.1	180	0.00	0	G	NM_014314		32481365	32481365	-1	no_errors	ENST00000379883	ensembl	human	known	69_37n	silent	145	25.26	49	SNP	0.003	C
DDX58	23586	genome.wustl.edu	37	9	32481395	32481395	+	Silent	SNP	G	G	A	rs532802115		TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr9:32481395G>A	ENST00000379883.2	-	11	1738	c.1581C>T	c.(1579-1581)gaC>gaT	p.D527D	DDX58_ENST00000542096.1_Silent_p.D456D|DDX58_ENST00000379868.1_Silent_p.D324D|DDX58_ENST00000379882.1_Silent_p.D482D|DDX58_ENST00000545044.1_Silent_p.D324D	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	527	Interaction with ZC3HAV1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		CTTCATCTTTGTCTGGCATCT	0.383																																						dbGAP											0													142.0	118.0	126.0					9																	32481395		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.1581C>T	9.37:g.32481395G>A			A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Silent	SNP	pfam_RIG-I_C-RD,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_DEATH-like,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D527	ENST00000379883.2	37	c.1581	CCDS6526.1	9																																																																																			DDX58	-	NULL	ENSG00000107201		0.383	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	HGNC	protein_coding	OTTHUMT00000052011.1	223	0.00	0	G	NM_014314		32481395	32481395	-1	no_errors	ENST00000379883	ensembl	human	known	69_37n	silent	96	60.82	149	SNP	1.000	A
DHRS13	147015	genome.wustl.edu	37	17	27228017	27228017	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr17:27228017C>A	ENST00000378895.4	-	4	799	c.673G>T	c.(673-675)Gcc>Tcc	p.A225S	DHRS13_ENST00000426464.2_Missense_Mutation_p.A144S|DHRS13_ENST00000581974.1_5'Flank|DHRS13_ENST00000394901.3_Missense_Mutation_p.A175S|RP11-20B24.4_ENST00000580603.1_RNA|RP11-20B24.4_ENST00000579187.1_RNA	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	225						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CCTGGGTGGGCTGCATAGCAG	0.612																																						dbGAP											0													48.0	51.0	50.0					17																	27228017		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.673G>T	17.37:g.27228017C>A	ENSP00000368173:p.Ala225Ser		Q96BH7	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.A225S	ENST00000378895.4	37	c.673	CCDS11246.2	17	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893258	0.72524	.	.	ENSG00000167536	ENST00000378895;ENST00000394901;ENST00000426464	D;D;D	0.91843	-2.92;-2.92;-2.92	5.33	5.33	0.75918	NAD(P)-binding domain (1);	0.115574	0.56097	D	0.000021	D	0.94978	0.8375	M	0.71920	2.185	0.37873	D	0.930129	D;D	0.67145	0.996;0.985	P;P	0.59056	0.851;0.643	D	0.96444	0.9329	10	0.87932	D	0	.	18.009	0.89217	0.0:1.0:0.0:0.0	.	144;225	B4DJC5;Q6UX07	.;DHR13_HUMAN	S	225;175;144	ENSP00000368173:A225S;ENSP00000378361:A175S;ENSP00000412826:A144S	ENSP00000368173:A225S	A	-	1	0	DHRS13	24252143	0.997000	0.39634	0.969000	0.41365	0.588000	0.36517	3.296000	0.51802	2.487000	0.83934	0.462000	0.41574	GCC	DHRS13	-	prints_Glc/ribitol_DH	ENSG00000167536		0.612	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS13	HGNC	protein_coding	OTTHUMT00000255952.1	85	0.00	0	C	NM_144683		27228017	27228017	-1	no_errors	ENST00000378895	ensembl	human	known	69_37n	missense	356	21.24	96	SNP	0.998	A
DMD	1756	genome.wustl.edu	37	X	32364092	32364092	+	Nonsense_Mutation	SNP	G	G	A	rs398123991		TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chrX:32364092G>A	ENST00000357033.4	-	39	5760	c.5554C>T	c.(5554-5556)Cag>Tag	p.Q1852*	DMD_ENST00000378677.2_Nonsense_Mutation_p.Q1848*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1852	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGTAACAGCTGCTGTTTTATC	0.318																																						dbGAP											0			GRCh37	CM010825	DMD	M							130.0	125.0	127.0					X																	32364092		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5554C>T	X.37:g.32364092G>A	ENSP00000354923:p.Gln1852*		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q1852*	ENST00000357033.4	37	c.5554	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	47	13.821074	0.99765	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000493412	.	.	.	5.85	5.85	0.93711	.	0.213163	0.22862	U	0.054729	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	19.1152	0.93336	0.0:0.0:1.0:0.0	.	.	.	.	X	1844;511;508;1848;1852;1852;1729;71	.	ENSP00000354923:Q1852X	Q	-	1	0	DMD	32274013	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.079000	0.64431	2.464000	0.83262	0.513000	0.50165	CAG	DMD	-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.318	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	202	0.49	1	G	NM_004006		32364092	32364092	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	nonsense	80	16.67	16	SNP	1.000	A
DNAH6	1768	genome.wustl.edu	37	2	84940260	84940260	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr2:84940260G>C	ENST00000237449.6	+	56	9428	c.9420G>C	c.(9418-9420)ttG>ttC	p.L3140F	DNAH6_ENST00000389394.3_Missense_Mutation_p.L3140F			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3140	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CCATTCTTTTGAAACAAATTT	0.353																																						dbGAP											0													222.0	185.0	196.0					2																	84940260		692	1591	2283	-	-	-	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.9420G>C	2.37:g.84940260G>C	ENSP00000237449:p.Leu3140Phe		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L3140F	ENST00000237449.6	37	c.9420	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	15.52	2.856453	0.51376	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.21932	1.98;1.98	5.11	3.0	0.34707	.	0.219839	0.22684	N	0.056913	T	0.50752	0.1634	H	0.95224	3.64	0.80722	D	1	P	0.50272	0.933	P	0.59948	0.866	T	0.53373	-0.8448	10	0.48119	T	0.1	.	8.6294	0.33911	0.2277:0.0:0.7723:0.0	.	3140	Q9C0G6	DYH6_HUMAN	F	3140	ENSP00000374045:L3140F;ENSP00000237449:L3140F	ENSP00000237449:L3140F	L	+	3	2	DNAH6	84793771	1.000000	0.71417	0.999000	0.59377	0.824000	0.46624	2.642000	0.46596	0.449000	0.26747	0.655000	0.94253	TTG	DNAH6	-	NULL	ENSG00000115423		0.353	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	471	0.00	0	G	NM_001370		84940260	84940260	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	missense	157	42.49	116	SNP	1.000	C
DPP6	1804	genome.wustl.edu	37	7	154172083	154172083	+	Missense_Mutation	SNP	G	G	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr7:154172083G>T	ENST00000377770.3	+	3	559	c.418G>T	c.(418-420)Gac>Tac	p.D140Y	DPP6_ENST00000406326.1_Missense_Mutation_p.D140Y|DPP6_ENST00000332007.3_Missense_Mutation_p.D78Y|DPP6_ENST00000404039.1_Missense_Mutation_p.D76Y|DPP6_ENST00000427557.1_Missense_Mutation_p.D78Y|DPP6_ENST00000496611.1_3'UTR			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	140					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CTTCAGTGAAGACTTCAAAAT	0.423																																					NSCLC(125;1384 1783 2490 7422 34254)	dbGAP											0													90.0	88.0	89.0					7																	154172083		1919	4133	6052	-	-	-	SO:0001583	missense	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.418G>T	7.37:g.154172083G>T	ENSP00000367001:p.Asp140Tyr			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.D140Y	ENST00000377770.3	37	c.418		7	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031797	0.75504	.	.	ENSG00000130226	ENST00000404039;ENST00000406326;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.17	4.26	0.50523	.	0.154695	0.56097	D	0.000026	T	0.54111	0.1838	.	.	.	0.48040	D	0.999577	D;D;D;D;D;D	0.89917	0.995;0.995;1.0;1.0;0.998;1.0	P;D;D;D;D;D	0.72338	0.862;0.94;0.977;0.963;0.969;0.963	T	0.58814	-0.7570	9	0.72032	D	0.01	-14.4285	11.7462	0.51821	0.0:0.1782:0.8218:0.0	.	78;78;78;140;140;76	E9PDL2;B7Z1K3;P42658-2;P42658;Q8IYG9;E9PF59	.;.;.;DPP6_HUMAN;.;.	Y	76;140;140;78;78	ENSP00000385578:D76Y;ENSP00000384393:D140Y;ENSP00000367001:D140Y;ENSP00000328226:D78Y;ENSP00000397303:D78Y	ENSP00000328226:D78Y	D	+	1	0	DPP6	153803016	1.000000	0.71417	0.624000	0.29186	0.981000	0.71138	4.615000	0.61190	1.246000	0.43901	0.557000	0.71058	GAC	DPP6	-	NULL	ENSG00000130226		0.423	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	149	0.00	0	G	NM_130797		154172083	154172083	+1	no_errors	ENST00000377770	ensembl	human	known	69_37n	missense	49	26.87	18	SNP	0.988	T
ELOVL5	60481	genome.wustl.edu	37	6	53139934	53139934	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr6:53139934delC	ENST00000542638.1	-	5	897	c.450delG	c.(448-450)atgfs	p.M150fs	ELOVL5_ENST00000541407.1_Frame_Shift_Del_p.M177fs|ELOVL5_ENST00000370918.4_Frame_Shift_Del_p.M140fs|ELOVL5_ENST00000304434.6_Frame_Shift_Del_p.M150fs|ELOVL5_ENST00000486973.1_5'Flank|MIR5685_ENST00000579080.1_RNA			Q9NYP7	ELOV5_HUMAN	ELOVL fatty acid elongase 5	150					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7	Lung NSC(77;0.116)					AGATGTTCAGCATCGAGGCAT	0.512																																						dbGAP											0													136.0	108.0	118.0					6																	53139934		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF052129	CCDS4951.1, CCDS56433.1, CCDS56434.1, CCDS75470.1	6p21.1-p12.1	2014-07-30	2011-05-25		ENSG00000012660	ENSG00000012660			21308	protein-coding gene	gene with protein product		611805	"""ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"", ""spinocerebellar ataxia 38"""	SCA38		10970790, 25065913	Standard	NM_021814		Approved	HELO1, dJ483K16.1	uc011dwx.2	Q9NYP7	OTTHUMG00000016249	ENST00000542638.1:c.450delG	6.37:g.53139934delC	ENSP00000440728:p.Met150fs		B4DZJ2|F6SH78|Q59EL3|Q5TGH5|Q6NXE7|Q7L2S5|Q8NCG4|Q9UI22	Frame_Shift_Del	DEL	pfam_GNS1_SUR4	p.M177fs	ENST00000542638.1	37	c.531	CCDS4951.1	6																																																																																			ELOVL5	-	pfam_GNS1_SUR4	ENSG00000012660		0.512	ELOVL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL5	HGNC	protein_coding	OTTHUMT00000043566.1	140	0.00	0	C	NM_021814		53139934	53139934	-1	no_errors	ENST00000541407	ensembl	human	known	69_37n	frame_shift_del	79	23.15	25	DEL	1.000	-
ERG	2078	genome.wustl.edu	37	21	39817365	39817365	+	Silent	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr21:39817365G>A	ENST00000417133.2	-	4	404	c.219C>T	c.(217-219)atC>atT	p.I73I	ERG_ENST00000398905.1_Silent_p.I66I|ERG_ENST00000442448.1_Silent_p.I73I|ERG_ENST00000398911.1_Silent_p.I73I|ERG_ENST00000398919.2_Silent_p.I73I|ERG_ENST00000398897.1_Intron|ERG_ENST00000429727.2_Silent_p.I66I|ERG_ENST00000398907.1_Silent_p.I66I|ERG_ENST00000398910.1_Silent_p.I73I|ERG_ENST00000453032.2_Intron|ERG_ENST00000288319.7_Silent_p.I66I	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	ATTCCATTTTGATGGTGACCC	0.552			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)	dbGAP		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	0													83.0	73.0	76.0					21																	39817365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.219C>T	21.37:g.39817365G>A			A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,prints_Ets,pfscan_Ets	p.I73	ENST00000417133.2	37	c.219	CCDS46648.1	21																																																																																			ERG	-	NULL	ENSG00000157554		0.552	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ERG	HGNC	protein_coding	OTTHUMT00000207532.2	109	0.00	0	G	NM_182918		39817365	39817365	-1	no_errors	ENST00000398919	ensembl	human	known	69_37n	silent	124	20.89	33	SNP	1.000	A
EXOC6	54536	genome.wustl.edu	37	10	94688180	94688181	+	Splice_Site	INS	-	-	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr10:94688180_94688181insT	ENST00000260762.6	+	9	986		c.e9+1		EXOC6_ENST00000371547.4_Splice_Site|EXOC6_ENST00000443748.2_Splice_Site|EXOC6_ENST00000371552.4_Splice_Site	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6						cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				GTCGAATATGGTAAGTATGCGA	0.337																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.972+1->T	10.37:g.94688181_94688181dupT			E9PHI3|Q5VXH8|Q9NZ24	Splice_Site	INS	-	e10+1	ENST00000260762.6	37	c.1020+1_1020+1	CCDS7424.2	10																																																																																			EXOC6	-	-	ENSG00000138190		0.337	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6	HGNC	protein_coding	OTTHUMT00000049410.2	159	0.00	0	-	NM_019053	Intron	94688180	94688181	+1	no_errors	ENST00000371547	ensembl	human	known	69_37n	splice_site_ins	129	28.73	52	INS	1.000:1.000	T
FLT3	2322	genome.wustl.edu	37	13	28602382	28602382	+	Silent	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr13:28602382G>A	ENST00000241453.7	-	16	2067	c.1986C>T	c.(1984-1986)ctC>ctT	p.L662L	FLT3_ENST00000537084.1_Silent_p.L662L|FLT3_ENST00000380982.4_Silent_p.L662L	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	662	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCATCATCTTGAGTTCTGACA	0.428			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													97.0	80.0	86.0					13																	28602382		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1986C>T	13.37:g.28602382G>A			A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L662	ENST00000241453.7	37	c.1986	CCDS31953.1	13																																																																																			FLT3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000122025		0.428	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	62	0.00	0	G			28602382	28602382	-1	no_errors	ENST00000380982	ensembl	human	known	69_37n	silent	66	13.16	10	SNP	1.000	A
GANAB	23193	genome.wustl.edu	37	11	62396294	62396294	+	Silent	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr11:62396294G>A	ENST00000356638.3	-	17	2143	c.2127C>T	c.(2125-2127)ccC>ccT	p.P709P	GANAB_ENST00000534779.1_Silent_p.P617P|GANAB_ENST00000346178.4_Silent_p.P731P|GANAB_ENST00000540933.1_Silent_p.P612P	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	709					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TGTACCAGAAGGGCAGCAAAG	0.547																																					Melanoma(23;1005 1074 15747 18937)	dbGAP											0													187.0	163.0	171.0					11																	62396294		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.2127C>T	11.37:g.62396294G>A			A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	NULL	p.L62F	ENST00000356638.3	37	c.184	CCDS8026.1	11																																																																																			GANAB	-	NULL	ENSG00000089597		0.547	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	HGNC	protein_coding	OTTHUMT00000395689.1	125	0.00	0	G	NM_198334		62396294	62396294	-1	no_errors	ENST00000531841	ensembl	human	known	69_37n	missense	19	78.65	70	SNP	0.997	A
GIMAP8	155038	genome.wustl.edu	37	7	150171135	150171135	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr7:150171135G>A	ENST00000307271.3	+	4	1292	c.718G>A	c.(718-720)Gag>Aag	p.E240K		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	240						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CACAGGACCCGAGCAGAATCC	0.552																																						dbGAP											0													77.0	80.0	79.0					7																	150171135		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.718G>A	7.37:g.150171135G>A	ENSP00000305107:p.Glu240Lys			Missense_Mutation	SNP	pfam_AIG1	p.E240K	ENST00000307271.3	37	c.718	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	G	8.894	0.954795	0.18431	.	.	ENSG00000171115	ENST00000307271	T	0.05649	3.41	4.24	1.4	0.22301	.	0.479328	0.17372	N	0.176637	T	0.03390	0.0098	N	0.13235	0.315	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40608	-0.9554	10	0.41790	T	0.15	.	4.3731	0.11258	0.211:0.1867:0.6023:0.0	.	240	Q8ND71	GIMA8_HUMAN	K	240	ENSP00000305107:E240K	ENSP00000305107:E240K	E	+	1	0	GIMAP8	149802068	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.608000	0.05641	0.100000	0.17581	-0.143000	0.13931	GAG	GIMAP8	-	NULL	ENSG00000171115		0.552	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	133	0.00	0	G	NM_175571		150171135	150171135	+1	no_errors	ENST00000307271	ensembl	human	known	69_37n	missense	79	22.55	23	SNP	0.000	A
HEY2	23493	genome.wustl.edu	37	6	126080572	126080572	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr6:126080572C>T	ENST00000368364.3	+	5	835	c.638C>T	c.(637-639)tCc>tTc	p.S213F	HEY2_ENST00000368365.1_Missense_Mutation_p.S167F	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	213					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		TGTCGCCTCTCCACAACTTCA	0.662																																						dbGAP											0													146.0	143.0	144.0					6																	126080572		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.638C>T	6.37:g.126080572C>T	ENSP00000357348:p.Ser213Phe			Missense_Mutation	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd,prints_Antifreeze_1	p.S213F	ENST00000368364.3	37	c.638	CCDS5131.1	6	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619282	0.66787	.	.	ENSG00000135547	ENST00000368365;ENST00000368364	T;T	0.60424	0.2;0.19	5.59	5.59	0.84812	.	0.503717	0.20132	N	0.098574	T	0.41719	0.1171	L	0.48642	1.525	0.53688	D	0.999976	B	0.32693	0.38	B	0.28784	0.094	T	0.48714	-0.9011	10	0.62326	D	0.03	-18.6503	18.3591	0.90368	0.0:1.0:0.0:0.0	.	213	Q9UBP5	HEY2_HUMAN	F	167;213	ENSP00000357349:S167F;ENSP00000357348:S213F	ENSP00000357348:S213F	S	+	2	0	HEY2	126122265	0.439000	0.25610	0.946000	0.38457	0.937000	0.57800	1.585000	0.36600	2.625000	0.88918	0.561000	0.74099	TCC	HEY2	-	NULL	ENSG00000135547		0.662	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEY2	HGNC	protein_coding	OTTHUMT00000042077.1	34	0.00	0	C			126080572	126080572	+1	no_errors	ENST00000368364	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	0.910	T
IREB2	3658	genome.wustl.edu	37	15	78757626	78757626	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr15:78757626G>A	ENST00000258886.8	+	4	455	c.306G>A	c.(304-306)atG>atA	p.M102I	IREB2_ENST00000560440.1_Missense_Mutation_p.M102I	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	102					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TTGCTGCTATGAGGGAGGCAG	0.358																																					NSCLC(200;764 2208 35157 49871 50830)	dbGAP											0													134.0	119.0	124.0					15																	78757626		2196	4293	6489	-	-	-	SO:0001583	missense	0			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.306G>A	15.37:g.78757626G>A	ENSP00000258886:p.Met102Ile		A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.M102I	ENST00000258886.8	37	c.306	CCDS10302.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.284290	0.95517	.	.	ENSG00000136381	ENST00000258886	T	0.18174	2.23	5.69	5.69	0.88448	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.034057	0.85682	D	0.000000	T	0.45276	0.1334	M	0.76170	2.325	0.80722	D	1	D;P	0.55385	0.971;0.949	D;P	0.68192	0.956;0.769	T	0.35649	-0.9780	10	0.87932	D	0	.	19.8145	0.96560	0.0:0.0:1.0:0.0	.	102;102	P48200;Q8WVK6	IREB2_HUMAN;.	I	102	ENSP00000258886:M102I	ENSP00000258886:M102I	M	+	3	0	IREB2	76544681	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.666000	0.98612	2.683000	0.91414	0.563000	0.77884	ATG	IREB2	-	pfam_Acoase/IPM_deHydtase_lsu_aba,superfamily_Acoase/IPM_deHydtase_lsu_aba	ENSG00000136381		0.358	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IREB2	HGNC	protein_coding	OTTHUMT00000290109.3	209	0.00	0	G	NM_004136		78757626	78757626	+1	no_errors	ENST00000258886	ensembl	human	known	69_37n	missense	79	19.39	19	SNP	1.000	A
IRX3	79191	genome.wustl.edu	37	16	54319414	54319414	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr16:54319414delC	ENST00000329734.3	-	2	1091	c.379delG	c.(379-381)gacfs	p.D127fs		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	127					mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						CGGGACGGGTCCCCGAACTGG	0.677																																					GBM(143;1830 1866 4487 4646 37383)	dbGAP											0													81.0	66.0	71.0					16																	54319414		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0			U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.379delG	16.37:g.54319414delC	ENSP00000331608:p.Asp127fs		Q7Z4A4|Q7Z4A5|Q8IVC6	Frame_Shift_Del	DEL	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,smart_Iroquois_homeo,pfscan_Homeodomain	p.D127fs	ENST00000329734.3	37	c.379	CCDS10750.1	16																																																																																			IRX3	-	superfamily_Homeodomain-like	ENSG00000177508		0.677	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX3	HGNC	protein_coding	OTTHUMT00000256910.2	160	0.00	0	C			54319414	54319414	-1	no_errors	ENST00000329734	ensembl	human	known	69_37n	frame_shift_del	62	48.76	59	DEL	1.000	-
IWS1	55677	genome.wustl.edu	37	2	128253598	128253598	+	Silent	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr2:128253598G>A	ENST00000295321.4	-	7	1951	c.1692C>T	c.(1690-1692)atC>atT	p.I564I	IWS1_ENST00000455721.2_3'UTR|AC010976.2_ENST00000599001.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	564	Interaction with SUPT6H and ALYREF.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TCATCTTGACGATCATGGCAC	0.478																																						dbGAP											0													211.0	197.0	202.0					2																	128253598		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1692C>T	2.37:g.128253598G>A			Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Silent	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.I564	ENST00000295321.4	37	c.1692	CCDS2146.1	2																																																																																			IWS1	-	NULL	ENSG00000163166		0.478	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2	180	0.00	0	G	NM_017969		128253598	128253598	-1	no_errors	ENST00000295321	ensembl	human	known	69_37n	silent	126	36.36	72	SNP	0.136	A
KANK3	256949	genome.wustl.edu	37	19	8399296	8399296	+	Silent	SNP	G	G	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr19:8399296G>C	ENST00000593649.1	-	4	1400	c.1335C>G	c.(1333-1335)ctC>ctG	p.L445L	KANK3_ENST00000330915.3_Silent_p.L445L			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	445										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						TGATGGATTTGAGGATGCCTG	0.647																																						dbGAP											0													54.0	54.0	54.0					19																	8399296		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1335C>G	19.37:g.8399296G>C			Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L445	ENST00000593649.1	37	c.1335		19																																																																																			KANK3	-	NULL	ENSG00000186994		0.647	KANK3-002	KNOWN	basic	protein_coding	KANK3	HGNC	protein_coding	OTTHUMT00000461379.1	41	0.00	0	G	NM_198471		8399296	8399296	-1	no_errors	ENST00000330915	ensembl	human	known	69_37n	silent	15	34.78	8	SNP	1.000	C
KCNH8	131096	genome.wustl.edu	37	3	19575051	19575051	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr3:19575051G>A	ENST00000328405.2	+	16	3050	c.2784G>A	c.(2782-2784)tgG>tgA	p.W928*		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	928					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						GAACGAGCTGGAGTGCACACC	0.522																																					NSCLC(124;1625 1765 8018 24930 42026)	dbGAP											0													92.0	86.0	88.0					3																	19575051		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2784G>A	3.37:g.19575051G>A	ENSP00000328813:p.Trp928*		B7Z2I7|Q59GQ6	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.W928*	ENST00000328405.2	37	c.2784	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.295278	0.98192	.	.	ENSG00000183960	ENST00000328405	.	.	.	5.58	4.69	0.59074	.	0.000000	0.30920	U	0.008609	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3322	0.83039	0.0:0.1324:0.8676:0.0	.	.	.	.	X	928	.	.	W	+	3	0	KCNH8	19550055	1.000000	0.71417	0.998000	0.56505	0.694000	0.40290	5.410000	0.66381	1.300000	0.44818	0.655000	0.94253	TGG	KCNH8	-	NULL	ENSG00000183960		0.522	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	HGNC	protein_coding	OTTHUMT00000252139.2	185	0.00	0	G	NM_144633		19575051	19575051	+1	no_errors	ENST00000328405	ensembl	human	known	69_37n	nonsense	141	12.35	20	SNP	1.000	A
KCNN2	3781	genome.wustl.edu	37	5	113740533	113740533	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr5:113740533G>A	ENST00000512097.3	+	4	1999	c.981G>A	c.(979-981)tgG>tgA	p.W327*	KCNN2_ENST00000507750.1_Intron|KCNN2_ENST00000264773.3_Nonsense_Mutation_p.W327*			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	327					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	TTGCCGCATGGACTGTCCGAG	0.333																																						dbGAP											0													131.0	130.0	130.0					5																	113740533		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.981G>A	5.37:g.113740533G>A	ENSP00000427120:p.Trp327*		A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Nonsense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.W327*	ENST00000512097.3	37	c.981	CCDS4114.1	5	.	.	.	.	.	.	.	.	.	.	G	47	13.459870	0.99743	.	.	ENSG00000080709	ENST00000512097;ENST00000264773	.	.	.	5.54	5.54	0.83059	.	0.110120	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0303	19.0766	0.93165	0.0:0.0:1.0:0.0	.	.	.	.	X	327	.	ENSP00000264773:W327X	W	+	3	0	KCNN2	113768432	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.751000	0.98889	2.616000	0.88540	0.491000	0.48974	TGG	KCNN2	-	pfam_Ion_trans_2	ENSG00000080709		0.333	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	KCNN2	HGNC	protein_coding	OTTHUMT00000250775.2	101	0.00	0	G	NM_021614		113740533	113740533	+1	no_errors	ENST00000264773	ensembl	human	known	69_37n	nonsense	99	13.04	15	SNP	1.000	A
KIAA1715	80856	genome.wustl.edu	37	2	176857117	176857117	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr2:176857117T>A	ENST00000272748.4	-	4	346	c.99A>T	c.(97-99)gaA>gaT	p.E33D	KIAA1715_ENST00000544803.1_Missense_Mutation_p.E33D|KIAA1715_ENST00000466445.1_5'Flank|KIAA1715_ENST00000535310.1_5'UTR	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	33					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			TCTGATTTTTTTCCCTAAATT	0.259																																						dbGAP											0													69.0	74.0	72.0					2																	176857117		2202	4296	6498	-	-	-	SO:0001583	missense	0			AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.99A>T	2.37:g.176857117T>A	ENSP00000272748:p.Glu33Asp		B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	pfam_DUF2296	p.E33D	ENST00000272748.4	37	c.99	CCDS33332.1	2	.	.	.	.	.	.	.	.	.	.	T	9.137	1.012939	0.19277	.	.	ENSG00000144320	ENST00000272748;ENST00000544803;ENST00000392540;ENST00000445472	.	.	.	5.51	4.15	0.48705	.	0.255560	0.45126	D	0.000388	T	0.43389	0.1245	L	0.35854	1.095	0.80722	D	1	B;B	0.24675	0.023;0.109	B;B	0.20767	0.012;0.031	T	0.48019	-0.9071	9	0.87932	D	0	-12.9286	6.4267	0.21773	0.1319:0.1282:0.0:0.7399	.	33;33	B7ZLA8;Q9C0E8	.;LNP_HUMAN	D	33;33;28;33	.	ENSP00000272748:E33D	E	-	3	2	KIAA1715	176565363	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.409000	0.34680	2.095000	0.63458	0.377000	0.23210	GAA	KIAA1715	-	NULL	ENSG00000144320		0.259	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1715	HGNC	protein_coding	OTTHUMT00000333949.3	160	0.00	0	T	XM_042834		176857117	176857117	-1	no_errors	ENST00000544803	ensembl	human	known	69_37n	missense	84	20.00	21	SNP	0.997	A
KIF1A	547	genome.wustl.edu	37	2	241713623	241713623	+	Silent	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr2:241713623G>A	ENST00000320389.7	-	12	1172	c.1014C>T	c.(1012-1014)taC>taT	p.Y338Y	KIF1A_ENST00000498729.2_Silent_p.Y338Y	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	338	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGGTCTCATCGTAGTTGATGT	0.572																																						dbGAP											0													77.0	83.0	81.0					2																	241713623		2158	4257	6415	-	-	-	SO:0001819	synonymous_variant	0			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.1014C>T	2.37:g.241713623G>A			B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R146*	ENST00000320389.7	37	c.436	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	g	4.769	0.143015	0.09083	.	.	ENSG00000130294	ENST00000428768	.	.	.	4.33	-7.37	0.01412	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9351	0.79698	0.7896:0.0:0.2104:0.0	.	.	.	.	X	146	.	.	R	-	1	2	KIF1A	241362296	0.000000	0.05858	0.730000	0.30809	0.582000	0.36321	-1.710000	0.01888	-1.663000	0.01481	-0.372000	0.07161	CGA	KIF1A	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom	ENSG00000130294		0.572	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	49	0.00	0	G	NM_138483		241713623	241713623	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000428768	ensembl	human	novel	69_37n	nonsense	12	50.00	12	SNP	0.799	A
KIF21B	23046	genome.wustl.edu	37	1	200973933	200973933	+	Silent	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:200973933G>A	ENST00000422435.2	-	6	1177	c.861C>T	c.(859-861)ggC>ggT	p.G287G	KIF21B_ENST00000461742.2_Silent_p.G287G|KIF21B_ENST00000332129.2_Silent_p.G287G|KIF21B_ENST00000360529.5_Silent_p.G287G	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	287	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TGGCCCGCTCGCCAGTAGCCC	0.597																																						dbGAP											0													49.0	47.0	48.0					1																	200973933		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.861C>T	1.37:g.200973933G>A			B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.G287	ENST00000422435.2	37	c.861	CCDS58056.1	1																																																																																			KIF21B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000116852		0.597	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	HGNC	protein_coding	OTTHUMT00000382635.1	37	0.00	0	G	XM_371332		200973933	200973933	-1	no_errors	ENST00000422435	ensembl	human	known	69_37n	silent	42	41.10	30	SNP	1.000	A
KIF26B	55083	genome.wustl.edu	37	1	245850728	245850728	+	Silent	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:245850728C>T	ENST00000407071.2	+	12	4883	c.4443C>T	c.(4441-4443)gaC>gaT	p.D1481D	KIF26B_ENST00000366518.4_Silent_p.D1100D	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1481					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			AGGAGCAGGACGGAAAGCCCA	0.597																																						dbGAP											0													22.0	27.0	26.0					1																	245850728		2150	4253	6403	-	-	-	SO:0001819	synonymous_variant	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4443C>T	1.37:g.245850728C>T			Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D1481	ENST00000407071.2	37	c.4443	CCDS44342.1	1																																																																																			KIF26B	-	NULL	ENSG00000162849		0.597	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	16	0.00	0	C	XM_371354		245850728	245850728	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	0.001	T
KRTAP10-2	386679	genome.wustl.edu	37	21	45970680	45970680	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr21:45970680G>C	ENST00000391621.1	-	1	708	c.662C>G	c.(661-663)aCc>aGc	p.T221S	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	221	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						GCAGGAGGAGGTGCAGCAAGC	0.622																																						dbGAP											0													105.0	113.0	110.0					21																	45970680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.662C>G	21.37:g.45970680G>C	ENSP00000375479:p.Thr221Ser		Q70LJ5	Missense_Mutation	SNP	NULL	p.T221S	ENST00000391621.1	37	c.662	CCDS42955.1	21	.	.	.	.	.	.	.	.	.	.	g	0.665	-0.804330	0.02819	.	.	ENSG00000205445	ENST00000391621	T	0.01347	4.99	2.8	1.9	0.25705	.	.	.	.	.	T	0.01353	0.0044	N	0.25485	0.75	0.09310	N	1	P	0.35033	0.481	B	0.36335	0.222	T	0.50423	-0.8830	9	0.44086	T	0.13	.	5.5861	0.17275	0.1629:0.0:0.8371:0.0	.	221	P60368	KR102_HUMAN	S	221	ENSP00000375479:T221S	ENSP00000375479:T221S	T	-	2	0	KRTAP10-2	44795108	0.000000	0.05858	0.029000	0.17559	0.056000	0.15407	0.233000	0.17911	0.493000	0.27837	0.462000	0.41574	ACC	KRTAP10-2	-	NULL	ENSG00000205445		0.622	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-2	HGNC	protein_coding	OTTHUMT00000128027.1	95	0.00	0	G			45970680	45970680	-1	no_errors	ENST00000391621	ensembl	human	known	69_37n	missense	92	14.02	15	SNP	0.015	C
KRTAP10-7	386675	genome.wustl.edu	37	21	46020575	46020575	+	Silent	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr21:46020575C>T	ENST00000380102.2	+	1	79	c.54C>T	c.(52-54)cgC>cgT	p.R18R	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	18						keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						ACGGCAGCCGCGTCTGCCTTC	0.642																																						dbGAP											0													36.0	46.0	43.0					21																	46020575		2061	4187	6248	-	-	-	SO:0001819	synonymous_variant	0			AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.54C>T	21.37:g.46020575C>T			Q0VDJ8|Q70LJ2	Silent	SNP	NULL	p.R18	ENST00000380102.2	37	c.54		21																																																																																			KRTAP10-7	-	NULL	ENSG00000205441		0.642	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	KRTAP10-7	HGNC	protein_coding	OTTHUMT00000128038.1	154	0.00	0	C	NM_198689		46020575	46020575	+1	no_errors	ENST00000380102	ensembl	human	known	69_37n	silent	109	36.78	64	SNP	0.001	T
KRTAP4-16P	85354	genome.wustl.edu	37	17	39258148	39258148	+	Missense_Mutation	SNP	T	T	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr17:39258148T>G	ENST00000440582.1	-	1	313	c.314A>C	c.(313-315)cAc>cCc	p.H105P						keratin associated protein 4-16, pseudogene											haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						gcagctggggtggcagcagGT	0.652																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AC025904		17q21.2	2013-06-25	2010-01-06	2010-01-06	ENSG00000241241	ENSG00000241241		"""Keratin associated proteins"""	18921	pseudogene	pseudogene			"""keratin associated protein 4 pseudogene 1"""	KRTAP4P1			Standard	NG_005311		Approved	KAP4A			OTTHUMG00000133590	ENST00000440582.1:c.314A>C	17.37:g.39258148T>G	ENSP00000411198:p.His105Pro			Missense_Mutation	SNP	NULL	p.H105P	ENST00000440582.1	37	c.314		17	.	.	.	.	.	.	.	.	.	.	.	0.037	-1.303374	0.01353	.	.	ENSG00000241241	ENST00000440582	T	0.00637	6.05	2.5	-1.62	0.08372	.	.	.	.	.	T	0.00724	0.0024	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.44050	-0.9353	6	0.54805	T	0.06	.	4.1996	0.10460	0.0:0.4404:0.1718:0.3878	.	.	.	.	P	105	ENSP00000411198:H105P	ENSP00000411198:H105P	H	-	2	0	AC100808.7	36511674	0.000000	0.05858	0.004000	0.12327	0.029000	0.11900	-0.746000	0.04829	-0.936000	0.03723	-1.160000	0.01791	CAC	KRTAP4-16P	-	NULL	ENSG00000241241		0.652	KRTAP4-16P-001	PUTATIVE	basic|appris_principal	protein_coding	KRTAP4-16P	HGNC	protein_coding	OTTHUMT00000257694.1	21	0.00	0	T	NG_005311		39258148	39258148	-1	no_errors	ENST00000440582	ensembl	human	putative	69_37n	missense	14	34.78	8	SNP	0.001	G
LEO1	123169	genome.wustl.edu	37	15	52244140	52244140	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr15:52244140C>T	ENST00000299601.5	-	9	1572	c.1512G>A	c.(1510-1512)atG>atA	p.M504I	LEO1_ENST00000315141.5_Missense_Mutation_p.M444I	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	504					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		GTGACAGAGTCATCTTTCTAT	0.438																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	dbGAP											0													173.0	143.0	153.0					15																	52244140		2195	4293	6488	-	-	-	SO:0001583	missense	0			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1512G>A	15.37:g.52244140C>T	ENSP00000299601:p.Met504Ile		Q96N99	Missense_Mutation	SNP	pfam_Leo1	p.M504I	ENST00000299601.5	37	c.1512	CCDS10146.1	15	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224050	0.79576	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	L	0.35542	1.07	0.80722	D	1	B;P	0.48162	0.104;0.906	B;P	0.52109	0.135;0.69	T	0.55425	-0.8143	9	0.31617	T	0.26	.	19.6961	0.96026	0.0:1.0:0.0:0.0	.	444;504	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	I	504;482;444	.	ENSP00000299601:M504I	M	-	3	0	LEO1	50031432	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.629000	0.83207	2.654000	0.90174	0.650000	0.86243	ATG	LEO1	-	pfam_Leo1	ENSG00000166477		0.438	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	HGNC	protein_coding	OTTHUMT00000254791.2	135	0.00	0	C	NM_138792		52244140	52244140	-1	no_errors	ENST00000299601	ensembl	human	known	69_37n	missense	34	66.99	69	SNP	1.000	T
LGALSL	29094	genome.wustl.edu	37	2	64683480	64683480	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr2:64683480G>A	ENST00000238875.5	+	4	710	c.256G>A	c.(256-258)Gaa>Aaa	p.E86K	AC008074.3_ENST00000441630.1_RNA|LGALSL_ENST00000409537.2_Intron	NM_014181.2	NP_054900.2	Q3ZCW2	LEGL_HUMAN	lectin, galactoside-binding-like	86	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.					intracellular (GO:0005622)	carbohydrate binding (GO:0030246)										TGTGGCAATCGAACTCAAAGC	0.453																																						dbGAP											0													137.0	142.0	141.0					2																	64683480		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161508	CCDS1877.1	2p14	2011-08-15			ENSG00000119862	ENSG00000119862			25012	protein-coding gene	gene with protein product	"""galectin-related protein"""					11042152, 16682780	Standard	NM_014181		Approved	HSPC159, GRP	uc002scy.4	Q3ZCW2	OTTHUMG00000129541	ENST00000238875.5:c.256G>A	2.37:g.64683480G>A	ENSP00000238875:p.Glu86Lys		B2RBG8|D6W5E8|Q6P5T6|Q9P005	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.E86K	ENST00000238875.5	37	c.256	CCDS1877.1	2	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166122	0.57476	.	.	ENSG00000119862	ENST00000238875	T	0.04758	3.56	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.042775	0.85682	D	0.000000	T	0.04452	0.0122	L	0.31207	0.915	0.80722	D	1	P	0.44690	0.841	B	0.27380	0.079	T	0.48399	-0.9039	10	0.48119	T	0.1	-21.107	20.0203	0.97492	0.0:0.0:1.0:0.0	.	86	Q3ZCW2	LEGL_HUMAN	K	86	ENSP00000238875:E86K	ENSP00000238875:E86K	E	+	1	0	AC008074.1	64536984	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.998000	0.70653	2.730000	0.93505	0.655000	0.94253	GAA	LGALSL	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	ENSG00000119862		0.453	LGALSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALSL	HGNC	protein_coding	OTTHUMT00000251731.2	52	0.00	0	G	NM_014181		64683480	64683480	+1	no_errors	ENST00000238875	ensembl	human	novel	69_37n	missense	18	25.00	6	SNP	1.000	A
LRP1	4035	genome.wustl.edu	37	12	57595392	57595392	+	Silent	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr12:57595392C>T	ENST00000243077.3	+	66	10924	c.10458C>T	c.(10456-10458)ccC>ccT	p.P3486P		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3486	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GTGATGAGCCCGCCAACTGCA	0.642																																						dbGAP											0													90.0	78.0	82.0					12																	57595392		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.10458C>T	12.37:g.57595392C>T			Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.P3486	ENST00000243077.3	37	c.10458	CCDS8932.1	12																																																																																			LRP1	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000123384		0.642	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	50	0.00	0	C	NM_002332		57595392	57595392	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	silent	31	16.22	6	SNP	0.001	T
MOS	4342	genome.wustl.edu	37	8	57026280	57026280	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr8:57026280G>A	ENST00000311923.1	-	1	261	c.262C>T	c.(262-264)Caa>Taa	p.Q88*		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	88	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			TTGTTCACTTGCTTTATGGCC	0.577																																					Esophageal Squamous(124;373 2870 4778)	dbGAP											0													130.0	114.0	119.0					8																	57026280		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.262C>T	8.37:g.57026280G>A	ENSP00000310722:p.Gln88*		Q3KPG9|Q3KPH0	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q88*	ENST00000311923.1	37	c.262	CCDS6164.1	8	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561170	0.86335	.	.	ENSG00000172680	ENST00000311923	.	.	.	5.37	5.37	0.77165	.	0.150389	0.42053	D	0.000771	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.063	0.64810	0.0:0.0:0.8493:0.1507	.	.	.	.	X	88	.	ENSP00000310722:Q88X	Q	-	1	0	MOS	57188834	1.000000	0.71417	0.990000	0.47175	0.793000	0.44817	3.949000	0.56668	2.533000	0.85409	0.551000	0.68910	CAA	MOS	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000172680		0.577	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOS	HGNC	protein_coding	OTTHUMT00000378174.1	50	0.00	0	G	NM_005372		57026280	57026280	-1	no_errors	ENST00000311923	ensembl	human	known	69_37n	nonsense	56	12.50	8	SNP	1.000	A
MRPL51	51258	genome.wustl.edu	37	12	6602122	6602122	+	Silent	SNP	G	G	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr12:6602122G>T	ENST00000229238.3	-	2	557	c.96C>A	c.(94-96)atC>atA	p.I32I	NCAPD2_ENST00000545962.1_5'Flank|MRPL51_ENST00000543164.1_5'UTR|NCAPD2_ENST00000315579.5_5'Flank|MRPL51_ENST00000543703.1_Intron	NM_016497.3	NP_057581.2	Q4U2R6	RM51_HUMAN	mitochondrial ribosomal protein L51	32					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			kidney(2)|large_intestine(1)|lung(3)	6						GCCTTATACCGATCAATCTAG	0.517																																						dbGAP											0													81.0	85.0	83.0					12																	6602122		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051355	CCDS8547.1	12p13.3-p13.1	2014-02-19	2002-01-07	2002-01-11		ENSG00000111639		"""Mitochondrial ribosomal proteins / large subunits"""	14044	protein-coding gene	gene with protein product		611855	"""mitochondrial ribosomal protein 64"""	MRP64		11551941, 11543634	Standard	NM_016497		Approved	CDA09, HSPC241, bMRP64	uc001qom.2	Q4U2R6		ENST00000229238.3:c.96C>A	12.37:g.6602122G>T			Q96Q57|Q9BQ36|Q9P0N7	Silent	SNP	pfam_Ribosomal_L51_mit	p.I32	ENST00000229238.3	37	c.96	CCDS8547.1	12																																																																																			MRPL51	-	NULL	ENSG00000111639		0.517	MRPL51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL51	HGNC	protein_coding	OTTHUMT00000399956.1	108	0.00	0	G	NM_016497		6602122	6602122	-1	no_errors	ENST00000229238	ensembl	human	known	69_37n	silent	104	14.75	18	SNP	0.000	T
NEDD9	4739	genome.wustl.edu	37	6	11188468	11188468	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr6:11188468G>A	ENST00000379446.5	-	6	2144	c.1978C>T	c.(1978-1980)Cag>Tag	p.Q660*	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Nonsense_Mutation_p.Q660*	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	660					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			TGTTCCAGCTGCATCTTGTTC	0.378																																						dbGAP											0													366.0	293.0	318.0					6																	11188468		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.1978C>T	6.37:g.11188468G>A	ENSP00000368759:p.Gln660*		A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Nonsense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.Q660*	ENST00000379446.5	37	c.1978	CCDS4520.1	6	.	.	.	.	.	.	.	.	.	.	G	42	9.628250	0.99223	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	.	.	.	5.27	5.27	0.74061	.	0.049504	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-25.0281	15.823	0.78673	0.0:0.1453:0.8547:0.0	.	.	.	.	X	660	.	ENSP00000368759:Q660X	Q	-	1	0	NEDD9	11296454	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.988000	0.76212	2.640000	0.89533	0.650000	0.86243	CAG	NEDD9	-	pfam_CAS_DUF3513	ENSG00000111859		0.378	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD9	HGNC	protein_coding	OTTHUMT00000039853.2	310	0.32	1	G	NM_006403		11188468	11188468	-1	no_errors	ENST00000379446	ensembl	human	known	69_37n	nonsense	228	12.64	33	SNP	1.000	A
NFASC	23114	genome.wustl.edu	37	1	204937936	204937937	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:204937936_204937937insAT	ENST00000401399.1	+	9	1028_1029	c.829_830insAT	c.(829-831)gacfs	p.D277fs	NFASC_ENST00000338586.6_Frame_Shift_Ins_p.D277fs|NFASC_ENST00000539706.1_Frame_Shift_Ins_p.D288fs|NFASC_ENST00000367170.4_Frame_Shift_Ins_p.D277fs|NFASC_ENST00000513543.1_Frame_Shift_Ins_p.D288fs|NFASC_ENST00000367172.4_Frame_Shift_Ins_p.D277fs|NFASC_ENST00000404907.1_Frame_Shift_Ins_p.D288fs|NFASC_ENST00000403080.1_Frame_Shift_Ins_p.D277fs|NFASC_ENST00000339876.6_Frame_Shift_Ins_p.D277fs|NFASC_ENST00000404076.1_Frame_Shift_Ins_p.D271fs|NFASC_ENST00000367169.4_Frame_Shift_Ins_p.D277fs|NFASC_ENST00000360049.4_Frame_Shift_Ins_p.D288fs|NFASC_ENST00000367171.4_Frame_Shift_Ins_p.D277fs|NFASC_ENST00000338515.6_Frame_Shift_Ins_p.D277fs			O94856	NFASC_HUMAN	neurofascin	277	Ig-like C2-type 3.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCCAACACCAGACATCGCATGG	0.495																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	Exception_encountered	1.37:g.204937936_204937937insAT	ENSP00000385637:p.Asp277fs		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I278fs	ENST00000401399.1	37	c.829_830	CCDS53460.1	1																																																																																			NFASC	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000163531		0.495	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	86	0.00	0	-	NM_001005388		204937936	204937937	+1	no_errors	ENST00000367172	ensembl	human	known	69_37n	frame_shift_ins	133	20.83	35	INS	1.000:1.000	AT
NHP2	55651	genome.wustl.edu	37	5	177576773	177576773	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr5:177576773A>G	ENST00000274606.3	-	4	552	c.403T>C	c.(403-405)Tac>Cac	p.Y135H	RMND5B_ENST00000515098.1_3'UTR|NHP2_ENST00000314397.4_3'UTR	NM_017838.3	NP_060308.1	Q9NX24	NHP2_HUMAN	NHP2 ribonucleoprotein	135					rRNA pseudouridine synthesis (GO:0031118)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|kidney(1)|ovary(2)	4						GCCTCCTGGTACTCCTCATGG	0.597																																						dbGAP											0													59.0	65.0	63.0					5																	177576773		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161404	CCDS4432.1, CCDS34308.1	5q35.3	2014-09-17	2012-12-10	2008-10-13	ENSG00000145912	ENSG00000145912			14377	protein-coding gene	gene with protein product		606470	"""nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)"", ""NHP2 ribonucleoprotein homolog (yeast)"""	NOLA2		11074001	Standard	NM_017838		Approved	FLJ20479	uc003mir.2	Q9NX24	OTTHUMG00000130886	ENST00000274606.3:c.403T>C	5.37:g.177576773A>G	ENSP00000274606:p.Tyr135His		A6NKY8|Q9P095	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45,prints_Ribosomal_L7Ae/L8/Nhp2,prints_H/ACA_rnp_Nhp2_euk	p.Y135H	ENST00000274606.3	37	c.403	CCDS4432.1	5	.	.	.	.	.	.	.	.	.	.	a	27.8	4.864264	0.91511	.	.	ENSG00000145912	ENST00000274606	T	0.57595	0.39	5.55	5.55	0.83447	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	T	0.72875	0.3515	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75388	-0.3335	10	0.49607	T	0.09	-17.7862	13.6549	0.62333	1.0:0.0:0.0:0.0	.	135	Q9NX24	NHP2_HUMAN	H	135	ENSP00000274606:Y135H	ENSP00000274606:Y135H	Y	-	1	0	NHP2	177509379	1.000000	0.71417	0.947000	0.38551	0.969000	0.65631	9.152000	0.94680	2.100000	0.63781	0.533000	0.62120	TAC	NHP2	-	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	ENSG00000145912		0.597	NHP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHP2	HGNC	protein_coding	OTTHUMT00000253471.1	61	0.00	0	A	NM_017838		177576773	177576773	-1	no_errors	ENST00000274606	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	G
NR4A1	3164	genome.wustl.edu	37	12	52448565	52448565	+	Silent	SNP	C	C	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr12:52448565C>G	ENST00000243050.1	+	3	767	c.453C>G	c.(451-453)ctC>ctG	p.L151L	NR4A1_ENST00000545748.1_Silent_p.L205L|NR4A1_ENST00000550082.1_Silent_p.L164L|NR4A1_ENST00000394824.2_Silent_p.L151L|NR4A1_ENST00000360284.3_Silent_p.L164L|NR4A1_ENST00000394825.1_Silent_p.L151L|NR4A1_ENST00000548232.1_Silent_p.L151L	NM_002135.4	NP_002126.2	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	151					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CGCCCCAGCTCTCTCCCTGGG	0.682																																						dbGAP											0													27.0	32.0	30.0					12																	52448565		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000243050.1:c.453C>G	12.37:g.52448565C>G			B4DML7|Q15627|Q53Y00|Q6IBU8	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Nuc_orph_rcpt,prints_Nuc_orp_HMR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.L205	ENST00000243050.1	37	c.615	CCDS8818.1	12																																																																																			NR4A1	-	prints_Nuc_orph_rcpt	ENSG00000123358		0.682	NR4A1-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NR4A1	HGNC	protein_coding	OTTHUMT00000317922.2	58	0.00	0	C			52448565	52448565	+1	no_errors	ENST00000545748	ensembl	human	known	69_37n	silent	37	32.73	18	SNP	0.987	G
OBSCN	84033	genome.wustl.edu	37	1	228547542	228547542	+	Intron	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:228547542G>A	ENST00000422127.1	+	80	18705				OBSCN_ENST00000366709.4_Missense_Mutation_p.G3436R|OBSCN_ENST00000570156.2_Intron|OBSCN_ENST00000284548.11_Missense_Mutation_p.G6317R|OBSCN_ENST00000366707.4_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGCTCTGCCCGGACTCTCGGG	0.672																																						dbGAP											0													14.0	17.0	16.0					1																	228547542		1949	4114	6063	-	-	-	SO:0001627	intron_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18662-2735G>A	1.37:g.228547542G>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Ig-like,pfscan_DH-domain	p.G3436R	ENST00000422127.1	37	c.10306	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	2.560	-0.302014	0.05495	.	.	ENSG00000154358	ENST00000284548;ENST00000366709	T;T	0.55413	0.52;0.67	3.83	-4.72	0.03269	.	.	.	.	.	T	0.23014	0.0556	N	0.05124	-0.11	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.25502	-1.0130	9	0.13108	T	0.6	.	6.9978	0.24793	0.39:0.2399:0.3702:0.0	.	6317	Q5VST9-3	.	R	6317;3436	ENSP00000284548:G6317R;ENSP00000355670:G3436R	ENSP00000284548:G6317R	G	+	1	0	OBSCN	226614165	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.151000	0.10175	-1.229000	0.02564	-0.347000	0.07816	GGA	OBSCN	-	NULL	ENSG00000154358		0.672	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		18	0.00	0	G	NM_052843		228547542	228547542	+1	no_errors	ENST00000366709	ensembl	human	known	69_37n	missense	8	46.67	7	SNP	0.000	A
OR10H2	26538	genome.wustl.edu	37	19	15838899	15838899	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr19:15838899G>A	ENST00000305899.3	+	1	66	c.46G>A	c.(46-48)Ggc>Agc	p.G16S		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					CATCCTCGTCGGCTTCTCTGC	0.562																																						dbGAP											0													282.0	244.0	257.0					19																	15838899		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.46G>A	19.37:g.15838899G>A	ENSP00000306095:p.Gly16Ser		Q6IFQ1|Q96R58	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G16S	ENST00000305899.3	37	c.46	CCDS12333.1	19	.	.	.	.	.	.	.	.	.	.	.	7.986	0.752230	0.15778	.	.	ENSG00000171942	ENST00000305899	T	0.00653	5.96	2.88	0.672	0.17935	.	0.000000	0.50627	D	0.000114	T	0.01353	0.0044	M	0.93375	3.41	0.20764	N	0.999858	P	0.39060	0.657	B	0.34346	0.18	T	0.37776	-0.9691	10	0.48119	T	0.1	.	6.6872	0.23152	0.2541:0.0:0.7459:0.0	.	16	O60403	O10H2_HUMAN	S	16	ENSP00000306095:G16S	ENSP00000306095:G16S	G	+	1	0	OR10H2	15699899	1.000000	0.71417	0.842000	0.33263	0.070000	0.16714	2.068000	0.41471	0.028000	0.15324	-0.255000	0.11280	GGC	OR10H2	-	NULL	ENSG00000171942		0.562	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H2	HGNC	protein_coding	OTTHUMT00000460917.1	557	0.00	0	G			15838899	15838899	+1	no_errors	ENST00000305899	ensembl	human	known	69_37n	missense	582	20.82	153	SNP	0.326	A
PCDHA2	56146	genome.wustl.edu	37	5	140176837	140176838	+	Frame_Shift_Ins	INS	-	-	C	rs558931090		TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr5:140176837_140176838insC	ENST00000526136.1	+	1	2288_2289	c.2288_2289insC	c.(2287-2292)gaccccfs	p.DP763fs	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Frame_Shift_Ins_p.DP763fs|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Frame_Shift_Ins_p.DP763fs	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	763	5 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTGGGGAGGACCCCCCCAAGA	0.619																																						dbGAP											0									,,,	8,4254		0,8,2123					,,,	3.1	0.9			49	7,8247		0,7,4120	no	frameshift,intron,frameshift,intron	PCDHA2,PCDHA1	NM_031495.1,NM_031411.1,NM_018905.2,NM_018900.2	,,,	0,15,6243	A1A1,A1R,RR		0.0848,0.1877,0.1198	,,,	,,,		15,12501				-	-	-	SO:0001589	frameshift_variant	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.2295dupC	5.37:g.140176844_140176844dupC	ENSP00000431748:p.Asp763fs		O75287|Q9BTV3	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.K766fs	ENST00000526136.1	37	c.2288_2289	CCDS54914.1	5																																																																																			PCDHA2	-	NULL	ENSG00000204969		0.619	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	64	0.00	0	-	NM_018905		140176837	140176838	+1	no_errors	ENST00000526136	ensembl	human	known	69_37n	frame_shift_ins	23	17.86	5	INS	0.292:0.004	C
PCDHA9	9752	genome.wustl.edu	37	5	140228577	140228577	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr5:140228577C>T	ENST00000532602.1	+	1	1530	c.497C>T	c.(496-498)gCc>gTc	p.A166V	PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.A166V|PCDHA4_ENST00000512229.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	166	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGAGAACGCCCTGCTCACT	0.522																																					Melanoma(55;1800 1972 14909)	dbGAP											0													24.0	22.0	23.0					5																	140228577		2196	4254	6450	-	-	-	SO:0001583	missense	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.497C>T	5.37:g.140228577C>T	ENSP00000436042:p.Ala166Val		O15053|Q2M3S5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A166V	ENST00000532602.1	37	c.497	CCDS54920.1	5	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977411	0.74360	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.22743	1.94;1.94	4.13	4.13	0.48395	Cadherin (4);Cadherin-like (1);	0.295611	0.17113	U	0.186539	T	0.56262	0.1973	M	0.91663	3.23	0.27500	N	0.95202	D;D	0.89917	0.973;1.0	P;D	0.87578	0.864;0.998	T	0.58081	-0.7699	10	0.87932	D	0	.	16.9231	0.86168	0.0:1.0:0.0:0.0	.	166;166	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	V	166	ENSP00000436042:A166V;ENSP00000367362:A166V	ENSP00000367362:A166V	A	+	2	0	PCDHA9	140208761	0.041000	0.20044	0.696000	0.30242	0.510000	0.34073	2.398000	0.44486	2.263000	0.75096	0.591000	0.81541	GCC	PCDHA9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204961		0.522	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	34	0.00	0	C	NM_031857		140228577	140228577	+1	no_errors	ENST00000532602	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.980	T
PDS5A	23244	genome.wustl.edu	37	4	39924337	39924337	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr4:39924337T>C	ENST00000303538.8	-	6	1098	c.559A>G	c.(559-561)Atg>Gtg	p.M187V	PDS5A_ENST00000503396.1_Missense_Mutation_p.M187V	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						AAATCTAGCATGTGCATTTGT	0.343																																						dbGAP											0													115.0	102.0	106.0					4																	39924337		1872	4096	5968	-	-	-	SO:0001583	missense	0			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.559A>G	4.37:g.39924337T>C	ENSP00000303427:p.Met187Val			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M187V	ENST00000303538.8	37	c.559	CCDS47045.1	4	.	.	.	.	.	.	.	.	.	.	T	22.8	4.343144	0.82022	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T;T	0.66280	0.0;-0.2	5.75	5.75	0.90469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77565	0.4149	M	0.66939	2.045	0.80722	D	1	D;D	0.57257	0.968;0.979	P;D	0.75484	0.839;0.986	T	0.77125	-0.2703	9	.	.	.	-16.6373	16.3473	0.83146	0.0:0.0:0.0:1.0	.	187;187	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	V	187	ENSP00000303427:M187V;ENSP00000426749:M187V	.	M	-	1	0	PDS5A	39600732	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.997000	0.88414	2.320000	0.78422	0.528000	0.53228	ATG	PDS5A	-	superfamily_ARM-type_fold	ENSG00000121892		0.343	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1	117	0.00	0	T	NM_015200		39924337	39924337	-1	no_errors	ENST00000303538	ensembl	human	known	69_37n	missense	81	25.69	28	SNP	1.000	C
PHLDA1	22822	genome.wustl.edu	37	12	76424354	76424354	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr12:76424354C>G	ENST00000266671.5	-	1	3358	c.1168G>C	c.(1168-1170)Ggg>Cgg	p.G390R	RP11-290L1.3_ENST00000552367.1_RNA|PHLDA1_ENST00000602540.1_Missense_Mutation_p.G249R|RP11-290L1.2_ENST00000547721.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	390					apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				AGCCGGTGCCCgtgcggctgc	0.662																																						dbGAP											0													64.0	60.0	61.0					12																	76424354		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.1168G>C	12.37:g.76424354C>G	ENSP00000266671:p.Gly390Arg		A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.G390R	ENST00000266671.5	37	c.1168	CCDS31861.1	12	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587970	0.66105	.	.	ENSG00000139289	ENST00000266671;ENST00000421361	D	0.81739	-1.53	4.92	4.92	0.64577	.	0.156285	0.39341	N	0.001396	D	0.83478	0.5263	L	0.29908	0.895	0.39097	D	0.961206	D	0.89917	1.0	D	0.97110	1.0	D	0.85909	0.1439	10	0.87932	D	0	-11.5232	13.4933	0.61408	0.0:1.0:0.0:0.0	.	390	Q8WV24	PHLA1_HUMAN	R	390;208	ENSP00000266671:G390R	ENSP00000266671:G390R	G	-	1	0	PHLDA1	74710621	0.660000	0.27420	1.000000	0.80357	0.942000	0.58702	1.863000	0.39459	2.573000	0.86826	0.561000	0.74099	GGG	PHLDA1	-	NULL	ENSG00000139289		0.662	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHLDA1	HGNC	protein_coding	OTTHUMT00000405846.2	504	0.20	1	C	NM_007350		76424354	76424354	-1	no_errors	ENST00000266671	ensembl	human	known	69_37n	missense	220	22.46	64	SNP	1.000	G
PLA2G4A	5321	genome.wustl.edu	37	1	186880523	186880523	+	Splice_Site	SNP	T	T	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:186880523T>A	ENST00000367466.3	+	7	710		c.e7+2		PLA2G4A_ENST00000442353.2_Intron|PLA2G4A_ENST00000466600.1_Splice_Site	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)						arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	GCACGTGATGTGAGTTGGAAA	0.353																																						dbGAP											0													92.0	95.0	94.0					1																	186880523		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.558+2T>A	1.37:g.186880523T>A			B1AKG4|Q29R80	Splice_Site	SNP	-	e6+2	ENST00000367466.3	37	c.558+2	CCDS1372.1	1	.	.	.	.	.	.	.	.	.	.	T	12.52	1.962459	0.34659	.	.	ENSG00000116711	ENST00000367466	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.841	0.57802	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLA2G4A	185147146	1.000000	0.71417	1.000000	0.80357	0.232000	0.25224	4.530000	0.60595	1.973000	0.57446	0.528000	0.53228	.	PLA2G4A	-	-	ENSG00000116711		0.353	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4A	HGNC	protein_coding	OTTHUMT00000086236.1	117	0.00	0	T	NM_024420	Intron	186880523	186880523	+1	no_errors	ENST00000367466	ensembl	human	known	69_37n	splice_site	106	15.87	20	SNP	1.000	A
PLCH1	23007	genome.wustl.edu	37	3	155303908	155303908	+	Silent	SNP	C	C	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr3:155303908C>A	ENST00000340059.7	-	4	509	c.510G>T	c.(508-510)ctG>ctT	p.L170L	PLCH1_ENST00000494598.1_Silent_p.L170L|PLCH1_ENST00000447496.2_Silent_p.L170L|PLCH1_ENST00000414191.1_Silent_p.L152L|PLCH1_ENST00000460012.1_Silent_p.L152L|PLCH1_ENST00000334686.6_Silent_p.L152L	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	170	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GTTTATGCATCAGCTGATGTA	0.398																																						dbGAP											0													134.0	127.0	130.0					3																	155303908		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.510G>T	3.37:g.155303908C>A			Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.L170	ENST00000340059.7	37	c.510	CCDS46939.1	3																																																																																			PLCH1	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000114805		0.398	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	108	0.00	0	C	NM_014996		155303908	155303908	-1	no_errors	ENST00000340059	ensembl	human	known	69_37n	silent	43	36.76	25	SNP	0.999	A
PLEKHM3	389072	genome.wustl.edu	37	2	208841408	208841408	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr2:208841408G>A	ENST00000427836.2	-	3	2002	c.1513C>T	c.(1513-1515)Cga>Tga	p.R505*	PLEKHM3_ENST00000389247.4_Nonsense_Mutation_p.R505*|PLEKHM3_ENST00000457206.1_Nonsense_Mutation_p.R505*	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	505					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GTGAGTCCTCGTTCCAAAGAC	0.443																																						dbGAP											0													70.0	68.0	69.0					2																	208841408		1927	4134	6061	-	-	-	SO:0001587	stop_gained	0			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.1513C>T	2.37:g.208841408G>A	ENSP00000417003:p.Arg505*		B9EKV2|Q8WW68	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R505*	ENST00000427836.2	37	c.1513	CCDS42808.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.132439|10.132439	0.99343|0.99343	.|.	.|.	ENSG00000178385|ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206|ENST00000447645	.|.	.|.	.|.	5.52|5.52	3.59|3.59	0.41128|0.41128	.|.	0.047958|.	0.85682|.	D|.	0.000000|.	.|T	.|0.62551	.|0.2437	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70378	.|-0.4888	.|3	0.02654|.	T|.	1|.	.|.	13.6414|13.6414	0.62253|0.62253	0.0:0.0:0.5704:0.4296|0.0:0.0:0.5704:0.4296	.|.	.|.	.|.	.|.	X|M	505|256	.|.	ENSP00000373899:R505X|.	R|T	-|-	1|2	2|0	PLEKHM3|PLEKHM3	208549653|208549653	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.267000|4.267000	0.58877|0.58877	1.433000|1.433000	0.47394|0.47394	0.655000|0.655000	0.94253|0.94253	CGA|ACG	PLEKHM3	-	NULL	ENSG00000178385		0.443	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM3	HGNC	protein_coding	OTTHUMT00000337036.1	177	0.00	0	G	NM_001080475		208841408	208841408	-1	no_errors	ENST00000427836	ensembl	human	known	69_37n	nonsense	70	51.05	73	SNP	1.000	A
PTPRS	5802	genome.wustl.edu	37	19	5212055	5212055	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr19:5212055C>T	ENST00000587303.1	-	31	5075	c.4976G>A	c.(4975-4977)cGc>cAc	p.R1659H	PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000348075.2_Missense_Mutation_p.R1621H|PTPRS_ENST00000262963.6_Missense_Mutation_p.R1639H|PTPRS_ENST00000372412.4_Missense_Mutation_p.R1660H|PTPRS_ENST00000588012.1_Missense_Mutation_p.R1621H|PTPRS_ENST00000592099.1_Missense_Mutation_p.R1212H|PTPRS_ENST00000353284.2_Missense_Mutation_p.R1212H|PTPRS_ENST00000357368.4_Missense_Mutation_p.R1659H			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1659					cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	ATAGAGGCTGCGTGCGGGCAC	0.627																																						dbGAP											0													60.0	55.0	56.0					19																	5212055		2203	4300	6503	-	-	-	SO:0001583	missense	0			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4976G>A	19.37:g.5212055C>T	ENSP00000467537:p.Arg1659His		O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like	p.R1660H	ENST00000587303.1	37	c.4979	CCDS45930.1	19	.	.	.	.	.	.	.	.	.	.	C	15.32	2.799618	0.50208	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	2.47	2.47	0.30058	.	0.000000	0.64402	U	0.000006	T	0.61311	0.2337	M	0.91300	3.195	0.80722	D	1	D;P;D;P;D;D	0.89917	1.0;0.945;1.0;0.945;0.999;1.0	D;B;D;B;D;D	0.87578	0.998;0.291;0.996;0.291;0.99;0.987	T	0.72827	-0.4175	10	0.87932	D	0	.	13.3072	0.60359	0.0:1.0:0.0:0.0	.	1241;1212;1216;1621;1659;1254	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	H	1254;1660;1659;1659;1650;1639;1621;1241;1216;1212	ENSP00000361489:R1660H;ENSP00000349932:R1659H;ENSP00000262963:R1639H;ENSP00000269907:R1621H;ENSP00000327313:R1212H	ENSP00000262963:R1639H	R	-	2	0	PTPRS	5163055	1.000000	0.71417	0.947000	0.38551	0.475000	0.33008	7.528000	0.81941	1.399000	0.46721	0.478000	0.44815	CGC	PTPRS	-	NULL	ENSG00000105426		0.627	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2	34	0.00	0	C			5212055	5212055	-1	no_errors	ENST00000372412	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	T
RIN2	54453	genome.wustl.edu	37	20	19945639	19945639	+	Missense_Mutation	SNP	C	C	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr20:19945639C>G	ENST00000255006.6	+	6	803	c.654C>G	c.(652-654)ttC>ttG	p.F218L	RIN2_ENST00000484638.1_Intron|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	169					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						CAGATTTATTCCGGCTCATTG	0.473																																						dbGAP											0													177.0	162.0	166.0					20																	19945639		1866	4106	5972	-	-	-	SO:0001583	missense	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.654C>G	20.37:g.19945639C>G	ENSP00000255006:p.Phe218Leu		Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.F218L	ENST00000255006.6	37	c.654	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398485	0.83120	.	.	ENSG00000132669	ENST00000255006	T	0.39787	1.06	5.64	5.64	0.86602	SH2 motif (3);	0.000000	0.85682	D	0.000000	T	0.64360	0.2591	M	0.69185	2.1	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.61950	-0.6957	9	.	.	.	-31.0831	19.3045	0.94155	0.0:1.0:0.0:0.0	.	169	Q8WYP3	RIN2_HUMAN	L	218	ENSP00000255006:F218L	.	F	+	3	2	RIN2	19893639	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.110000	0.50352	2.639000	0.89480	0.655000	0.94253	TTC	RIN2	-	pfscan_SH2	ENSG00000132669		0.473	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	257	0.00	0	C			19945639	19945639	+1	no_errors	ENST00000255006	ensembl	human	known	69_37n	missense	105	54.74	127	SNP	1.000	G
RIN2	54453	genome.wustl.edu	37	20	19956393	19956394	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr20:19956393_19956394insC	ENST00000255006.6	+	8	2020_2021	c.1871_1872insC	c.(1870-1875)gaccccfs	p.DP624fs	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Intron	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	575	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						TCGGAGCTGGACCCCCCCATCG	0.495																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1878dupC	20.37:g.19956400_19956400dupC	ENSP00000255006:p.Asp624fs		Q00425|Q5TFT8|Q9BQL3|Q9H071	Frame_Shift_Ins	INS	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.I627fs	ENST00000255006.6	37	c.1871_1872	CCDS56182.1	20																																																																																			RIN2	-	NULL	ENSG00000132669		0.495	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	24	0.00	0	-			19956393	19956394	+1	no_errors	ENST00000255006	ensembl	human	known	69_37n	frame_shift_ins	17	15.00	3	INS	1.000:0.882	C
SHROOM2	357	genome.wustl.edu	37	X	9864432	9864433	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chrX:9864432_9864433insC	ENST00000380913.3	+	4	2574_2575	c.2484_2485insC	c.(2485-2487)ccgfs	p.P829fs		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	829					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				AGCCAGAGAGGCCGCGGACAGC	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2486dupC	X.37:g.9864434_9864434dupC	ENSP00000370299:p.Pro829fs		B9EIQ7	Frame_Shift_Ins	INS	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R829fs	ENST00000380913.3	37	c.2484_2485	CCDS14135.1	X																																																																																			SHROOM2	-	NULL	ENSG00000146950		0.629	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	31	0.00	0	-	NM_001649		9864432	9864433	+1	no_errors	ENST00000380913	ensembl	human	known	69_37n	frame_shift_ins	15	21.05	4	INS	0.001:0.020	C
SMTNL1	219537	genome.wustl.edu	37	11	57308982	57308982	+	5'Flank	SNP	C	C	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr11:57308982C>A	ENST00000399154.2	+	0	0				SMTNL1_ENST00000457912.1_Missense_Mutation_p.L2I|SMTNL1_ENST00000527972.1_5'Flank			A8MU46	SMTL1_HUMAN	smoothelin-like 1						negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						TACCCCCATGCTCCCGGGGGC	0.522																																						dbGAP											0													98.0	101.0	100.0					11																	57308982		1947	4134	6081	-	-	-	SO:0001631	upstream_gene_variant	0			BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46			11.37:g.57308982C>A	Exception_encountered			Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.L2I	ENST00000399154.2	37	c.4		11	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472726	0.26423	.	.	ENSG00000214872	ENST00000457912	D	0.93426	-3.22	4.07	-0.0561	0.13806	.	.	.	.	.	D	0.85492	0.5709	.	.	.	0.09310	N	1	B	0.21309	0.054	B	0.15870	0.014	T	0.72530	-0.4265	8	0.36615	T	0.2	.	3.7506	0.08565	0.0:0.4852:0.1851:0.3297	.	2	C9J621	.	I	2	ENSP00000406485:L2I	ENSP00000406485:L2I	L	+	1	0	SMTNL1	57065558	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.555000	0.02170	0.006000	0.14734	-0.145000	0.13849	CTC	SMTNL1	-	NULL	ENSG00000214872		0.522	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	SMTNL1	HGNC	protein_coding		83	0.00	0	C	XM_166203		57308982	57308982	+1	no_errors	ENST00000457912	ensembl	human	known	69_37n	missense	50	18.03	11	SNP	0.000	A
SORCS1	114815	genome.wustl.edu	37	10	108339234	108339234	+	Splice_Site	SNP	T	T	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr10:108339234T>G	ENST00000263054.6	-	25	3273		c.e25-2		SORCS1_ENST00000344440.6_Splice_Site|SORCS1_ENST00000369698.1_Splice_Site	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1						neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCAGGGGGGCTTGTGGGGGAA	0.532																																						dbGAP											0													57.0	50.0	52.0					10																	108339234		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.3266-2A>C	10.37:g.108339234T>G			A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Splice_Site	SNP	-	e25-2	ENST00000263054.6	37	c.3266-2	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	T	11.41	1.629912	0.28978	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000452214;ENST00000344440	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.991	0.80206	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SORCS1	108329224	1.000000	0.71417	0.783000	0.31826	0.053000	0.15095	7.614000	0.82996	2.239000	0.73571	0.416000	0.27883	.	SORCS1	-	-	ENSG00000108018		0.532	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	214	0.00	0	T	NM_052918	Intron	108339234	108339234	-1	no_errors	ENST00000344440	ensembl	human	known	69_37n	splice_site	144	25.39	49	SNP	0.998	G
SPARCL1	8404	genome.wustl.edu	37	4	88414874	88414874	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr4:88414874C>T	ENST00000282470.6	-	4	1548	c.1078G>A	c.(1078-1080)Gac>Aac	p.D360N	SPARCL1_ENST00000503414.1_Missense_Mutation_p.D235N|SPARCL1_ENST00000418378.1_Missense_Mutation_p.D360N	NM_004684.4	NP_004675.3	Q14515	SPRL1_HUMAN	SPARC-like 1 (hevin)	360					signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(2)	21				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		ATGAAGTAGTCATCACTTGCA	0.488																																						dbGAP											0													106.0	96.0	99.0					4																	88414874		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86693	CCDS3622.1	4q22-q25	2013-01-10	2008-08-29		ENSG00000152583	ENSG00000152583		"""EF-hand domain containing"""	11220	protein-coding gene	gene with protein product		606041	"""SPARC-like 1 (mast9, hevin)"""			8488563, 7600298, 16844696	Standard	NM_001128310		Approved	MAST9	uc003hqs.4	Q14515	OTTHUMG00000130605	ENST00000282470.6:c.1078G>A	4.37:g.88414874C>T	ENSP00000282470:p.Asp360Asn		B4E2Z0|E7ESU2|Q14800	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,pfam_Follistatin/Osteonectin_EGF,smart_Fol_N,smart_Prot_inh_Kazal,pirsf_SPARC-like_p1,pfscan_EF_HAND_2	p.D360N	ENST00000282470.6	37	c.1078	CCDS3622.1	4	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967734	0.53507	.	.	ENSG00000152583	ENST00000282470;ENST00000418378;ENST00000438050;ENST00000503414	D;D;D	0.90444	-2.67;-2.67;-2.67	4.32	4.32	0.51571	.	0.597488	0.18584	N	0.136948	D	0.83519	0.5272	N	0.24115	0.695	0.25572	N	0.986882	B;B	0.25390	0.125;0.125	B;B	0.20184	0.028;0.028	T	0.76041	-0.3104	10	0.54805	T	0.06	-14.1411	12.6178	0.56586	0.0:1.0:0.0:0.0	.	360;360	Q8N4S1;Q14515	.;SPRL1_HUMAN	N	360;360;235;235	ENSP00000282470:D360N;ENSP00000414856:D360N;ENSP00000422903:D235N	ENSP00000282470:D360N	D	-	1	0	SPARCL1	88633898	0.065000	0.20965	0.538000	0.28064	0.171000	0.22731	1.658000	0.37376	2.689000	0.91719	0.655000	0.94253	GAC	SPARCL1	-	pirsf_SPARC-like_p1	ENSG00000152583		0.488	SPARCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARCL1	HGNC	protein_coding	OTTHUMT00000253059.2	139	0.00	0	C			88414874	88414874	-1	no_errors	ENST00000282470	ensembl	human	known	69_37n	missense	117	18.18	26	SNP	0.613	T
SSTR2	6752	genome.wustl.edu	37	17	71165918	71165918	+	Missense_Mutation	SNP	A	A	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr17:71165918A>G	ENST00000357585.2	+	2	829	c.460A>G	c.(460-462)Agg>Ggg	p.R154G	SSTR2_ENST00000315332.2_Missense_Mutation_p.R154G|RP11-143K11.5_ENST00000580671.1_RNA	NM_001050.2	NP_001041.1	P30874	SSR2_HUMAN	somatostatin receptor 2	154					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|peristalsis (GO:0030432)|regulation of muscle contraction (GO:0006937)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|somatostatin receptor activity (GO:0004994)			endometrium(2)|large_intestine(5)|lung(2)|prostate(2)	11			LUSC - Lung squamous cell carcinoma(166;0.197)		Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	GGCCAAGTGGAGGAGACCCCG	0.562																																						dbGAP											0													79.0	70.0	73.0					17																	71165918		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11691.1	17q24	2012-08-08				ENSG00000180616		"""GPCR / Class A : Somatostatin receptors"""	11331	protein-coding gene	gene with protein product		182452				8449518	Standard	NM_001050		Approved		uc002jje.3	P30874		ENST00000357585.2:c.460A>G	17.37:g.71165918A>G	ENSP00000350198:p.Arg154Gly		A8K3Y0|B2R9P7|Q4VBP0|Q96GE0|Q96TF2|Q9BWH1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Somatstn_rcpt_2,prints_7TM_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Neuropept_W_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt,prints_Somatstn_rcpt_5	p.R154G	ENST00000357585.2	37	c.460	CCDS11691.1	17	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485565	0.63962	.	.	ENSG00000180616	ENST00000357585;ENST00000315332	T;T	0.39406	1.08;1.08	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75206	0.3818	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83396	0.0020	10	0.87932	D	0	.	15.7969	0.78420	1.0:0.0:0.0:0.0	.	154	P30874	SSR2_HUMAN	G	154	ENSP00000350198:R154G;ENSP00000326616:R154G	ENSP00000326616:R154G	R	+	1	2	SSTR2	68677513	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.235000	0.51328	2.207000	0.71202	0.533000	0.62120	AGG	SSTR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Opioid_rcpt	ENSG00000180616		0.562	SSTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR2	HGNC	protein_coding	OTTHUMT00000441633.1	111	0.00	0	A			71165918	71165918	+1	no_errors	ENST00000357585	ensembl	human	known	69_37n	missense	12	65.71	23	SNP	1.000	G
ST20	400410	genome.wustl.edu	37	15	80191306	80191306	+	Silent	SNP	C	C	A	rs562070889	byFrequency	TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr15:80191306C>A	ENST00000478497.1	-	3	886	c.207G>T	c.(205-207)acG>acT	p.T69T	MTHFS_ENST00000258874.3_5'Flank|ST20-MTHFS_ENST00000479961.1_Intron|MTHFS_ENST00000559722.1_5'Flank|ST20_ENST00000485386.1_Silent_p.T69T|ST20_ENST00000562759.1_Silent_p.T69T|ST20-MTHFS_ENST00000494999.1_Intron	NM_001100879.1	NP_001094349.1	Q9HBF5	ST20_HUMAN	suppressor of tumorigenicity 20	69					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						CAATCGTTTTCGTAAGAGTCA	0.363																																						dbGAP											0													105.0	107.0	106.0					15																	80191306		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF249277	CCDS42067.1	15q25.1	2007-07-16				ENSG00000180953			33520	protein-coding gene	gene with protein product							Standard	NM_001100879		Approved	HCCS-1		Q9HBF5		ENST00000478497.1:c.207G>T	15.37:g.80191306C>A				Silent	SNP	NULL	p.T69	ENST00000478497.1	37	c.207	CCDS42067.1	15																																																																																			ST20	-	NULL	ENSG00000180953		0.363	ST20-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ST20	HGNC	protein_coding	OTTHUMT00000416728.2	106	0.00	0	C			80191306	80191306	-1	no_errors	ENST00000478497	ensembl	human	known	69_37n	silent	47	26.15	17	SNP	0.000	A
SULT1A4	445329	genome.wustl.edu	37	16	29472811	29472811	+	Silent	SNP	A	A	G	rs150339073		TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr16:29472811A>G	ENST00000360423.7	+	2	206	c.105A>G	c.(103-105)caA>caG	p.Q35Q	SULT1A4_ENST00000565290.1_Silent_p.Q35Q|SNX29P2_ENST00000398878.3_lincRNA|SLX1B-SULT1A4_ENST00000564950.1_RNA|SULT1A4_ENST00000344620.6_Silent_p.Q35Q|SULT1A4_ENST00000395400.3_Silent_p.Q35Q	NM_001017390.2	NP_001017390.1	P0DMN0	ST1A4_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4	35					catecholamine metabolic process (GO:0006584)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	aryl sulfotransferase activity (GO:0004062)										AGAGCTTCCAAGCCCGACCTG	0.627																																						dbGAP											0													2.0	2.0	2.0					16																	29472811		1105	2210	3315	-	-	-	SO:0001819	synonymous_variant	0			L34160	CCDS32427.1	16p11.2	2013-05-10			ENSG00000213648	ENSG00000213648	2.8.2.1	"""Sulfotransferases, cytosolic"""	30004	protein-coding gene	gene with protein product		615819				15358107, 15752422	Standard	NM_001017390		Approved		uc002dxk.3	P0DMN0	OTTHUMG00000170468	ENST00000360423.7:c.105A>G	16.37:g.29472811A>G			B4DNV0|O95603|P50224|Q1ET66|Q6ZWJ5	Silent	SNP	pfam_Sulfotransferase_dom	p.Q35	ENST00000360423.7	37	c.105	CCDS32427.1	16																																																																																			SULT1A4	-	NULL	ENSG00000213648		0.627	SULT1A4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SULT1A4	HGNC	protein_coding	OTTHUMT00000409298.1	11	0.00	0	A	NM_001017389		29472811	29472811	+1	no_errors	ENST00000565290	ensembl	human	known	69_37n	silent	5	37.50	3	SNP	0.951	G
SYTL2	54843	genome.wustl.edu	37	11	85431982	85431982	+	Missense_Mutation	SNP	G	G	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr11:85431982G>C	ENST00000528231.1	-	8	1757	c.1480C>G	c.(1480-1482)Cct>Gct	p.P494A	SYTL2_ENST00000525423.1_Missense_Mutation_p.P816A|SYTL2_ENST00000389958.3_5'Flank|SYTL2_ENST00000524452.1_Missense_Mutation_p.P494A|SYTL2_ENST00000533892.1_5'Flank|SYTL2_ENST00000316356.4_Missense_Mutation_p.P495A|SYTL2_ENST00000529581.1_5'Flank|SYTL2_ENST00000354566.3_Missense_Mutation_p.P816A|SYTL2_ENST00000359152.5_Missense_Mutation_p.P1340A|SYTL2_ENST00000527523.1_Missense_Mutation_p.P446A|SYTL2_ENST00000389960.4_Missense_Mutation_p.P494A|SYTL2_ENST00000528566.1_5'Flank	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	494					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TTCAAAACAGGACTGGGTTCT	0.358																																						dbGAP											0													65.0	67.0	66.0					11																	85431982		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1480C>G	11.37:g.85431982G>C	ENSP00000431701:p.Pro494Ala		B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.P1340A	ENST00000528231.1	37	c.4018	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	G	14.96	2.692083	0.48202	.	.	ENSG00000137501	ENST00000389960;ENST00000359152;ENST00000354566;ENST00000316356;ENST00000525423;ENST00000530351;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T;T;T;T;T	0.47528	0.91;1.59;1.52;1.12;1.57;0.91;1.06;0.84;0.91	5.96	5.02	0.67125	.	0.236379	0.42964	D	0.000625	T	0.54095	0.1837	L	0.39397	1.21	0.53688	D	0.999973	B;B;B;B;B;D;D;D	0.59767	0.278;0.142;0.074;0.033;0.122;0.986;0.986;0.986	B;B;B;B;B;P;P;P	0.56474	0.176;0.125;0.055;0.045;0.117;0.799;0.683;0.683	T	0.45818	-0.9235	9	.	.	.	-16.4276	16.907	0.86131	0.0:0.1277:0.8723:0.0	.	446;494;494;495;352;816;816;816	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15;Q9HCH5-11;Q9HCH5-7;Q9HCH5-8	.;.;SYTL2_HUMAN;.;.;.;.;.	A	494;1340;816;495;816;235;494;446;494	ENSP00000374610:P494A;ENSP00000352065:P1340A;ENSP00000346576:P816A;ENSP00000318803:P495A;ENSP00000432694:P816A;ENSP00000435009:P235A;ENSP00000431701:P494A;ENSP00000434010:P446A;ENSP00000435238:P494A	.	P	-	1	0	SYTL2	85109630	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.426000	0.66476	2.831000	0.97527	0.650000	0.86243	CCT	SYTL2	-	NULL	ENSG00000137501		0.358	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1	100	0.00	0	G	NM_206927		85431982	85431982	-1	no_errors	ENST00000359152	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	C
TIMELESS	8914	genome.wustl.edu	37	12	56822802	56822802	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr12:56822802C>T	ENST00000553532.1	-	11	1319	c.1169G>A	c.(1168-1170)cGa>cAa	p.R390Q	TIMELESS_ENST00000229201.4_Missense_Mutation_p.R389Q|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GGAGGCAGCTCGGTTGAAGGC	0.498																																						dbGAP											0													95.0	85.0	88.0					12																	56822802		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.1169G>A	12.37:g.56822802C>T	ENSP00000450607:p.Arg390Gln			Missense_Mutation	SNP	pfam_TIMELESS_C,pfam_Timeless	p.R390Q	ENST00000553532.1	37	c.1169	CCDS8918.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.704101	0.96812	.	.	ENSG00000111602	ENST00000229201;ENST00000553532	T;T	0.12039	2.73;2.72	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.44623	0.1302	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.45527	-0.9255	10	0.72032	D	0.01	-7.675	18.4881	0.90836	0.0:1.0:0.0:0.0	.	389;390	Q9UNS1-2;Q9UNS1	.;TIM_HUMAN	Q	389;390	ENSP00000229201:R389Q;ENSP00000450607:R390Q	ENSP00000229201:R390Q	R	-	2	0	TIMELESS	55109069	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.503000	0.81632	2.738000	0.93877	0.555000	0.69702	CGA	TIMELESS	-	NULL	ENSG00000111602		0.498	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	152	0.00	0	C	NM_003920		56822802	56822802	-1	no_errors	ENST00000553532	ensembl	human	known	69_37n	missense	118	21.85	33	SNP	1.000	T
TLE6	79816	genome.wustl.edu	37	19	2994071	2994071	+	Missense_Mutation	SNP	C	C	T	rs200522179		TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr19:2994071C>T	ENST00000246112.4	+	16	1793	c.1592C>T	c.(1591-1593)cCg>cTg	p.P531L	TLE6_ENST00000452088.1_Missense_Mutation_p.P408L	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	531					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACAGCATGCCGGCGGGGACA	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		13661	0.001		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.1592C>T	19.37:g.2994071C>T	ENSP00000246112:p.Pro531Leu		J3KMZ1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.P531L	ENST00000246112.4	37	c.1592	CCDS45910.1	19	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.77	1.443504	0.25987	.	.	ENSG00000104953	ENST00000447920;ENST00000246112;ENST00000452088	T;T	0.11277	2.79;2.79	2.76	0.525	0.17072	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.15435	0.0372	M	0.82323	2.585	0.32824	D	0.503109	D;P;P	0.56287	0.975;0.874;0.938	B;B;B	0.43680	0.427;0.117;0.327	T	0.32161	-0.9917	9	0.87932	D	0	-18.8902	5.2643	0.15591	0.0:0.7152:0.0:0.2848	.	531;389;408	C9JGZ7;Q9Y6S1;Q9H808	.;.;TLE6_HUMAN	L	531;531;408	ENSP00000246112:P531L;ENSP00000406893:P408L	ENSP00000246112:P531L	P	+	2	0	TLE6	2945071	0.608000	0.26966	0.102000	0.21198	0.009000	0.06853	0.901000	0.28445	0.232000	0.21100	0.561000	0.74099	CCG	TLE6	-	superfamily_WD40_repeat_dom,prints_Groucho_enhance	ENSG00000104953		0.602	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE6	HGNC	protein_coding	OTTHUMT00000345996.3	66	0.00	0	C	NM_024760		2994071	2994071	+1	no_errors	ENST00000246112	ensembl	human	known	69_37n	missense	16	66.00	33	SNP	0.109	T
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H193R	ENST00000269305.4	37	c.578	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	385	0.26	1	T	NM_000546		7578271	7578271	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	66	79.75	260	SNP	0.998	C
TRAF6	7189	genome.wustl.edu	37	11	36511852	36511852	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr11:36511852C>T	ENST00000526995.1	-	7	1351	c.1105G>A	c.(1105-1107)Gag>Aag	p.E369K	TRAF6_ENST00000348124.5_Missense_Mutation_p.E369K|TRAF6_ENST00000529150.1_5'Flank	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	369	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				GGTTTCTCCTCTTCTTGACAT	0.453																																						dbGAP											0													112.0	111.0	111.0					11																	36511852		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.1105G>A	11.37:g.36511852C>T	ENSP00000433623:p.Glu369Lys		A6NKI7|A8KAB3|D3DR16|Q8NEH5	Missense_Mutation	SNP	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.E369K	ENST00000526995.1	37	c.1105	CCDS7901.1	11	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389086	0.42410	.	.	ENSG00000175104	ENST00000526995;ENST00000348124	T;T	0.81330	-1.48;-1.48	5.35	5.35	0.76521	TRAF-type (1);TRAF-like (1);MATH (3);	0.044232	0.85682	D	0.000000	T	0.75125	0.3807	L	0.47716	1.5	0.80722	D	1	B	0.22276	0.067	B	0.23275	0.045	T	0.70099	-0.4965	10	0.08381	T	0.77	-21.406	19.4113	0.94673	0.0:1.0:0.0:0.0	.	369	Q9Y4K3	TRAF6_HUMAN	K	369	ENSP00000433623:E369K;ENSP00000337853:E369K	ENSP00000337853:E369K	E	-	1	0	TRAF6	36468428	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.674000	0.68117	2.657000	0.90304	0.555000	0.69702	GAG	TRAF6	-	superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH	ENSG00000175104		0.453	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF6	HGNC	protein_coding	OTTHUMT00000389530.1	307	0.00	0	C	NM_145803		36511852	36511852	-1	no_errors	ENST00000348124	ensembl	human	known	69_37n	missense	172	23.89	54	SNP	1.000	T
TRBV27	28560	genome.wustl.edu	37	7	142423558	142423558	+	RNA	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr7:142423558G>A	ENST00000390399.3	+	0	257									T cell receptor beta variable 27																		AATGAATGTTGAGGCGACTGA	0.478																																						dbGAP											0													75.0	74.0	74.0					7																	142423558		1920	4122	6042	-	-	-			0			L36092		7q34	2012-02-07			ENSG00000211752	ENSG00000211752		"""T cell receptors / TRB locus"""	12208	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TCRBV14S1, TCRBV27S1			OTTHUMG00000158924		7.37:g.142423558G>A				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E72K	ENST00000390399.3	37	c.214		7																																																																																			TRBV27	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211752		0.478	TRBV27-002	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV27	HGNC	TR_V_gene	OTTHUMT00000352544.2	181	0.00	0	G	NG_001333		142423558	142423558	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390399	ensembl	human	known	69_37n	missense	129	17.31	27	SNP	0.000	A
TSLP	85480	genome.wustl.edu	37	5	110411704	110411704	+	Missense_Mutation	SNP	C	C	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr5:110411704C>A	ENST00000344895.3	+	4	611	c.412C>A	c.(412-414)Ctg>Atg	p.L138M	CTC-551A13.2_ENST00000507269.3_RNA|TSLP_ENST00000420978.2_Missense_Mutation_p.L138M|TSLP_ENST00000379706.4_Missense_Mutation_p.L42M	NM_033035.4	NP_149024.1	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin	138						extracellular space (GO:0005615)				breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		CAATAAATGTCTGGAACAAGT	0.358																																						dbGAP											0													128.0	127.0	127.0					5																	110411704		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC040592	CCDS4101.1	5q22.1	2007-08-24			ENSG00000145777	ENSG00000145777			30743	protein-coding gene	gene with protein product		607003				11418668, 11480573	Standard	NM_033035		Approved		uc003kpb.2	Q969D9	OTTHUMG00000128791	ENST00000344895.3:c.412C>A	5.37:g.110411704C>A	ENSP00000339804:p.Leu138Met		Q8IW99	Missense_Mutation	SNP	NULL	p.L138M	ENST00000344895.3	37	c.412	CCDS4101.1	5	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338352	0.41398	.	.	ENSG00000145777	ENST00000420978;ENST00000344895;ENST00000379706	.	.	.	4.52	3.66	0.41972	.	1.459220	0.04817	N	0.436206	T	0.51075	0.1653	L	0.29908	0.895	0.09310	N	1	D	0.64830	0.994	P	0.62740	0.906	T	0.40608	-0.9554	9	0.54805	T	0.06	0.8796	8.4528	0.32882	0.0:0.8973:0.0:0.1027	.	138	Q969D9	TSLP_HUMAN	M	138;138;42	.	ENSP00000339804:L138M	L	+	1	2	TSLP	110439603	0.048000	0.20356	0.054000	0.19295	0.583000	0.36354	1.011000	0.29911	1.504000	0.48704	0.655000	0.94253	CTG	TSLP	-	NULL	ENSG00000145777		0.358	TSLP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSLP	HGNC	protein_coding	OTTHUMT00000250717.1	189	0.00	0	C	NM_033035		110411704	110411704	+1	no_errors	ENST00000344895	ensembl	human	known	69_37n	missense	66	10.81	8	SNP	0.058	A
TRPC7	57113	genome.wustl.edu	37	5	135692897	135692897	+	Missense_Mutation	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr5:135692897C>T	ENST00000513104.1	-	2	461	c.179G>A	c.(178-180)cGg>cAg	p.R60Q	TRPC7_ENST00000426057.2_Missense_Mutation_p.R60Q|TRPC7_ENST00000355180.3_Missense_Mutation_p.R60Q	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	60					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAGCATTTTCCGGACCACCGG	0.602																																						dbGAP											0													92.0	105.0	101.0					5																	135692897		2165	4278	6443	-	-	-	SO:0001583	missense	0			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.179G>A	5.37:g.135692897C>T	ENSP00000426070:p.Arg60Gln		A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R60Q	ENST00000513104.1	37	c.179	CCDS47267.2	5	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479861	0.84747	.	.	ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	T;T;T	0.65732	-0.17;-0.17;-0.17	5.2	4.33	0.51752	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.67711	0.2922	L	0.31845	0.965	0.29990	N	0.81696	D;D;P;P	0.71674	0.998;0.976;0.659;0.956	D;P;B;P	0.76575	0.988;0.568;0.44;0.727	T	0.64546	-0.6382	10	0.26408	T	0.33	-21.2504	13.8347	0.63402	0.0:0.9272:0.0:0.0728	.	60;60;60;60	Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.;.;.;TRPC7_HUMAN	Q	60	ENSP00000347312:R60Q;ENSP00000441628:R60Q;ENSP00000426070:R60Q	ENSP00000265193:R60Q	R	-	2	0	TRPC7	135720796	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.651000	0.83577	1.422000	0.47177	-0.136000	0.14681	CGG	TRPC7	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,tigrfam_TRP_channel	ENSG00000069018		0.602	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	HGNC	protein_coding	OTTHUMT00000366975.1	24	0.00	0	C	NM_020389		135692897	135692897	-1	no_errors	ENST00000513104	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	T
TTC14	151613	genome.wustl.edu	37	3	180322642	180322642	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr3:180322642G>A	ENST00000296015.4	+	6	836	c.704G>A	c.(703-705)aGa>aAa	p.R235K	TTC14_ENST00000382584.4_Missense_Mutation_p.R235K|TTC14_ENST00000412756.2_Missense_Mutation_p.R235K|RP11-496B10.3_ENST00000472596.1_lincRNA	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	235							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTTTTAAGGAGAAGTGTTGAG	0.299																																						dbGAP											0													53.0	56.0	55.0					3																	180322642		2198	4297	6495	-	-	-	SO:0001583	missense	0			AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.704G>A	3.37:g.180322642G>A	ENSP00000296015:p.Arg235Lys		G5E9X0|Q6UWJ7|Q8TF22	Missense_Mutation	SNP	pfam_TPR-1,superfamily_NA-bd_OB-fold-like,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.R235K	ENST00000296015.4	37	c.704	CCDS3237.1	3	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651933	0.29336	.	.	ENSG00000163728	ENST00000296015;ENST00000412756;ENST00000382584;ENST00000492617	T;T	0.46063	0.88;0.91	5.91	3.19	0.36642	.	0.239160	0.50627	N	0.000109	T	0.23965	0.0580	N	0.24115	0.695	0.80722	D	1	B;B;B	0.32653	0.379;0.002;0.003	B;B;B	0.25759	0.063;0.007;0.007	T	0.03969	-1.0988	10	0.27082	T	0.32	-8.6851	9.2467	0.37529	0.2723:0.0:0.7277:0.0	.	235;235;235	Q96N46-2;G5E9X0;Q96N46	.;.;TTC14_HUMAN	K	235;235;235;135	ENSP00000296015:R235K;ENSP00000372027:R235K	ENSP00000296015:R235K	R	+	2	0	TTC14	181805336	1.000000	0.71417	0.998000	0.56505	0.517000	0.34286	1.370000	0.34238	0.424000	0.26061	0.650000	0.86243	AGA	TTC14	-	NULL	ENSG00000163728		0.299	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC14	HGNC	protein_coding	OTTHUMT00000349786.1	59	0.00	0	G	NM_133462		180322642	180322642	+1	no_errors	ENST00000296015	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	A
UBR5	51366	genome.wustl.edu	37	8	103298762	103298762	+	Missense_Mutation	SNP	T	T	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr8:103298762T>A	ENST00000520539.1	-	38	5647	c.5041A>T	c.(5041-5043)Agt>Tgt	p.S1681C	UBR5_ENST00000521922.1_Missense_Mutation_p.S1675C|UBR5_ENST00000220959.4_Missense_Mutation_p.S1681C|UBR5_ENST00000519528.1_5'Flank	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1681	Poly-Ser.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			ATGTCGTCACTCTGACTACTA	0.418																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											0													135.0	124.0	128.0					8																	103298762		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.5041A>T	8.37:g.103298762T>A	ENSP00000429084:p.Ser1681Cys		B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.S1681C	ENST00000520539.1	37	c.5041	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	T	31	5.074114	0.94000	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.50277	0.75;0.75;0.75	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.58250	0.2109	L	0.47190	1.495	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.56865	0.808;0.808	T	0.61267	-0.7097	10	0.87932	D	0	.	16.243	0.82426	0.0:0.0:0.0:1.0	.	1675;1681	E7EMW7;O95071	.;UBR5_HUMAN	C	1681;1681;1675	ENSP00000429084:S1681C;ENSP00000220959:S1681C;ENSP00000427819:S1675C	ENSP00000220959:S1681C	S	-	1	0	UBR5	103367938	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.238000	0.73509	0.533000	0.62120	AGT	UBR5	-	NULL	ENSG00000104517		0.418	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	195	0.00	0	T	NM_015902		103298762	103298762	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	missense	102	74.11	292	SNP	1.000	A
USH2A	7399	genome.wustl.edu	37	1	216251659	216251659	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr1:216251659G>A	ENST00000307340.3	-	27	5730	c.5344C>T	c.(5344-5346)Ctt>Ttt	p.L1782F	USH2A_ENST00000366943.2_Missense_Mutation_p.L1782F|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000446411.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1782	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTAAAGGCAAGACTGGTATTT	0.363										HNSCC(13;0.011)																												dbGAP											0													224.0	244.0	237.0					1																	216251659		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5344C>T	1.37:g.216251659G>A	ENSP00000305941:p.Leu1782Phe		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L1782F	ENST00000307340.3	37	c.5344	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	4.952	0.176768	0.09443	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.79352	-1.26;-1.26	5.58	-1.73	0.08081	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.402479	0.17454	N	0.173686	T	0.58552	0.2130	L	0.31926	0.97	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.37641	-0.9697	10	0.23302	T	0.38	.	4.5376	0.12042	0.4029:0.0:0.2583:0.3388	.	1782	O75445	USH2A_HUMAN	F	1782	ENSP00000305941:L1782F;ENSP00000355910:L1782F	ENSP00000305941:L1782F	L	-	1	0	USH2A	214318282	0.003000	0.15002	0.001000	0.08648	0.981000	0.71138	0.398000	0.20899	0.021000	0.15133	0.650000	0.86243	CTT	USH2A	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Laminin_G,pfscan_Laminin_G	ENSG00000042781		0.363	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	54	0.00	0	G	NM_007123		216251659	216251659	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	59	11.94	8	SNP	0.000	A
VGLL1	51442	genome.wustl.edu	37	X	135630756	135630756	+	Missense_Mutation	SNP	A	A	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chrX:135630756A>T	ENST00000370634.3	+	3	393	c.223A>T	c.(223-225)Atg>Ttg	p.M75L	MIR934_ENST00000401241.1_RNA	NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	75					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					AGATGATAGCATGTCTCCAAA	0.388																																						dbGAP											0													161.0	150.0	154.0					X																	135630756		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.223A>T	X.37:g.135630756A>T	ENSP00000359668:p.Met75Leu		Q5H915	Missense_Mutation	SNP	pfam_Vg_Tdu,smart_TDU_repeat	p.M75L	ENST00000370634.3	37	c.223	CCDS14658.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.337|9.337	1.062125|1.062125	0.19987|0.19987	.|.	.|.	ENSG00000102243|ENSG00000102243	ENST00000440515|ENST00000370634	.|T	.|0.39997	.|1.05	5.54|5.54	1.62|1.62	0.23740|0.23740	.|.	.|0.168111	.|0.64402	.|D	.|0.000004	T|T	0.23171|0.23171	0.0560|0.0560	N|N	0.25485|0.25485	0.75|0.75	0.09310|0.09310	N|N	1|1	.|B	.|0.11235	.|0.004	.|B	.|0.13407	.|0.009	T|T	0.09122|0.09122	-1.0689|-1.0689	5|10	.|0.42905	.|T	.|0.14	-8.7247|-8.7247	2.2051|2.2051	0.03934|0.03934	0.5952:0.1559:0.0951:0.1539|0.5952:0.1559:0.0951:0.1539	.|.	.|75	.|Q99990	.|VGLL1_HUMAN	L|L	39|75	.|ENSP00000359668:M75L	.|ENSP00000359668:M75L	H|M	+|+	2|1	0|0	VGLL1|VGLL1	135458422|135458422	0.906000|0.906000	0.30813|0.30813	0.703000|0.703000	0.30354|0.30354	0.019000|0.019000	0.09904|0.09904	0.954000|0.954000	0.29175|0.29175	0.738000|0.738000	0.32606|0.32606	0.486000|0.486000	0.48141|0.48141	CAT|ATG	VGLL1	-	NULL	ENSG00000102243		0.388	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VGLL1	HGNC	protein_coding	OTTHUMT00000058493.1	128	0.00	0	A	NM_016267		135630756	135630756	+1	no_errors	ENST00000370634	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	0.043	T
XKR5	389610	genome.wustl.edu	37	8	6668898	6668898	+	RNA	SNP	C	C	T			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr8:6668898C>T	ENST00000518724.1	-	0	2033							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		TCCAGCGGCTCCTCTAGCTCT	0.592																																						dbGAP											0													71.0	63.0	66.0					8																	6668898		692	1591	2283	-	-	-			0			AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6668898C>T			Q5GH74	RNA	SNP	-	NULL	ENST00000518724.1	37	NULL		8																																																																																			XKR5	-	-	ENSG00000186530		0.592	XKR5-001	KNOWN	basic	processed_transcript	XKR5	HGNC	processed_transcript	OTTHUMT00000331969.2	124	0.00	0	C	NM_207411		6668898	6668898	-1	no_errors	ENST00000405979	ensembl	human	known	69_37n	rna	50	20.63	13	SNP	0.001	T
ZFHX4	79776	genome.wustl.edu	37	8	77616630	77616630	+	Missense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr8:77616630G>A	ENST00000521891.2	+	2	755	c.307G>A	c.(307-309)Gcc>Acc	p.A103T	ZFHX4_ENST00000518282.1_Missense_Mutation_p.A103T|ZFHX4_ENST00000455469.2_Missense_Mutation_p.A103T|ZFHX4_ENST00000050961.6_Missense_Mutation_p.A103T|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTGCCCTAATGCCCGCCTTCC	0.502										HNSCC(33;0.089)																												dbGAP											0													181.0	175.0	177.0					8																	77616630		2034	4178	6212	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.307G>A	8.37:g.77616630G>A	ENSP00000430497:p.Ala103Thr		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.A103T	ENST00000521891.2	37	c.307	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717526	0.68844	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000520307;ENST00000517585;ENST00000523809;ENST00000518282	T;T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2;1.2	5.43	5.43	0.79202	.	0.157403	0.29192	U	0.012880	T	0.40767	0.1130	L	0.44542	1.39	0.58432	D	0.999999	P;P;P;B	0.41366	0.457;0.747;0.592;0.208	B;P;B;B	0.45406	0.193;0.479;0.355;0.084	T	0.03818	-1.1001	10	0.27082	T	0.32	.	19.4356	0.94792	0.0:0.0:1.0:0.0	.	103;103;103;103	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	T	103	ENSP00000430497:A103T;ENSP00000399605:A103T;ENSP00000050961:A103T;ENSP00000428525:A103T;ENSP00000427775:A103T;ENSP00000427739:A103T;ENSP00000430848:A103T	ENSP00000050961:A103T	A	+	1	0	ZFHX4	77779185	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.228000	0.95250	2.826000	0.97356	0.655000	0.94253	GCC	ZFHX4	-	NULL	ENSG00000091656		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	201	0.00	0	G	NM_024721		77616630	77616630	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	200	18.62	46	SNP	1.000	A
ZNF106	64397	genome.wustl.edu	37	15	42734373	42734373	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr15:42734373G>A	ENST00000263805.4	-	7	3918	c.3592C>T	c.(3592-3594)Cag>Tag	p.Q1198*	ZNF106_ENST00000565611.1_Nonsense_Mutation_p.Q383*|ZNF106_ENST00000565380.1_Nonsense_Mutation_p.Q426*	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1198					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TGTTTAATCTGAACTGATGAG	0.488																																						dbGAP											0													154.0	142.0	146.0					15																	42734373		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.3592C>T	15.37:g.42734373G>A	ENSP00000263805:p.Gln1198*		B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1198*	ENST00000263805.4	37	c.3592	CCDS32208.1	15	.	.	.	.	.	.	.	.	.	.	G	38	6.706726	0.97776	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	.	.	.	5.44	4.51	0.55191	.	0.363713	0.28612	N	0.014736	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-3.1838	11.2456	0.48996	0.0:0.1378:0.719:0.1432	.	.	.	.	X	1198;426	.	ENSP00000263805:Q1198X	Q	-	1	0	ZFP106	40521665	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	3.647000	0.54403	1.487000	0.48415	0.655000	0.94253	CAG	ZFP106	-	NULL	ENSG00000103994		0.488	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP106	HGNC	protein_coding	OTTHUMT00000422587.1	114	0.00	0	G	NM_022473		42734373	42734373	-1	no_errors	ENST00000263805	ensembl	human	known	69_37n	nonsense	78	15.22	14	SNP	0.997	A
ZNF85	7639	genome.wustl.edu	37	19	21131734	21131734	+	Silent	SNP	C	C	G			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr19:21131734C>G	ENST00000328178.8	+	4	527	c.414C>G	c.(412-414)ctC>ctG	p.L138L	ZNF85_ENST00000601023.1_Silent_p.L79L|ZNF85_ENST00000345030.6_Silent_p.L105L	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	138					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						ACCAATGTCTCACAGCTACCC	0.323																																						dbGAP											0													65.0	69.0	67.0					19																	21131734		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.414C>G	19.37:g.21131734C>G			B9ZVP4|Q6NVI0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L138	ENST00000328178.8	37	c.414	CCDS32977.1	19																																																																																			ZNF85	-	NULL	ENSG00000105750		0.323	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF85	HGNC	protein_coding	OTTHUMT00000463430.1	47	0.00	0	C	NM_003429		21131734	21131734	+1	no_errors	ENST00000328178	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	0.000	G
ZNF324	25799	genome.wustl.edu	37	19	58980577	58980577	+	Missense_Mutation	SNP	T	T	C			TCGA-AN-A0FT-01A-11W-A050-09	TCGA-AN-A0FT-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0598fc5f-9651-4ace-bf4e-56759d544e52	520abbc0-ff40-4a8e-b002-c36bac79cb72	g.chr19:58980577T>C	ENST00000536459.2	+	2	734	c.25T>C	c.(25-27)Tac>Cac	p.Y9H	ZNF324_ENST00000196482.3_Missense_Mutation_p.Y9H|ZNF324_ENST00000535298.1_5'Flank			O75467	Z324A_HUMAN	zinc finger protein 324	9	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(2)|prostate(2)|urinary_tract(2)	16		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		TGTGGCTGTGTACTTCTCCCA	0.577																																						dbGAP											0													85.0	74.0	77.0					19																	58980577		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF060503	CCDS12981.1	19q13.43	2013-01-08				ENSG00000083812		"""Zinc fingers, C2H2-type"", ""-"""	14096	protein-coding gene	gene with protein product							Standard	NM_014347		Approved	ZF5128, ZNF324A	uc002qsw.2	O75467		ENST00000536459.2:c.25T>C	19.37:g.58980577T>C	ENSP00000444812:p.Tyr9His		B3KRX1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y9H	ENST00000536459.2	37	c.25	CCDS12981.1	19	.	.	.	.	.	.	.	.	.	.	T	7.248	0.602640	0.13939	.	.	ENSG00000083812	ENST00000378044;ENST00000196482;ENST00000536459	T;T	0.01918	4.56;4.56	3.44	1.08	0.20341	Krueppel-associated box (4);	0.000000	0.31450	N	0.007638	T	0.02727	0.0082	L	0.60957	1.885	0.80722	D	1	B	0.16603	0.018	B	0.23419	0.046	T	0.44544	-0.9321	10	0.41790	T	0.15	.	4.7362	0.12989	0.0:0.1169:0.1907:0.6924	.	9	O75467	Z324A_HUMAN	H	9	ENSP00000196482:Y9H;ENSP00000444812:Y9H	ENSP00000196482:Y9H	Y	+	1	0	ZNF324	63672389	0.964000	0.33143	1.000000	0.80357	0.987000	0.75469	-0.024000	0.12435	0.509000	0.28195	0.379000	0.24179	TAC	ZNF324	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000083812		0.577	ZNF324-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324	HGNC	protein_coding	OTTHUMT00000467044.1	86	0.00	0	T	NM_014347		58980577	58980577	+1	no_errors	ENST00000196482	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	C
