#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB1	5243	genome.wustl.edu	37	7	87179586	87179586	+	Silent	SNP	C	C	T	rs200176685		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr7:87179586C>T	ENST00000265724.3	-	13	1668	c.1251G>A	c.(1249-1251)gtG>gtA	p.V417V	ABCB1_ENST00000543898.1_Silent_p.V353V	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	417	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	GCCCACTCTGCACCTTCAGGT	0.522																																						dbGAP											0													96.0	80.0	85.0					7																	87179586		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1251G>A	7.37:g.87179586C>T			A8K294|B5AK60|Q12755|Q14812	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.V417	ENST00000265724.3	37	c.1251	CCDS5608.1	7																																																																																			ABCB1	-	pfscan_ABC_transporter-like	ENSG00000085563		0.522	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	98	0.00	0	C	NM_000927		87179586	87179586	-1	no_errors	ENST00000265724	ensembl	human	known	69_37n	silent	183	19.74	45	SNP	0.998	T
ADAMTS6	11174	genome.wustl.edu	37	5	64511230	64511230	+	IGR	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr5:64511230G>A								ADAMTS6 (16638 upstream) : ADAMTS6 (81804 downstream)																							GTAATGAAAAGCTGTCCCAGC	0.403																																						dbGAP											0													144.0	133.0	137.0					5																	64511230		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0																															5.37:g.64511230G>A				Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.A786V		37	c.2357		5	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154083	0.38021	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680	T;T	0.44881	0.91;0.91	5.69	5.69	0.88448	ADAM-TS Spacer 1 (1);	0.159133	0.56097	D	0.000028	T	0.20740	0.0499	N	0.02379	-0.575	0.80722	D	1	B;B	0.12013	0.005;0.003	B;B	0.22880	0.026;0.042	T	0.22277	-1.0221	10	0.02654	T	1	.	19.8113	0.96547	0.0:0.0:1.0:0.0	.	786;786	D6R9L6;Q9UKP5	.;ATS6_HUMAN	V	786;736;786	ENSP00000370443:A786V;ENSP00000423551:A786V	ENSP00000261306:A736V	A	-	2	0	ADAMTS6	64546986	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.444000	0.97578	2.690000	0.91761	0.655000	0.94253	GCT	ADAMTS6	-	pfam_ADAM_spacer1	ENSG00000049192	0	0.403					ADAMTS6	HGNC			192	0.00	0	G			64511230	64511230	-1	no_errors	ENST00000381055	ensembl	human	known	69_37n	missense	163	20.87	43	SNP	1.000	A
ANAPC5	51433	genome.wustl.edu	37	12	121757513	121757513	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr12:121757513C>G	ENST00000261819.3	-	13	1745	c.1624G>C	c.(1624-1626)Gag>Cag	p.E542Q	ANAPC5_ENST00000541887.1_Missense_Mutation_p.E529Q|ANAPC5_ENST00000344395.4_Missense_Mutation_p.E430Q|ANAPC5_ENST00000441917.2_Missense_Mutation_p.E430Q|ANAPC5_ENST00000535482.1_Missense_Mutation_p.E208Q|ANAPC5_ENST00000544314.1_5'UTR	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	542					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TAAACACCCTCTATGCTATTG	0.308																																						dbGAP											0													73.0	65.0	68.0					12																	121757513		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.1624G>C	12.37:g.121757513C>G	ENSP00000261819:p.Glu542Gln		E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	SNP	smart_TPR_repeat	p.E542Q	ENST00000261819.3	37	c.1624	CCDS9220.1	12	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298250	0.81025	.	.	ENSG00000089053	ENST00000441917;ENST00000541887;ENST00000261819;ENST00000535482;ENST00000544314;ENST00000344395	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	5.24	5.24	0.73138	Tetratricopeptide-like helical (1);	0.049167	0.85682	D	0.000000	D	0.84352	0.5453	L	0.47716	1.5	0.80722	D	1	P;P;D;D	0.89917	0.865;0.946;0.999;1.0	P;P;P;D	0.66084	0.618;0.618;0.879;0.941	D	0.85631	0.1270	10	0.72032	D	0.01	.	18.1779	0.89767	0.0:1.0:0.0:0.0	.	208;144;430;542	F5H0N1;B4DFK4;E9PFB2;Q9UJX4	.;.;.;APC5_HUMAN	Q	430;529;542;208;144;430	ENSP00000415061:E430Q;ENSP00000439875:E529Q;ENSP00000261819:E542Q;ENSP00000438754:E208Q;ENSP00000343787:E430Q	ENSP00000261819:E542Q	E	-	1	0	ANAPC5	120241896	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.304000	0.78882	2.598000	0.87819	0.563000	0.77884	GAG	ANAPC5	-	smart_TPR_repeat	ENSG00000089053		0.308	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC5	HGNC	protein_coding	OTTHUMT00000402582.1	150	0.00	0	C			121757513	121757513	-1	no_errors	ENST00000261819	ensembl	human	known	69_37n	missense	120	13.67	19	SNP	1.000	G
APOBR	55911	genome.wustl.edu	37	16	28507365	28507365	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr16:28507365G>A	ENST00000431282.1	+	2	1013	c.1003G>A	c.(1003-1005)Gag>Aag	p.E335K	CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.E335K|APOBR_ENST00000328423.5_Missense_Mutation_p.E335K			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	335	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						CTCGGGAGGGGAGGAGGCCGG	0.716																																						dbGAP											0													12.0	15.0	14.0					16																	28507365		1840	4019	5859	-	-	-	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1003G>A	16.37:g.28507365G>A	ENSP00000416094:p.Glu335Lys		H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.E335K	ENST00000431282.1	37	c.1003		16	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150306	0.37923	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.59906	0.23;0.23	2.86	-4.37	0.03633	.	.	.	.	.	T	0.33962	0.0881	N	0.19112	0.55	0.09310	N	1	B	0.31077	0.307	B	0.32724	0.151	T	0.26292	-1.0107	9	0.25106	T	0.35	.	5.0088	0.14302	0.2582:0.4882:0.2536:0.0	.	326	Q9NS13	.	K	335	ENSP00000327669:E335K;ENSP00000416094:E335K	ENSP00000327669:E335K	E	+	1	0	APOBR	28414866	0.026000	0.19158	0.000000	0.03702	0.012000	0.07955	1.483000	0.35497	-0.480000	0.06803	0.455000	0.32223	GAG	APOBR	-	NULL	ENSG00000184730		0.716	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		8	0.00	0	G	NM_182804		28507365	28507365	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	0.130	A
AR	367	genome.wustl.edu	37	X	66931346	66931346	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chrX:66931346C>G	ENST00000374690.3	+	4	2512	c.1988C>G	c.(1987-1989)tCa>tGa	p.S663*	AR_ENST00000396043.2_Nonsense_Mutation_p.S131*|AR_ENST00000396044.3_Nonsense_Mutation_p.S663*	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	662	Interaction with KAT7.|Interaction with LPXN.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTGACAGTGTCACACATTGAA	0.522									Androgen Insensitivity Syndrome																													dbGAP											0													115.0	75.0	89.0					X																	66931346		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1988C>G	X.37:g.66931346C>G	ENSP00000363822:p.Ser663*		A2RUN2|B1AKD7|Q9UD95	Nonsense_Mutation	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.S663*	ENST00000374690.3	37	c.1988	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	c	33	5.227206	0.95173	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396044;ENST00000396043	.	.	.	5.28	4.41	0.53225	.	0.558155	0.18949	N	0.126733	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	6.8668	0.24098	0.0:0.7946:0.0:0.2054	.	.	.	.	X	473;663;663;131	.	ENSP00000363822:S663X	S	+	2	0	AR	66848071	1.000000	0.71417	0.992000	0.48379	0.924000	0.55760	5.840000	0.69402	1.192000	0.43071	0.591000	0.81541	TCA	AR	-	NULL	ENSG00000169083		0.522	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	67	0.00	0	C	NM_000044		66931346	66931346	+1	no_errors	ENST00000374690	ensembl	human	known	69_37n	nonsense	131	16.03	25	SNP	1.000	G
ASUN	55726	genome.wustl.edu	37	12	27068941	27068941	+	Silent	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr12:27068941C>G	ENST00000261191.7	-	11	1778	c.1242G>C	c.(1240-1242)cgG>cgC	p.R414R	ASUN_ENST00000539625.1_Silent_p.R313R	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	414					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											TTACTGTAATCCGGTAGTCTG	0.383																																						dbGAP											0													57.0	55.0	55.0					12																	27068941		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.1242G>C	12.37:g.27068941C>G			B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Missense_Mutation	SNP	pfam_Cell_cycle_regulator_Mat89Bb	p.D128H	ENST00000261191.7	37	c.382	CCDS8708.1	12	.	.	.	.	.	.	.	.	.	.	C	9.137	1.012874	0.19277	.	.	ENSG00000064102	ENST00000542392	.	.	.	5.85	3.96	0.45880	.	.	.	.	.	T	0.72195	0.3430	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71718	-0.4508	4	.	.	.	-11.0638	16.6239	0.84937	0.0:0.7545:0.2455:0.0	.	.	.	.	H	128	.	.	D	-	1	0	C12orf11	26960208	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.799000	0.27028	0.874000	0.35823	0.655000	0.94253	GAT	ASUN	-	pfam_Cell_cycle_regulator_Mat89Bb	ENSG00000064102		0.383	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASUN	HGNC	protein_coding	OTTHUMT00000402819.1	98	0.00	0	C	NM_018164		27068941	27068941	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000542392	ensembl	human	novel	69_37n	missense	88	19.27	21	SNP	1.000	G
BAI1	575	genome.wustl.edu	37	8	143602279	143602279	+	Missense_Mutation	SNP	G	G	T	rs374047873		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr8:143602279G>T	ENST00000517894.1	+	20	3911	c.3017G>T	c.(3016-3018)cGc>cTc	p.R1006L	BAI1_ENST00000323289.5_Missense_Mutation_p.R1006L			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1006					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ACCCAGACCCGCAACAAGGTA	0.597																																						dbGAP											0													112.0	117.0	116.0					8																	143602279		2171	4263	6434	-	-	-	SO:0001583	missense	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3017G>T	8.37:g.143602279G>T	ENSP00000430945:p.Arg1006Leu			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.R1006L	ENST00000517894.1	37	c.3017		8	.	.	.	.	.	.	.	.	.	.	G	6.388	0.439762	0.12104	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.32753	1.44;1.44	2.86	2.86	0.33363	.	0.428735	0.18894	U	0.128228	T	0.14399	0.0348	N	0.03115	-0.41	0.45390	D	0.99837	B	0.09022	0.002	B	0.12837	0.008	T	0.06409	-1.0828	10	0.31617	T	0.26	.	12.7427	0.57261	0.0:0.0:1.0:0.0	.	1006	E9PBK0	.	L	1006	ENSP00000430945:R1006L;ENSP00000313046:R1006L	ENSP00000313046:R1006L	R	+	2	0	BAI1	143599281	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	4.455000	0.60075	1.406000	0.46857	0.446000	0.29264	CGC	BAI1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000181790		0.597	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	104	0.00	0	G	NM_001702		143602279	143602279	+1	no_errors	ENST00000323289	ensembl	human	known	69_37n	missense	148	21.58	41	SNP	1.000	T
BCKDK	10295	genome.wustl.edu	37	16	31123564	31123564	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr16:31123564G>T	ENST00000394951.1	+	13	1840	c.1217G>T	c.(1216-1218)cGg>cTg	p.R406L	BCKDK_ENST00000287507.3_3'UTR|BCKDK_ENST00000219794.6_Missense_Mutation_p.R406L|BCKDK_ENST00000394950.3_3'UTR|AC135050.1_ENST00000517000.2_RNA			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	406					branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						ATCGATGGCCGGGAGGAAAGC	0.682																																						dbGAP											0													43.0	45.0	44.0					16																	31123564		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.1217G>T	16.37:g.31123564G>T	ENSP00000378405:p.Arg406Leu		A8MY43|Q6FGL4|Q96G95|Q96IN5	Missense_Mutation	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core,prints_Sig_transdc_His_kin-like_C	p.R406L	ENST00000394951.1	37	c.1217	CCDS10705.1	16	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513392	0.64522	.	.	ENSG00000103507	ENST00000394951;ENST00000219794	T;T	0.55413	0.52;0.52	5.66	4.62	0.57501	.	0.055825	0.64402	D	0.000001	T	0.24774	0.0601	N	0.03608	-0.345	0.42331	D	0.992299	B	0.21520	0.057	B	0.20384	0.029	T	0.13388	-1.0511	10	0.39692	T	0.17	-22.5819	4.4887	0.11803	0.2914:0.0:0.7086:0.0	.	406	O14874	BCKD_HUMAN	L	406	ENSP00000378405:R406L;ENSP00000219794:R406L	ENSP00000219794:R406L	R	+	2	0	BCKDK	31031065	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.816000	0.62642	2.673000	0.90976	0.591000	0.81541	CGG	BCKDK	-	NULL	ENSG00000103507		0.682	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCKDK	HGNC	protein_coding	OTTHUMT00000108514.1	10	0.00	0	G	NM_005881		31123564	31123564	+1	no_errors	ENST00000219794	ensembl	human	known	69_37n	missense	35	41.67	25	SNP	1.000	T
BUB1B	701	genome.wustl.edu	37	15	40498522	40498522	+	Silent	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr15:40498522G>A	ENST00000287598.6	+	15	2067	c.1872G>A	c.(1870-1872)gaG>gaA	p.E624E	BUB1B_ENST00000412359.3_Silent_p.E638E	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	624					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		CTTTTCATGAGATAATGTCCT	0.448			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																													dbGAP	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0													98.0	99.0	99.0					15																	40498522		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.1872G>A	15.37:g.40498522G>A			B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Silent	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I	p.E638	ENST00000287598.6	37	c.1914	CCDS10053.1	15																																																																																			BUB1B	-	NULL	ENSG00000156970		0.448	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	HGNC	protein_coding	OTTHUMT00000252122.4	81	0.00	0	G			40498522	40498522	+1	no_errors	ENST00000412359	ensembl	human	known	69_37n	silent	77	23.76	24	SNP	0.912	A
C17orf78	284099	genome.wustl.edu	37	17	35736110	35736110	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr17:35736110C>T	ENST00000300618.4	+	3	231	c.181C>T	c.(181-183)Caa>Taa	p.Q61*	ACACA_ENST00000416895.1_Intron|C17orf78_ENST00000586700.1_Nonsense_Mutation_p.Q61*|ACACA_ENST00000353139.5_Intron	NM_173625.3	NP_775896.3	Q8N4C9	CQ078_HUMAN	chromosome 17 open reading frame 78	61						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(1)|lung(2)|stomach(1)	6		Breast(25;0.00295)|Ovarian(249;0.15)				AACATTCATTCAAAACCGGAC	0.393																																						dbGAP											0													89.0	90.0	90.0					17																	35736110		1866	4095	5961	-	-	-	SO:0001587	stop_gained	0			BC034672	CCDS45655.1	17q12	2014-05-06			ENSG00000167230	ENSG00000278505			26831	protein-coding gene	gene with protein product						14702039	Standard	NM_173625		Approved	FLJ39647	uc002hns.3	Q8N4C9	OTTHUMG00000188467	ENST00000300618.4:c.181C>T	17.37:g.35736110C>T	ENSP00000300618:p.Gln61*		Q8N8D2	Nonsense_Mutation	SNP	NULL	p.Q61*	ENST00000300618.4	37	c.181	CCDS45655.1	17	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625631	0.46840	.	.	ENSG00000167230	ENST00000300618;ENST00000321564	.	.	.	4.27	2.21	0.28008	.	0.563004	0.14899	N	0.291919	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-0.2628	4.7383	0.12999	0.2139:0.6741:0.0:0.112	.	.	.	.	X	61	.	ENSP00000300618:Q61X	Q	+	1	0	C17orf78	32810223	0.007000	0.16637	0.033000	0.17914	0.407000	0.30961	0.323000	0.19593	0.404000	0.25506	0.591000	0.81541	CAA	C17orf78	-	NULL	ENSG00000167230		0.393	C17orf78-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C17orf78	HGNC	protein_coding	OTTHUMT00000451570.2	161	0.00	0	C	NM_173625		35736110	35736110	+1	no_errors	ENST00000300618	ensembl	human	known	69_37n	nonsense	96	29.41	40	SNP	0.059	T
C1orf101	257044	genome.wustl.edu	37	1	244681976	244681976	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:244681976C>G	ENST00000366534.4	+	8	566	c.512C>G	c.(511-513)tCt>tGt	p.S171C	C1orf101_ENST00000473875.1_Intron|C1orf101_ENST00000366533.4_Missense_Mutation_p.S171C|C1orf101_ENST00000366531.3_Missense_Mutation_p.S20C	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	171						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			AAAGTTTATTCTTCAAATGAG	0.289																																						dbGAP											0													42.0	47.0	46.0					1																	244681976		2196	4294	6490	-	-	-	SO:0001583	missense	0			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.512C>G	1.37:g.244681976C>G	ENSP00000355492:p.Ser171Cys		B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	NULL	p.S171C	ENST00000366534.4	37	c.512	CCDS44340.1	1	.	.	.	.	.	.	.	.	.	.	C	8.708	0.911250	0.17833	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000366531	T;T	0.31769	1.48;1.48	4.79	-5.77	0.02369	.	2.946000	0.00786	N	0.001301	T	0.14399	0.0348	N	0.08118	0	0.09310	N	1	B;B	0.33448	0.412;0.412	B;B	0.34385	0.181;0.181	T	0.08806	-1.0704	10	0.38643	T	0.18	.	4.0168	0.09647	0.3925:0.3141:0.0:0.2934	.	171;171	Q5SY80;Q5SY80-2	CA101_HUMAN;.	C	171;171;171;20	ENSP00000355492:S171C;ENSP00000355491:S171C	ENSP00000355489:S20C	S	+	2	0	C1orf101	242748599	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.836000	0.04382	-1.262000	0.02459	-0.247000	0.11927	TCT	C1orf101	-	NULL	ENSG00000179397		0.289	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	HGNC	protein_coding	OTTHUMT00000096701.1	68	0.00	0	C	NM_173807		244681976	244681976	+1	no_errors	ENST00000366534	ensembl	human	known	69_37n	missense	64	11.11	8	SNP	0.000	G
C6orf58	352999	genome.wustl.edu	37	6	127898402	127898402	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:127898402T>A	ENST00000329722.7	+	1	84	c.72T>A	c.(70-72)aaT>aaA	p.N24K	C6orf58_ENST00000498112.1_Intron	NM_001010905.1	NP_001010905.1	Q6P5S2	CF058_HUMAN	chromosome 6 open reading frame 58	24						extracellular vesicular exosome (GO:0070062)				kidney(3)|large_intestine(3)|liver(1)|lung(7)|pancreas(1)	15				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)		GGACTTCCAATCTCTCAGAGA	0.502																																						dbGAP											0													126.0	129.0	128.0					6																	127898402		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC062712	CCDS34533.1	6q22.33	2011-12-13			ENSG00000184530	ENSG00000184530			20960	protein-coding gene	gene with protein product							Standard	NM_001010905		Approved		uc003qbh.4	Q6P5S2	OTTHUMG00000015530	ENST00000329722.7:c.72T>A	6.37:g.127898402T>A	ENSP00000328069:p.Asn24Lys		B4E1I0|Q5VUP2	Missense_Mutation	SNP	pfam_DUF781	p.N24K	ENST00000329722.7	37	c.72	CCDS34533.1	6	.	.	.	.	.	.	.	.	.	.	T	16.51	3.143431	0.57044	.	.	ENSG00000184530	ENST00000329722	T	0.47177	0.85	4.72	-3.96	0.04106	.	0.518150	0.21244	N	0.077773	T	0.38295	0.1035	M	0.76838	2.35	0.09310	N	1	D	0.54964	0.969	P	0.56563	0.801	T	0.41431	-0.9509	10	0.72032	D	0.01	-9.7189	5.658	0.17652	0.1491:0.4486:0.0:0.4023	.	24	Q6P5S2	CF058_HUMAN	K	24	ENSP00000328069:N24K	ENSP00000328069:N24K	N	+	3	2	C6orf58	127940095	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.360000	0.20250	-0.955000	0.03636	-0.274000	0.10170	AAT	C6orf58	-	pfam_DUF781	ENSG00000184530		0.502	C6orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf58	HGNC	protein_coding	OTTHUMT00000042152.1	104	0.00	0	T	NM_001010905		127898402	127898402	+1	no_errors	ENST00000329722	ensembl	human	known	69_37n	missense	79	22.55	23	SNP	0.000	A
C7	730	genome.wustl.edu	37	5	40959673	40959673	+	Missense_Mutation	SNP	G	G	A	rs537357253		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr5:40959673G>A	ENST00000313164.9	+	12	1971	c.1612G>A	c.(1612-1614)Gaa>Aaa	p.E538K		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	538	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				CTGCGTTGGAGAAACGACAGA	0.547													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21015	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													71.0	79.0	77.0					5																	40959673		2002	4175	6177	-	-	-	SO:0001583	missense	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1612G>A	5.37:g.40959673G>A	ENSP00000322061:p.Glu538Lys		Q6P3T5|Q92489	Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Complement_control_module,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.E538K	ENST00000313164.9	37	c.1612	CCDS47201.1	5	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546616	0.65198	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	T	0.53423	0.62	5.4	5.4	0.78164	.	0.328276	0.31210	N	0.008041	T	0.64461	0.2600	L	0.56769	1.78	0.46416	D	0.99903	D	0.64830	0.994	D	0.66716	0.946	T	0.58002	-0.7713	10	0.25106	T	0.35	-24.9412	19.1646	0.93551	0.0:0.0:1.0:0.0	.	538	P10643	CO7_HUMAN	K	538;378	ENSP00000322061:E538K	ENSP00000322061:E538K	E	+	1	0	C7	40995430	1.000000	0.71417	0.988000	0.46212	0.142000	0.21351	3.058000	0.49939	2.538000	0.85594	0.462000	0.41574	GAA	C7	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000112936		0.547	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1	79	0.00	0	G			40959673	40959673	+1	no_errors	ENST00000313164	ensembl	human	known	69_37n	missense	98	22.22	28	SNP	0.997	A
CACNA1I	8911	genome.wustl.edu	37	22	40075816	40075816	+	Silent	SNP	C	C	A	rs368298637		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr22:40075816C>A	ENST00000402142.3	+	33	5484	c.5484C>A	c.(5482-5484)atC>atA	p.I1828I	CACNA1I_ENST00000400164.3_Silent_p.I1793I|CACNA1I_ENST00000404898.1_Silent_p.I1793I|CACNA1I_ENST00000336649.4_Silent_p.I1834I|CACNA1I_ENST00000407673.1_Silent_p.I1793I|CACNA1I_ENST00000401624.1_Silent_p.I1828I	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1828					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CGGGCTCCATCTTCCACCACT	0.607																																						dbGAP											0													42.0	46.0	45.0					22																	40075816		2042	4191	6233	-	-	-	SO:0001819	synonymous_variant	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.5484C>A	22.37:g.40075816C>A			B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.I1834	ENST00000402142.3	37	c.5502	CCDS46710.1	22																																																																																			CACNA1I	-	NULL	ENSG00000100346		0.607	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	25	0.00	0	C	NM_001003406		40075816	40075816	+1	no_errors	ENST00000336649	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	1.000	A
CADM2	253559	genome.wustl.edu	37	3	86114834	86114834	+	Silent	SNP	G	G	A	rs36050101	byFrequency	TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr3:86114834G>A	ENST00000407528.2	+	9	1205	c.1143G>A	c.(1141-1143)acG>acA	p.T381T	CADM2_ENST00000405615.2_Silent_p.T383T|CADM2_ENST00000383699.3_Silent_p.T350T	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	381					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TATTTGTCACGCTGTGTTCTA	0.423																																						dbGAP											0													202.0	173.0	183.0					3																	86114834		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.1143G>A	3.37:g.86114834G>A			G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like	p.T383	ENST00000407528.2	37	c.1149	CCDS54614.1	3																																																																																			CADM2	-	NULL	ENSG00000175161		0.423	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM2	HGNC	protein_coding	OTTHUMT00000352822.1	368	0.00	0	G	NM_153184		86114834	86114834	+1	no_errors	ENST00000405615	ensembl	human	known	69_37n	silent	240	47.02	213	SNP	0.793	A
CBLB	868	genome.wustl.edu	37	3	105586395	105586395	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr3:105586395G>T	ENST00000264122.4	-	2	348	c.27C>A	c.(25-27)aaC>aaA	p.N9K	CBLB_ENST00000394027.3_Missense_Mutation_p.N31K|CBLB_ENST00000405772.1_Missense_Mutation_p.N9K|CBLB_ENST00000545639.1_Missense_Mutation_p.N31K|CBLB_ENST00000403724.1_Missense_Mutation_p.N9K	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	9					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						GACCACCAGGGTTTCTGCCAT	0.408			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	dbGAP		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													76.0	74.0	75.0					3																	105586395		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.27C>A	3.37:g.105586395G>T	ENSP00000264122:p.Asn9Lys		A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.N9K	ENST00000264122.4	37	c.27	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	G	12.23	1.874792	0.33069	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772;ENST00000545639;ENST00000438603;ENST00000447441;ENST00000443752	D;D;D;D	0.83419	-1.71;-1.69;-1.71;-1.72	5.24	2.07	0.26955	.	0.244071	0.40728	N	0.001036	T	0.78464	0.4287	N	0.08118	0	0.38648	D	0.951779	P;P;D	0.57899	0.948;0.728;0.981	B;B;D	0.67900	0.354;0.277;0.954	T	0.78489	-0.2184	10	0.87932	D	0	-18.0979	8.2947	0.31978	0.2976:0.0:0.7024:0.0	.	31;9;9	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	K	9;31;9;9;31;31;9;9	ENSP00000264122:N9K;ENSP00000377595:N31K;ENSP00000384816:N9K;ENSP00000384938:N9K	ENSP00000264122:N9K	N	-	3	2	CBLB	107069085	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.923000	0.40055	0.089000	0.17243	0.557000	0.71058	AAC	CBLB	-	NULL	ENSG00000114423		0.408	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	HGNC	protein_coding	OTTHUMT00000319417.2	97	0.00	0	G	NM_170662		105586395	105586395	-1	no_errors	ENST00000264122	ensembl	human	known	69_37n	missense	72	20.88	19	SNP	1.000	T
CNTNAP5	129684	genome.wustl.edu	37	2	125547707	125547707	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr2:125547707T>G	ENST00000431078.1	+	18	3342	c.2978T>G	c.(2977-2979)tTt>tGt	p.F993C		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	993	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GAAGGGCCCTTTTGCAAAAAA	0.512																																						dbGAP											0													48.0	54.0	52.0					2																	125547707		2023	4201	6224	-	-	-	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2978T>G	2.37:g.125547707T>G	ENSP00000399013:p.Phe993Cys		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.F993C	ENST00000431078.1	37	c.2978	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	T	13.98	2.400036	0.42613	.	.	ENSG00000155052	ENST00000431078	T	0.75821	-0.97	5.62	4.46	0.54185	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.52532	D	0.000074	D	0.88206	0.6374	H	0.95114	3.625	0.36093	D	0.843591	D	0.89917	1.0	D	0.70227	0.968	D	0.90862	0.4739	10	0.59425	D	0.04	.	8.2677	0.31824	0.0:0.1531:0.0:0.8469	.	993	Q8WYK1	CNTP5_HUMAN	C	993	ENSP00000399013:F993C	ENSP00000399013:F993C	F	+	2	0	CNTNAP5	125264177	1.000000	0.71417	0.744000	0.31058	0.972000	0.66771	2.580000	0.46068	1.068000	0.40764	0.533000	0.62120	TTT	CNTNAP5	-	superfamily_ConA-like_lec_gl,smart_EGF-like,pfscan_EG-like_dom	ENSG00000155052		0.512	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	42	0.00	0	T			125547707	125547707	+1	no_errors	ENST00000431078	ensembl	human	known	69_37n	missense	52	33.33	26	SNP	0.998	G
HPS3	84343	genome.wustl.edu	37	3	148894046	148894046	+	IGR	SNP	G	G	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr3:148894046G>T	ENST00000296051.2	+	0	4665				CP_ENST00000264613.6_Missense_Mutation_p.Q1058K	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3						organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CCTTCATTTTGTAGAACGGTG	0.388									Hermansky-Pudlak syndrome																													dbGAP											0													99.0	93.0	95.0					3																	148894046		2203	4299	6502	-	-	-	SO:0001628	intergenic_variant	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548		3.37:g.148894046G>T			A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	pfam_Cu-oxidase_2,pfam_Cu-oxidase_3,pfam_Cu-oxidase,superfamily_Cupredoxin	p.Q1058K	ENST00000296051.2	37	c.3172	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	G	7.740	0.701068	0.15172	.	.	ENSG00000047457	ENST00000479771;ENST00000264613;ENST00000494544	D;D;D	0.99706	-6.47;-6.47;-6.47	5.62	2.42	0.29668	Cupredoxin (2);	0.524137	0.20086	N	0.099548	D	0.96950	0.9004	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	D	0.94032	0.7302	10	0.09084	T	0.74	-6.1883	5.9833	0.19419	0.0704:0.2013:0.5633:0.165	.	1058	P00450	CERU_HUMAN	K	193;1058;841	ENSP00000420367:Q193K;ENSP00000264613:Q1058K;ENSP00000420545:Q841K	ENSP00000264613:Q1058K	Q	-	1	0	CP	150376736	0.898000	0.30612	0.039000	0.18376	0.006000	0.05464	1.052000	0.30429	1.362000	0.46000	0.650000	0.86243	CAA	CP	-	superfamily_Cupredoxin	ENSG00000047457		0.388	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	HGNC	protein_coding	OTTHUMT00000356151.1	195	0.00	0	G	NM_032383		148894046	148894046	-1	no_errors	ENST00000264613	ensembl	human	known	69_37n	missense	139	23.63	43	SNP	0.070	T
CYP7B1	9420	genome.wustl.edu	37	8	65527712	65527712	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr8:65527712G>A	ENST00000310193.3	-	4	1101	c.928C>T	c.(928-930)Cgg>Tgg	p.R310W	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	310					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TCTGGGTGCCGCAGAAGATAA	0.478																																						dbGAP											0													92.0	85.0	87.0					8																	65527712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.928C>T	8.37:g.65527712G>A	ENSP00000310721:p.Arg310Trp		B2RN07|Q9UNF5	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.R310W	ENST00000310193.3	37	c.928	CCDS6180.1	8	.	.	.	.	.	.	.	.	.	.	G	16.40	3.111799	0.56398	.	.	ENSG00000172817	ENST00000310193	T	0.70869	-0.52	5.93	5.93	0.95920	.	0.597985	0.19021	N	0.124813	D	0.86990	0.6066	M	0.91612	3.225	0.29099	N	0.881581	D	0.89917	1.0	D	0.70487	0.969	D	0.84395	0.0557	10	0.87932	D	0	-29.0678	15.1109	0.72355	0.0:0.0:0.8586:0.1414	.	310	O75881	CP7B1_HUMAN	W	310	ENSP00000310721:R310W	ENSP00000310721:R310W	R	-	1	2	CYP7B1	65690266	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.029000	0.41098	2.826000	0.97356	0.655000	0.94253	CGG	CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000172817		0.478	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	149	0.00	0	G			65527712	65527712	-1	no_errors	ENST00000310193	ensembl	human	known	69_37n	missense	132	20.96	35	SNP	1.000	A
DCST1	149095	genome.wustl.edu	37	1	155018896	155018896	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:155018896G>C	ENST00000295542.1	+	13	1525	c.1429G>C	c.(1429-1431)Gac>Cac	p.D477H	DCST1_ENST00000392480.1_Missense_Mutation_p.D477H|RP11-307C12.11_ENST00000452962.1_RNA|DCST1_ENST00000423025.2_Missense_Mutation_p.D452H|DCST1_ENST00000368419.2_Missense_Mutation_p.D477H	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	477						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GTGTGGCTTGGACTGGGCTCT	0.612																																						dbGAP											0													189.0	136.0	154.0					1																	155018896		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1429G>C	1.37:g.155018896G>C	ENSP00000295542:p.Asp477His		B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	pfam_DC_STAMP-like,pfscan_Znf_RING	p.D477H	ENST00000295542.1	37	c.1429	CCDS1083.1	1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771832	0.49680	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	4.95	4.95	0.65309	Dendritic cell-specific transmembrane protein-like (1);	0.000000	0.85682	D	0.000000	D	0.85270	0.5658	M	0.78049	2.395	0.53005	D	0.999966	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.998	D	0.86888	0.2046	10	0.87932	D	0	-38.2161	13.5445	0.61695	0.0:0.0:1.0:0.0	.	452;502;477	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	H	477;477;452;477	ENSP00000295542:D477H;ENSP00000376271:D477H;ENSP00000387369:D452H;ENSP00000357404:D477H	ENSP00000295542:D477H	D	+	1	0	DCST1	153285520	1.000000	0.71417	0.997000	0.53966	0.127000	0.20565	6.435000	0.73412	2.570000	0.86706	0.655000	0.94253	GAC	DCST1	-	pfam_DC_STAMP-like	ENSG00000163357		0.612	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST1	HGNC	protein_coding	OTTHUMT00000099006.1	68	0.00	0	G	NM_152494		155018896	155018896	+1	no_errors	ENST00000295542	ensembl	human	known	69_37n	missense	207	17.20	43	SNP	0.999	C
DLC1	10395	genome.wustl.edu	37	8	13072274	13072274	+	Intron	SNP	G	G	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr8:13072274G>T	ENST00000276297.4	-	5	1758				DLC1_ENST00000512044.2_Intron|DLC1_ENST00000316609.5_Nonsense_Mutation_p.S453*	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CAACTTTACTGATTTTACCGC	0.448																																						dbGAP											0													145.0	129.0	134.0					8																	13072274		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1348+90503C>A	8.37:g.13072274G>T			B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Nonsense_Mutation	SNP	NULL	p.S453*	ENST00000276297.4	37	c.1358	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	G	37	6.140269	0.97320	.	.	ENSG00000164741	ENST00000316609	.	.	.	4.79	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.21802	N	0.999531	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	9.1033	0.36683	0.0966:0.0:0.9034:0.0	.	.	.	.	X	453	.	ENSP00000321034:S453X	S	-	2	0	DLC1	13116645	0.916000	0.31088	0.011000	0.14972	0.933000	0.57130	2.406000	0.44557	1.635000	0.50512	0.655000	0.94253	TCA	DLC1	-	NULL	ENSG00000164741		0.448	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	313	0.00	0	G	NM_182643, NM_006094		13072274	13072274	-1	no_errors	ENST00000316609	ensembl	human	known	69_37n	nonsense	124	27.91	48	SNP	0.015	T
DOPEY1	23033	genome.wustl.edu	37	6	83830462	83830462	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:83830462C>G	ENST00000349129.2	+	10	1311	c.1051C>G	c.(1051-1053)Cta>Gta	p.L351V	DOPEY1_ENST00000369739.3_Missense_Mutation_p.L342V|DOPEY1_ENST00000536812.1_3'UTR|DOPEY1_ENST00000237163.5_Missense_Mutation_p.L342V	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	351					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AATGCAGGATCTAAAGCCTTT	0.373																																						dbGAP											0													135.0	127.0	130.0					6																	83830462		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.1051C>G	6.37:g.83830462C>G	ENSP00000195654:p.Leu351Val		Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.L351V	ENST00000349129.2	37	c.1051	CCDS4996.1	6	.	.	.	.	.	.	.	.	.	.	C	18.40	3.615443	0.66672	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T;T	0.26223	1.76;1.76;1.75	5.74	3.95	0.45737	.	0.000000	0.64402	D	0.000008	T	0.34135	0.0887	M	0.79475	2.455	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.997	D;P;P	0.67103	0.949;0.754;0.81	T	0.13388	-1.0511	10	0.33940	T	0.23	-8.4231	9.251	0.37555	0.0:0.7118:0.0:0.2882	.	248;342;351	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	V	351;342;342	ENSP00000195654:L351V;ENSP00000237163:L342V;ENSP00000358754:L342V	ENSP00000237163:L342V	L	+	1	2	DOPEY1	83887181	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.603000	0.46266	1.433000	0.47394	0.557000	0.71058	CTA	DOPEY1	-	superfamily_ARM-type_fold	ENSG00000083097		0.373	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	273	0.00	0	C	NM_015018		83830462	83830462	+1	no_errors	ENST00000349129	ensembl	human	known	69_37n	missense	173	21.72	48	SNP	1.000	G
ECE1	1889	genome.wustl.edu	37	1	21599264	21599264	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:21599264C>T	ENST00000374893.6	-	4	495	c.421G>A	c.(421-423)Gat>Aat	p.D141N	ECE1_ENST00000357071.4_Missense_Mutation_p.D129N|ECE1_ENST00000415912.2_Missense_Mutation_p.D125N|ECE1_ENST00000436918.2_Missense_Mutation_p.D141N|ECE1_ENST00000264205.6_Missense_Mutation_p.D138N	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	141					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		GAGTGGCCATCAGGGACTGGG	0.572																																						dbGAP											0													147.0	131.0	137.0					1																	21599264		2203	4300	6503	-	-	-	SO:0001583	missense	0			D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.421G>A	1.37:g.21599264C>T	ENSP00000364028:p.Asp141Asn		A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.D141N	ENST00000374893.6	37	c.421	CCDS215.1	1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146131	0.77888	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205;ENST00000473505;ENST00000481130	T;T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	5.45	5.45	0.79879	Peptidase M13 (1);	0.161622	0.53938	D	0.000043	T	0.71091	0.3299	L	0.42008	1.315	0.58432	D	0.999997	B;B;B;B;B	0.19583	0.02;0.004;0.0;0.037;0.003	B;B;B;B;B	0.26614	0.051;0.019;0.005;0.071;0.019	T	0.66791	-0.5834	10	0.49607	T	0.09	-22.6031	18.2307	0.89934	0.0:1.0:0.0:0.0	.	141;125;141;129;138	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	N	125;129;141;141;138;27;127	ENSP00000405088:D125N;ENSP00000349581:D129N;ENSP00000364028:D141N;ENSP00000388439:D141N;ENSP00000264205:D138N;ENSP00000431856:D27N;ENSP00000436633:D127N	ENSP00000264205:D138N	D	-	1	0	ECE1	21471851	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.744000	0.85034	2.732000	0.93576	0.655000	0.94253	GAT	ECE1	-	pfam_Peptidase_M13_N	ENSG00000117298		0.572	ECE1-002	KNOWN	basic|CCDS	protein_coding	ECE1	HGNC	protein_coding	OTTHUMT00000007470.2	159	0.00	0	C	NM_001397		21599264	21599264	-1	no_errors	ENST00000374893	ensembl	human	known	69_37n	missense	148	36.21	84	SNP	1.000	T
ETS1	2113	genome.wustl.edu	37	11	128332356	128332356	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr11:128332356C>T	ENST00000319397.6	-	8	1535	c.1226G>A	c.(1225-1227)cGc>cAc	p.R409H	ETS1_ENST00000345075.4_Missense_Mutation_p.R322H|ETS1_ENST00000535549.1_Missense_Mutation_p.R193H|ETS1_ENST00000526145.2_Missense_Mutation_p.R322H|ETS1_ENST00000392668.4_Missense_Mutation_p.R453H|ETS1_ENST00000531611.1_3'UTR	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	409					angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GTACACGTAGCGTTTCCCCGC	0.522																																						dbGAP											0													192.0	153.0	166.0					11																	128332356		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.1226G>A	11.37:g.128332356C>T	ENSP00000324578:p.Arg409His		A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	p.R453H	ENST00000319397.6	37	c.1358	CCDS8475.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.451048	0.96205	.	.	ENSG00000134954	ENST00000345075;ENST00000535549;ENST00000392668;ENST00000319397;ENST00000526145	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.95	5.95	0.96441	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.70448	0.3225	H	0.95151	3.63	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.987;0.954;0.999	T	0.78760	-0.2078	10	0.87932	D	0	.	20.3886	0.98946	0.0:1.0:0.0:0.0	.	409;193;453	P14921;F5GYX9;Q6N087	ETS1_HUMAN;.;.	H	322;193;453;409;322	ENSP00000340485:R322H;ENSP00000441430:R193H;ENSP00000376436:R453H;ENSP00000324578:R409H;ENSP00000433500:R322H	ENSP00000324578:R409H	R	-	2	0	ETS1	127837566	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.814000	0.86154	2.810000	0.96702	0.650000	0.86243	CGC	ETS1	-	pfam_Ets,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	ENSG00000134954		0.522	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS1	HGNC	protein_coding	OTTHUMT00000386269.2	146	0.00	0	C	NM_005238		128332356	128332356	-1	no_errors	ENST00000392668	ensembl	human	known	69_37n	missense	209	19.62	51	SNP	1.000	T
EVX2	344191	genome.wustl.edu	37	2	176948445	176948445	+	Silent	SNP	C	C	T	rs61731351	byFrequency	TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr2:176948445C>T	ENST00000308618.4	-	1	196	c.60G>A	c.(58-60)acG>acA	p.T20T		NM_001080458.1	NP_001073927.1	Q03828	EVX2_HUMAN	even-skipped homeobox 2	20					limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(3)	16			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		TCTTGCCCGCCGTAGGGCTGT	0.547																																						dbGAP											0													68.0	79.0	75.0					2																	176948445		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33333.1	2q31.1	2012-03-09	2007-02-15		ENSG00000174279	ENSG00000174279		"""Homeoboxes / ANTP class : HOXL subclass"""	3507	protein-coding gene	gene with protein product		142991	"""eve, even-skipped homeobox homolog 2 (Drosophila)"""			1675198	Standard	NM_001080458		Approved		uc010zeu.2	Q03828	OTTHUMG00000154173	ENST00000308618.4:c.60G>A	2.37:g.176948445C>T				Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Antifreeze_1,prints_Homeobox_metazoa	p.T20	ENST00000308618.4	37	c.60	CCDS33333.1	2																																																																																			EVX2	-	NULL	ENSG00000174279		0.547	EVX2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	EVX2	HGNC	protein_coding	OTTHUMT00000359252.1	78	0.00	0	C			176948445	176948445	-1	no_errors	ENST00000308618	ensembl	human	known	69_37n	silent	66	40.54	45	SNP	0.830	T
FKBP11	51303	genome.wustl.edu	37	12	49315850	49315850	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr12:49315850G>A	ENST00000550765.1	-	6	921	c.523C>T	c.(523-525)Cac>Tac	p.H175Y	CCDC65_ENST00000266984.5_Intron|AC073610.5_ENST00000537495.1_3'UTR|FKBP11_ENST00000444214.2_Missense_Mutation_p.H73Y|RP11-302B13.5_ENST00000398092.4_Intron	NM_016594.2	NP_057678.1	Q9NYL4	FKB11_HUMAN	FK506 binding protein 11, 19 kDa	175					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			kidney(1)|large_intestine(3)|lung(1)	5						CTGTATAGGTGATACCCAATG	0.438																																						dbGAP											0													88.0	93.0	91.0					12																	49315850		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF238079	CCDS8773.1, CCDS44870.1, CCDS44871.1	12q13.12	2008-08-04	2002-08-29			ENSG00000134285			18624	protein-coding gene	gene with protein product		610571	"""FK506 binding protein 11 (19 kDa)"""			12036304, 16596453	Standard	NM_016594		Approved	FKBP19	uc001rsp.3	Q9NYL4		ENST00000550765.1:c.523C>T	12.37:g.49315850G>A	ENSP00000449751:p.His175Tyr		B4DWB7	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	p.H175Y	ENST00000550765.1	37	c.523	CCDS8773.1	12	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396790	0.25205	.	.	ENSG00000134285	ENST00000444214;ENST00000550765	T;T	0.62364	0.03;0.62	5.85	4.94	0.65067	.	0.113257	0.64402	D	0.000009	T	0.31796	0.0808	N	0.02539	-0.55	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.30475	-0.9977	10	0.07325	T	0.83	-12.6826	11.9879	0.53157	0.1281:0.0:0.8719:0.0	.	175	Q9NYL4	FKB11_HUMAN	Y	73;175	ENSP00000412403:H73Y;ENSP00000449751:H175Y	ENSP00000412403:H73Y	H	-	1	0	FKBP11	47602117	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.443000	0.59994	2.941000	0.99782	0.655000	0.94253	CAC	FKBP11	-	NULL	ENSG00000134285		0.438	FKBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP11	HGNC	protein_coding	OTTHUMT00000408927.1	232	0.00	0	G	NM_016594		49315850	49315850	-1	no_errors	ENST00000550765	ensembl	human	known	69_37n	missense	325	14.02	53	SNP	1.000	A
FYCO1	79443	genome.wustl.edu	37	3	46007805	46007805	+	Silent	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr3:46007805C>G	ENST00000296137.2	-	8	3226	c.3021G>C	c.(3019-3021)ctG>ctC	p.L1007L	FYCO1_ENST00000535325.1_Silent_p.L1007L	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1007					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TTTCAGCACTCAGCTGGAACT	0.612																																						dbGAP											0													104.0	91.0	95.0					3																	46007805		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3021G>C	3.37:g.46007805C>G			B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Silent	SNP	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.L1007	ENST00000296137.2	37	c.3021	CCDS2734.1	3																																																																																			FYCO1	-	superfamily_tRNA-bd_arm	ENSG00000163820		0.612	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2	92	0.00	0	C	NM_024513		46007805	46007805	-1	no_errors	ENST00000535325	ensembl	human	known	69_37n	silent	83	20.95	22	SNP	1.000	G
GAB2	9846	genome.wustl.edu	37	11	77930333	77930333	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr11:77930333C>G	ENST00000361507.4	-	10	2101	c.2016G>C	c.(2014-2016)aaG>aaC	p.K672N	GAB2_ENST00000340149.2_Missense_Mutation_p.K634N	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	672					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			GCTTGGCACCCTTGGAAGGCT	0.617																																						dbGAP											0													101.0	86.0	91.0					11																	77930333		2200	4292	6492	-	-	-	SO:0001583	missense	0			AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.2016G>C	11.37:g.77930333C>G	ENSP00000354952:p.Lys672Asn		A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.K672N	ENST00000361507.4	37	c.2016	CCDS8259.1	11	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769769	0.49680	.	.	ENSG00000033327	ENST00000340149;ENST00000361507	T;T	0.22945	1.93;1.93	5.38	3.52	0.40303	.	0.000000	0.85682	U	0.000000	T	0.48926	0.1527	M	0.77820	2.39	0.51482	D	0.999923	D	0.76494	0.999	D	0.70716	0.97	T	0.49762	-0.8905	10	0.54805	T	0.06	-18.1113	12.0178	0.53324	0.0:0.8595:0.0:0.1405	.	672	Q9UQC2	GAB2_HUMAN	N	634;672	ENSP00000343959:K634N;ENSP00000354952:K672N	ENSP00000343959:K634N	K	-	3	2	GAB2	77607981	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.376000	0.34306	0.761000	0.33130	0.563000	0.77884	AAG	GAB2	-	NULL	ENSG00000033327		0.617	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB2	HGNC	protein_coding	OTTHUMT00000391085.1	40	0.00	0	C	NM_080491		77930333	77930333	-1	no_errors	ENST00000361507	ensembl	human	known	69_37n	missense	50	43.18	38	SNP	1.000	G
GALT	2592	genome.wustl.edu	37	9	34648780	34648780	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr9:34648780G>C	ENST00000378842.3	+	8	751	c.709G>C	c.(709-711)Gag>Cag	p.E237Q	GALT_ENST00000556278.1_Intron|IL11RA_ENST00000555003.1_5'Flank|GALT_ENST00000450095.2_Missense_Mutation_p.E128Q	NM_000155.3	NP_000146.2	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	237					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)|UDP-glucose catabolic process (GO:0006258)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	UDP-glucose:hexose-1-phosphate uridylyltransferase activity (GO:0008108)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(2)|lung(5)|upper_aerodigestive_tract(1)	16	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		CCTAACCAGTGAGCACTGGTT	0.572									Galactosemia																													dbGAP											0													122.0	117.0	119.0					9																	34648780		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Galactose-1-Phosphate Uridyltransferase Deficiency	M60091	CCDS6565.1, CCDS59122.1	9p13	2013-01-08			ENSG00000213930	ENSG00000213930	2.7.7.12		4135	protein-coding gene	gene with protein product		606999					Standard	NM_000155		Approved		uc003zve.4	P07902	OTTHUMG00000019836	ENST00000378842.3:c.709G>C	9.37:g.34648780G>C	ENSP00000368119:p.Glu237Gln		B4E097|E7ET32|Q14355|Q14356|Q14357|Q14358|Q14359|Q14360|Q14361|Q14363|Q14364|Q14365|Q14369|Q14370|Q14371|Q14372|Q14373|Q14374|Q14375|Q14377|Q14378|Q14380|Q14381|Q14382|Q14383|Q14384|Q14385|Q14386|Q14387|Q14389|Q16766|Q53XK1|Q5VZ81|Q96BY1	Missense_Mutation	SNP	pfam_GalP_Utransf_N,pfam_GalP_Utransf_C,superfamily_HIT-like,pirsf_GalP_UDPtransf1,tigrfam_GalP_UDPtransf1	p.E237Q	ENST00000378842.3	37	c.709	CCDS6565.1	9	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384209	0.42308	.	.	ENSG00000213930	ENST00000450095;ENST00000378842	D;D	0.99338	-5.76;-5.76	5.78	5.78	0.91487	Histidine triad motif (1);Galactose-1-phosphate uridyl transferase, C-terminal (1);Histidine triad-like motif (1);	0.317715	0.27749	U	0.018016	D	0.97961	0.9329	L	0.58354	1.805	0.46078	D	0.99885	B;B;B	0.33280	0.012;0.405;0.036	B;B;B	0.25291	0.027;0.059;0.027	D	0.97729	1.0201	10	0.51188	T	0.08	-13.2767	16.7452	0.85470	0.0:0.0:1.0:0.0	.	189;128;237	B4DT62;E7ET32;P07902	.;.;GALT_HUMAN	Q	128;237	ENSP00000401956:E128Q;ENSP00000368119:E237Q	ENSP00000368119:E237Q	E	+	1	0	GALT	34638780	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.660000	0.46749	2.749000	0.94314	0.655000	0.94253	GAG	GALT	-	pfam_GalP_Utransf_C,superfamily_HIT-like,pirsf_GalP_UDPtransf1,tigrfam_GalP_UDPtransf1	ENSG00000213930		0.572	GALT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GALT	HGNC	protein_coding	OTTHUMT00000052231.1	40	0.00	0	G	NM_000155		34648780	34648780	+1	no_errors	ENST00000378842	ensembl	human	known	69_37n	missense	33	34.00	17	SNP	1.000	C
GGCT	79017	genome.wustl.edu	37	7	30538452	30538452	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr7:30538452G>C	ENST00000275428.4	-	3	524	c.390C>G	c.(388-390)taC>taG	p.Y130*	GGCT_ENST00000005374.6_Intron|GGCT_ENST00000409144.1_Intron|GGCT_ENST00000409390.1_Intron|GGCT_ENST00000598361.1_Nonsense_Mutation_p.Y45*|GGCT_ENST00000409436.1_Nonsense_Mutation_p.Y130*	NM_024051.3	NP_076956.1	O75223	GGCT_HUMAN	gamma-glutamylcyclotransferase	130					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|release of cytochrome c from mitochondria (GO:0001836)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	gamma-glutamylcyclotransferase activity (GO:0003839)|protein homodimerization activity (GO:0042803)	p.Y130*(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8						GAGCACTTTCGTAATTTGTCA	0.338																																						dbGAP											1	Substitution - Nonsense(1)	endometrium(1)											155.0	146.0	149.0					7																	30538452		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC019243	CCDS5428.1, CCDS56474.1, CCDS56475.1, CCDS56476.1	7p15-p14	2010-04-23	2010-04-23	2008-08-04	ENSG00000006625	ENSG00000006625	2.3.2.4		21705	protein-coding gene	gene with protein product		137170	"""chromosome 7 open reading frame 24"""	C7orf24, GCTG		17932939, 18515354	Standard	NM_024051		Approved	MGC3077, CRF21, Ggc	uc003tba.3	O75223	OTTHUMG00000128593	ENST00000275428.4:c.390C>G	7.37:g.30538452G>C	ENSP00000275428:p.Tyr130*		B2RDN0|B8ZZN4|B8ZZR8|Q9BS37	Nonsense_Mutation	SNP	pfam_AIG2-like	p.Y130*	ENST00000275428.4	37	c.390	CCDS5428.1	7	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940902	0.73557	.	.	ENSG00000006625	ENST00000275428;ENST00000497601;ENST00000409436	.	.	.	5.55	-2.67	0.06059	.	0.225910	0.47852	D	0.000210	.	.	.	.	.	.	0.50039	D	0.999841	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.9078	12.4639	0.55747	0.6217:0.0:0.3783:0.0	.	.	.	.	X	130;69;130	.	ENSP00000275428:Y130X	Y	-	3	2	GGCT	30504977	0.534000	0.26362	0.328000	0.25416	0.731000	0.41821	0.123000	0.15708	-0.353000	0.08224	-1.128000	0.01989	TAC	GGCT	-	NULL	ENSG00000006625		0.338	GGCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCT	HGNC	protein_coding	OTTHUMT00000250447.2	466	0.00	0	G	NM_024051		30538452	30538452	-1	no_errors	ENST00000275428	ensembl	human	known	69_37n	nonsense	387	21.46	106	SNP	0.657	C
GPR119	139760	genome.wustl.edu	37	X	129518882	129518882	+	Silent	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chrX:129518882G>C	ENST00000276218.2	-	1	629	c.540C>G	c.(538-540)ctC>ctG	p.L180L		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	180					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						AGAAGACAAAGAGGAGCATGG	0.522																																						dbGAP											0													106.0	86.0	93.0					X																	129518882		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.540C>G	X.37:g.129518882G>C			Q495H7|Q4VBN3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.L180	ENST00000276218.2	37	c.540	CCDS14625.1	X																																																																																			GPR119	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000147262		0.522	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR119	HGNC	protein_coding	OTTHUMT00000058270.1	39	0.00	0	G	NM_178471		129518882	129518882	-1	no_errors	ENST00000276218	ensembl	human	known	69_37n	silent	55	15.38	10	SNP	0.998	C
GPR155	151556	genome.wustl.edu	37	2	175311476	175311476	+	Splice_Site	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr2:175311476C>T	ENST00000392552.2	-	12	2115		c.e12-1		GPR155_ENST00000392551.2_Splice_Site|GPR155_ENST00000459996.1_5'Flank|GPR155_ENST00000295500.4_Splice_Site	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155						cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						CAATGATTGTCTATAAAAGAG	0.378																																						dbGAP											0													142.0	136.0	138.0					2																	175311476		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.1877-1G>A	2.37:g.175311476C>T			B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Splice_Site	SNP	-	e11-1	ENST00000392552.2	37	c.1877-1	CCDS2259.1	2	.	.	.	.	.	.	.	.	.	.	C	13.19	2.161766	0.38217	.	.	ENSG00000163328	ENST00000392552;ENST00000510236;ENST00000392551;ENST00000295500	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3512	0.94387	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPR155	175019722	1.000000	0.71417	0.997000	0.53966	0.234000	0.25298	4.226000	0.58606	2.568000	0.86640	0.563000	0.77884	.	GPR155	-	-	ENSG00000163328		0.378	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR155	HGNC	protein_coding	OTTHUMT00000255455.1	142	0.00	0	C	NM_152529	Intron	175311476	175311476	-1	no_errors	ENST00000295500	ensembl	human	known	69_37n	splice_site	138	12.66	20	SNP	1.000	T
GSTO1	9446	genome.wustl.edu	37	10	106014943	106014943	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr10:106014943C>T	ENST00000369713.5	+	2	251	c.57C>T	c.(55-57)gtC>gtT	p.V19V	GSTO1_ENST00000369710.4_Silent_p.V19V|GSTO1_ENST00000539281.1_5'UTR|GSTO1_ENST00000493946.1_3'UTR	NM_004832.2	NP_004823.1	P78417	GSTO1_HUMAN	glutathione S-transferase omega 1	19					cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014810)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)			large_intestine(1)|lung(1)|stomach(1)	3		Colorectal(252;0.102)|Breast(234;0.122)		Epithelial(162;8.07e-10)|all cancers(201;2.72e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0147)	Glutathione(DB00143)|Vitamin E(DB00163)	CGGGGCCGGTCCCGGAGGGCT	0.682																																						dbGAP											0													30.0	35.0	33.0					10																	106014943		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212303	CCDS7555.1, CCDS53572.1, CCDS53573.1	10q25.1	2012-06-21			ENSG00000148834	ENSG00000148834	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	13312	protein-coding gene	gene with protein product		605482				10783391, 12618591	Standard	NM_004832		Approved	GSTTLp28, P28	uc001kya.3	P78417	OTTHUMG00000019001	ENST00000369713.5:c.57C>T	10.37:g.106014943C>T			D3DRA3|F5H7H0|Q5TA03|Q7Z3T2	Silent	SNP	pfam_GST_C,pfam_Glutathione_S-Trfase_N,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_omega	p.V19	ENST00000369713.5	37	c.57	CCDS7555.1	10																																																																																			GSTO1	-	superfamily_Thioredoxin-like_fold	ENSG00000148834		0.682	GSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTO1	HGNC	protein_coding	OTTHUMT00000050193.1	15	0.00	0	C	NM_004832		106014943	106014943	+1	no_errors	ENST00000369713	ensembl	human	known	69_37n	silent	9	52.63	10	SNP	1.000	T
HIVEP1	3096	genome.wustl.edu	37	6	12164532	12164532	+	Silent	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:12164532G>A	ENST00000379388.2	+	9	8327	c.7995G>A	c.(7993-7995)ctG>ctA	p.L2665L	HIVEP1_ENST00000541134.1_Silent_p.L530L	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2665					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AACCTCTGCTGAAGGCACATT	0.562																																						dbGAP											0													45.0	48.0	47.0					6																	12164532		2128	4249	6377	-	-	-	SO:0001819	synonymous_variant	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.7995G>A	6.37:g.12164532G>A			B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L2665	ENST00000379388.2	37	c.7995	CCDS43426.1	6																																																																																			HIVEP1	-	NULL	ENSG00000095951		0.562	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	42	0.00	0	G	NM_002114		12164532	12164532	+1	no_errors	ENST00000379388	ensembl	human	known	69_37n	silent	47	12.96	7	SNP	0.000	A
HNRNPKP3	399881	genome.wustl.edu	37	11	43283606	43283606	+	RNA	DEL	A	A	-	rs377012965		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr11:43283606delA	ENST00000511537.1	-	0	1329					NR_033868.1				heterogeneous nuclear ribonucleoprotein K pseudogene 3																		AAGCAAATGTAAAAAAAAAAA	0.388																																						dbGAP											0																																										-	-	-			0					11p12	2011-07-05				ENSG00000251557			42376	pseudogene	pseudogene							Standard	NR_033868		Approved		uc001mxe.2				11.37:g.43283606delA				RNA	DEL	-	NULL	ENST00000511537.1	37	NULL		11																																																																																			HNRNPKP3	-	-	ENSG00000251557		0.388	HNRNPKP3-003	KNOWN	basic	processed_transcript	HNRNPKP3	HGNC	pseudogene	OTTHUMT00000390385.1	20	0.00	0	A	NR_033868		43283606	43283606	-1	no_errors	ENST00000511537	ensembl	human	known	69_37n	rna	14	17.65	3	DEL	0.986	-
HRNR	388697	genome.wustl.edu	37	1	152191378	152191378	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:152191378A>C	ENST00000368801.2	-	3	2802	c.2727T>G	c.(2725-2727)caT>caG	p.H909Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	909					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCAGACCCATGTCGGCCAT	0.652																																						dbGAP											0													115.0	127.0	123.0					1																	152191378		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2727T>G	1.37:g.152191378A>C	ENSP00000357791:p.His909Gln		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.H909Q	ENST00000368801.2	37	c.2727	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	A	8.101	0.776702	0.16120	.	.	ENSG00000197915	ENST00000368801	T	0.01560	4.77	3.96	-7.77	0.01227	.	.	.	.	.	T	0.00356	0.0011	L	0.36672	1.1	0.09310	N	1	B	0.26081	0.141	B	0.19666	0.026	T	0.46748	-0.9169	9	0.25106	T	0.35	.	1.1396	0.01762	0.1735:0.332:0.2604:0.2341	.	909	Q86YZ3	HORN_HUMAN	Q	909	ENSP00000357791:H909Q	ENSP00000357791:H909Q	H	-	3	2	HRNR	150458002	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.255000	0.00538	-1.905000	0.01090	-0.486000	0.04755	CAT	HRNR	-	NULL	ENSG00000197915		0.652	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	74	0.00	0	A	XM_373868		152191378	152191378	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	102	50.49	104	SNP	0.000	C
IFT140	9742	genome.wustl.edu	37	16	1608111	1608111	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr16:1608111C>T	ENST00000426508.2	-	19	2587	c.2224G>A	c.(2224-2226)Gag>Aag	p.E742K	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	742					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				GGCTCCACCTCGTCTTCTCTG	0.567																																						dbGAP											0													137.0	133.0	134.0					16																	1608111		2199	4300	6499	-	-	-	SO:0001583	missense	0			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2224G>A	16.37:g.1608111C>T	ENSP00000406012:p.Glu742Lys		A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E742K	ENST00000426508.2	37	c.2224	CCDS10439.1	16	.	.	.	.	.	.	.	.	.	.	C	1.256	-0.617235	0.03663	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.41400	1.0	5.2	1.85	0.25348	.	1.473100	0.03846	N	0.271479	T	0.19087	0.0458	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.19451	-1.0305	10	0.06236	T	0.91	.	1.9292	0.03323	0.109:0.2489:0.3743:0.2677	.	742;467	Q96RY7;B4DR58	IF140_HUMAN;.	K	742	ENSP00000406012:E742K	ENSP00000380562:E742K	E	-	1	0	IFT140	1548112	0.000000	0.05858	0.027000	0.17364	0.002000	0.02628	0.043000	0.13971	0.106000	0.17784	-0.440000	0.05779	GAG	IFT140	-	NULL	ENSG00000187535		0.567	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT140	HGNC	protein_coding	OTTHUMT00000250438.2	91	0.00	0	C	NM_014714		1608111	1608111	-1	no_errors	ENST00000426508	ensembl	human	known	69_37n	missense	231	14.44	39	SNP	0.003	T
IMPG1	3617	genome.wustl.edu	37	6	76744474	76744474	+	Missense_Mutation	SNP	C	C	T	rs200194885		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:76744474C>T	ENST00000369950.3	-	3	521	c.332G>A	c.(331-333)cGg>cAg	p.R111Q	IMPG1_ENST00000369963.3_Missense_Mutation_p.R33Q	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1									p.R111Q(1)		breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CAGAAAGATCCGATATGCTTC	0.488																																					Pancreas(37;839 1141 2599 26037)	dbGAP											1	Substitution - Missense(1)	large_intestine(1)											92.0	83.0	86.0					6																	76744474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.332G>A	6.37:g.76744474C>T	ENSP00000358966:p.Arg111Gln			Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.R111Q	ENST00000369950.3	37	c.332	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	C	36	5.711068	0.96821	.	.	ENSG00000112706	ENST00000369950;ENST00000369963	T;T	0.81163	-1.34;-1.46	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000016	D	0.89382	0.6699	M	0.80982	2.52	0.53688	D	0.999976	D	0.89917	1.0	D	0.85130	0.997	D	0.88377	0.2999	9	.	.	.	.	19.9944	0.97379	0.0:1.0:0.0:0.0	.	111	Q17R60	IMPG1_HUMAN	Q	111;33	ENSP00000358966:R111Q;ENSP00000358980:R33Q	.	R	-	2	0	IMPG1	76801194	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.076000	0.50081	2.720000	0.93068	0.557000	0.71058	CGG	IMPG1	-	NULL	ENSG00000112706		0.488	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	40	0.00	0	C	NM_001563		76744474	76744474	-1	no_errors	ENST00000369950	ensembl	human	known	69_37n	missense	47	21.67	13	SNP	1.000	T
IQCA1	79781	genome.wustl.edu	37	2	237233390	237233390	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr2:237233390C>A	ENST00000409907.3	-	19	2684	c.2410G>T	c.(2410-2412)Gcc>Tcc	p.A804S	IQCA1_ENST00000431676.2_Missense_Mutation_p.A763S|IQCA1_ENST00000309507.5_Missense_Mutation_p.A801S	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	804							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						ATCGCCAAGGCACGTTTTTTA	0.388																																						dbGAP											0													60.0	53.0	55.0					2																	237233390		1875	4107	5982	-	-	-	SO:0001583	missense	0			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.2410G>T	2.37:g.237233390C>A	ENSP00000387347:p.Ala804Ser		B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfscan_IQ_motif_EF-hand-BS	p.A804S	ENST00000409907.3	37	c.2410	CCDS46549.1	2	.	.	.	.	.	.	.	.	.	.	C	7.308	0.614476	0.14129	.	.	ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676	D;D;T	0.93906	-3.31;-3.31;1.6	4.95	4.06	0.47325	.	0.249386	0.31976	N	0.006771	D	0.86049	0.5840	L	0.36672	1.1	0.21386	N	0.99971	B;B;B	0.27117	0.102;0.168;0.102	B;B;B	0.23275	0.03;0.018;0.045	T	0.71537	-0.4563	10	0.17832	T	0.49	.	5.4746	0.16688	0.0:0.6568:0.1757:0.1676	.	763;812;804	E7EWQ0;E9PH78;Q86XH1	.;.;IQCA1_HUMAN	S	804;812;801;763	ENSP00000387347:A804S;ENSP00000311951:A801S;ENSP00000407213:A763S	ENSP00000311951:A801S	A	-	1	0	IQCA1	236898129	0.003000	0.15002	0.742000	0.31022	0.107000	0.19398	0.339000	0.19875	1.163000	0.42636	0.655000	0.94253	GCC	IQCA1	-	NULL	ENSG00000132321		0.388	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	HGNC	protein_coding	OTTHUMT00000329266.1	296	0.00	0	C	NM_024726		237233390	237233390	-1	no_errors	ENST00000409907	ensembl	human	known	69_37n	missense	314	19.90	78	SNP	0.870	A
ITPRIPL2	162073	genome.wustl.edu	37	16	19126677	19126677	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr16:19126677C>T	ENST00000381440.3	+	1	1424	c.894C>T	c.(892-894)taC>taT	p.Y298Y	CTD-2349B8.1_ENST00000564808.2_Intron	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	298						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GCACTGACTACGGCTGCTGCC	0.652											OREG0023657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													61.0	63.0	62.0					16																	19126677		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.894C>T	16.37:g.19126677C>T		730		Silent	SNP	NULL	p.Y298	ENST00000381440.3	37	c.894	CCDS32395.1	16																																																																																			ITPRIPL2	-	NULL	ENSG00000205730		0.652	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPRIPL2	HGNC	protein_coding	OTTHUMT00000435827.3	9	0.00	0	C	NM_001034841		19126677	19126677	+1	no_errors	ENST00000381440	ensembl	human	known	69_37n	silent	45	15.09	8	SNP	1.000	T
KIF14	9928	genome.wustl.edu	37	1	200584610	200584610	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:200584610G>T	ENST00000367350.4	-	3	1678	c.1240C>A	c.(1240-1242)Cat>Aat	p.H414N		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	414	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TAGTGAGGATGACATTCATCA	0.403																																						dbGAP											0													92.0	90.0	91.0					1																	200584610		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.1240C>A	1.37:g.200584610G>T	ENSP00000356319:p.His414Asn		Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.H414N	ENST00000367350.4	37	c.1240	CCDS30963.1	1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634556	0.47049	.	.	ENSG00000118193	ENST00000367350	T	0.72394	-0.65	5.64	5.64	0.86602	Kinesin, motor domain (4);	0.105878	0.64402	D	0.000004	T	0.55097	0.1899	N	0.03930	-0.32	0.38381	D	0.945149	B	0.28470	0.213	B	0.37989	0.262	T	0.54384	-0.8302	10	0.12430	T	0.62	.	20.0723	0.97728	0.0:0.0:1.0:0.0	.	414	Q15058	KIF14_HUMAN	N	414	ENSP00000356319:H414N	ENSP00000356319:H414N	H	-	1	0	KIF14	198851233	1.000000	0.71417	0.192000	0.23308	0.984000	0.73092	5.422000	0.66453	2.819000	0.97034	0.650000	0.86243	CAT	KIF14	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000118193		0.403	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF14	HGNC	protein_coding	OTTHUMT00000086878.1	159	0.00	0	G	NM_014875		200584610	200584610	-1	no_errors	ENST00000367350	ensembl	human	known	69_37n	missense	179	27.53	68	SNP	0.988	T
KIF26B	55083	genome.wustl.edu	37	1	245861453	245861453	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:245861453C>T	ENST00000407071.2	+	13	6310	c.5870C>T	c.(5869-5871)tCt>tTt	p.S1957F	KIF26B_ENST00000366518.4_Missense_Mutation_p.S1576F	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1957					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CTGGACACCTCTTCCCCTGTG	0.547																																						dbGAP											0													47.0	50.0	49.0					1																	245861453		1862	4101	5963	-	-	-	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.5870C>T	1.37:g.245861453C>T	ENSP00000385545:p.Ser1957Phe		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1957F	ENST00000407071.2	37	c.5870	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508116	0.64410	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.79352	-1.26;-1.26	5.68	5.68	0.88126	.	.	.	.	.	T	0.73690	0.3619	L	0.38175	1.15	0.45056	D	0.998078	P	0.37955	0.612	B	0.37833	0.259	T	0.76402	-0.2972	9	0.87932	D	0	.	19.7789	0.96410	0.0:1.0:0.0:0.0	.	1957	Q2KJY2	KI26B_HUMAN	F	1957;1576;1573	ENSP00000385545:S1957F;ENSP00000355475:S1576F	ENSP00000355475:S1576F	S	+	2	0	KIF26B	243928076	0.420000	0.25457	0.996000	0.52242	0.506000	0.33950	5.307000	0.65762	2.679000	0.91253	0.655000	0.94253	TCT	KIF26B	-	NULL	ENSG00000162849		0.547	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	83	0.00	0	C	XM_371354		245861453	245861453	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	missense	166	15.31	30	SNP	1.000	T
KIF3B	9371	genome.wustl.edu	37	20	30898419	30898419	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr20:30898419C>T	ENST00000375712.3	+	2	1006	c.839C>T	c.(838-840)tCt>tTt	p.S280F	KIF3B_ENST00000418717.2_5'UTR	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	280	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AATGTCATCTCTGCTCTAGTG	0.522																																						dbGAP											0													92.0	86.0	88.0					20																	30898419		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.839C>T	20.37:g.30898419C>T	ENSP00000364864:p.Ser280Phe		B2RMP4|B4DSR5|E1P5M5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S280F	ENST00000375712.3	37	c.839	CCDS13200.1	20	.	.	.	.	.	.	.	.	.	.	C	18.55	3.647663	0.67358	.	.	ENSG00000101350	ENST00000375712	T	0.76448	-1.02	4.52	4.52	0.55395	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.89667	0.6781	M	0.89030	3	0.80722	D	1	D;D	0.89917	0.988;1.0	P;D	0.72075	0.9;0.976	D	0.91990	0.5602	10	0.87932	D	0	.	17.4488	0.87586	0.0:1.0:0.0:0.0	.	280;280	B4DYF2;O15066	.;KIF3B_HUMAN	F	280	ENSP00000364864:S280F	ENSP00000364864:S280F	S	+	2	0	KIF3B	30362080	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.651000	0.83577	2.336000	0.79503	0.462000	0.41574	TCT	KIF3B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom	ENSG00000101350		0.522	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	82	0.00	0	C	NM_004798		30898419	30898419	+1	no_errors	ENST00000375712	ensembl	human	known	69_37n	missense	122	14.69	21	SNP	1.000	T
KL	9365	genome.wustl.edu	37	13	33638277	33638277	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr13:33638277C>G	ENST00000380099.3	+	5	3001	c.2993C>G	c.(2992-2994)tCc>tGc	p.S998C	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	998					acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		ATTTCTCTCTCCCTTATATTT	0.333																																						dbGAP											0													45.0	47.0	46.0					13																	33638277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2993C>G	13.37:g.33638277C>G	ENSP00000369442:p.Ser998Cys		Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.S998C	ENST00000380099.3	37	c.2993	CCDS9347.1	13	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803860	0.31869	.	.	ENSG00000133116	ENST00000380099	T	0.22539	1.95	5.22	5.22	0.72569	.	0.257283	0.41097	D	0.000942	T	0.18257	0.0438	L	0.50333	1.59	0.24258	N	0.995295	B	0.09022	0.002	B	0.06405	0.002	T	0.08493	-1.0719	10	0.40728	T	0.16	-22.6988	7.105	0.25358	0.0:0.7904:0.0:0.2096	.	998	Q9UEF7	KLOT_HUMAN	C	998	ENSP00000369442:S998C	ENSP00000369442:S998C	S	+	2	0	KL	32536277	0.994000	0.37717	0.991000	0.47740	0.709000	0.40893	3.285000	0.51716	2.590000	0.87494	0.655000	0.94253	TCC	KL	-	NULL	ENSG00000133116		0.333	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KL	HGNC	protein_coding	OTTHUMT00000045987.1	148	0.00	0	C			33638277	33638277	+1	no_errors	ENST00000380099	ensembl	human	known	69_37n	missense	57	30.49	25	SNP	0.994	G
KRT25	147183	genome.wustl.edu	37	17	38907420	38907420	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr17:38907420C>T	ENST00000312150.4	-	4	888	c.828G>A	c.(826-828)gaG>gaA	p.E276E		NM_181534.3	NP_853512.1			keratin 25											endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				GAGTCACCTTCTCGTTGAACC	0.537																																						dbGAP											0													88.0	75.0	79.0					17																	38907420		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.828G>A	17.37:g.38907420C>T				Silent	SNP	pfam_F,prints_Keratin_I	p.E276	ENST00000312150.4	37	c.828	CCDS11373.1	17																																																																																			KRT25	-	pfam_F	ENSG00000204897		0.537	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT25	HGNC	protein_coding	OTTHUMT00000257218.1	56	0.00	0	C	NM_181534		38907420	38907420	-1	no_errors	ENST00000312150	ensembl	human	known	69_37n	silent	75	27.88	29	SNP	0.020	T
L3MBTL3	84456	genome.wustl.edu	37	6	130392142	130392142	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:130392142C>T	ENST00000529410.1	+	15	1593	c.1114C>T	c.(1114-1116)Cga>Tga	p.R372*	L3MBTL3_ENST00000361794.2_Nonsense_Mutation_p.R372*|L3MBTL3_ENST00000368136.2_Nonsense_Mutation_p.R372*|L3MBTL3_ENST00000533560.1_Nonsense_Mutation_p.R347*|L3MBTL3_ENST00000526019.1_Nonsense_Mutation_p.R347*|L3MBTL3_ENST00000368139.2_Nonsense_Mutation_p.R347*			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	372					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		ATCGGGCTTTCGAGTTGGTAT	0.438																																						dbGAP											0													227.0	218.0	221.0					6																	130392142		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1114C>T	6.37:g.130392142C>T	ENSP00000431962:p.Arg372*		Q4VXE1|Q5VUM9|Q6P9B5	Nonsense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.R372*	ENST00000529410.1	37	c.1114	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	C	41	8.949975	0.99014	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	372;347;372;347;347;372	.	ENSP00000354526:R372X	R	+	1	2	L3MBTL3	130433835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.250000	0.51445	2.941000	0.99782	0.655000	0.94253	CGA	L3MBTL3	-	smart_Mbt,pfscan_Mbt	ENSG00000198945		0.438	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2	232	0.00	0	C	XM_027074		130392142	130392142	+1	no_errors	ENST00000361794	ensembl	human	known	69_37n	nonsense	211	12.81	31	SNP	1.000	T
LAMB1	3912	genome.wustl.edu	37	7	107626640	107626640	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr7:107626640C>T	ENST00000222399.6	-	6	822	c.592G>A	c.(592-594)Gaa>Aaa	p.E198K	LAMB1_ENST00000393560.1_Missense_Mutation_p.E198K|LAMB1_ENST00000393561.1_Missense_Mutation_p.E222K	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	198	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GTTGAGGGTTCAATGTCAGAA	0.388																																						dbGAP											0													116.0	114.0	115.0					7																	107626640		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.592G>A	7.37:g.107626640C>T	ENSP00000222399:p.Glu198Lys		Q14D91	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E198K	ENST00000222399.6	37	c.592	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.659032	0.96734	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.76316	-1.01;-1.01;-1.01	5.85	5.85	0.93711	Laminin, N-terminal (3);	.	.	.	.	D	0.87981	0.6315	M	0.66378	2.025	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.965;1.0;0.999	D	0.87903	0.2692	9	0.72032	D	0.01	.	20.172	0.98160	0.0:1.0:0.0:0.0	.	198;198;222	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	K	222;198;198	ENSP00000377191:E222K;ENSP00000222399:E198K;ENSP00000377190:E198K	ENSP00000222399:E198K	E	-	1	0	LAMB1	107413876	1.000000	0.71417	0.989000	0.46669	0.956000	0.61745	7.818000	0.86416	2.766000	0.95052	0.650000	0.86243	GAA	LAMB1	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000091136		0.388	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	211	0.00	0	C	NM_002291		107626640	107626640	-1	no_errors	ENST00000222399	ensembl	human	known	69_37n	missense	205	15.98	39	SNP	1.000	T
LIMD1	8994	genome.wustl.edu	37	3	45636504	45636504	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr3:45636504C>T	ENST00000273317.4	+	1	154	c.133C>T	c.(133-135)Cgc>Tgc	p.R45C	LIMD1_ENST00000440097.1_Missense_Mutation_p.R45C|AC099539.1_ENST00000516118.1_RNA|LIMD1_ENST00000465039.1_Intron	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	45					cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		TGAGGAAACTCGCAGGGTGTT	0.572																																						dbGAP											0													51.0	49.0	49.0					3																	45636504		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.133C>T	3.37:g.45636504C>T	ENSP00000273317:p.Arg45Cys		Q17RQ1|Q9BQQ9|Q9NQ47	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R45C	ENST00000273317.4	37	c.133	CCDS2729.1	3	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482121	0.63849	.	.	ENSG00000144791	ENST00000440097;ENST00000273317	T;T	0.71461	-0.57;-0.33	4.22	3.3	0.37823	.	0.000000	0.64402	D	0.000002	T	0.72309	0.3444	N	0.24115	0.695	0.50467	D	0.999875	D	0.89917	1.0	D	0.79784	0.993	T	0.75844	-0.3174	10	0.87932	D	0	.	11.764	0.51920	0.444:0.556:0.0:0.0	.	45	Q9UGP4	LIMD1_HUMAN	C	45	ENSP00000394537:R45C;ENSP00000273317:R45C	ENSP00000273317:R45C	R	+	1	0	LIMD1	45611508	0.250000	0.23951	0.987000	0.45799	0.938000	0.57974	0.861000	0.27885	1.901000	0.55032	0.462000	0.41574	CGC	LIMD1	-	NULL	ENSG00000144791		0.572	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMD1	HGNC	protein_coding	OTTHUMT00000257327.1	18	0.00	0	C	NM_014240		45636504	45636504	+1	no_errors	ENST00000273317	ensembl	human	known	69_37n	missense	18	43.75	14	SNP	0.978	T
LINC00521	256369	genome.wustl.edu	37	14	94466008	94466008	+	RNA	SNP	G	G	C	rs192272134	byFrequency	TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr14:94466008G>C	ENST00000444118.1	+	0	465					NR_024182.1		Q8NCU1	CN048_HUMAN	long intergenic non-protein coding RNA 521																		GAAAATCCCCGAGGGTATGTA	0.522													G|||	3	0.000599042	0.0	0.0	5008	,	,		21479	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													81.0	85.0	84.0					14																	94466008		2203	4300	6503	-	-	-			0			BI463117		14q32.12	2012-10-12	2011-11-29	2011-11-29	ENSG00000175699	ENSG00000175699		"""Long non-coding RNAs"""	19860	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 48"""	C14orf48			Standard	NR_024182		Approved		uc001ycg.1	Q8NCU1	OTTHUMG00000156974		14.37:g.94466008G>C			Q8N7S1	RNA	SNP	-	NULL	ENST00000444118.1	37	NULL		14																																																																																			LINC00521	-	-	ENSG00000175699		0.522	LINC00521-003	KNOWN	basic	processed_transcript	LINC00521	HGNC	processed_transcript	OTTHUMT00000346916.1	78	0.00	0	G			94466008	94466008	+1	no_errors	ENST00000314629	ensembl	human	known	69_37n	rna	96	25.00	32	SNP	0.500	C
LLGL2	3993	genome.wustl.edu	37	17	73564696	73564696	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr17:73564696C>T	ENST00000392550.3	+	11	1293	c.1176C>T	c.(1174-1176)caC>caT	p.H392H	LLGL2_ENST00000167462.5_Silent_p.H392H|LLGL2_ENST00000577200.1_Silent_p.H392H	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	392					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			GCTCTCACCACGTCTCCAACA	0.637																																						dbGAP											0													58.0	51.0	54.0					17																	73564696		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1176C>T	17.37:g.73564696C>T			Q14521|Q9BR62	Silent	SNP	pfam_LLGL2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,prints_Lethal2_giant	p.H392	ENST00000392550.3	37	c.1176	CCDS32733.1	17																																																																																			LLGL2	-	superfamily_WD40_repeat_dom	ENSG00000073350		0.637	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	HGNC	protein_coding	OTTHUMT00000447633.1	25	0.00	0	C	NM_004524		73564696	73564696	+1	no_errors	ENST00000392550	ensembl	human	known	69_37n	silent	35	31.37	16	SNP	0.975	T
LPAR1	1902	genome.wustl.edu	37	9	113637855	113637855	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr9:113637855C>T	ENST00000374431.3	-	5	1324	c.941G>A	c.(940-942)cGc>cAc	p.R314H	LPAR1_ENST00000374430.2_Missense_Mutation_p.R314H|LPAR1_ENST00000358883.4_Missense_Mutation_p.R314H|LPAR1_ENST00000538760.1_Missense_Mutation_p.R315H|LPAR1_ENST00000541779.1_Missense_Mutation_p.R315H	NM_057159.2	NP_476500.1	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	314					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|bleb assembly (GO:0032060)|cellular response to oxygen levels (GO:0071453)|G-protein coupled receptor signaling pathway (GO:0007186)|myelination (GO:0042552)|negative regulation of neuron projection development (GO:0010977)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell chemotaxis (GO:0071673)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(6)|skin(1)	21						TTCTTTGTCGCGGTAGGAGTA	0.562																																					NSCLC(115;661 2323 9836 34256)	dbGAP											0													169.0	166.0	167.0					9																	113637855		2203	4300	6503	-	-	-	SO:0001583	missense	0			U80811	CCDS6777.1	9q	2012-08-08	2008-04-11	2008-04-11	ENSG00000198121	ENSG00000198121		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3166	protein-coding gene	gene with protein product		602282	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2"""	EDG2		8922387, 9070858	Standard	NM_001401		Approved	edg-2, rec.1.3, vzg-1, Gpcr26, Mrec1.3, LPA1, GPR26	uc004bfc.3	Q92633	OTTHUMG00000020486	ENST00000374431.3:c.941G>A	9.37:g.113637855C>T	ENSP00000363553:p.Arg314His		B4DK36|O00656|O00722|P78351	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_LPA_rcpt_EDG2,prints_LPA_rcpt,prints_7TM_GPCR_Rhodpsn	p.R315H	ENST00000374431.3	37	c.944	CCDS6777.1	9	.	.	.	.	.	.	.	.	.	.	C	32	5.132243	0.94473	.	.	ENSG00000198121	ENST00000374431;ENST00000541779;ENST00000374430;ENST00000358883;ENST00000449490;ENST00000538760	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.54967	0.1891	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.991;0.991	T	0.55263	-0.8168	10	0.66056	D	0.02	.	19.609	0.95594	0.0:1.0:0.0:0.0	.	315;315;314	B4DQ18;B4DK36;Q92633	.;.;LPAR1_HUMAN	H	314;315;314;314;296;315	ENSP00000363553:R314H;ENSP00000445697:R315H;ENSP00000363552:R314H;ENSP00000351755:R314H;ENSP00000440201:R315H	ENSP00000351755:R314H	R	-	2	0	LPAR1	112677676	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	7.755000	0.85180	2.882000	0.98803	0.655000	0.94253	CGC	LPAR1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000198121		0.562	LPAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR1	HGNC	protein_coding	OTTHUMT00000053631.1	99	0.00	0	C	NM_057159		113637855	113637855	-1	no_errors	ENST00000538760	ensembl	human	known	69_37n	missense	195	20.41	50	SNP	1.000	T
LRRC32	2615	genome.wustl.edu	37	11	76372514	76372514	+	Silent	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr11:76372514G>C	ENST00000407242.2	-	3	365	c.123C>G	c.(121-123)ctC>ctG	p.L41L	LRRC32_ENST00000464145.1_Intron|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000260061.5_Silent_p.L41L|LRRC32_ENST00000404995.1_Silent_p.L41L	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	41					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)		p.L41L(1)		endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						AGGGGACCTGGAGCAGGCCCA	0.622																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											32.0	32.0	32.0					11																	76372514		2200	4291	6491	-	-	-	SO:0001819	synonymous_variant	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.123C>G	11.37:g.76372514G>C			Q86V06	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.L41	ENST00000407242.2	37	c.123	CCDS8245.1	11																																																																																			LRRC32	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000137507		0.622	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	21	0.00	0	G	NM_005512		76372514	76372514	-1	no_errors	ENST00000260061	ensembl	human	known	69_37n	silent	54	19.40	13	SNP	0.000	C
LYST	1130	genome.wustl.edu	37	1	235969927	235969927	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:235969927G>A	ENST00000389794.3	-	6	2683	c.2509C>T	c.(2509-2511)Cca>Tca	p.P837S	LYST_ENST00000536965.1_Missense_Mutation_p.P837S|LYST_ENST00000389793.2_Missense_Mutation_p.P837S			Q99698	LYST_HUMAN	lysosomal trafficking regulator	837					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.P837S(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCAATATCTGGAACTGAGGCA	0.388																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											223.0	214.0	217.0					1																	235969927		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.2509C>T	1.37:g.235969927G>A	ENSP00000374444:p.Pro837Ser		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P837S	ENST00000389794.3	37	c.2509	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	9.538	1.112634	0.20795	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.61510	0.1;0.1;1.26	5.48	3.57	0.40892	.	0.407398	0.28140	N	0.016444	T	0.37839	0.1018	L	0.33485	1.01	0.24115	N	0.99583	B;B	0.18013	0.025;0.012	B;B	0.18871	0.023;0.021	T	0.27806	-1.0063	10	0.05833	T	0.94	.	7.3156	0.26499	0.1483:0.1394:0.7122:0.0	.	837;837	Q99698-3;Q99698	.;LYST_HUMAN	S	837	ENSP00000374444:P837S;ENSP00000374443:P837S;ENSP00000438315:P837S	ENSP00000374443:P837S	P	-	1	0	LYST	234036550	0.983000	0.35010	0.005000	0.12908	0.940000	0.58332	1.964000	0.40462	0.662000	0.31006	0.655000	0.94253	CCA	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.388	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	220	0.00	0	G			235969927	235969927	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	missense	207	32.13	98	SNP	0.900	A
MAP2	4133	genome.wustl.edu	37	2	210560177	210560177	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr2:210560177G>C	ENST00000360351.4	+	7	3789	c.3283G>C	c.(3283-3285)Gag>Cag	p.E1095Q	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.E1091Q|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1095					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TATGGGTGTTGAGTCTGGCCA	0.498																																					Pancreas(27;423 979 28787 29963)	dbGAP											0													101.0	99.0	100.0					2																	210560177		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3283G>C	2.37:g.210560177G>C	ENSP00000353508:p.Glu1095Gln		Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.E1095Q	ENST00000360351.4	37	c.3283	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503659	0.85176	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.25749	1.78;1.78	5.83	5.83	0.93111	MAP2/Tau projection (1);	0.095855	0.45606	D	0.000346	T	0.50274	0.1606	L	0.56769	1.78	0.42899	D	0.994222	D;D	0.71674	0.998;0.998	D;D	0.69824	0.943;0.966	T	0.46373	-0.9196	10	0.87932	D	0	-12.3452	20.1184	0.97949	0.0:0.0:1.0:0.0	.	1091;1095	P11137-3;P11137	.;MAP2_HUMAN	Q	1095;1091	ENSP00000353508:E1095Q;ENSP00000392164:E1091Q	ENSP00000353508:E1095Q	E	+	1	0	MAP2	210268422	1.000000	0.71417	0.118000	0.21660	0.297000	0.27493	4.762000	0.62250	2.775000	0.95449	0.650000	0.86243	GAG	MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.498	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	73	0.00	0	G	NM_001039538		210560177	210560177	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	84	28.21	33	SNP	0.948	C
MAPK14	1432	genome.wustl.edu	37	6	36040654	36040654	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:36040654C>T	ENST00000229794.4	+	4	698	c.310C>T	c.(310-312)Ctg>Ttg	p.L104L	MAPK14_ENST00000229795.3_Silent_p.L104L|MAPK14_ENST00000310795.4_Silent_p.L104L|MAPK14_ENST00000468133.1_Silent_p.L27L	NM_139012.2|NM_139014.2	NP_620581.1|NP_620583.1	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14	104	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cartilage condensation (GO:0001502)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to ionizing radiation (GO:0071479)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chemotaxis (GO:0006935)|chondrocyte differentiation (GO:0002062)|DNA damage checkpoint (GO:0000077)|fatty acid oxidation (GO:0019395)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoclast differentiation (GO:0030316)|p38MAPK cascade (GO:0038066)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to muramyl dipeptide (GO:0032495)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|signal transduction in response to DNA damage (GO:0042770)|skeletal muscle tissue development (GO:0007519)|stress-activated MAPK cascade (GO:0051403)|stress-induced premature senescence (GO:0090400)|striated muscle cell differentiation (GO:0051146)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|MAP kinase kinase activity (GO:0004708)|NFAT protein binding (GO:0051525)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|stomach(1)	16						TTCTAGGTATCTGGTGACCCA	0.363																																					Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)	dbGAP											0													87.0	85.0	86.0					6																	36040654		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L35263	CCDS4815.1, CCDS4816.1, CCDS4817.1	6p21.3-p21.2	2011-06-09			ENSG00000112062	ENSG00000112062		"""Mitogen-activated protein kinase cascade / Kinases"""	6876	protein-coding gene	gene with protein product	"""p38 MAP kinase"""	600289		CSPB1, CSBP1, CSBP2		7997261	Standard	NM_139012		Approved	PRKM14, p38, Mxi2, PRKM15	uc003olq.3	Q16539	OTTHUMG00000159806	ENST00000229794.4:c.310C>T	6.37:g.36040654C>T			A6ZJ92|A8K6P4|B0LPH0|B5TY32|O60776|Q13083|Q14084|Q8TDX0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_p38	p.L104	ENST00000229794.4	37	c.310	CCDS4816.1	6																																																																																			MAPK14	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000112062		0.363	MAPK14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK14	HGNC	protein_coding	OTTHUMT00000357450.1	234	0.00	0	C	NM_001315		36040654	36040654	+1	no_errors	ENST00000229794	ensembl	human	known	69_37n	silent	229	17.63	49	SNP	1.000	T
MAP3K4	4216	genome.wustl.edu	37	6	161507647	161507647	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:161507647C>G	ENST00000392142.4	+	9	2652	c.2504C>G	c.(2503-2505)tCa>tGa	p.S835*	MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.S835*|MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.S835*|MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.S835*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	835					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.S835L(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TTCAGGCTTTCAGCCCCAGTT	0.358																																						dbGAP											2	Substitution - Missense(2)	lung(2)											70.0	68.0	69.0					6																	161507647		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2504C>G	6.37:g.161507647C>G	ENSP00000375986:p.Ser835*		A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S835*	ENST00000392142.4	37	c.2504	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	C	39	7.506994	0.98325	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	5.28	5.28	0.74379	.	0.175509	0.39687	N	0.001291	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-11.0362	19.2757	0.94030	0.0:1.0:0.0:0.0	.	.	.	.	X	835	.	ENSP00000297332:S835X	S	+	2	0	MAP3K4	161427637	0.995000	0.38212	0.065000	0.19835	0.923000	0.55619	6.576000	0.74023	2.624000	0.88883	0.650000	0.86243	TCA	MAP3K4	-	NULL	ENSG00000085511		0.358	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	159	0.00	0	C			161507647	161507647	+1	no_errors	ENST00000392142	ensembl	human	known	69_37n	nonsense	122	19.74	30	SNP	0.134	G
MEGF11	84465	genome.wustl.edu	37	15	66206079	66206079	+	Silent	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr15:66206079G>A	ENST00000409699.2	-	20	2878	c.2706C>T	c.(2704-2706)ctC>ctT	p.L902L	MEGF11_ENST00000422354.1_Silent_p.L902L|MEGF11_ENST00000360698.4_3'UTR|MEGF11_ENST00000288745.3_Silent_p.L827L|MEGF11_ENST00000395625.2_Silent_p.L827L|MEGF11_ENST00000478721.1_5'UTR|MEGF11_ENST00000395614.1_Silent_p.L75L			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	902					homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						CCTTACCTGAGAGGGAGTAGT	0.612																																						dbGAP											0													51.0	51.0	51.0					15																	66206079		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.2706C>T	15.37:g.66206079G>A			Q17R86|Q6UXS5|Q8ND91|Q96KG6	Silent	SNP	pfam_EGF_laminin,pfam_EGF_extracell,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_EMI_domain	p.L902	ENST00000409699.2	37	c.2706	CCDS10213.2	15																																																																																			MEGF11	-	NULL	ENSG00000157890		0.612	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF11	HGNC	protein_coding	OTTHUMT00000329307.2	25	0.00	0	G	NM_032445		66206079	66206079	-1	no_errors	ENST00000409699	ensembl	human	known	69_37n	silent	68	20.93	18	SNP	0.987	A
MS4A14	84689	genome.wustl.edu	37	11	60183854	60183854	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr11:60183854G>C	ENST00000300187.6	+	5	1690	c.1413G>C	c.(1411-1413)tgG>tgC	p.W471C	MS4A14_ENST00000531787.1_Missense_Mutation_p.W359C|MS4A14_ENST00000531783.1_Missense_Mutation_p.W504C|MS4A14_ENST00000395005.2_Missense_Mutation_p.W454C	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	471	Gln-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						CCAAAGAATGGAAATCTGAGG	0.378																																						dbGAP											0													68.0	70.0	69.0					11																	60183854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.1413G>C	11.37:g.60183854G>C	ENSP00000300187:p.Trp471Cys		E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	pfam_CD20-like	p.W471C	ENST00000300187.6	37	c.1413	CCDS31569.1	11	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673805	0.29693	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	T;T;T;T	0.64803	-0.12;0.93;-0.09;1.39	3.91	3.91	0.45181	.	3.339140	0.00531	N	0.000209	T	0.78496	0.4292	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.63821	-0.6550	10	0.59425	D	0.04	-5.611	12.1567	0.54081	0.0:0.0:1.0:0.0	.	454;471	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	C	359;471;454;504	ENSP00000437222:W359C;ENSP00000300187:W471C;ENSP00000378453:W454C;ENSP00000433761:W504C	ENSP00000300187:W471C	W	+	3	0	MS4A14	59940430	0.998000	0.40836	0.909000	0.35828	0.034000	0.12701	2.101000	0.41787	2.123000	0.65237	0.650000	0.86243	TGG	MS4A14	-	NULL	ENSG00000166928		0.378	MS4A14-002	KNOWN	basic|CCDS	protein_coding	MS4A14	HGNC	protein_coding	OTTHUMT00000395383.2	84	0.00	0	G			60183854	60183854	+1	no_errors	ENST00000300187	ensembl	human	known	69_37n	missense	58	25.64	20	SNP	0.992	C
MTHFD1L	25902	genome.wustl.edu	37	6	151281482	151281482	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:151281482G>A	ENST00000367321.3	+	18	2149	c.1875G>A	c.(1873-1875)atG>atA	p.M625I		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	625	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TCGCAGACATGAAGGCACGGC	0.587																																						dbGAP											0													80.0	64.0	70.0					6																	151281482		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.1875G>A	6.37:g.151281482G>A	ENSP00000356290:p.Met625Ile		Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.M625I	ENST00000367321.3	37	c.1875	CCDS5228.1	6	.	.	.	.	.	.	.	.	.	.	G	31	5.080075	0.94050	.	.	ENSG00000120254	ENST00000367321	T	0.22539	1.95	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.47284	0.1437	M	0.86097	2.795	0.80722	D	1	D;P;D	0.89917	1.0;0.704;0.997	D;P;D	0.87578	0.998;0.6;0.995	T	0.51260	-0.8728	10	0.72032	D	0.01	.	18.8511	0.92230	0.0:0.0:1.0:0.0	.	626;380;625	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	I	625	ENSP00000356290:M625I	ENSP00000356290:M625I	M	+	3	0	MTHFD1L	151323175	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.272000	0.95707	2.758000	0.94735	0.460000	0.39030	ATG	MTHFD1L	-	pfam_Formate_THF_ligase	ENSG00000120254		0.587	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD1L	HGNC	protein_coding	OTTHUMT00000042699.1	14	0.00	0	G	NM_015440		151281482	151281482	+1	no_errors	ENST00000367321	ensembl	human	known	69_37n	missense	70	15.66	13	SNP	1.000	A
MUC5B	727897	genome.wustl.edu	37	11	1268931	1268931	+	Silent	SNP	A	A	C	rs2334757	byFrequency	TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr11:1268931A>C	ENST00000529681.1	+	31	10879	c.10821A>C	c.(10819-10821)gcA>gcC	p.A3607A	MUC5B_ENST00000447027.1_Silent_p.A3610A|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3607	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCGGAGGGGCAGTCTGTGAGC	0.672													-|||	1447	0.288938	0.2065	0.2565	5008	,	,		10450	0.5159		0.2078	False		,,,				2504	0.273					dbGAP											0													38.0	41.0	40.0					11																	1268931		1863	4019	5882	-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10821A>C	11.37:g.1268931A>C			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A3610	ENST00000529681.1	37	c.10830	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	30	0.00	0	A	XM_001126093		1268931	1268931	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	51	23.88	16	SNP	0.000	C
MYLK3	91807	genome.wustl.edu	37	16	46771693	46771693	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr16:46771693G>C	ENST00000394809.4	-	3	1046	c.931C>G	c.(931-933)Cag>Gag	p.Q311E	MYLK3_ENST00000536476.1_Intron	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	311					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CCTGGGCACTGAGGGCCAGGC	0.657																																						dbGAP											0													56.0	53.0	54.0					16																	46771693		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.931C>G	16.37:g.46771693G>C	ENSP00000378288:p.Gln311Glu		B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q311E	ENST00000394809.4	37	c.931	CCDS10723.2	16	.	.	.	.	.	.	.	.	.	.	G	0.236	-1.017219	0.02078	.	.	ENSG00000140795	ENST00000394809	T	0.66638	-0.22	3.5	1.23	0.21249	.	.	.	.	.	T	0.50871	0.1641	L	0.32530	0.975	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33548	-0.9864	9	0.22109	T	0.4	.	8.9693	0.35897	0.0:0.4517:0.5483:0.0	.	311	Q32MK0	MYLK3_HUMAN	E	311	ENSP00000378288:Q311E	ENSP00000378288:Q311E	Q	-	1	0	MYLK3	45329194	0.000000	0.05858	0.011000	0.14972	0.371000	0.29859	0.332000	0.19751	0.761000	0.33130	0.655000	0.94253	CAG	MYLK3	-	NULL	ENSG00000140795		0.657	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLK3	HGNC	protein_coding	OTTHUMT00000255743.2	13	0.00	0	G	NM_182493		46771693	46771693	-1	no_errors	ENST00000394809	ensembl	human	known	69_37n	missense	60	14.29	10	SNP	0.006	C
NOC4L	79050	genome.wustl.edu	37	12	132636742	132636742	+	Splice_Site	SNP	G	G	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr12:132636742G>T	ENST00000330579.1	+	14	1472	c.1431G>T	c.(1429-1431)gaG>gaT	p.E477D	NOC4L_ENST00000538784.1_Splice_Site_p.E92D	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	477					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		CGGCCTACGAGGTGCGGAACT	0.652																																						dbGAP											0													37.0	31.0	33.0					12																	132636742		2191	4289	6480	-	-	-	SO:0001630	splice_region_variant	0				CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.1431+1G>T	12.37:g.132636742G>T			Q8N2S5|Q96I14	Missense_Mutation	SNP	pfam_CCAAT-binding_factor,superfamily_ARM-type_fold	p.E477D	ENST00000330579.1	37	c.1431	CCDS9277.1	12	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736756	0.69304	.	.	ENSG00000184967	ENST00000330579;ENST00000538784	T;T	0.37584	1.19;1.19	4.59	1.73	0.24493	.	0.117401	0.56097	D	0.000031	T	0.42562	0.1208	L	0.50333	1.59	0.46678	D	0.999157	D	0.69078	0.997	P	0.60473	0.875	T	0.16541	-1.0399	10	0.21540	T	0.41	-24.4497	8.1258	0.30997	0.2611:0.0:0.7389:0.0	.	477	Q9BVI4	NOC4L_HUMAN	D	477;92	ENSP00000328854:E477D;ENSP00000443336:E92D	ENSP00000328854:E477D	E	+	3	2	NOC4L	131202695	1.000000	0.71417	0.068000	0.19968	0.021000	0.10359	5.082000	0.64450	0.053000	0.16036	-0.362000	0.07510	GAG	NOC4L	-	NULL	ENSG00000184967		0.652	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC4L	HGNC	protein_coding	OTTHUMT00000398999.1	15	0.00	0	G	NM_024078	Missense_Mutation	132636742	132636742	+1	no_errors	ENST00000330579	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	1.000	T
NOTCH2	4853	genome.wustl.edu	37	1	120484236	120484236	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:120484236G>C	ENST00000256646.2	-	18	3113	c.2894C>G	c.(2893-2895)tCt>tGt	p.S965C		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	965	EGF-like 25; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACGTAGTCAGAGCAGGTCCC	0.498			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													136.0	100.0	112.0					1																	120484236		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.2894C>G	1.37:g.120484236G>C	ENSP00000256646:p.Ser965Cys		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.S965C	ENST00000256646.2	37	c.2894	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.024725	0.75390	.	.	ENSG00000134250	ENST00000256646	D	0.93763	-3.28	6.08	6.08	0.98989	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.37483	U	0.002064	D	0.94122	0.8115	L	0.39898	1.24	0.39618	D	0.969984	D;D	0.56287	0.971;0.975	D;P	0.64506	0.926;0.87	D	0.93003	0.6425	10	0.41790	T	0.15	.	19.6603	0.95864	0.0:0.0:1.0:0.0	.	965;965	Q6IQ50;Q04721	.;NOTC2_HUMAN	C	965	ENSP00000256646:S965C	ENSP00000256646:S965C	S	-	2	0	NOTCH2	120285759	1.000000	0.71417	0.992000	0.48379	0.986000	0.74619	4.223000	0.58587	2.894000	0.99253	0.591000	0.81541	TCT	NOTCH2	-	pirsf_Notch,pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000134250		0.498	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	70	0.00	0	G	NM_024408		120484236	120484236	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	missense	105	18.60	24	SNP	0.997	C
NSMCE2	286053	genome.wustl.edu	37	8	126194375	126194375	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr8:126194375G>C	ENST00000287437.3	+	5	511	c.295G>C	c.(295-297)Gat>Cat	p.D99H	NSMCE2_ENST00000522563.1_Missense_Mutation_p.D99H|NSMCE2_ENST00000517315.1_Missense_Mutation_p.D39H	NM_173685.2	NP_775956.1	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog (S. cerevisiae)	99					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|protein sumoylation (GO:0016925)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			AAAAATACCAGATTTAAAATT	0.284																																						dbGAP											0													55.0	65.0	62.0					8																	126194375		2199	4292	6491	-	-	-	SO:0001583	missense	0			AK057002	CCDS6356.1	8q24.13	2013-01-28	2006-12-21	2006-07-05	ENSG00000156831	ENSG00000156831		"""Zinc fingers, MIZ-type"""	26513	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 7"""		"""chromosome 8 open reading frame 36"", ""non-SMC element 2 homolog (MMS21, S. cerevisiae)"""	C8orf36		12477932	Standard	NM_173685		Approved	FLJ32440, MMS21, NSE2, ZMIZ7	uc003yrw.2	Q96MF7	OTTHUMG00000164993	ENST00000287437.3:c.295G>C	8.37:g.126194375G>C	ENSP00000287437:p.Asp99His		Q8N549	Missense_Mutation	SNP	pfscan_Znf_MIZ	p.D99H	ENST00000287437.3	37	c.295	CCDS6356.1	8	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656815	0.67586	.	.	ENSG00000156831	ENST00000523741;ENST00000517532;ENST00000287437;ENST00000522563;ENST00000517315	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.77	4.89	0.63831	.	0.078822	0.48767	D	0.000171	T	0.55065	0.1897	L	0.47716	1.5	0.41765	D	0.989734	D;D	0.76494	0.968;0.999	B;D	0.64042	0.431;0.921	T	0.58352	-0.7651	10	0.59425	D	0.04	.	14.3616	0.66776	0.0:0.0:0.8508:0.1492	.	99;99	Q96MF7;E5RHW9	NSE2_HUMAN;.	H	99;99;99;99;39	ENSP00000429383:D99H;ENSP00000429612:D99H;ENSP00000287437:D99H;ENSP00000430668:D99H;ENSP00000428846:D39H	ENSP00000287437:D99H	D	+	1	0	NSMCE2	126263557	0.999000	0.42202	1.000000	0.80357	0.919000	0.55068	1.619000	0.36965	1.564000	0.49628	0.585000	0.79938	GAT	NSMCE2	-	NULL	ENSG00000156831		0.284	NSMCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMCE2	HGNC	protein_coding	OTTHUMT00000381378.1	122	0.00	0	G	NM_173685		126194375	126194375	+1	no_errors	ENST00000287437	ensembl	human	known	69_37n	missense	77	18.09	17	SNP	1.000	C
OPHN1	4983	genome.wustl.edu	37	X	67414316	67414316	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chrX:67414316G>A	ENST00000355520.5	-	13	1770	c.1129C>T	c.(1129-1131)Cag>Tag	p.Q377*	OPHN1_ENST00000540071.1_Nonsense_Mutation_p.Q377*	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	377					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						CTTTCTTGCTGTTTTGTTATA	0.328																																						dbGAP											0													149.0	126.0	134.0					X																	67414316		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1129C>T	X.37:g.67414316G>A	ENSP00000347710:p.Gln377*		B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.Q377*	ENST00000355520.5	37	c.1129	CCDS14388.1	X	.	.	.	.	.	.	.	.	.	.	G	43	10.238890	0.99366	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	.	.	.	5.02	5.02	0.67125	.	0.060412	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	12.6192	0.56594	0.0:0.0:1.0:0.0	.	.	.	.	X	377	.	ENSP00000347710:Q377X	Q	-	1	0	OPHN1	67331041	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.497000	0.60367	2.474000	0.83562	0.600000	0.82982	CAG	OPHN1	-	NULL	ENSG00000079482		0.328	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	HGNC	protein_coding	OTTHUMT00000057011.1	368	0.00	0	G	NM_002547		67414316	67414316	-1	no_errors	ENST00000355520	ensembl	human	known	69_37n	nonsense	203	63.88	359	SNP	1.000	A
P4HA2	8974	genome.wustl.edu	37	5	131533908	131533908	+	Missense_Mutation	SNP	G	G	T	rs201351338		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr5:131533908G>T	ENST00000401867.1	-	13	1930	c.1362C>A	c.(1360-1362)ttC>ttA	p.F454L	P4HA2_ENST00000360568.3_Intron|P4HA2_ENST00000379104.2_Missense_Mutation_p.F454L|P4HA2_ENST00000166534.4_Missense_Mutation_p.F454L|P4HA2_ENST00000379100.2_Intron|P4HA2_ENST00000379086.1_Intron			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	454	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	CGTAGTTTAAGAAAGTAGCCA	0.498																																					Esophageal Squamous(68;117 1135 17362 19256 34242)	dbGAP											0													134.0	119.0	124.0					5																	131533908		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.1362C>A	5.37:g.131533908G>T	ENSP00000384999:p.Phe454Leu		D3DQ85|D3DQ86|Q8WWN0	Missense_Mutation	SNP	pfam_Pro_4_hyd_alph_N,pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.F454L	ENST00000401867.1	37	c.1362	CCDS4151.1	5	.	.	.	.	.	.	.	.	.	.	G	9.750	1.167324	0.21621	.	.	ENSG00000072682	ENST00000401867;ENST00000166534;ENST00000379104	T;T;T	0.74002	-0.8;-0.8;-0.8	6.03	4.23	0.50019	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.044119	0.85682	D	0.000000	T	0.60843	0.2300	N	0.05351	-0.065	0.80722	D	1	P	0.46142	0.873	P	0.51945	0.685	T	0.60459	-0.7259	10	0.37606	T	0.19	-0.169	5.3664	0.16115	0.3777:0.0:0.6223:0.0	.	454	O15460	P4HA2_HUMAN	L	454	ENSP00000384999:F454L;ENSP00000166534:F454L;ENSP00000368398:F454L	ENSP00000166534:F454L	F	-	3	2	P4HA2	131561807	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.648000	0.46647	1.535000	0.49220	0.555000	0.69702	TTC	P4HA2	-	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	ENSG00000072682		0.498	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P4HA2	HGNC	protein_coding	OTTHUMT00000132653.4	193	0.00	0	G	NM_004199		131533908	131533908	-1	no_errors	ENST00000166534	ensembl	human	known	69_37n	missense	201	22.39	58	SNP	1.000	T
PCNXL2	80003	genome.wustl.edu	37	1	233388221	233388221	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:233388221C>G	ENST00000258229.9	-	7	2241	c.2007G>C	c.(2005-2007)caG>caC	p.Q669H	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	669						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGTAGATTATCTGTCTTTGTC	0.363																																						dbGAP											0													125.0	117.0	120.0					1																	233388221		1842	4096	5938	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2007G>C	1.37:g.233388221C>G	ENSP00000258229:p.Gln669His		O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.Q669H	ENST00000258229.9	37	c.2007	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.801516	0.50315	.	.	ENSG00000135749	ENST00000258229	T	0.09073	3.02	5.49	-6.58	0.01836	.	.	.	.	.	T	0.04227	0.0117	N	0.14661	0.345	0.58432	D	0.999997	B	0.13145	0.007	B	0.08055	0.003	T	0.26467	-1.0102	9	0.42905	T	0.14	.	10.4597	0.44572	0.0:0.3568:0.0917:0.5515	.	669	A6NKB5	PCX2_HUMAN	H	669	ENSP00000258229:Q669H	ENSP00000258229:Q669H	Q	-	3	2	PCNXL2	231454844	0.417000	0.25432	0.447000	0.26932	0.987000	0.75469	-0.642000	0.05427	-1.305000	0.02327	-0.262000	0.10625	CAG	PCNXL2	-	NULL	ENSG00000135749		0.363	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	185	0.00	0	C	NM_014801		233388221	233388221	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	176	34.57	93	SNP	0.486	G
PFDN6	10471	genome.wustl.edu	37	6	33258201	33258201	+	Silent	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:33258201G>A	ENST00000395131.1	+	4	640	c.234G>A	c.(232-234)aaG>aaA	p.K78K	WDR46_ENST00000477718.1_5'Flank|PFDN6_ENST00000374606.5_Silent_p.K78K|PFDN6_ENST00000374607.1_Silent_p.K78K|WDR46_ENST00000374617.4_5'Flank|RGL2_ENST00000437840.2_5'Flank|PFDN6_ENST00000374610.2_Silent_p.K78K|PFDN6_ENST00000463584.1_Silent_p.K78K			O15212	PFD6_HUMAN	prefoldin subunit 6	78					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	prefoldin complex (GO:0016272)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(1)	2						CAGTAGGGAAGAGGCTGGACT	0.532																																						dbGAP											0													73.0	75.0	75.0					6																	33258201		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC039033	CCDS4773.1	6p21.3	2006-02-24	2006-02-24	2006-02-24	ENSG00000204220	ENSG00000204220			4926	protein-coding gene	gene with protein product		605660	"""HLA class II region expressed gene KE2"", ""prefoldin 6"""	HKE2		9545376, 9630229	Standard	NM_001185181		Approved	KE-2, H2-KE2, PFD6	uc031sny.1	O15212	OTTHUMG00000031247	ENST00000395131.1:c.234G>A	6.37:g.33258201G>A				Silent	SNP	pfam_PFD_beta-like,superfamily_Prefoldin	p.K78	ENST00000395131.1	37	c.234	CCDS4773.1	6																																																																																			PFDN6	-	pfam_PFD_beta-like,superfamily_Prefoldin	ENSG00000204220		0.532	PFDN6-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PFDN6	HGNC	protein_coding	OTTHUMT00000276361.1	86	0.00	0	G	NM_014260		33258201	33258201	+1	no_errors	ENST00000374606	ensembl	human	known	69_37n	silent	133	19.39	32	SNP	1.000	A
PGK2	5232	genome.wustl.edu	37	6	49754484	49754484	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:49754484C>T	ENST00000304801.3	-	1	569	c.417G>A	c.(415-417)aaG>aaA	p.K139K		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	139					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CAGCTTTAATCTTCTTTCCAG	0.517																																						dbGAP											0													111.0	108.0	109.0					6																	49754484		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.417G>A	6.37:g.49754484C>T			B2R6Y8|Q9H107	Silent	SNP	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase,prints_Phosphoglycerate_kinase	p.K139	ENST00000304801.3	37	c.417	CCDS4930.1	6																																																																																			PGK2	-	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase	ENSG00000170950		0.517	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK2	HGNC	protein_coding	OTTHUMT00000040872.1	114	0.00	0	C			49754484	49754484	-1	no_errors	ENST00000304801	ensembl	human	known	69_37n	silent	228	11.97	31	SNP	0.997	T
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	189	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	92	25.20	31	SNP	1.000	A
PLD2	5338	genome.wustl.edu	37	17	4711091	4711091	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr17:4711091C>T	ENST00000263088.6	+	2	155	c.24C>T	c.(22-24)ctC>ctT	p.L8L	PLD2_ENST00000572940.1_Silent_p.L8L|RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	8					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	CTGAGAGCCTCTTCCCCACTG	0.622																																						dbGAP											0													53.0	54.0	53.0					17																	4711091		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.24C>T	17.37:g.4711091C>T			I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Silent	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.L8	ENST00000263088.6	37	c.24	CCDS11057.1	17																																																																																			PLD2	-	pirsf_PLipase_D_euk	ENSG00000129219		0.622	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD2	HGNC	protein_coding	OTTHUMT00000207561.3	17	0.00	0	C	NM_002663		4711091	4711091	+1	no_errors	ENST00000263088	ensembl	human	known	69_37n	silent	33	28.26	13	SNP	0.820	T
POM121L2	94026	genome.wustl.edu	37	6	27278174	27278174	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr6:27278174C>T	ENST00000444565.1	-	1	1775	c.1776G>A	c.(1774-1776)atG>atA	p.M592I	POM121L2_ENST00000377451.2_Missense_Mutation_p.M528I	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	592										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						AAGGAGCTATCATGGGCGTAG	0.483																																						dbGAP											0													87.0	78.0	81.0					6																	27278174		692	1591	2283	-	-	-	SO:0001583	missense	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1776G>A	6.37:g.27278174C>T	ENSP00000392726:p.Met592Ile		C9J1I7	Missense_Mutation	SNP	NULL	p.M592I	ENST00000444565.1	37	c.1776	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102639	0.37145	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.13307	2.61;2.6	4.11	0.096	0.14488	.	2.038800	0.02961	N	0.143110	T	0.02970	0.0088	L	0.29908	0.895	0.09310	N	1	B	0.22983	0.078	B	0.16722	0.016	T	0.38542	-0.9656	10	0.33940	T	0.23	.	4.6448	0.12566	0.0:0.45:0.3488:0.2012	.	592	C9J1I7	.	I	528;592	ENSP00000366671:M528I;ENSP00000392726:M592I	ENSP00000366671:M528I	M	-	3	0	POM121L2	27386153	0.000000	0.05858	0.000000	0.03702	0.464000	0.32679	-0.128000	0.10531	0.003000	0.14656	0.484000	0.47621	ATG	POM121L2	-	NULL	ENSG00000158553		0.483	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	102	0.97	1	C	NM_033482		27278174	27278174	-1	no_errors	ENST00000444565	ensembl	human	known	69_37n	missense	109	19.26	26	SNP	0.000	T
PPP1R1A	5502	genome.wustl.edu	37	12	54974805	54974805	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr12:54974805C>T	ENST00000257905.8	-	6	603	c.433G>A	c.(433-435)Gag>Aag	p.E145K	PPP1R1A_ENST00000547431.1_Silent_p.T71T	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	145	Interaction with PPP1R15A.				glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						CTGCCTCTCTCGTGAGTTTTA	0.542																																						dbGAP											0													198.0	186.0	190.0					12																	54974805		1889	4122	6011	-	-	-	SO:0001583	missense	0			U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.433G>A	12.37:g.54974805C>T	ENSP00000257905:p.Glu145Lys		Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	pfam_PPI_1DARPP-32	p.E145K	ENST00000257905.8	37	c.433	CCDS44912.1	12	.	.	.	.	.	.	.	.	.	.	C	16.58	3.161800	0.57368	.	.	ENSG00000135447	ENST00000257905	T	0.30182	1.54	4.95	3.13	0.36017	.	0.363246	0.23966	N	0.042814	T	0.28499	0.0705	L	0.42245	1.32	0.29132	N	0.879579	P	0.52577	0.954	P	0.44897	0.463	T	0.12604	-1.0541	10	0.66056	D	0.02	.	9.8657	0.41142	0.0:0.7734:0.1426:0.084	.	145	Q13522	PPR1A_HUMAN	K	145	ENSP00000257905:E145K	ENSP00000257905:E145K	E	-	1	0	PPP1R1A	53261072	0.998000	0.40836	0.984000	0.44739	0.462000	0.32619	0.452000	0.21795	0.237000	0.21200	-0.795000	0.03280	GAG	PPP1R1A	-	pfam_PPI_1DARPP-32	ENSG00000135447		0.542	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R1A	HGNC	protein_coding	OTTHUMT00000406604.1	300	0.33	1	C	NM_006741		54974805	54974805	-1	no_errors	ENST00000257905	ensembl	human	known	69_37n	missense	359	19.51	87	SNP	0.996	T
HELZ2	85441	genome.wustl.edu	37	20	62191561	62191561	+	Silent	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr20:62191561G>A	ENST00000467148.1	-	17	7689	c.7620C>T	c.(7618-7620)atC>atT	p.I2540I	HELZ2_ENST00000427522.2_Silent_p.I1971I	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2540	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CCACCCCGGCGATGCCCTCTC	0.706																																						dbGAP											0													28.0	21.0	23.0					20																	62191561		2171	4264	6435	-	-	-	SO:0001819	synonymous_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7620C>T	20.37:g.62191561G>A			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.I2540	ENST00000467148.1	37	c.7620	CCDS33508.1	20																																																																																			RP4-697K14.7	-	NULL	ENSG00000130589		0.706	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	Clone_based_vega_gene	protein_coding	OTTHUMT00000354127.1	16	0.00	0	G	NM_001037335		62191561	62191561	-1	no_errors	ENST00000467148	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	0.002	A
PRUNE2	158471	genome.wustl.edu	37	9	79324907	79324907	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr9:79324907C>T	ENST00000376718.3	-	8	2406	c.2283G>A	c.(2281-2283)ctG>ctA	p.L761L	PRUNE2_ENST00000428286.1_Silent_p.L402L	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	761					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AGTCTTCTATCAGGTGGTTTG	0.498																																						dbGAP											0													47.0	43.0	44.0					9																	79324907		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.2283G>A	9.37:g.79324907C>T			B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.D83N	ENST00000376718.3	37	c.247	CCDS47982.1	9	.	.	.	.	.	.	.	.	.	.	C	5.222	0.226427	0.09916	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.71	3.87	0.44632	.	.	.	.	.	T	0.58906	0.2155	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54063	-0.8349	4	.	.	.	-2.0545	8.9465	0.35762	0.0:0.7639:0.0:0.2361	.	.	.	.	N	83	.	.	D	-	1	0	PRUNE2	78514727	0.992000	0.36948	1.000000	0.80357	0.965000	0.64279	0.059000	0.14322	0.767000	0.33267	0.462000	0.41574	GAT	PRUNE2	-	NULL	ENSG00000106772		0.498	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	86	0.00	0	C	NM_138818		79324907	79324907	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426088	ensembl	human	known	69_37n	missense	73	33.03	36	SNP	0.999	T
RAB33A	9363	genome.wustl.edu	37	X	129306147	129306147	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chrX:129306147C>G	ENST00000257017.4	+	1	525	c.111C>G	c.(109-111)ttC>ttG	p.F37L		NM_004794.2	NP_004785.1	Q14088	RB33A_HUMAN	RAB33A, member RAS oncogene family	37					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(5)	11						TTCGCATCTTCAAAATAATCG	0.627																																						dbGAP											0													83.0	65.0	71.0					X																	129306147		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14889	CCDS14621.1	Xq26	2008-02-05			ENSG00000134594	ENSG00000134594		"""RAB, member RAS oncogene"""	9773	protein-coding gene	gene with protein product		300333				7688322, 9512502	Standard	NM_004794		Approved	RabS10	uc004evl.3	Q14088	OTTHUMG00000022391	ENST00000257017.4:c.111C>G	X.37:g.129306147C>G	ENSP00000257017:p.Phe37Leu		Q5JUZ6|Q92465	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F37L	ENST00000257017.4	37	c.111	CCDS14621.1	X	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930198	0.73327	.	.	ENSG00000134594	ENST00000257017	T	0.79749	-1.3	4.52	3.65	0.41850	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.76730	0.4028	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.78600	-0.2141	10	0.72032	D	0.01	-11.7383	8.9866	0.35997	0.0:0.8225:0.0:0.1775	.	37	Q14088	RB33A_HUMAN	L	37	ENSP00000257017:F37L	ENSP00000257017:F37L	F	+	3	2	RAB33A	129133828	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.676000	0.37565	1.004000	0.39156	0.556000	0.70494	TTC	RAB33A	-	pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000134594		0.627	RAB33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB33A	HGNC	protein_coding	OTTHUMT00000058246.1	30	0.00	0	C	NM_004794		129306147	129306147	+1	no_errors	ENST00000257017	ensembl	human	known	69_37n	missense	54	16.92	11	SNP	1.000	G
RELN	5649	genome.wustl.edu	37	7	103130322	103130322	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr7:103130322C>T	ENST00000428762.1	-	60	9789	c.9630G>A	c.(9628-9630)caG>caA	p.Q3210Q	RELN_ENST00000343529.5_Silent_p.Q3210Q|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Silent_p.Q3210Q	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3210					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTTCTCCCTTCTGGATCCAGC	0.547																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													107.0	84.0	92.0					7																	103130322		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.9630G>A	7.37:g.103130322C>T			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.Q3210	ENST00000428762.1	37	c.9630	CCDS47680.1	7																																																																																			RELN	-	NULL	ENSG00000189056		0.547	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	83	0.00	0	C	NM_005045		103130322	103130322	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	silent	74	13.95	12	SNP	1.000	T
RERG	85004	genome.wustl.edu	37	12	15262253	15262253	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr12:15262253C>T	ENST00000256953.2	-	5	727	c.391G>A	c.(391-393)Gaa>Aaa	p.E131K	RERG_ENST00000538313.1_Missense_Mutation_p.E131K|RERG_ENST00000536465.1_Missense_Mutation_p.E131K|RERG_ENST00000546331.1_Missense_Mutation_p.E112K	NM_032918.2	NP_116307.1	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	131					negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to hormone (GO:0009725)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	estrogen receptor binding (GO:0030331)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16						TCTCCTTCTTCTGTGCTAACC	0.453																																						dbGAP											0													213.0	186.0	195.0					12																	15262253		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF339750	CCDS8673.1, CCDS53753.1	12p13.1	2014-05-09			ENSG00000134533	ENSG00000134533			15980	protein-coding gene	gene with protein product		612664				11533059	Standard	NM_032918		Approved	MGC15754	uc001rct.3	Q96A58	OTTHUMG00000168745	ENST00000256953.2:c.391G>A	12.37:g.15262253C>T	ENSP00000256953:p.Glu131Lys		B2R9R0|B4DI02	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E131K	ENST00000256953.2	37	c.391	CCDS8673.1	12	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188412	0.78789	.	.	ENSG00000134533	ENST00000256953;ENST00000538313;ENST00000536465;ENST00000546331	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.046333	0.85682	D	0.000000	T	0.70919	0.3279	L	0.43923	1.385	0.80722	D	1	P;B	0.40619	0.724;0.222	B;B	0.35278	0.199;0.153	T	0.74352	-0.3693	10	0.48119	T	0.1	.	17.4091	0.87481	0.0:1.0:0.0:0.0	.	112;131	B4DI02;Q96A58	.;RERG_HUMAN	K	131;131;131;112	ENSP00000256953:E131K;ENSP00000441505:E131K;ENSP00000438280:E131K;ENSP00000444485:E112K	ENSP00000256953:E131K	E	-	1	0	RERG	15153520	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.771000	0.85420	2.526000	0.85167	0.655000	0.94253	GAA	RERG	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000134533		0.453	RERG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERG	HGNC	protein_coding	OTTHUMT00000400882.1	179	0.00	0	C	NM_032918		15262253	15262253	-1	no_errors	ENST00000256953	ensembl	human	known	69_37n	missense	252	20.00	63	SNP	1.000	T
RGPD3	653489	genome.wustl.edu	37	2	107040417	107040417	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr2:107040417C>G	ENST00000409886.3	-	20	4093	c.4006G>C	c.(4006-4008)Gaa>Caa	p.E1336Q	RGPD3_ENST00000304514.7_Missense_Mutation_p.E1336Q	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1336	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						ACAACAGGTTCAAAGTACTGT	0.398																																						dbGAP											0													8.0	6.0	7.0					2																	107040417		673	1543	2216	-	-	-	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.4006G>C	2.37:g.107040417C>G	ENSP00000386588:p.Glu1336Gln		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E1336Q	ENST00000409886.3	37	c.4006	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	13.13	2.146456	0.37923	.	.	ENSG00000153165	ENST00000409886;ENST00000304514	T;T	0.48522	0.81;0.81	2.35	2.35	0.29111	Pleckstrin homology-type (1);Ran binding protein 1 (2);	.	.	.	.	T	0.61060	0.2317	M	0.62209	1.925	0.32673	N	0.516485	D	0.60575	0.988	D	0.68621	0.959	T	0.67138	-0.5746	9	0.46703	T	0.11	-36.2617	10.4115	0.44296	0.0:1.0:0.0:0.0	.	1336	A6NKT7	RGPD3_HUMAN	Q	1336	ENSP00000386588:E1336Q;ENSP00000303659:E1336Q	ENSP00000303659:E1336Q	E	-	1	0	RGPD3	106406849	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	7.578000	0.82498	1.314000	0.45095	0.186000	0.17326	GAA	RGPD3	-	smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000153165		0.398	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	177	0.00	0	C	XM_929931		107040417	107040417	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	missense	95	22.76	28	SNP	1.000	G
RNF40	9810	genome.wustl.edu	37	16	30783268	30783268	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr16:30783268G>C	ENST00000324685.6	+	18	3136	c.2701G>C	c.(2701-2703)Gag>Cag	p.E901Q	RNF40_ENST00000563683.1_Missense_Mutation_p.E861Q|RNF40_ENST00000357890.5_Missense_Mutation_p.E801Q|RNF40_ENST00000402121.3_Missense_Mutation_p.E593Q|RNF40_ENST00000567365.1_3'UTR	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	901					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			TCGTGAGAAAGAGAGCTTCAA	0.662																																						dbGAP											0													35.0	35.0	35.0					16																	30783268		2197	4298	6495	-	-	-	SO:0001583	missense	0			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.2701G>C	16.37:g.30783268G>C	ENSP00000325677:p.Glu901Gln		Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.E901Q	ENST00000324685.6	37	c.2701	CCDS10691.1	16	.	.	.	.	.	.	.	.	.	.	g	33	5.250558	0.95305	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121;ENST00000538323	T;T;T	0.39056	1.1;1.11;1.15	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.67608	0.2911	M	0.81497	2.545	0.80722	D	1	P;P;D;D;D	0.76494	0.694;0.86;0.997;0.996;0.999	P;P;D;P;D	0.69142	0.452;0.729;0.945;0.894;0.962	T	0.70963	-0.4729	10	0.87932	D	0	-30.8011	18.659	0.91465	0.0:0.0:1.0:0.0	.	233;593;801;901;901	F6SYU7;F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;.;BRE1B_HUMAN	Q	901;801;593;233	ENSP00000325677:E901Q;ENSP00000350563:E801Q;ENSP00000384942:E593Q	ENSP00000325677:E901Q	E	+	1	0	RNF40	30690769	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.446000	0.97590	2.718000	0.92993	0.651000	0.88453	GAG	RNF40	-	NULL	ENSG00000103549		0.662	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2	12	0.00	0	G	NM_014771		30783268	30783268	+1	no_errors	ENST00000324685	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	1.000	C
RPS16	6217	genome.wustl.edu	37	19	39924348	39924348	+	Silent	SNP	G	G	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr19:39924348G>T	ENST00000251453.3	-	3	256	c.204C>A	c.(202-204)atC>atA	p.I68I	RPS16_ENST00000599539.1_Silent_p.I68I|RPS16_ENST00000339471.4_Silent_p.I68I|RPS16_ENST00000601655.1_Silent_p.I51I	NM_001020.4	NP_001011.1	P62249	RS16_HUMAN	ribosomal protein S16	68					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|large_intestine(2)|lung(2)|skin(2)	7	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;4.14e-26)|all cancers(26;2.68e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CACGGACACGGATGTCTACAC	0.557																																						dbGAP											0													90.0	69.0	76.0					19																	39924348		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M60854	CCDS12535.1	19q13.1	2011-04-05				ENSG00000105193		"""S ribosomal proteins"""	10396	protein-coding gene	gene with protein product	"""40S ribosomal protein S16"""	603675				2016298, 9582194	Standard	XM_005259137		Approved	S16	uc002olk.3	P62249		ENST00000251453.3:c.204C>A	19.37:g.39924348G>T			B2RDD5|P17008	Silent	SNP	pfam_Ribosomal_S9,superfamily_Ribosomal_S5_D2-typ_fold	p.I68	ENST00000251453.3	37	c.204	CCDS12535.1	19																																																																																			RPS16	-	pfam_Ribosomal_S9,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000105193		0.557	RPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS16	HGNC	protein_coding	OTTHUMT00000464511.1	57	0.00	0	G	NM_001020		39924348	39924348	-1	no_errors	ENST00000339471	ensembl	human	known	69_37n	silent	82	18.00	18	SNP	1.000	T
RTL1	388015	genome.wustl.edu	37	14	101348584	101348584	+	Missense_Mutation	SNP	C	C	T	rs11623267	byFrequency	TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr14:101348584C>T	ENST00000534062.1	-	1	2600	c.2542G>A	c.(2542-2544)Gag>Aag	p.E848K	MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA|MIR136_ENST00000385207.1_RNA|MIR432_ENST00000606207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	848			E -> Q (in dbSNP:rs11623267).		multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TCTTGCTCCTCGACTCCCCAG	0.612																																						dbGAP											0													27.0	27.0	27.0					14																	101348584		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2542G>A	14.37:g.101348584C>T	ENSP00000435342:p.Glu848Lys		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.E848K	ENST00000534062.1	37	c.2542	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	11.62	1.692001	0.30052	.	.	ENSG00000254656	ENST00000534062	T	0.51071	0.72	3.33	3.33	0.38152	.	0.294433	0.19232	N	0.119389	T	0.40815	0.1132	L	0.41632	1.29	0.31557	P	0.658037	P	0.50943	0.94	B	0.43251	0.413	T	0.59643	-0.7416	9	0.52906	T	0.07	.	12.9629	0.58468	0.0:1.0:0.0:0.0	.	848	E9PKS8	.	K	848	ENSP00000435342:E848K	ENSP00000435342:E848K	E	-	1	0	RTL1	100418337	0.992000	0.36948	0.816000	0.32577	0.297000	0.27493	3.624000	0.54231	2.180000	0.69256	0.561000	0.74099	GAG	RTL1	-	NULL	ENSG00000254656		0.612	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	34	0.00	0	C	NM_001134888		101348584	101348584	-1	no_errors	ENST00000534062	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.995	T
RTN4	57142	genome.wustl.edu	37	2	55252534	55252534	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr2:55252534C>A	ENST00000337526.6	-	3	2944	c.2701G>T	c.(2701-2703)Gct>Tct	p.A901S	RTN4_ENST00000394611.2_Missense_Mutation_p.A695S|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_Missense_Mutation_p.A695S|RTN4_ENST00000405240.1_Missense_Mutation_p.A695S|RTN4_ENST00000404909.1_Missense_Mutation_p.A695S|RTN4_ENST00000354474.6_Missense_Mutation_p.A669S|RTN4_ENST00000317610.7_Intron	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	901					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						GGGGCATTAGCAATTTCACTT	0.393																																						dbGAP											0													61.0	62.0	62.0					2																	55252534		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.2701G>T	2.37:g.55252534C>A	ENSP00000337838:p.Ala901Ser		O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.A901S	ENST00000337526.6	37	c.2701	CCDS42684.1	2	.	.	.	.	.	.	.	.	.	.	C	7.971	0.749161	0.15710	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27	5.6	3.72	0.42706	.	0.939189	0.08959	N	0.868904	T	0.11580	0.0282	L	0.43152	1.355	0.09310	N	1	B	0.34015	0.435	B	0.29598	0.104	T	0.28933	-1.0028	10	0.06757	T	0.87	-0.0017	5.3569	0.16065	0.1313:0.5069:0.2866:0.0752	.	901	Q9NQC3	RTN4_HUMAN	S	695;695;901;695;695;669	ENSP00000384471:A695S;ENSP00000349944:A695S;ENSP00000337838:A901S;ENSP00000378109:A695S;ENSP00000385650:A695S;ENSP00000346465:A669S	ENSP00000337838:A901S	A	-	1	0	RTN4	55106038	0.017000	0.18338	0.013000	0.15412	0.652000	0.38707	1.040000	0.30278	0.633000	0.30452	0.655000	0.94253	GCT	RTN4	-	NULL	ENSG00000115310		0.393	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1	62	0.00	0	C			55252534	55252534	-1	no_errors	ENST00000337526	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	0.000	A
SCAPER	49855	genome.wustl.edu	37	15	76726583	76726583	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr15:76726583C>G	ENST00000563290.1	-	26	3242	c.3147G>C	c.(3145-3147)ttG>ttC	p.L1049F	SCAPER_ENST00000538941.2_Missense_Mutation_p.L803F|SCAPER_ENST00000324767.7_Missense_Mutation_p.L1049F			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	1049						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GTCCAGTTGTCAAGCCTTCAA	0.383																																						dbGAP											0													104.0	98.0	100.0					15																	76726583		1836	4088	5924	-	-	-	SO:0001583	missense	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.3147G>C	15.37:g.76726583C>G	ENSP00000454973:p.Leu1049Phe		F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.L1049F	ENST00000563290.1	37	c.3147	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602893	0.46423	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.31769	1.53;1.48	5.83	5.83	0.93111	.	0.140388	0.49916	D	0.000126	T	0.25680	0.0625	L	0.42245	1.32	0.51233	D	0.999911	B;B	0.19331	0.021;0.035	B;B	0.20955	0.014;0.032	T	0.07481	-1.0770	10	0.51188	T	0.08	.	8.0029	0.30308	0.0:0.7507:0.1626:0.0867	.	1048;803	Q9BY12;F5H7X8	SCAPE_HUMAN;.	F	1049;803;1071	ENSP00000326924:L1049F;ENSP00000442190:L803F	ENSP00000303560:L1071F	L	-	3	2	SCAPER	74513638	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.079000	0.41577	2.753000	0.94483	0.585000	0.79938	TTG	SCAPER	-	NULL	ENSG00000140386		0.383	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	161	0.00	0	C	NM_020843		76726583	76726583	-1	no_errors	ENST00000324767	ensembl	human	known	69_37n	missense	98	31.47	45	SNP	1.000	G
SLC37A1	54020	genome.wustl.edu	37	21	43967216	43967216	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr21:43967216C>T	ENST00000352133.2	+	9	1716	c.734C>T	c.(733-735)cCg>cTg	p.P245L	SLC37A1_ENST00000398341.3_Missense_Mutation_p.P245L			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	245					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						CTTTCAGATCCGAACGACGTC	0.562																																						dbGAP											0													324.0	242.0	270.0					21																	43967216		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.734C>T	21.37:g.43967216C>T	ENSP00000344648:p.Pro245Leu		D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P245L	ENST00000352133.2	37	c.734	CCDS13689.1	21	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929584	0.52759	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.66460	-0.21;-0.21	4.15	4.15	0.48705	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.129314	0.53938	D	0.000058	D	0.83422	0.5251	M	0.90198	3.095	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	D	0.87251	0.2273	10	0.87932	D	0	-14.3337	13.5457	0.61702	0.0:1.0:0.0:0.0	.	245	P57057	GLPT_HUMAN	L	245	ENSP00000381383:P245L;ENSP00000344648:P245L	ENSP00000344648:P245L	P	+	2	0	SLC37A1	42840285	0.991000	0.36638	0.906000	0.35671	0.145000	0.21501	3.807000	0.55591	2.028000	0.59812	0.460000	0.39030	CCG	SLC37A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000160190		0.562	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC37A1	HGNC	protein_coding	OTTHUMT00000195377.1	159	0.00	0	C			43967216	43967216	+1	no_errors	ENST00000352133	ensembl	human	known	69_37n	missense	239	22.40	69	SNP	0.975	T
SLC5A2	6524	genome.wustl.edu	37	16	31496154	31496154	+	Silent	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr16:31496154C>G	ENST00000330498.3	+	3	232	c.213C>G	c.(211-213)ctC>ctG	p.L71L	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	71					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)			endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	GGGCCTCTCTCTTCGCCAGCA	0.662																																						dbGAP											0													48.0	53.0	51.0					16																	31496154		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.213C>G	16.37:g.31496154C>G			A2RRD2	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L71	ENST00000330498.3	37	c.213	CCDS10714.1	16																																																																																			SLC5A2	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000140675		0.662	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A2	HGNC	protein_coding	OTTHUMT00000255627.2	35	0.00	0	C			31496154	31496154	+1	no_errors	ENST00000330498	ensembl	human	known	69_37n	silent	120	12.41	17	SNP	1.000	G
SLC5A3	6526	genome.wustl.edu	37	21	35467894	35467894	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr21:35467894C>G	ENST00000381151.3	+	2	909	c.397C>G	c.(397-399)Ctc>Gtc	p.L133V	MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_Missense_Mutation_p.L133V			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	133					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						GTCTCTGATTCTCTATATTTT	0.443																																						dbGAP											0													184.0	189.0	187.0					21																	35467894		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.397C>G	21.37:g.35467894C>G	ENSP00000370543:p.Leu133Val		O43489	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L133V	ENST00000381151.3	37	c.397	CCDS33549.1	21	.	.	.	.	.	.	.	.	.	.	C	18.52	3.641145	0.67244	.	.	ENSG00000198743	ENST00000381151	D	0.88046	-2.33	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	D	0.92786	0.7706	M	0.64080	1.96	0.58432	D	0.999998	D	0.76494	0.999	D	0.71656	0.974	D	0.92528	0.6031	10	0.72032	D	0.01	.	20.0675	0.97707	0.0:1.0:0.0:0.0	.	133	P53794	SC5A3_HUMAN	V	133	ENSP00000370543:L133V	ENSP00000370543:L133V	L	+	1	0	SLC5A3	34389764	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.810000	0.86072	2.848000	0.98002	0.609000	0.83330	CTC	SLC5A3	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000198743		0.443	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	SLC5A3	HGNC	protein_coding	OTTHUMT00000141037.1	128	0.00	0	C			35467894	35467894	+1	no_errors	ENST00000381151	ensembl	human	known	69_37n	missense	163	18.50	37	SNP	1.000	G
SLC8A3	6547	genome.wustl.edu	37	14	70634913	70634913	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr14:70634913C>A	ENST00000381269.2	-	2	980	c.227G>T	c.(226-228)aGg>aTg	p.R76M	SLC8A3_ENST00000356921.2_Missense_Mutation_p.R76M|SLC8A3_ENST00000528359.1_Missense_Mutation_p.R76M|SLC8A3_ENST00000357887.3_Missense_Mutation_p.R76M|SLC8A3_ENST00000534137.1_Missense_Mutation_p.R76M	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	76					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GACAATGACCCTGGCAATCTT	0.507																																						dbGAP											0													74.0	66.0	69.0					14																	70634913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.227G>T	14.37:g.70634913C>A	ENSP00000370669:p.Arg76Met		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.R76M	ENST00000381269.2	37	c.227	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315575	0.60524	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.42513	1.06;0.97;1.11;1.05;1.11	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.68650	0.3024	M	0.83012	2.62	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.99;0.996	D;D;D;D	0.85130	0.996;0.997;0.974;0.982	T	0.74472	-0.3654	10	0.87932	D	0	.	18.1311	0.89602	0.0:1.0:0.0:0.0	.	76;76;76;76	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	M	76	ENSP00000349392:R76M;ENSP00000370669:R76M;ENSP00000350560:R76M;ENSP00000436688:R76M;ENSP00000433531:R76M	ENSP00000349392:R76M	R	-	2	0	SLC8A3	69704666	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.645000	0.83430	2.509000	0.84616	0.563000	0.77884	AGG	SLC8A3	-	tigrfam_Na_Ca_Ex	ENSG00000100678		0.507	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	HGNC	protein_coding	OTTHUMT00000390736.1	86	0.00	0	C			70634913	70634913	-1	no_errors	ENST00000381269	ensembl	human	known	69_37n	missense	24	63.08	41	SNP	1.000	A
SRPR	6734	genome.wustl.edu	37	11	126136666	126136666	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr11:126136666C>A	ENST00000332118.6	-	5	832	c.678G>T	c.(676-678)gaG>gaT	p.E226D	SRPR_ENST00000532259.1_Missense_Mutation_p.E198D|SRPR_ENST00000530680.1_5'Flank|FOXRED1_ENST00000263578.5_5'Flank|FOXRED1_ENST00000442061.2_5'Flank|FOXRED1_ENST00000532125.1_5'Flank	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	226					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		ACTTGGACTTCTCCATACCCC	0.498																																						dbGAP											0													182.0	183.0	182.0					11																	126136666		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.678G>T	11.37:g.126136666C>A	ENSP00000328023:p.Glu226Asp		A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	pfam_Sig_recog_particle_rcpt_asu_N,pfam_Signal_recog_part_SRP54_GTPase,pfam_ArgK,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_Signal_recog_particl_SRP54_hlx,superfamily_Longin-like_dom,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_Signal_recog_part_SRP54_GTPase	p.E226D	ENST00000332118.6	37	c.678	CCDS31717.1	11	.	.	.	.	.	.	.	.	.	.	C	9.444	1.088702	0.20390	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	6.17	-3.26	0.05064	Signal recognition particle receptor, alpha subunit, N-terminal (1);	0.503008	0.24078	N	0.041755	T	0.35038	0.0918	L	0.43152	1.355	0.31927	N	0.612682	B;B	0.02656	0.0;0.0	B;B	0.12837	0.008;0.002	T	0.29671	-1.0004	9	0.18276	T	0.48	-7.6492	8.1203	0.30967	0.2442:0.1805:0.5164:0.0589	.	198;226	E9PJS4;P08240	.;SRPR_HUMAN	D	226;198	.	ENSP00000328023:E226D	E	-	3	2	SRPR	125641876	0.980000	0.34600	0.832000	0.32986	0.916000	0.54674	0.058000	0.14301	-0.973000	0.03555	-0.181000	0.13052	GAG	SRPR	-	pfam_Sig_recog_particle_rcpt_asu_N	ENSG00000182934		0.498	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPR	HGNC	protein_coding	OTTHUMT00000386425.2	74	0.00	0	C	NM_003139		126136666	126136666	-1	no_errors	ENST00000332118	ensembl	human	known	69_37n	missense	52	49.51	51	SNP	0.962	A
STEAP1B	256227	genome.wustl.edu	37	7	22533058	22533058	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr7:22533058C>T	ENST00000406890.2	-	3	519	c.425G>A	c.(424-426)aGa>aAa	p.R142K	STEAP1B_ENST00000404369.4_Missense_Mutation_p.R161K	NM_207342.2	NP_997225.1	Q6NZ63	STEAL_HUMAN	STEAP family member 1B	142						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(2)	4						AAACTGCTTTCTTGTTAACAT	0.393																																						dbGAP											0													169.0	143.0	151.0					7																	22533058		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS55094.1, CCDS56469.1	7p15.3	2011-05-19			ENSG00000105889	ENSG00000105889			41907	protein-coding gene	gene with protein product							Standard	NM_207342		Approved		uc010kum.2	Q6NZ63	OTTHUMG00000152529	ENST00000406890.2:c.425G>A	7.37:g.22533058C>T	ENSP00000385239:p.Arg142Lys		B5MCI2	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.R142K	ENST00000406890.2	37	c.425	CCDS55094.1	7	.	.	.	.	.	.	.	.	.	.	c	14.06	2.421278	0.42918	.	.	ENSG00000105889	ENST00000406890;ENST00000404369;ENST00000424363;ENST00000439708	D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03	1.23	1.23	0.21249	Flavoprotein transmembrane component (1);	0.000000	0.44483	U	0.000443	D	0.94955	0.8368	M	0.83603	2.65	0.25161	N	0.990356	D;D	0.76494	0.999;0.997	D;D	0.83275	0.996;0.992	D	0.87299	0.2304	10	0.72032	D	0.01	-15.7648	8.5117	0.33222	0.0:1.0:0.0:0.0	.	161;142	B5MCI2;Q6NZ63	.;STEAL_HUMAN	K	142;161;161;161	ENSP00000385239:R142K;ENSP00000384370:R161K;ENSP00000416608:R161K;ENSP00000408954:R161K	ENSP00000384370:R161K	R	-	2	0	STEAP1B	22499583	0.999000	0.42202	0.999000	0.59377	0.190000	0.23558	5.802000	0.69122	1.022000	0.39626	0.121000	0.15741	AGA	STEAP1B	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000105889		0.393	STEAP1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STEAP1B	HGNC	protein_coding	OTTHUMT00000326617.2	325	0.00	0	C			22533058	22533058	-1	no_errors	ENST00000406890	ensembl	human	known	69_37n	missense	302	16.34	59	SNP	1.000	T
SYNRG	11276	genome.wustl.edu	37	17	35900635	35900635	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr17:35900635C>G	ENST00000339208.6	-	16	3353	c.3213G>C	c.(3211-3213)aaG>aaC	p.K1071N	SYNRG_ENST00000394378.2_Missense_Mutation_p.K993N|SYNRG_ENST00000346661.4_Missense_Mutation_p.K1071N|SYNRG_ENST00000345615.4_Missense_Mutation_p.K993N|SYNRG_ENST00000591288.1_Missense_Mutation_p.K865N|SYNRG_ENST00000585472.1_Missense_Mutation_p.K992N|SYNRG_ENST00000502449.2_Missense_Mutation_p.K948N	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	1071					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TCAAACTCCTCTTGTGTGATC	0.473																																						dbGAP											0													81.0	85.0	84.0					17																	35900635		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.3213G>C	17.37:g.35900635C>G	ENSP00000343610:p.Lys1071Asn		A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EPS15_homology	p.K1071N	ENST00000339208.6	37	c.3213	CCDS11321.1	17	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338235	0.60963	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378	T;T	0.57907	0.92;0.37	5.3	3.25	0.37280	.	0.054934	0.64402	D	0.000001	T	0.65491	0.2696	M	0.63843	1.955	0.53688	D	0.999975	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.998;0.998	T	0.64478	-0.6398	10	0.72032	D	0.01	-7.8729	8.169	0.31243	0.0:0.663:0.0:0.337	.	865;993;993;993;1071;1071	B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;SYNRG_HUMAN	N	1071;865;1071;993;993	ENSP00000005279:K1071N;ENSP00000377903:K993N	ENSP00000343610:K865N	K	-	3	2	SYNRG	32974748	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	0.898000	0.28404	0.562000	0.29204	0.563000	0.77884	AAG	SYNRG	-	NULL	ENSG00000006114		0.473	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNRG	HGNC	protein_coding	OTTHUMT00000256811.2	64	0.00	0	C	NM_007247		35900635	35900635	-1	no_errors	ENST00000339208	ensembl	human	known	69_37n	missense	55	38.20	34	SNP	1.000	G
TAS1R1	80835	genome.wustl.edu	37	1	6639317	6639317	+	Silent	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr1:6639317C>G	ENST00000333172.6	+	6	2392	c.2199C>G	c.(2197-2199)ctC>ctG	p.L733L	TAS1R1_ENST00000328191.4_3'UTR|ZBTB48_ENST00000377674.4_5'Flank|TAS1R1_ENST00000351136.3_Silent_p.L479L	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	733					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TGGCCTTCCTCTACAATGGCC	0.562																																						dbGAP											0													166.0	133.0	144.0					1																	6639317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.2199C>G	1.37:g.6639317C>G			B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.L733	ENST00000333172.6	37	c.2199	CCDS81.1	1																																																																																			TAS1R1	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000173662		0.562	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R1	HGNC	protein_coding	OTTHUMT00000004211.1	103	0.00	0	C			6639317	6639317	+1	no_errors	ENST00000333172	ensembl	human	known	69_37n	silent	100	31.97	47	SNP	0.279	G
TAS2R42	353164	genome.wustl.edu	37	12	11338818	11338818	+	Silent	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr12:11338818G>A	ENST00000334266.1	-	1	725	c.726C>T	c.(724-726)ctC>ctT	p.L242L		NM_181429.1	NP_852094.1	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	242					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L242L(1)		breast(1)|kidney(2)|lung(4)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			GAACTATGAAGAGGAAAAGGA	0.398																																					Melanoma(15;352 722 10077 19546 48810)	dbGAP											1	Substitution - coding silent(1)	lung(1)											88.0	87.0	87.0					12																	11338818		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AX097739, AB199241	CCDS31747.1	12p13	2012-08-22			ENSG00000186136	ENSG00000186136		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18888	protein-coding gene	gene with protein product		613966				12679530	Standard	NM_181429		Approved	T2R24, T2R55, hT2R55, TAS2R55	uc001qzr.1	Q7RTR8	OTTHUMG00000168567	ENST00000334266.1:c.726C>T	12.37:g.11338818G>A			A2RRP4|Q645X0	Silent	SNP	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.L242	ENST00000334266.1	37	c.726	CCDS31747.1	12																																																																																			TAS2R42	-	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186136		0.398	TAS2R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R42	HGNC	protein_coding	OTTHUMT00000400243.1	123	0.00	0	G	NM_181429		11338818	11338818	-1	no_errors	ENST00000334266	ensembl	human	known	69_37n	silent	96	19.33	23	SNP	0.038	A
TGDS	23483	genome.wustl.edu	37	13	95232200	95232200	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr13:95232200A>G	ENST00000261296.5	-	7	683	c.563T>C	c.(562-564)gTt>gCt	p.V188A	TGDS_ENST00000498294.1_5'UTR	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	188					nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					TGTGATGACAACTGGAAACTT	0.289																																						dbGAP											0													86.0	85.0	85.0					13																	95232200		2202	4295	6497	-	-	-	SO:0001583	missense	0			AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.563T>C	13.37:g.95232200A>G	ENSP00000261296:p.Val188Ala		Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_dTDP_dehydrorham_reduct,pfam_Polysac_CapD-like,pfam_Male_sterile_NAD-bd	p.V188A	ENST00000261296.5	37	c.563	CCDS9471.1	13	.	.	.	.	.	.	.	.	.	.	A	14.06	2.421433	0.42918	.	.	ENSG00000088451	ENST00000261296	D	0.92595	-3.07	6.06	2.4	0.29515	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.241830	0.41712	N	0.000839	D	0.84316	0.5445	N	0.26092	0.79	0.41153	D	0.98604	B	0.33171	0.4	B	0.30251	0.113	T	0.78445	-0.2201	10	0.52906	T	0.07	.	9.441	0.38668	0.8021:0.0:0.1979:0.0	.	188	O95455	TGDS_HUMAN	A	188	ENSP00000261296:V188A	ENSP00000261296:V188A	V	-	2	0	TGDS	94030201	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.496000	0.45346	0.199000	0.20427	0.528000	0.53228	GTT	TGDS	-	pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_dTDP_dehydrorham_reduct,pfam_Polysac_CapD-like,pfam_Male_sterile_NAD-bd	ENSG00000088451		0.289	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGDS	HGNC	protein_coding	OTTHUMT00000106904.2	319	0.00	0	A	NM_014305		95232200	95232200	-1	no_errors	ENST00000261296	ensembl	human	known	69_37n	missense	123	29.71	52	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7578449	7578449	+	Missense_Mutation	SNP	C	C	T	rs193920817		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr17:7578449C>T	ENST00000269305.4	-	5	670	c.481G>A	c.(481-483)Gcc>Acc	p.A161T	TP53_ENST00000359597.4_Missense_Mutation_p.A161T|TP53_ENST00000455263.2_Missense_Mutation_p.A161T|TP53_ENST00000413465.2_Missense_Mutation_p.A161T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.A161T|TP53_ENST00000420246.2_Missense_Mutation_p.A161T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	161	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).|MA -> IP (in a sporadic cancer; somatic mutation).|MA -> IS (in sporadic cancers; somatic mutation).|MA -> IT (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A161T(54)|p.0?(8)|p.A68T(3)|p.A29T(3)|p.A161fs*9(3)|p.R156_I162delRVRAMAI(2)|p.M160fs*10(2)|p.V157_C176del20(1)|p.A161fs*19(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.A161fs*10(1)|p.R156_A161del(1)|p.V157fs*9(1)|p.A161fs*20(1)|p.M160_A161>IS(1)|p.A161fs*8(1)|p.S149fs*72(1)|p.A161fs*7(1)|p.T155_A161delTRVRAMA(1)|p.R156fs*20(1)|p.A161S(1)|p.A161P(1)|p.V157_I162delVRAMAI(1)|p.A161F(1)|p.A159_Q167delAMAIYKQSQ(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGTAGATGGCCATGGCGCGG	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	96	Substitution - Missense(63)|Deletion - Frameshift(10)|Deletion - In frame(9)|Whole gene deletion(8)|Complex - frameshift(3)|Insertion - Frameshift(2)|Complex - compound substitution(1)	lung(15)|large_intestine(13)|urinary_tract(8)|stomach(7)|central_nervous_system(7)|upper_aerodigestive_tract(6)|oesophagus(6)|pancreas(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|bone(4)|liver(4)|breast(3)|ovary(3)|thyroid(1)|meninges(1)|peritoneum(1)|skin(1)											52.0	53.0	53.0					17																	7578449		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.481G>A	17.37:g.7578449C>T	ENSP00000269305:p.Ala161Thr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.A161T	ENST00000269305.4	37	c.481	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048421	0.55110	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99816	-6.91;-6.91;-6.91;-6.91;-6.91;-6.91;-6.91;-6.91;-6.91	5.59	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99816	0.9919	M	0.86420	2.815	0.50313	D	0.999869	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.998;0.975;0.998;0.999;1.0;1.0	D	0.96744	0.9549	10	0.72032	D	0.01	-25.6622	14.7187	0.69289	0.0:0.8543:0.1457:0.0	.	122;161;161;68;161;161;161	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	161;161;161;161;161;161;150;68;29;68;29;161	ENSP00000410739:A161T;ENSP00000352610:A161T;ENSP00000269305:A161T;ENSP00000398846:A161T;ENSP00000391127:A161T;ENSP00000391478:A161T;ENSP00000425104:A29T;ENSP00000423862:A68T;ENSP00000424104:A161T	ENSP00000269305:A161T	A	-	1	0	TP53	7519174	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	1.014000	0.29950	1.498000	0.48600	0.655000	0.94253	GCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	39	0.00	0	C	NM_000546		7578449	7578449	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	17	69.64	39	SNP	1.000	T
TRPC3	7222	genome.wustl.edu	37	4	122853847	122853847	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr4:122853847C>T	ENST00000379645.3	-	2	639	c.566G>A	c.(565-567)cGc>cAc	p.R189H	TRPC3_ENST00000513531.1_Missense_Mutation_p.R116H|TRPC3_ENST00000264811.5_Missense_Mutation_p.R116H	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	104					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CTCTACGATGCGCACGTAGCC	0.637																																						dbGAP											0													80.0	68.0	72.0					4																	122853847		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.566G>A	4.37:g.122853847C>T	ENSP00000368966:p.Arg189His		A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPC3_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R189H	ENST00000379645.3	37	c.566	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	C	35	5.486607	0.96323	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.64803	-0.12;-0.12;-0.12	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.75361	0.3839	L	0.42245	1.32	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.75671	-0.3237	10	0.66056	D	0.02	-2.0813	20.0804	0.97772	0.0:1.0:0.0:0.0	.	116;189	E9PCJ9;Q5G1L5	.;.	H	116;189;116	ENSP00000264811:R116H;ENSP00000368966:R189H;ENSP00000426899:R116H	ENSP00000264811:R116H	R	-	2	0	TRPC3	123073297	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.755000	0.85180	2.738000	0.93877	0.655000	0.94253	CGC	TRPC3	-	superfamily_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	ENSG00000138741		0.637	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	HGNC	protein_coding	OTTHUMT00000364252.1	14	0.00	0	C	NM_003305		122853847	122853847	-1	no_errors	ENST00000379645	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	T
USPL1	10208	genome.wustl.edu	37	13	31233476	31233476	+	Silent	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr13:31233476C>T	ENST00000255304.4	+	9	3604	c.3262C>T	c.(3262-3264)Ctg>Ttg	p.L1088L		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	1088					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		CGATGAATATCTGTTTGAGAA	0.299																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0													52.0	53.0	52.0					13																	31233476		2188	4290	6478	-	-	-	SO:0001819	synonymous_variant	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.3262C>T	13.37:g.31233476C>T			Q14109|Q6AI45|Q8IY30|Q8IYE8	Silent	SNP	pfscan_Peptidase_C19	p.L1088	ENST00000255304.4	37	c.3262	CCDS9336.1	13																																																																																			USPL1	-	NULL	ENSG00000132952		0.299	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	122	0.00	0	C	NM_005800		31233476	31233476	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	silent	72	46.67	63	SNP	0.899	T
VPS41	27072	genome.wustl.edu	37	7	38807156	38807156	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr7:38807156C>T	ENST00000310301.4	-	15	1282	c.1228G>A	c.(1228-1230)Gac>Aac	p.D410N	VPS41_ENST00000395969.2_Missense_Mutation_p.D385N	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	410					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						ATGTCATAGTCTCCTCTCTCC	0.333																																						dbGAP											0													98.0	92.0	94.0					7																	38807156		2203	4300	6503	-	-	-	SO:0001583	missense	0			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.1228G>A	7.37:g.38807156C>T	ENSP00000309457:p.Asp410Asn		E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_VPS41,pfscan_Znf_RING	p.D410N	ENST00000310301.4	37	c.1228	CCDS5457.1	7	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125426	0.56721	.	.	ENSG00000006715	ENST00000310301;ENST00000395969	T;T	0.17854	2.25;2.25	5.51	5.51	0.81932	.	0.377777	0.31859	N	0.006957	T	0.18923	0.0454	L	0.45581	1.43	0.49798	D	0.999823	B;B;B	0.31383	0.321;0.321;0.321	B;B;B	0.28139	0.086;0.086;0.086	T	0.02179	-1.1200	10	0.30854	T	0.27	-8.1808	19.4094	0.94662	0.0:1.0:0.0:0.0	.	410;385;410	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	N	410;385	ENSP00000309457:D410N;ENSP00000379297:D385N	ENSP00000309457:D410N	D	-	1	0	VPS41	38773681	1.000000	0.71417	0.956000	0.39512	0.791000	0.44710	5.237000	0.65360	2.591000	0.87537	0.563000	0.77884	GAC	VPS41	-	pirsf_VPS41	ENSG00000006715		0.333	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS41	HGNC	protein_coding	OTTHUMT00000226986.3	205	0.00	0	C			38807156	38807156	-1	no_errors	ENST00000310301	ensembl	human	known	69_37n	missense	213	19.62	52	SNP	1.000	T
WDR37	22884	genome.wustl.edu	37	10	1118202	1118202	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr10:1118202C>T	ENST00000358220.1	+	2	251	c.107C>T	c.(106-108)aCg>aTg	p.T36M	WDR37_ENST00000263150.4_Missense_Mutation_p.T36M|WDR37_ENST00000381329.1_Missense_Mutation_p.T36M			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	36										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CAGGAGAGGACGGGACTGCCA	0.463																																						dbGAP											0													189.0	164.0	173.0					10																	1118202		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.107C>T	10.37:g.1118202C>T	ENSP00000350954:p.Thr36Met		A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T36M	ENST00000358220.1	37	c.107	CCDS7057.1	10	.	.	.	.	.	.	.	.	.	.	C	9.437	1.087095	0.20390	.	.	ENSG00000047056	ENST00000358220;ENST00000381329;ENST00000263150	T;T;T	0.71934	0.02;-0.61;0.02	5.58	4.67	0.58626	.	0.332405	0.33457	N	0.004900	T	0.59649	0.2209	L	0.47716	1.5	0.26336	N	0.977441	B;B;P	0.40332	0.212;0.212;0.713	B;B;B	0.26770	0.017;0.017;0.073	T	0.56208	-0.8017	10	0.44086	T	0.13	.	15.8102	0.78557	0.1373:0.8627:0.0:0.0	.	36;36;36	A8K976;Q9Y2I8;E7EQ49	.;WDR37_HUMAN;.	M	36	ENSP00000350954:T36M;ENSP00000370730:T36M;ENSP00000263150:T36M	ENSP00000263150:T36M	T	+	2	0	WDR37	1108202	0.999000	0.42202	0.546000	0.28166	0.189000	0.23516	4.503000	0.60407	1.342000	0.45619	-0.309000	0.09137	ACG	WDR37	-	NULL	ENSG00000047056		0.463	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR37	HGNC	protein_coding	OTTHUMT00000046418.1	71	0.00	0	C	NM_014023		1118202	1118202	+1	no_errors	ENST00000263150	ensembl	human	known	69_37n	missense	30	61.54	48	SNP	0.602	T
WNK3	65267	genome.wustl.edu	37	X	54275569	54275569	+	Missense_Mutation	SNP	G	G	A	rs375928678		TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chrX:54275569G>A	ENST00000375159.2	-	16	3211	c.3212C>T	c.(3211-3213)cCt>cTt	p.P1071L	WNK3_ENST00000375169.3_Missense_Mutation_p.P1071L|WNK3_ENST00000354646.2_Missense_Mutation_p.P1071L			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1071					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GACTGTCTTAGGAGAACTTGC	0.463																																						dbGAP											0													91.0	80.0	84.0					X																	54275569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.3212C>T	X.37:g.54275569G>A	ENSP00000364301:p.Pro1071Leu		B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P1071L	ENST00000375159.2	37	c.3212	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	G	5.088	0.201914	0.09652	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.26957	1.7;1.7;1.7	5.19	3.42	0.39159	.	0.545816	0.17364	N	0.176916	T	0.15522	0.0374	L	0.27053	0.805	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.08055	0.003;0.001	T	0.21690	-1.0238	10	0.49607	T	0.09	-3.1171	3.9838	0.09506	0.2746:0.0:0.5601:0.1653	.	1071;1071	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	L	1071	ENSP00000364312:P1071L;ENSP00000346667:P1071L;ENSP00000364301:P1071L	ENSP00000346667:P1071L	P	-	2	0	WNK3	54292294	0.997000	0.39634	0.606000	0.28943	0.615000	0.37417	3.730000	0.55006	0.405000	0.25532	-0.268000	0.10319	CCT	WNK3	-	NULL	ENSG00000196632		0.463	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	210	0.00	0	G	NM_020922		54275569	54275569	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	missense	235	10.98	29	SNP	0.030	A
ZAN	7455	genome.wustl.edu	37	7	100352988	100352988	+	RNA	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr7:100352988C>G	ENST00000348028.3	+	0	3429				ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCACTGCATCCAGGCCTCTT	0.572																																						dbGAP											0													114.0	113.0	114.0					7																	100352988		1923	4133	6056	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100352988C>G			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.I1088M	ENST00000348028.3	37	c.3264		7	.	.	.	.	.	.	.	.	.	.	c	15.87	2.961233	0.53400	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	D;D;D	0.92647	-3.08;-3.08;-3.08	5.13	5.13	0.70059	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.162788	0.29321	N	0.012485	D	0.96137	0.8741	M	0.86268	2.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.98;0.989	D	0.96318	0.9234	10	0.87932	D	0	.	14.7944	0.69868	0.0:1.0:0.0:0.0	.	1088;1088	F5H0T8;Q9Y493	.;ZAN_HUMAN	M	1088	ENSP00000445943:I1088M;ENSP00000445091:I1088M;ENSP00000444427:I1088M	ENSP00000423579:I1088M	I	+	3	3	ZAN	100190924	0.732000	0.28121	0.954000	0.39281	0.588000	0.36517	1.505000	0.35736	2.758000	0.94735	0.651000	0.88453	ATC	ZAN	-	pfam_TIL_dom,superfamily_TIL_dom	ENSG00000146839		0.572	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	73	0.00	0	C	NM_003386		100352988	100352988	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	149	17.22	31	SNP	0.965	G
ZFYVE20	64145	genome.wustl.edu	37	3	15115823	15115823	+	Silent	SNP	G	G	A			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr3:15115823G>A	ENST00000253699.3	-	14	2434	c.1821C>T	c.(1819-1821)ggC>ggT	p.G607G	ZFYVE20_ENST00000476527.2_Silent_p.G607G	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	607	Necessary for the interaction with EHD1.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						AGCGCTCCTGGCCAACGGCTG	0.592																																						dbGAP											0													46.0	50.0	49.0					3																	15115823		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.1821C>T	3.37:g.15115823G>A			B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Silent	SNP	pfam_Rbsn,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.G607	ENST00000253699.3	37	c.1821	CCDS2623.1	3																																																																																			ZFYVE20	-	NULL	ENSG00000131381		0.592	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE20	HGNC	protein_coding	OTTHUMT00000252102.2	80	0.00	0	G	NM_022340		15115823	15115823	-1	no_errors	ENST00000253699	ensembl	human	known	69_37n	silent	87	30.40	38	SNP	0.023	A
ZNF69	7620	genome.wustl.edu	37	19	12016630	12016630	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A03N-01B-11D-A10M-09	TCGA-AO-A03N-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ef5987f1-46ac-430a-b94a-49afa0e286d4	0af57ba4-305f-4d9d-b6fd-b242be5cd19a	g.chr19:12016630C>G	ENST00000429654.2	+	4	1558	c.1418C>G	c.(1417-1419)tCt>tGt	p.S473C	ZNF69_ENST00000340180.5_Intron			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		AGAATACACTCTGGAGAAAGA	0.393																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.1418C>G	19.37:g.12016630C>G	ENSP00000402985:p.Ser473Cys		Q86VA7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S473C	ENST00000429654.2	37	c.1418		19	.	.	.	.	.	.	.	.	.	.	c	12.70	2.015782	0.35606	.	.	ENSG00000198429	ENST00000429654	T	0.19938	2.11	1.26	-2.51	0.06365	.	.	.	.	.	T	0.20210	0.0486	.	.	.	0.19300	N	0.999976	.	.	.	.	.	.	T	0.29761	-1.0001	6	0.87932	D	0	.	5.3844	0.16211	0.2563:0.4555:0.2881:0.0	.	.	.	.	C	473	ENSP00000402985:S473C	ENSP00000402985:S473C	S	+	2	0	ZNF69	11877630	0.243000	0.23878	0.000000	0.03702	0.210000	0.24377	0.915000	0.28638	-1.112000	0.02984	0.194000	0.17425	TCT	ZNF69	-	pfscan_Znf_C2H2	ENSG00000198429		0.393	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	ZNF69	HGNC	protein_coding	OTTHUMT00000344082.1	127	0.00	0	C	NM_021915		12016630	12016630	+1	no_errors	ENST00000429654	ensembl	human	known	69_37n	missense	83	21.70	23	SNP	0.990	G
