#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTSL3	57188	genome.wustl.edu	37	15	84639385	84639385	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr15:84639385C>A	ENST00000286744.5	+	20	2864	c.2640C>A	c.(2638-2640)tgC>tgA	p.C880*	ADAMTSL3_ENST00000567716.1_3'UTR|ADAMTSL3_ENST00000567476.1_Nonsense_Mutation_p.C880*	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	880	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGCCTGAGTGCAGTAGTAAGT	0.488																																						dbGAP											0													162.0	139.0	147.0					15																	84639385		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2640C>A	15.37:g.84639385C>A	ENSP00000286744:p.Cys880*		A1A566|A1A567|Q9ULI7	Nonsense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.C880*	ENST00000286744.5	37	c.2640	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	C	43	10.235291	0.99365	.	.	ENSG00000156218	ENST00000286744	.	.	.	4.39	2.45	0.29901	.	0.000000	0.46442	D	0.000281	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3435	0.43893	0.0:0.8323:0.0:0.1677	.	.	.	.	X	880	.	ENSP00000286744:C880X	C	+	3	2	ADAMTSL3	82430389	0.106000	0.21978	0.120000	0.21714	0.950000	0.60333	0.243000	0.18106	1.051000	0.40369	0.650000	0.86243	TGC	ADAMTSL3	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000156218		0.488	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2	94	0.00	0	C	NM_207517		84639385	84639385	+1	no_errors	ENST00000286744	ensembl	human	known	69_37n	nonsense	117	26.42	42	SNP	0.830	A
AKAP14	158798	genome.wustl.edu	37	X	119037310	119037310	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chrX:119037310G>C	ENST00000371431.3	+	3	398	c.124G>C	c.(124-126)Gct>Cct	p.A42P	AKAP14_ENST00000371422.1_Missense_Mutation_p.A42P|AKAP14_ENST00000371423.2_Missense_Mutation_p.A42P|AKAP14_ENST00000394594.2_Missense_Mutation_p.A42P|AKAP14_ENST00000334356.2_Missense_Mutation_p.A42P|AKAP14_ENST00000371425.4_Missense_Mutation_p.A42P	NM_178813.5	NP_848928.1	Q86UN6	AKA28_HUMAN	A kinase (PRKA) anchor protein 14	42	RII-binding.				spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)				endometrium(4)|large_intestine(1)|lung(8)	13						AGTAGCTCTAGCTCTGGTTGA	0.388																																						dbGAP											0													205.0	148.0	168.0					X																	119037310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF514780	CCDS14591.1, CCDS35376.1, CCDS35377.1	Xq24	2008-02-05			ENSG00000186471	ENSG00000186471		"""A-kinase anchor proteins"""	24061	protein-coding gene	gene with protein product		300462				12475942	Standard	NM_178813		Approved	AKAP28	uc004ese.3	Q86UN6	OTTHUMG00000022285	ENST00000371431.3:c.124G>C	X.37:g.119037310G>C	ENSP00000360485:p.Ala42Pro		A6NNZ0|Q86UN4|Q86UN5	Missense_Mutation	SNP	NULL	p.A42P	ENST00000371431.3	37	c.124	CCDS14591.1	X	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545456	0.27652	.	.	ENSG00000186471	ENST00000371431;ENST00000371423;ENST00000371425;ENST00000394594;ENST00000371422;ENST00000334356	.	.	.	4.0	-2.79	0.05841	.	1.458410	0.04081	N	0.309621	T	0.28101	0.0693	N	0.19112	0.55	0.09310	N	1	D;D;D	0.64830	0.994;0.989;0.994	P;P;P	0.56960	0.737;0.55;0.81	T	0.11036	-1.0604	9	0.52906	T	0.07	0.8	1.0341	0.01544	0.4454:0.1476:0.2297:0.1773	.	42;42;42	A6NNZ0;Q86UN6;Q86UN6-3	.;AKA28_HUMAN;.	P	42	.	ENSP00000334680:A42P	A	+	1	0	AKAP14	118921338	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.524000	0.06222	-0.841000	0.04200	0.600000	0.82982	GCT	AKAP14	-	NULL	ENSG00000186471		0.388	AKAP14-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP14	HGNC	protein_coding	OTTHUMT00000058078.1	171	0.58	1	G	NM_178813		119037310	119037310	+1	no_errors	ENST00000371431	ensembl	human	known	69_37n	missense	25	81.20	108	SNP	0.000	C
ANKRD30A	91074	genome.wustl.edu	37	10	37419269	37419270	+	Missense_Mutation	DNP	TG	TG	AT	rs370367803		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr10:37419269_37419270TG>AT	ENST00000602533.1	+	3	404_405	c.305_306TG>AT	c.(304-306)cTG>cAT	p.L102H	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.L102H|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.L102H			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	158					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GTGGCAAAACTGCTGTCCCATG	0.381																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	Exception_encountered	10.37:g.37419269_37419270delinsAT	ENSP00000473551:p.Leu102His		Q5W025	Missense_Mutation|Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L102Q|p.L102	ENST00000602533.1	37	c.305|c.306		10																																																																																			ANKRD30A	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148513		0.381	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	149	0.00	0	T|G	NM_052997		37419269|37419270	37419269|37419270	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	missense|silent	80|76	27.03|28.30	30	SNP	0.990|0.989	A|T
ANKRD35	148741	genome.wustl.edu	37	1	145558223	145558223	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:145558223G>A	ENST00000355594.4	+	5	427	c.340G>A	c.(340-342)Gat>Aat	p.D114N	ANKRD35_ENST00000544626.1_Intron	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	114										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGCTAATGAAGATGCTGTGGA	0.532																																					Melanoma(9;127 754 22988 51047)	dbGAP											0													114.0	102.0	106.0					1																	145558223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.340G>A	1.37:g.145558223G>A	ENSP00000347802:p.Asp114Asn		A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D114N	ENST00000355594.4	37	c.340	CCDS919.1	1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869581	0.91587	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.45668	0.89	5.17	5.17	0.71159	Ankyrin repeat-containing domain (4);	0.000000	0.41396	D	0.000895	T	0.29524	0.0736	N	0.03881	-0.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.42498	-0.9448	10	0.35671	T	0.21	-20.4059	14.511	0.67787	0.0:0.0:1.0:0.0	.	114	Q8N283	ANR35_HUMAN	N	23;114	ENSP00000347802:D114N	ENSP00000347802:D114N	D	+	1	0	ANKRD35	144269580	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.934000	0.63491	2.573000	0.86826	0.655000	0.94253	GAT	ANKRD35	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000198483		0.532	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	HGNC	protein_coding	OTTHUMT00000038515.1	56	0.00	0	G	NM_144698		145558223	145558223	+1	no_errors	ENST00000355594	ensembl	human	known	69_37n	missense	131	13.73	21	SNP	1.000	A
AP1B1	162	genome.wustl.edu	37	22	29737711	29737711	+	Silent	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr22:29737711G>A	ENST00000405198.1	-	12	1606	c.1575C>T	c.(1573-1575)atC>atT	p.I525I	AP1B1_ENST00000432560.2_Silent_p.I525I|AP1B1_ENST00000356015.2_Silent_p.I525I|AP1B1_ENST00000317368.7_Silent_p.I525I|AP1B1_ENST00000472057.1_5'Flank|AP1B1_ENST00000415447.1_Silent_p.I525I|AP1B1_ENST00000357586.2_Silent_p.I525I|AP1B1_ENST00000402502.1_Silent_p.I525I			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	525					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GGCGCCAGTAGATGTAGCCAC	0.597																																						dbGAP											0													65.0	56.0	59.0					22																	29737711		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.1575C>T	22.37:g.29737711G>A			C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu	p.I525	ENST00000405198.1	37	c.1575	CCDS13855.1	22																																																																																			AP1B1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP_complex_bsu	ENSG00000100280		0.597	AP1B1-001	KNOWN	basic|CCDS	protein_coding	AP1B1	HGNC	protein_coding	OTTHUMT00000321374.1	23	0.00	0	G	NM_001127		29737711	29737711	-1	no_errors	ENST00000357586	ensembl	human	known	69_37n	silent	2	92.31	24	SNP	1.000	A
AP2A1	160	genome.wustl.edu	37	19	50309000	50309000	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:50309000C>G	ENST00000359032.5	+	21	2617	c.2617C>G	c.(2617-2619)Cag>Gag	p.Q873E	AP2A1_ENST00000354293.5_Missense_Mutation_p.Q851E	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	873					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		GATGGCGGCCCAGGATTTCTT	0.667																																						dbGAP											0													19.0	20.0	20.0					19																	50309000		1869	4076	5945	-	-	-	SO:0001583	missense	0			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.2617C>G	19.37:g.50309000C>G	ENSP00000351926:p.Gln873Glu		Q96CI7|Q96PP6|Q96PP7|Q9H070	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.Q873E	ENST00000359032.5	37	c.2617	CCDS46148.1	19	.	.	.	.	.	.	.	.	.	.	C	5.878	0.346199	0.11126	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	T;T	0.15487	2.42;2.42	5.82	4.73	0.59995	Coatomer/calthrin adaptor appendage, C-terminal subdomain (1);Clathrin alpha-adaptin/coatomer adaptor, appendage, C-terminal subdomain (1);Clathrin adaptor, alpha-adaptin, appendage, C-terminal subdomain (1);	0.161907	0.56097	D	0.000032	T	0.06096	0.0158	N	0.02111	-0.68	0.33939	D	0.643036	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.10405	-1.0631	10	0.02654	T	1	.	15.3218	0.74126	0.0:0.8596:0.1404:0.0	.	851;873	O95782-2;O95782	.;AP2A1_HUMAN	E	851;873	ENSP00000346246:Q851E;ENSP00000351926:Q873E	ENSP00000346246:Q851E	Q	+	1	0	AP2A1	55000812	0.913000	0.31002	1.000000	0.80357	0.630000	0.37929	1.910000	0.39927	2.756000	0.94617	0.561000	0.74099	CAG	AP2A1	-	pfam_Clathrin_a-adaptin_app_sub_C,superfamily_Coatomer/calthrin_app_sub_C,pirsf_AP2_complex_asu	ENSG00000196961		0.667	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1	16	0.00	0	C			50309000	50309000	+1	no_errors	ENST00000359032	ensembl	human	known	69_37n	missense	7	80.00	28	SNP	0.998	G
APOB	338	genome.wustl.edu	37	2	21235092	21235092	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr2:21235092G>T	ENST00000233242.1	-	26	4775	c.4648C>A	c.(4648-4650)Ctg>Atg	p.L1550M		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1550					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.L1550M(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCACTTTGCAGATCAGAGGTG	0.443																																						dbGAP											1	Substitution - Missense(1)	lung(1)											106.0	107.0	106.0					2																	21235092		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4648C>A	2.37:g.21235092G>T	ENSP00000233242:p.Leu1550Met		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.L1550M	ENST00000233242.1	37	c.4648	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968619	0.53614	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00840	5.63	5.88	4.0	0.46444	.	0.151059	0.30611	N	0.009246	T	0.01029	0.0034	L	0.54323	1.7	0.48236	D	0.999618	P	0.44006	0.824	B	0.36092	0.217	T	0.68519	-0.5387	10	0.42905	T	0.14	.	4.9428	0.13975	0.0807:0.26:0.5395:0.1198	.	1550	P04114	APOB_HUMAN	M	1550	ENSP00000233242:L1550M	ENSP00000233242:L1550M	L	-	1	2	APOB	21088597	0.967000	0.33354	0.994000	0.49952	0.821000	0.46438	0.563000	0.23547	1.499000	0.48617	0.655000	0.94253	CTG	APOB	-	NULL	ENSG00000084674		0.443	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	153	0.00	0	G			21235092	21235092	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	108	46.53	94	SNP	0.627	T
APPBP2	10513	genome.wustl.edu	37	17	58538075	58538075	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:58538075G>A	ENST00000083182.3	-	9	1297	c.1010C>T	c.(1009-1011)gCc>gTc	p.A337V	APPBP2_ENST00000592995.1_5'UTR	NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	337					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			AGAAGAGTAGGCCAAATCTTC	0.388																																						dbGAP											0													95.0	85.0	88.0					17																	58538075		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.1010C>T	17.37:g.58538075G>A	ENSP00000083182:p.Ala337Val		A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A337V	ENST00000083182.3	37	c.1010	CCDS32699.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.828148	0.96996	.	.	ENSG00000062725	ENST00000083182	D	0.87412	-2.25	5.93	5.93	0.95920	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.92561	0.7637	M	0.66939	2.045	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	D	0.91838	0.5481	10	0.56958	D	0.05	-23.0553	20.3539	0.98825	0.0:0.0:1.0:0.0	.	337	Q92624	APBP2_HUMAN	V	337	ENSP00000083182:A337V	ENSP00000083182:A337V	A	-	2	0	APPBP2	55892857	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	9.434000	0.97515	2.826000	0.97356	0.655000	0.94253	GCC	APPBP2	-	NULL	ENSG00000062725		0.388	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPBP2	HGNC	protein_coding	OTTHUMT00000449465.1	121	0.00	0	G	NM_006380		58538075	58538075	-1	no_errors	ENST00000083182	ensembl	human	known	69_37n	missense	121	34.41	64	SNP	1.000	A
ARHGAP42	143872	genome.wustl.edu	37	11	100792303	100792303	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr11:100792303C>G	ENST00000298815.8	+	6	568	c.565C>G	c.(565-567)Caa>Gaa	p.Q189E	ARHGAP42_ENST00000524892.2_Missense_Mutation_p.Q155E	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	189	BAR.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						TCAAGAGGTCCAAGAAAAAAA	0.328																																						dbGAP											0													54.0	44.0	47.0					11																	100792303		692	1588	2280	-	-	-	SO:0001583	missense	0					11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.565C>G	11.37:g.100792303C>G	ENSP00000298815:p.Gln189Glu		Q96M56	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.Q189E	ENST00000298815.8	37	c.565		11	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797923	0.70567	.	.	ENSG00000165895	ENST00000524892;ENST00000298815;ENST00000531183	T;T;T	0.04758	3.56;3.56;3.56	5.53	5.53	0.82687	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.56097	D	0.000039	T	0.11239	0.0274	M	0.68952	2.095	0.80722	D	1	B	0.33299	0.407	B	0.38056	0.264	T	0.02917	-1.1094	10	0.42905	T	0.14	.	19.4552	0.94884	0.0:1.0:0.0:0.0	.	189	A6NI28	RHG42_HUMAN	E	155;189;45	ENSP00000431776:Q155E;ENSP00000298815:Q189E;ENSP00000434304:Q45E	ENSP00000298815:Q189E	Q	+	1	0	ARHGAP42	100297513	1.000000	0.71417	1.000000	0.80357	0.397000	0.30659	7.335000	0.79234	2.591000	0.87537	0.563000	0.77884	CAA	ARHGAP42	-	NULL	ENSG00000165895		0.328	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP42	HGNC	protein_coding		154	0.00	0	C	NM_152432		100792303	100792303	+1	no_errors	ENST00000298815	ensembl	human	known	69_37n	missense	10	76.19	32	SNP	1.000	G
ATAD3B	83858	genome.wustl.edu	37	1	1426042	1426042	+	Silent	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:1426042G>A	ENST00000308647.7	+	15	1721	c.1605G>A	c.(1603-1605)gtG>gtA	p.V535V		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	535						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		AGCTGGCCGTGTCCTGGCAGG	0.677																																						dbGAP											0													18.0	20.0	20.0					1																	1426042		2168	4220	6388	-	-	-	SO:0001819	synonymous_variant	0			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1605G>A	1.37:g.1426042G>A			A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Silent	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.V535	ENST00000308647.7	37	c.1605	CCDS30.1	1																																																																																			ATAD3B	-	NULL	ENSG00000160072		0.677	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	23	0.00	0	G	NM_031921		1426042	1426042	+1	no_errors	ENST00000308647	ensembl	human	known	69_37n	silent	4	87.88	29	SNP	1.000	A
BID	637	genome.wustl.edu	37	22	18220856	18220856	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr22:18220856C>T	ENST00000399774.3	-	5	672	c.503G>A	c.(502-504)cGt>cAt	p.R168H	BID_ENST00000473439.1_5'UTR|BID_ENST00000399767.1_Missense_Mutation_p.R72H|BID_ENST00000399765.1_Missense_Mutation_p.R72H|BID_ENST00000551952.1_Missense_Mutation_p.R168H|BID_ENST00000342111.5_3'UTR|BID_ENST00000317361.7_Missense_Mutation_p.R214H	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist	168					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)			large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		AAAGACATCACGGAGCAAGGA	0.532																																						dbGAP											0													116.0	112.0	113.0					22																	18220856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.503G>A	22.37:g.18220856C>T	ENSP00000382674:p.Arg168His		Q549M7|Q71T04|Q7Z4M9|Q8IY86	Missense_Mutation	SNP	pfam_BID	p.R214H	ENST00000399774.3	37	c.641	CCDS13748.1	22	.	.	.	.	.	.	.	.	.	.	C	12.33	1.904548	0.33628	.	.	ENSG00000015475	ENST00000317361;ENST00000399767;ENST00000399774;ENST00000399765;ENST00000551952	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	5.83	-0.0305	0.13914	.	0.196543	0.35067	N	0.003475	T	0.16514	0.0397	L	0.55481	1.735	0.09310	N	1	B;P	0.43578	0.383;0.811	B;B	0.34093	0.102;0.175	T	0.15122	-1.0448	10	0.52906	T	0.07	.	5.0838	0.14671	0.0:0.4175:0.2561:0.3265	.	168;214	P55957;P55957-2	BID_HUMAN;.	H	214;72;168;72;168	ENSP00000318822:R214H;ENSP00000382669:R72H;ENSP00000382674:R168H;ENSP00000382667:R72H;ENSP00000449236:R168H	ENSP00000318822:R214H	R	-	2	0	BID	16600856	0.000000	0.05858	0.001000	0.08648	0.121000	0.20230	-0.681000	0.05191	-0.107000	0.12088	-0.176000	0.13171	CGT	BID	-	pfam_BID	ENSG00000015475		0.532	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BID	HGNC	protein_coding	OTTHUMT00000316178.1	84	0.00	0	C	NM_197966		18220856	18220856	-1	no_errors	ENST00000317361	ensembl	human	known	69_37n	missense	17	81.31	87	SNP	0.005	T
N4BP2L1	90634	genome.wustl.edu	37	13	32972561	32972561	+	IGR	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr13:32972561G>C	ENST00000380130.2	-	0	3046				BRCA2_ENST00000544455.1_Missense_Mutation_p.C3304S|BRCA2_ENST00000380152.3_Missense_Mutation_p.C3304S	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1											large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		CCAAGGAGTTGTGGCACCAAA	0.388																																						dbGAP											0													106.0	107.0	107.0					13																	32972561		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697		13.37:g.32972561G>C			A4QN21|Q5TBK0	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_DNA_recomb/repair_BRCA2,pfscan_BRCA2_repeat	p.C3304S	ENST00000380130.2	37	c.9911	CCDS9345.2	13	.	.	.	.	.	.	.	.	.	.	G	18.41	3.616927	0.66672	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00753	5.74;5.74	5.58	5.58	0.84498	.	0.218648	0.49305	D	0.000157	T	0.01254	0.0041	M	0.62016	1.91	0.31708	N	0.639905	B	0.29909	0.261	B	0.24155	0.051	T	0.08249	-1.0731	10	0.62326	D	0.03	.	11.4196	0.49974	0.0:0.1261:0.7275:0.1464	.	3304	P51587	BRCA2_HUMAN	S	3304	ENSP00000369497:C3304S;ENSP00000439902:C3304S	ENSP00000369497:C3304S	C	+	2	0	BRCA2	31870561	1.000000	0.71417	0.930000	0.37139	0.819000	0.46315	2.797000	0.47877	2.616000	0.88540	0.467000	0.42956	TGT	BRCA2	-	pirsf_DNA_recomb/repair_BRCA2	ENSG00000139618		0.388	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding		126	0.00	0	G	NM_052818		32972561	32972561	+1	no_errors	ENST00000380152	ensembl	human	known	69_37n	missense	16	84.47	87	SNP	0.974	C
C4orf36	132989	genome.wustl.edu	37	4	87809333	87809333	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr4:87809333C>T	ENST00000473559.1	-	6	824	c.161G>A	c.(160-162)gGt>gAt	p.G54D	C4orf36_ENST00000295898.3_Missense_Mutation_p.G54D|C4orf36_ENST00000503001.1_5'UTR			Q96KX1	CD036_HUMAN	chromosome 4 open reading frame 36	54										breast(1)|kidney(1)|lung(1)|prostate(1)	4		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00141)		CTGCACAGAACCACCAAATGA	0.408																																						dbGAP											0													97.0	95.0	96.0					4																	87809333		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016746	CCDS3615.1	4q21.3	2008-02-05			ENSG00000163633	ENSG00000163633			28386	protein-coding gene	gene with protein product						12477932	Standard	NM_144645		Approved	MGC26744	uc003hqe.4	Q96KX1	OTTHUMG00000130597	ENST00000473559.1:c.161G>A	4.37:g.87809333C>T	ENSP00000420949:p.Gly54Asp			Missense_Mutation	SNP	NULL	p.G54D	ENST00000473559.1	37	c.161	CCDS3615.1	4	.	.	.	.	.	.	.	.	.	.	C	9.438	1.087250	0.20390	.	.	ENSG00000163633	ENST00000295898;ENST00000473559;ENST00000506308;ENST00000504008	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.13	0.244	0.15507	.	1.011420	0.07912	N	0.974438	T	0.14227	0.0344	N	0.08118	0	0.09310	N	1	B	0.24426	0.103	B	0.25140	0.058	T	0.32613	-0.9900	10	0.27082	T	0.32	-0.2324	4.4905	0.11812	0.0:0.4855:0.1581:0.3564	.	54	Q96KX1	CD036_HUMAN	D	54	ENSP00000295898:G54D;ENSP00000420949:G54D;ENSP00000421141:G54D;ENSP00000422720:G54D	ENSP00000295898:G54D	G	-	2	0	C4orf36	88028357	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-0.054000	0.11826	0.075000	0.16796	0.591000	0.81541	GGT	C4orf36	-	NULL	ENSG00000163633		0.408	C4orf36-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C4orf36	HGNC	protein_coding	OTTHUMT00000253045.2	181	0.00	0	C	NM_144645		87809333	87809333	-1	no_errors	ENST00000295898	ensembl	human	known	69_37n	missense	20	73.68	56	SNP	0.000	T
C6orf89	221477	genome.wustl.edu	37	6	36882408	36882408	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:36882408G>A	ENST00000480824.2	+	6	928	c.634G>A	c.(634-636)Ggg>Agg	p.G212R	C6orf89_ENST00000359359.2_Missense_Mutation_p.G106R|C6orf89_ENST00000373685.1_Missense_Mutation_p.G212R|C6orf89_ENST00000355190.3_Missense_Mutation_p.G219R|C6orf89_ENST00000510325.2_Missense_Mutation_p.G106R			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	212					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						CTTCTCTGAAGGGTTTTTCGC	0.537																																						dbGAP											0													176.0	185.0	182.0					6																	36882408		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.634G>A	6.37:g.36882408G>A	ENSP00000475947:p.Gly212Arg		B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	NULL	p.G219R	ENST00000480824.2	37	c.655		6	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758286	0.69763	.	.	ENSG00000198663	ENST00000359359;ENST00000510325;ENST00000355190;ENST00000373685	.	.	.	5.03	5.03	0.67393	.	0.307382	0.32819	N	0.005605	T	0.38188	0.1031	L	0.43152	1.355	0.38429	D	0.946382	P;P	0.46512	0.879;0.879	B;B	0.44108	0.441;0.441	T	0.41215	-0.9521	9	0.54805	T	0.06	-1.167	14.2104	0.65762	0.0:0.0:1.0:0.0	.	212;219	Q6UWU4;Q6UWU4-2	CF089_HUMAN;.	R	106;106;219;212	.	ENSP00000347322:G219R	G	+	1	0	C6orf89	36990386	1.000000	0.71417	0.877000	0.34402	0.676000	0.39594	4.746000	0.62133	2.500000	0.84329	0.609000	0.83330	GGG	C6orf89	-	NULL	ENSG00000198663		0.537	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	C6orf89	HGNC	protein_coding	OTTHUMT00000040387.2	180	0.00	0	G	NM_152734		36882408	36882408	+1	no_errors	ENST00000355190	ensembl	human	known	69_37n	missense	230	21.96	65	SNP	0.994	A
CACNA2D3	55799	genome.wustl.edu	37	3	54905585	54905585	+	Missense_Mutation	SNP	G	G	T	rs373496650		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr3:54905585G>T	ENST00000474759.1	+	18	1694	c.1646G>T	c.(1645-1647)cGa>cTa	p.R549L	CACNA2D3_ENST00000490478.1_Missense_Mutation_p.R455L|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.R549L|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.R549L	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	549	Cache.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GGAAAAAAGCGAAGGAAACCT	0.453																																						dbGAP											0													162.0	154.0	156.0					3																	54905585		1916	4125	6041	-	-	-	SO:0001583	missense	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1646G>T	3.37:g.54905585G>T	ENSP00000419101:p.Arg549Leu		B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R549L	ENST00000474759.1	37	c.1646	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388017	0.82902	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624;ENST00000438476	T;T;T;T	0.08458	3.09;3.09;3.09;3.09	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.13500	0.0327	L	0.34521	1.04	0.52501	D	0.999953	P	0.52170	0.951	P	0.54629	0.757	T	0.12553	-1.0543	10	0.09338	T	0.73	0.5016	17.7364	0.88394	0.0:0.0:1.0:0.0	.	549	Q8IZS8	CA2D3_HUMAN	L	549;549;549;455;455;448	ENSP00000389506:R549L;ENSP00000419101:R549L;ENSP00000288197:R549L;ENSP00000417279:R455L	ENSP00000288197:R549L	R	+	2	0	CACNA2D3	54880625	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	8.735000	0.91549	2.634000	0.89283	0.655000	0.94253	CGA	CACNA2D3	-	NULL	ENSG00000157445		0.453	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	199	0.00	0	G			54905585	54905585	+1	no_errors	ENST00000288197	ensembl	human	known	69_37n	missense	91	38.93	58	SNP	1.000	T
CCR7	1236	genome.wustl.edu	37	17	38711515	38711515	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:38711515G>A	ENST00000246657.2	-	3	678	c.616C>T	c.(616-618)Caa>Taa	p.Q206*	CCR7_ENST00000579344.1_Nonsense_Mutation_p.Q200*	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	206					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				CGCATCGCTTGCTCACTGCTG	0.567																																						dbGAP											0													71.0	62.0	65.0					17																	38711515		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.616C>T	17.37:g.38711515G>A	ENSP00000246657:p.Gln206*			Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Chemokine_CCR7,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_Chemokine_CCR11,pfscan_GPCR_Rhodpsn_supfam	p.Q206*	ENST00000246657.2	37	c.616	CCDS11369.1	17	.	.	.	.	.	.	.	.	.	.	G	8.999	0.979547	0.18812	.	.	ENSG00000126353	ENST00000246657	.	.	.	4.45	2.35	0.29111	.	1.327060	0.04770	N	0.427781	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	2.9038	0.05714	0.0901:0.1423:0.3825:0.3852	.	.	.	.	X	206	.	ENSP00000246657:Q206X	Q	-	1	0	CCR7	35965041	0.957000	0.32711	0.894000	0.35097	0.214000	0.24535	1.629000	0.37071	0.744000	0.32741	0.561000	0.74099	CAA	CCR7	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Chemokine_CCR7,pfscan_GPCR_Rhodpsn_supfam	ENSG00000126353		0.567	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR7	HGNC	protein_coding	OTTHUMT00000257222.1	30	0.00	0	G			38711515	38711515	-1	no_errors	ENST00000246657	ensembl	human	known	69_37n	nonsense	80	26.61	29	SNP	0.062	A
CD9	928	genome.wustl.edu	37	12	6309673	6309673	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr12:6309673T>A	ENST00000382518.1	+	2	444	c.8T>A	c.(7-9)gTc>gAc	p.V3D	CD9_ENST00000009180.4_Missense_Mutation_p.V3D|CD9_ENST00000382515.2_5'Flank			P21926	CD9_HUMAN	CD9 molecule	3					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						ACCATGCCGGTCAAAGGAGGC	0.632																																						dbGAP											0													97.0	87.0	90.0					12																	6309673		2203	4300	6503	-	-	-	SO:0001583	missense	0			M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.8T>A	12.37:g.6309673T>A	ENSP00000371958:p.Val3Asp		D3DUQ9|Q5J7W6|Q96ES4	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V3D	ENST00000382518.1	37	c.8	CCDS8540.1	12	.	.	.	.	.	.	.	.	.	.	T	22.6	4.311636	0.81358	.	.	ENSG00000010278	ENST00000382518;ENST00000536586;ENST00000382519;ENST00000425469;ENST00000009180	T;T;T;T	0.30981	2.05;1.57;1.51;2.05	4.06	4.06	0.47325	.	0.908395	0.09399	N	0.807510	T	0.51924	0.1703	M	0.72353	2.195	0.80722	D	1	D;P;D	0.71674	0.998;0.919;0.987	D;P;P	0.65010	0.931;0.786;0.723	T	0.46884	-0.9159	10	0.87932	D	0	.	9.3284	0.38008	0.0:0.0:0.0:1.0	.	3;3;3	B4DK09;B4DL91;P21926	.;.;CD9_HUMAN	D	3	ENSP00000371958:V3D;ENSP00000440985:V3D;ENSP00000371959:V3D;ENSP00000009180:V3D	ENSP00000009180:V3D	V	+	2	0	CD9	6179934	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.596000	0.61055	1.702000	0.51228	0.519000	0.50382	GTC	CD9	-	NULL	ENSG00000010278		0.632	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	CD9	HGNC	protein_coding	OTTHUMT00000103348.1	29	0.00	0	T			6309673	6309673	+1	no_errors	ENST00000009180	ensembl	human	known	69_37n	missense	41	45.45	35	SNP	1.000	A
CDR2L	30850	genome.wustl.edu	37	17	72998158	72998158	+	Splice_Site	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:72998158G>A	ENST00000337231.5	+	4	753		c.e4-1			NM_014603.2	NP_055418.2	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like													all_lung(278;0.226)					CCCGCCCCCAGGCTGACGGAG	0.652																																						dbGAP											0													23.0	25.0	24.0					17																	72998158		2201	4294	6495	-	-	-	SO:0001630	splice_region_variant	0				CCDS11710.2	17q25.1	2006-03-28			ENSG00000109089	ENSG00000109089			29999	protein-coding gene	gene with protein product	"""paraneoplastic antigen"""						Standard	NM_014603		Approved	HUMPPA	uc002jml.4	Q86X02	OTTHUMG00000150435	ENST00000337231.5:c.342-1G>A	17.37:g.72998158G>A			B4DFA7|Q15175	Splice_Site	SNP	-	e4-1	ENST00000337231.5	37	c.342-1	CCDS11710.2	17	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501786	0.64298	.	.	ENSG00000109089	ENST00000337231	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.155	0.93506	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDR2L	70509753	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	9.805000	0.99149	2.609000	0.88269	0.563000	0.77884	.	CDR2L	-	-	ENSG00000109089		0.652	CDR2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR2L	HGNC	protein_coding	OTTHUMT00000318080.1	12	0.00	0	G	NM_014603	Intron	72998158	72998158	+1	no_errors	ENST00000337231	ensembl	human	known	69_37n	splice_site	26	31.58	12	SNP	1.000	A
CEP170	9859	genome.wustl.edu	37	1	243327823	243327823	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:243327823T>C	ENST00000366542.1	-	13	3490	c.3439A>G	c.(3439-3441)Att>Gtt	p.I1147V	CEP170_ENST00000366544.1_Missense_Mutation_p.I1049V|RP11-261C10.4_ENST00000422938.1_RNA|RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000490813.1_5'Flank|CEP170_ENST00000366543.1_Missense_Mutation_p.I1049V	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	1147	Targeting to centrosomes.|Targeting to microtubules.					centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AATAAATCAATCCGAGAGATG	0.463																																						dbGAP											0													20.0	19.0	19.0					1																	243327823		1816	4044	5860	-	-	-	SO:0001583	missense	0			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.3439A>G	1.37:g.243327823T>C	ENSP00000355500:p.Ile1147Val		O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_Fibronectin_type3,smart_FHA_dom,pfscan_FHA_dom	p.I1147V	ENST00000366542.1	37	c.3439	CCDS44339.1	1	.	.	.	.	.	.	.	.	.	.	T	14.86	2.660897	0.47572	.	.	ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543;ENST00000532008	T;T;T	0.50277	0.86;0.85;0.75	4.6	4.6	0.57074	.	0.055638	0.64402	D	0.000001	T	0.60090	0.2242	L	0.51422	1.61	0.80722	D	1	D;P;P;P	0.54397	0.966;0.826;0.826;0.93	D;P;P;D	0.72075	0.976;0.811;0.811;0.926	T	0.55958	-0.8058	10	0.26408	T	0.33	-13.4409	13.4533	0.61184	0.0:0.0:0.0:1.0	.	1110;1049;1049;1147	B1ARM6;Q5SW79-3;Q5SW79-2;Q5SW79	.;.;.;CE170_HUMAN	V	1147;1049;1049;108	ENSP00000355500:I1147V;ENSP00000355502:I1049V;ENSP00000355501:I1049V	ENSP00000355500:I1147V	I	-	1	0	CEP170	241394446	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.632000	0.61311	1.815000	0.52974	0.454000	0.30748	ATT	CEP170	-	NULL	ENSG00000143702		0.463	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	HGNC	protein_coding	OTTHUMT00000096178.2	52	0.00	0	T	NM_014812		243327823	243327823	-1	no_errors	ENST00000366542	ensembl	human	known	69_37n	missense	51	54.87	62	SNP	1.000	C
CFTR	1080	genome.wustl.edu	37	7	117282532	117282532	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:117282532T>C	ENST00000003084.6	+	23	3890	c.3758T>C	c.(3757-3759)tTg>tCg	p.L1253S	CFTR_ENST00000454343.1_Missense_Mutation_p.L1192S|AC000111.6_ENST00000456270.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1253	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	AAGAGTACTTTGTTATCAGCT	0.418									Cystic Fibrosis																													dbGAP											0													140.0	140.0	140.0					7																	117282532		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3758T>C	7.37:g.117282532T>C	ENSP00000003084:p.Leu1253Ser		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.L1253S	ENST00000003084.6	37	c.3758	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	T	21.3	4.124858	0.77436	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.97089	-4.24;-4.24;-4.24	5.2	5.2	0.72013	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.98902	0.9628	H	0.95402	3.665	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.99659	1.0993	10	0.87932	D	0	-14.0439	15.3453	0.74330	0.0:0.0:0.0:1.0	.	1253	P13569	CFTR_HUMAN	S	1253;1192;1223	ENSP00000003084:L1253S;ENSP00000403677:L1192S;ENSP00000389119:L1223S	ENSP00000003084:L1253S	L	+	2	0	CFTR	117069768	1.000000	0.71417	0.985000	0.45067	0.825000	0.46686	7.492000	0.81482	2.076000	0.62316	0.477000	0.44152	TTG	CFTR	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_cAMP_cl_channel	ENSG00000001626		0.418	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	229	0.00	0	T	NM_000492		117282532	117282532	+1	no_errors	ENST00000003084	ensembl	human	known	69_37n	missense	54	38.64	34	SNP	1.000	C
CMYA5	202333	genome.wustl.edu	37	5	79030062	79030062	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr5:79030062delA	ENST00000446378.2	+	2	5505	c.5474delA	c.(5473-5475)gaafs	p.E1825fs		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1825					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAAAAGACAGAAAAAGCACTT	0.383																																						dbGAP											0													72.0	70.0	71.0					5																	79030062		1837	4096	5933	-	-	-	SO:0001589	frameshift_variant	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.5474delA	5.37:g.79030062delA	ENSP00000394770:p.Glu1825fs		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Frame_Shift_Del	DEL	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.A1827fs	ENST00000446378.2	37	c.5474	CCDS47238.1	5																																																																																			CMYA5	-	NULL	ENSG00000164309		0.383	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	119	0.00	0	A	NM_153610		79030062	79030062	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	frame_shift_del	40	29.82	17	DEL	0.001	-
CNTRL	11064	genome.wustl.edu	37	9	123937323	123937323	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr9:123937323C>G	ENST00000373855.1	+	43	7035	c.6775C>G	c.(6775-6777)Caa>Gaa	p.Q2259E	CNTRL_ENST00000238341.5_Missense_Mutation_p.Q2259E|CNTRL_ENST00000373850.1_Missense_Mutation_p.Q1707E|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	2259	Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TATGTCCAAGCAAGCAGAAGT	0.458																																						dbGAP											0													133.0	139.0	137.0					9																	123937323		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6775C>G	9.37:g.123937323C>G	ENSP00000362962:p.Gln2259Glu		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.Q2259E	ENST00000373855.1	37	c.6775	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396549	0.62177	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.37584	1.42;1.42;1.19	5.48	5.48	0.80851	.	.	.	.	.	T	0.36771	0.0979	M	0.61703	1.905	0.52099	D	0.999944	P	0.34800	0.469	B	0.28991	0.097	T	0.15122	-1.0448	9	0.28530	T	0.3	.	18.3295	0.90263	0.0:1.0:0.0:0.0	.	2259	Q7Z7A1	CNTRL_HUMAN	E	2259;2259;2259;416;1707;941	ENSP00000362962:Q2259E;ENSP00000238341:Q2259E;ENSP00000362956:Q1707E	ENSP00000238341:Q2259E	Q	+	1	0	CNTRL	122977144	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.137000	0.71710	2.569000	0.86673	0.555000	0.69702	CAA	CNTRL	-	NULL	ENSG00000119397		0.458	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	90	0.00	0	C	NM_007018		123937323	123937323	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	16	79.75	63	SNP	1.000	G
CPNE4	131034	genome.wustl.edu	37	3	131300432	131300432	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr3:131300432A>T	ENST00000512055.1	-	13	2984	c.858T>A	c.(856-858)aaT>aaA	p.N286K	CPNE4_ENST00000512332.1_Missense_Mutation_p.N304K|CPNE4_ENST00000429747.1_Missense_Mutation_p.N286K|CPNE4_ENST00000502818.1_Missense_Mutation_p.N304K|CPNE4_ENST00000511604.1_Missense_Mutation_p.N286K			Q96A23	CPNE4_HUMAN	copine IV	286						extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						CCTTGCACAGATTCAGAATCA	0.458																																						dbGAP											0													284.0	226.0	246.0					3																	131300432		2203	4300	6503	-	-	-	SO:0001583	missense	0			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.858T>A	3.37:g.131300432A>T	ENSP00000421705:p.Asn286Lys		D3DNC5|Q8TEX1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting	p.N304K	ENST00000512055.1	37	c.912	CCDS3072.1	3	.	.	.	.	.	.	.	.	.	.	A	0.031	-1.333160	0.01298	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.51071	0.73;0.73;0.72;0.73;0.72	5.51	1.69	0.24217	.	0.042982	0.85682	D	0.000000	T	0.15176	0.0366	N	0.01789	-0.72	0.51767	D	0.999936	B;B	0.33266	0.404;0.046	B;B	0.30572	0.117;0.028	T	0.29274	-1.0017	10	0.02654	T	1	-25.2946	8.739	0.34545	0.6983:0.0:0.3017:0.0	.	304;286	Q96A23-2;Q96A23	.;CPNE4_HUMAN	K	286;286;304;286;304	ENSP00000421705:N286K;ENSP00000411904:N286K;ENSP00000424853:N304K;ENSP00000423811:N286K;ENSP00000421646:N304K	ENSP00000411904:N286K	N	-	3	2	CPNE4	132783122	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	1.012000	0.29924	0.355000	0.24131	0.528000	0.53228	AAT	CPNE4	-	NULL	ENSG00000196353		0.458	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	258	0.00	0	A	NM_130808		131300432	131300432	-1	no_errors	ENST00000502818	ensembl	human	known	69_37n	missense	99	29.37	42	SNP	1.000	T
CRYGC	1420	genome.wustl.edu	37	2	208993146	208993146	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr2:208993146C>A	ENST00000282141.3	-	3	343	c.306G>T	c.(304-306)atG>atT	p.M102I		NM_020989.3	NP_066269.1	P07315	CRGC_HUMAN	crystallin, gamma C	102	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			NS(1)|endometrium(1)|large_intestine(2)|lung(5)	9				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		TCAGCTCCATCATGAGGCCTT	0.572																																						dbGAP											0													52.0	48.0	49.0					2																	208993146		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2379.1	2q33.3	2013-02-14			ENSG00000163254	ENSG00000163254			2410	protein-coding gene	gene with protein product		123680		CRYG3			Standard	NM_020989		Approved		uc002vco.4	P07315	OTTHUMG00000132942	ENST00000282141.3:c.306G>T	2.37:g.208993146C>A	ENSP00000282141:p.Met102Ile		Q53R50	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.M102I	ENST00000282141.3	37	c.306	CCDS2379.1	2	.	.	.	.	.	.	.	.	.	.	C	15.82	2.944919	0.53079	.	.	ENSG00000163254	ENST00000282141	T	0.76316	-1.01	5.26	4.37	0.52481	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.039078	0.85682	D	0.000000	T	0.78799	0.4340	M	0.81497	2.545	0.39493	D	0.968084	B	0.09022	0.002	B	0.17098	0.017	T	0.78445	-0.2201	10	0.72032	D	0.01	.	13.2835	0.60230	0.16:0.84:0.0:0.0	.	102	P07315	CRGC_HUMAN	I	102	ENSP00000282141:M102I	ENSP00000282141:M102I	M	-	3	0	CRYGC	208701391	0.992000	0.36948	0.997000	0.53966	0.959000	0.62525	2.994000	0.49433	1.323000	0.45263	0.557000	0.71058	ATG	CRYGC	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	ENSG00000163254		0.572	CRYGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGC	HGNC	protein_coding	OTTHUMT00000256474.1	21	0.00	0	C	NM_020989		208993146	208993146	-1	no_errors	ENST00000282141	ensembl	human	known	69_37n	missense	0	100.00	18	SNP	0.992	A
CRYGC	1420	genome.wustl.edu	37	2	208993166	208993166	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr2:208993166C>A	ENST00000282141.3	-	3	323	c.286G>T	c.(286-288)Gaa>Taa	p.E96*		NM_020989.3	NP_066269.1	P07315	CRGC_HUMAN	crystallin, gamma C	96	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			NS(1)|endometrium(1)|large_intestine(2)|lung(5)	9				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		TTGTGGTCTTCCCTCTCGTAC	0.547																																						dbGAP											0													48.0	45.0	46.0					2																	208993166		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS2379.1	2q33.3	2013-02-14			ENSG00000163254	ENSG00000163254			2410	protein-coding gene	gene with protein product		123680		CRYG3			Standard	NM_020989		Approved		uc002vco.4	P07315	OTTHUMG00000132942	ENST00000282141.3:c.286G>T	2.37:g.208993166C>A	ENSP00000282141:p.Glu96*		Q53R50	Nonsense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.E96*	ENST00000282141.3	37	c.286	CCDS2379.1	2	.	.	.	.	.	.	.	.	.	.	C	17.38	3.376013	0.61735	.	.	ENSG00000163254	ENST00000282141	.	.	.	5.26	5.26	0.73747	.	0.374067	0.29579	N	0.011754	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	16.6992	0.85344	0.0:1.0:0.0:0.0	.	.	.	.	X	96	.	ENSP00000282141:E96X	E	-	1	0	CRYGC	208701411	0.001000	0.12720	0.454000	0.27019	0.371000	0.29859	1.730000	0.38125	2.606000	0.88127	0.557000	0.71058	GAA	CRYGC	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	ENSG00000163254		0.547	CRYGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGC	HGNC	protein_coding	OTTHUMT00000256474.1	20	0.00	0	C	NM_020989		208993166	208993166	-1	no_errors	ENST00000282141	ensembl	human	known	69_37n	nonsense	0	100.00	15	SNP	0.891	A
CSF3R	1441	genome.wustl.edu	37	1	36940986	36940986	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:36940986C>G	ENST00000373106.1	-	4	900	c.353G>C	c.(352-354)cGc>cCc	p.R118P	CSF3R_ENST00000373103.1_Missense_Mutation_p.R118P|CSF3R_ENST00000440588.2_Missense_Mutation_p.R118P|CSF3R_ENST00000418048.2_Missense_Mutation_p.R118P|CSF3R_ENST00000361632.4_Missense_Mutation_p.R118P|CSF3R_ENST00000331941.5_Missense_Mutation_p.R118P|CSF3R_ENST00000487540.2_5'Flank|CSF3R_ENST00000338937.5_Missense_Mutation_p.R118P|CSF3R_ENST00000373104.1_Missense_Mutation_p.R118P	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	118					cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	ACAGCCTGCGCGCAGCTCAAC	0.567																																						dbGAP											0													91.0	84.0	87.0					1																	36940986		2203	4300	6503	-	-	-	SO:0001583	missense	0			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.353G>C	1.37:g.36940986C>G	ENSP00000362198:p.Arg118Pro			Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R118P	ENST00000373106.1	37	c.353	CCDS413.1	1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111145	0.56398	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	D;D;D;D;D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22;-2.22	5.49	-3.17	0.05202	Immunoglobulin-like fold (1);	0.826208	0.11119	N	0.597588	D	0.86527	0.5954	L	0.38175	1.15	0.09310	N	1	D;D;P;D	0.65815	0.991;0.986;0.956;0.995	P;P;B;P	0.59948	0.588;0.651;0.355;0.866	T	0.79115	-0.1936	10	0.36615	T	0.2	-1.401	12.1252	0.53913	0.0:0.5471:0.0:0.4529	.	118;118;118;118	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	P	118	ENSP00000362198:R118P;ENSP00000362196:R118P;ENSP00000362195:R118P;ENSP00000355406:R118P;ENSP00000332180:R118P;ENSP00000401588:R118P;ENSP00000345013:R118P;ENSP00000397568:R118P	ENSP00000332180:R118P	R	-	2	0	CSF3R	36713573	0.005000	0.15991	0.059000	0.19551	0.882000	0.50991	-0.491000	0.06474	-0.509000	0.06532	-0.263000	0.10527	CGC	CSF3R	-	NULL	ENSG00000119535		0.567	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2	35	0.00	0	C	NM_156039		36940986	36940986	-1	no_errors	ENST00000373103	ensembl	human	known	69_37n	missense	28	47.17	25	SNP	0.041	G
CXorf58	254158	genome.wustl.edu	37	X	23956748	23956748	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chrX:23956748A>T	ENST00000379211.3	+	8	1419	c.870A>T	c.(868-870)caA>caT	p.Q290H		NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	290										breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						GATCCAAGCAAGCTCAAATGA	0.343																																						dbGAP											0													91.0	90.0	90.0					X																	23956748		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.870A>T	X.37:g.23956748A>T	ENSP00000368511:p.Gln290His			Missense_Mutation	SNP	NULL	p.Q290H	ENST00000379211.3	37	c.870	CCDS14209.1	X	.	.	.	.	.	.	.	.	.	.	A	11.62	1.692578	0.30052	.	.	ENSG00000165182	ENST00000379211	T	0.29917	1.55	4.76	2.28	0.28536	.	0.747131	0.12014	N	0.507585	T	0.47266	0.1436	M	0.64997	1.995	0.09310	N	1	D;D	0.89917	1.0;0.997	D;P	0.70935	0.971;0.875	T	0.24440	-1.0160	10	0.72032	D	0.01	-2.5619	6.3103	0.21161	0.7028:0.0:0.2972:0.0	.	290;290	B7ZLS7;Q96LI9	.;CX058_HUMAN	H	290	ENSP00000368511:Q290H	ENSP00000368511:Q290H	Q	+	3	2	CXorf58	23866669	0.999000	0.42202	0.017000	0.16124	0.260000	0.26232	0.987000	0.29603	0.247000	0.21414	0.425000	0.28330	CAA	CXorf58	-	NULL	ENSG00000165182		0.343	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf58	HGNC	protein_coding	OTTHUMT00000056071.1	180	0.00	0	A	NM_152761		23956748	23956748	+1	no_errors	ENST00000379211	ensembl	human	known	69_37n	missense	15	85.98	92	SNP	0.070	T
CYLC1	1538	genome.wustl.edu	37	X	83129529	83129529	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chrX:83129529G>C	ENST00000329312.4	+	4	1850	c.1813G>C	c.(1813-1815)Gaa>Caa	p.E605Q		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	605	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						TCCATCAAGAGAAAAACCACC	0.443																																						dbGAP											0													75.0	64.0	67.0					X																	83129529		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1813G>C	X.37:g.83129529G>C	ENSP00000331556:p.Glu605Gln		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	NULL	p.E605Q	ENST00000329312.4	37	c.1813	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	g	8.898	0.955578	0.18507	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.61158	0.13	3.61	2.71	0.32032	.	.	.	.	.	T	0.58380	0.2118	L	0.34521	1.04	0.22081	N	0.999371	P;P	0.44946	0.546;0.846	P;P	0.56788	0.524;0.806	T	0.44967	-0.9293	9	0.44086	T	0.13	-12.5152	7.9107	0.29789	0.0:0.2487:0.7513:0.0	.	605;605	P35663;F5H4V5	CYLC1_HUMAN;.	Q	605	ENSP00000331556:E605Q	ENSP00000331556:E605Q	E	+	1	0	CYLC1	83016185	1.000000	0.71417	0.998000	0.56505	0.434000	0.31775	1.431000	0.34925	0.858000	0.35431	0.600000	0.82982	GAA	CYLC1	-	NULL	ENSG00000183035		0.443	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	107	0.00	0	G	NM_021118		83129529	83129529	+1	no_errors	ENST00000329312	ensembl	human	known	69_37n	missense	27	41.30	19	SNP	0.998	C
DCC	1630	genome.wustl.edu	37	18	50918216	50918216	+	Missense_Mutation	SNP	G	G	A	rs187939463		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr18:50918216G>A	ENST00000442544.2	+	17	3263	c.2647G>A	c.(2647-2649)Gtc>Atc	p.V883I	DCC_ENST00000412726.1_Missense_Mutation_p.V711I|DCC_ENST00000581580.1_Missense_Mutation_p.V518I	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	883	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ACTTTACACCGTCCGGTGGAG	0.443													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18913	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													103.0	97.0	99.0					18																	50918216		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.2647G>A	18.37:g.50918216G>A	ENSP00000389140:p.Val883Ile			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V883I	ENST00000442544.2	37	c.2647	CCDS11952.1	18	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	14.36	2.512105	0.44660	.	.	ENSG00000187323	ENST00000442544;ENST00000412726	T;T	0.60672	0.17;0.17	5.42	5.42	0.78866	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.42131	0.1189	N	0.24115	0.695	0.53688	D	0.999973	B;B;B	0.27853	0.128;0.128;0.191	B;B;B	0.25987	0.065;0.065;0.048	T	0.32107	-0.9919	10	0.32370	T	0.25	.	11.499	0.50426	0.0836:0.0:0.9164:0.0	.	711;711;883	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	I	883;711	ENSP00000389140:V883I;ENSP00000397322:V711I	ENSP00000397322:V711I	V	+	1	0	DCC	49172214	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.882000	0.87258	2.531000	0.85337	0.557000	0.71058	GTC	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187323		0.443	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	85	0.00	0	G	NM_005215		50918216	50918216	+1	no_errors	ENST00000442544	ensembl	human	known	69_37n	missense	80	29.20	33	SNP	1.000	A
DDX56	54606	genome.wustl.edu	37	7	44606075	44606075	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:44606075T>C	ENST00000258772.5	-	13	1644	c.1538A>G	c.(1537-1539)aAg>aGg	p.K513R	DDX56_ENST00000485367.1_5'UTR|DDX56_ENST00000431640.1_Missense_Mutation_p.K473R	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	513					ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						GGAAGACAGCTTCTTCCGCTT	0.597																																						dbGAP											0													37.0	33.0	34.0					7																	44606075		2196	4290	6486	-	-	-	SO:0001583	missense	0			AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.1538A>G	7.37:g.44606075T>C	ENSP00000258772:p.Lys513Arg		A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.K513R	ENST00000258772.5	37	c.1538	CCDS5492.1	7	.	.	.	.	.	.	.	.	.	.	.	14.29	2.490262	0.44249	.	.	ENSG00000136271	ENST00000258772;ENST00000431640;ENST00000448192	T;T	0.03920	3.77;3.76	4.39	3.26	0.37387	.	0.179793	0.47852	D	0.000204	T	0.02230	0.0069	N	0.08118	0	0.37897	D	0.930928	B;B	0.14012	0.009;0.009	B;B	0.12156	0.007;0.007	T	0.48445	-0.9035	10	0.15952	T	0.53	-31.2366	6.0211	0.19630	0.0:0.1147:0.0:0.8853	.	473;513	C9JV95;Q9NY93	.;DDX56_HUMAN	R	513;473;118	ENSP00000258772:K513R;ENSP00000393488:K473R	ENSP00000258772:K513R	K	-	2	0	DDX56	44572600	0.922000	0.31269	0.994000	0.49952	0.958000	0.62258	1.272000	0.33109	1.981000	0.57761	0.402000	0.26972	AAG	DDX56	-	NULL	ENSG00000136271		0.597	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX56	HGNC	protein_coding	OTTHUMT00000251291.1	17	0.00	0	T	NM_019082		44606075	44606075	-1	no_errors	ENST00000258772	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.973	C
DLC1	10395	genome.wustl.edu	37	8	13357276	13357276	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr8:13357276G>T	ENST00000276297.4	-	2	714	c.305C>A	c.(304-306)gCc>gAc	p.A102D	DLC1_ENST00000316609.5_Missense_Mutation_p.A102D|DLC1_ENST00000511869.1_Missense_Mutation_p.A102D	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	102					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TTCTGTGCTGGCTTCCAGAGA	0.423																																						dbGAP											0													222.0	224.0	224.0					8																	13357276		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.305C>A	8.37:g.13357276G>T	ENSP00000276297:p.Ala102Asp		B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.A102D	ENST00000276297.4	37	c.305	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	G	23.7	4.453039	0.84209	.	.	ENSG00000164741	ENST00000276297;ENST00000316609;ENST00000511869	T;T;T	0.32272	1.46;1.46;1.46	5.55	5.55	0.83447	.	0.000000	0.44483	D	0.000460	T	0.54255	0.1847	L	0.55990	1.75	0.42130	D	0.991467	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.91635	0.995;0.999;0.905	T	0.53920	-0.8370	10	0.87932	D	0	.	19.8905	0.96928	0.0:0.0:1.0:0.0	.	102;102;102	E9PF76;Q96QB1-3;Q96QB1	.;.;RHG07_HUMAN	D	102	ENSP00000276297:A102D;ENSP00000321034:A102D;ENSP00000425878:A102D	ENSP00000276297:A102D	A	-	2	0	DLC1	13401647	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.294000	0.65687	2.789000	0.95967	0.655000	0.94253	GCC	DLC1	-	NULL	ENSG00000164741		0.423	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	89	0.00	0	G	NM_182643, NM_006094		13357276	13357276	-1	no_errors	ENST00000276297	ensembl	human	known	69_37n	missense	8	77.14	27	SNP	1.000	T
DLEC1	9940	genome.wustl.edu	37	3	38080927	38080927	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr3:38080927C>G	ENST00000308059.6	+	1	232	c.211C>G	c.(211-213)Ctg>Gtg	p.L71V	DLEC1_ENST00000346219.3_Missense_Mutation_p.L71V|DLEC1_ENST00000452631.2_Missense_Mutation_p.L71V					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		GCAGCTTGCGCTGGCGCAGCG	0.652																																						dbGAP											0													33.0	40.0	38.0					3																	38080927		1988	4174	6162	-	-	-	SO:0001583	missense	0			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.211C>G	3.37:g.38080927C>G	ENSP00000308597:p.Leu71Val			Missense_Mutation	SNP	superfamily_PapD-like	p.L71V	ENST00000308059.6	37	c.211	CCDS2672.2	3	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745178	0.49151	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.07444	3.24;3.19;3.47	5.47	3.66	0.41972	.	0.633514	0.13169	N	0.408479	T	0.12390	0.0301	L	0.50333	1.59	0.09310	N	1	P;P;P	0.44139	0.827;0.827;0.827	B;P;B	0.46543	0.442;0.52;0.442	T	0.10776	-1.0615	10	0.59425	D	0.04	-7.2976	8.5399	0.33386	0.0:0.8167:0.0:0.1833	.	71;71;71	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	V	71	ENSP00000308597:L71V;ENSP00000315914:L71V;ENSP00000410427:L71V	ENSP00000308597:L71V	L	+	1	2	DLEC1	38055931	0.001000	0.12720	0.004000	0.12327	0.201000	0.24016	0.839000	0.27586	1.302000	0.44855	0.514000	0.50259	CTG	DLEC1	-	NULL	ENSG00000008226		0.652	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DLEC1	HGNC	protein_coding	OTTHUMT00000253745.3	17	0.00	0	C	NM_007337		38080927	38080927	+1	no_errors	ENST00000346219	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	0.004	G
DMXL1	1657	genome.wustl.edu	37	5	118573104	118573104	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr5:118573104T>C	ENST00000311085.8	+	39	8571	c.8491T>C	c.(8491-8493)Tac>Cac	p.Y2831H	DMXL1_ENST00000539542.1_Missense_Mutation_p.Y2852H|DMXL1_ENST00000505312.1_3'UTR	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2831										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GCCTAAGCCATACCTGGTAAG	0.299																																						dbGAP											0													76.0	82.0	80.0					5																	118573104		2202	4297	6499	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8491T>C	5.37:g.118573104T>C	ENSP00000309690:p.Tyr2831His			Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y2852H	ENST00000311085.8	37	c.8554	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	T	21.7	4.183842	0.78677	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.01304	5.03;5.03	4.46	4.46	0.54185	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.07369	0.0186	M	0.69823	2.125	0.58432	D	0.999995	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.972	T	0.04017	-1.0984	10	0.72032	D	0.01	-7.3214	14.0143	0.64515	0.0:0.0:0.0:1.0	.	2852;2831	F5H269;Q9Y485	.;DMXL1_HUMAN	H	2831;2852	ENSP00000309690:Y2831H;ENSP00000439479:Y2852H	ENSP00000309690:Y2831H	Y	+	1	0	DMXL1	118601003	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.246000	0.78247	1.757000	0.51966	0.482000	0.46254	TAC	DMXL1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000172869		0.299	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	124	0.00	0	T	NM_005509		118573104	118573104	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	5	85.29	29	SNP	1.000	C
AGO4	192670	genome.wustl.edu	37	1	36298161	36298161	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:36298161G>A	ENST00000373210.3	+	11	1614	c.1369G>A	c.(1369-1371)Gat>Aat	p.D457N		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	457					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										ATGTAGGGAAGATTTACTAAA	0.393																																						dbGAP											0													118.0	121.0	120.0					1																	36298161		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.1369G>A	1.37:g.36298161G>A	ENSP00000362306:p.Asp457Asn		A7MD27	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.D457N	ENST00000373210.3	37	c.1369	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341094	0.41498	.	.	ENSG00000134698	ENST00000373210	T	0.05513	3.43	5.36	5.36	0.76844	.	0.369884	0.32244	N	0.006380	T	0.04182	0.0116	N	0.10685	0.025	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42965	-0.9420	10	0.08599	T	0.76	-3.9187	19.0955	0.93249	0.0:0.0:1.0:0.0	.	457	Q9HCK5	AGO4_HUMAN	N	457	ENSP00000362306:D457N	ENSP00000362306:D457N	D	+	1	0	EIF2C4	36070748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.511000	0.84671	0.655000	0.94253	GAT	EIF2C4	-	NULL	ENSG00000134698		0.393	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C4	HGNC	protein_coding	OTTHUMT00000012213.3	233	0.00	0	G	NM_017629		36298161	36298161	+1	no_errors	ENST00000373210	ensembl	human	known	69_37n	missense	81	40.58	56	SNP	1.000	A
DNAH14	127602	genome.wustl.edu	37	1	225140371	225140371	+	Intron	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:225140371G>A	ENST00000445597.2	+	4	523				DNAH14_ENST00000366848.1_5'Flank|DNAH14_ENST00000400952.3_Splice_Site|DNAH14_ENST00000439375.2_5'Flank|DNAH14_ENST00000430092.1_Splice_Site|DNAH14_ENST00000498360.1_Splice_Site|DNAH14_ENST00000366850.3_Splice_Site|DNAH14_ENST00000366849.1_Splice_Site			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TTTTGTTACAGCCAGTTCCTT	0.318																																						dbGAP											0													36.0	34.0	35.0					1																	225140371		1791	4059	5850	-	-	-	SO:0001627	intron_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.524-26G>A	1.37:g.225140371G>A			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Splice_Site	SNP	-	e1-1	ENST00000445597.2	37	c.1-1		1																																																																																			DNAH14	-	-	ENSG00000185842		0.318	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	242	0.00	0	G	XM_059166		225140371	225140371	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	splice_site	163	16.33	32	SNP	0.074	A
ELN	2006	genome.wustl.edu	37	7	73462496	73462496	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:73462496G>A	ENST00000252034.7	+	14	1109	c.710G>A	c.(709-711)gGt>gAt	p.G237D	ELN_ENST00000320492.7_Missense_Mutation_p.G201D|ELN_ENST00000358929.4_Missense_Mutation_p.G237D|ELN_ENST00000357036.5_Missense_Mutation_p.G242D|ELN_ENST00000380553.4_Missense_Mutation_p.G120D|ELN_ENST00000380575.4_Missense_Mutation_p.G227D|ELN_ENST00000380562.4_Missense_Mutation_p.G237D|ELN_ENST00000380576.5_Missense_Mutation_p.G237D|ELN_ENST00000320399.6_Missense_Mutation_p.G237D|ELN_ENST00000458204.1_Missense_Mutation_p.G227D|ELN_ENST00000414324.1_Missense_Mutation_p.G232D|ELN_ENST00000380584.4_Missense_Mutation_p.G223D|ELN_ENST00000429192.1_Missense_Mutation_p.G242D|ELN_ENST00000445912.1_Missense_Mutation_p.G237D	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	237	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GGAGTGGCTGGTGCAGCGGGC	0.617			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																															dbGAP		Dom	yes		7	7q11.23	2006	elastin	yes	L	0													55.0	64.0	61.0					7																	73462496		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.710G>A	7.37:g.73462496G>A	ENSP00000252034:p.Gly237Asp		B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	prints_Tropoelastin	p.G237D	ENST00000252034.7	37	c.710	CCDS5562.2	7	.	.	.	.	.	.	.	.	.	.	G	10.56	1.385483	0.25031	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000438906;ENST00000438880;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000417091;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000428787;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.64618	0.52;0.54;0.4;1.0;-0.11;0.67;0.55;0.55;0.49;0.99;0.54;0.52;0.49;1.01;0.55;0.52	4.96	4.08	0.47627	.	.	.	.	.	T	0.66694	0.2815	L	0.38175	1.15	0.33473	D	0.586499	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.61080	0.989;0.989;0.981;0.989;0.989;0.981;0.989;0.989;0.989;0.989;0.989;0.989;0.989;0.989	P;P;P;P;P;P;P;P;P;P;P;P;P;P	0.61132	0.789;0.884;0.789;0.789;0.789;0.789;0.838;0.838;0.789;0.789;0.884;0.884;0.884;0.789	T	0.75687	-0.3231	9	0.87932	D	0	-4.0168	11.5119	0.50498	0.0:0.1814:0.8186:0.0	.	237;206;201;232;227;237;227;242;242;237;120;193;223;237	E7ENM0;E9PBM4;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.;.	D	237;237;237;201;215;98;232;237;227;223;227;242;203;242;206;120;237;155;237	ENSP00000389857:G237D;ENSP00000252034:G237D;ENSP00000351807:G237D;ENSP00000315607:G201D;ENSP00000406949:G215D;ENSP00000389206:G98D;ENSP00000392575:G232D;ENSP00000369936:G237D;ENSP00000369949:G227D;ENSP00000369958:G223D;ENSP00000403162:G227D;ENSP00000349540:G242D;ENSP00000391129:G242D;ENSP00000369926:G120D;ENSP00000369950:G237D;ENSP00000313565:G237D	ENSP00000252034:G237D	G	+	2	0	ELN	73100432	1.000000	0.71417	0.850000	0.33497	0.109000	0.19521	3.621000	0.54210	1.090000	0.41315	-0.528000	0.04320	GGT	ELN	-	prints_Tropoelastin	ENSG00000049540		0.617	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	HGNC	protein_coding	OTTHUMT00000316913.1	34	0.00	0	G	NM_000501		73462496	73462496	+1	no_errors	ENST00000358929	ensembl	human	known	69_37n	missense	48	18.64	11	SNP	0.739	A
IFT80	57560	genome.wustl.edu	37	3	159997110	159997110	+	Missense_Mutation	SNP	A	A	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr3:159997110A>C	ENST00000326448.7	-	16	2139	c.1707T>G	c.(1705-1707)aaT>aaG	p.N569K	IFT80_ENST00000483465.1_Missense_Mutation_p.N432K|IFT80_ENST00000496589.1_Missense_Mutation_p.N432K|RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.N740K	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	569					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TAGTTACTTGATTTCCAACAA	0.333																																						dbGAP											0													80.0	83.0	82.0					3																	159997110		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.1707T>G	3.37:g.159997110A>C	ENSP00000312778:p.Asn569Lys		B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N740K	ENST00000326448.7	37	c.2220	CCDS3188.1	3	.	.	.	.	.	.	.	.	.	.	A	17.41	3.382020	0.61845	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589	T;T;T	0.70399	0.14;-0.48;-0.48	6.16	2.52	0.30459	.	0.179103	0.34088	U	0.004269	T	0.67335	0.2882	M	0.75264	2.295	0.48236	D	0.99961	B	0.32573	0.376	B	0.32864	0.154	T	0.62263	-0.6891	10	0.42905	T	0.14	-13.2936	10.0621	0.42282	0.6129:0.0:0.3871:0.0	.	569	Q9P2H3	IFT80_HUMAN	K	569;432;432	ENSP00000312778:N569K;ENSP00000418196:N432K;ENSP00000420646:N432K	ENSP00000312778:N569K	N	-	3	2	IFT80	161479804	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.284000	0.43478	0.207000	0.20607	-0.297000	0.09499	AAT	RP11-432B6.3	-	NULL	ENSG00000248710		0.333	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248710	Clone_based_vega_gene	protein_coding	OTTHUMT00000352651.2	164	0.00	0	A	NM_020800		159997110	159997110	-1	no_errors	ENST00000483754	ensembl	human	known	69_37n	missense	214	10.08	24	SNP	1.000	C
EPB41L3	23136	genome.wustl.edu	37	18	5445173	5445173	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr18:5445173A>G	ENST00000341928.2	-	4	792	c.452T>C	c.(451-453)tTt>tCt	p.F151S	EPB41L3_ENST00000400111.3_Missense_Mutation_p.F151S|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000342933.3_Missense_Mutation_p.F151S|EPB41L3_ENST00000544123.1_Missense_Mutation_p.F151S|EPB41L3_ENST00000540638.2_Missense_Mutation_p.F151S	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	151	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CGTAAGCCCAAAGTAGTCTTT	0.408																																						dbGAP											0													204.0	161.0	175.0					18																	5445173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.452T>C	18.37:g.5445173A>G	ENSP00000343158:p.Phe151Ser		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.F151S	ENST00000341928.2	37	c.452	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	A	30	5.051708	0.93793	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111;ENST00000542652	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.82	5.82	0.92795	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.96109	0.8732	H	0.98068	4.14	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;1.0;0.999;1.0	D	0.97604	1.0125	10	0.87932	D	0	.	15.1603	0.72778	1.0:0.0:0.0:0.0	.	151;151;42;151;151	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	S	151;42;151;42;151;151;232	ENSP00000343158:F151S;ENSP00000441174:F151S;ENSP00000341138:F151S;ENSP00000382981:F151S	ENSP00000343158:F151S	F	-	2	0	EPB41L3	5435173	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.872000	0.92352	2.222000	0.72286	0.383000	0.25322	TTT	EPB41L3	-	pirsf_Band_41_protein,pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	ENSG00000082397		0.408	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	236	0.42	1	A	NM_012307		5445173	5445173	-1	no_errors	ENST00000341928	ensembl	human	known	69_37n	missense	223	16.61	45	SNP	1.000	G
ERVW-1	30816	genome.wustl.edu	37	7	92099631	92099631	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:92099631G>C	ENST00000493463.2	-	1	988	c.65C>G	c.(64-66)cCc>cGc	p.P22R	ERVW-1_ENST00000604270.1_Intron|ERVW-1_ENST00000603053.1_Missense_Mutation_p.P22R|AC007566.10_ENST00000427458.1_RNA	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1	22					anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						gcatggagggggtgcagtgag	0.458																																						dbGAP											0													46.0	54.0	51.0					7																	92099631		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.65C>G	7.37:g.92099631G>C	ENSP00000419945:p.Pro22Arg		B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	Missense_Mutation	SNP	pfam_TLV/ENV_coat_polyprotein	p.P22R	ENST00000493463.2	37	c.65	CCDS5626.1	7	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256794	0.39896	.	.	ENSG00000242950	ENST00000493463	T	0.22743	1.94	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.10852	0.0265	N	0.08118	0	0.09310	N	0.999998	.	.	.	.	.	.	T	0.30765	-0.9967	6	0.72032	D	0.01	.	.	.	.	.	.	.	.	R	22	ENSP00000419945:P22R	ENSP00000419945:P22R	P	-	2	0	ERVW-1	91937567	0.763000	0.28462	0.482000	0.27366	0.486000	0.33341	0.170000	0.16663	0.132000	0.18615	0.134000	0.15878	CCC	ERVW-1	-	NULL	ENSG00000242950		0.458	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	HGNC	protein_coding	OTTHUMT00000254009.2	63	0.00	0	G	NM_014590		92099631	92099631	-1	no_errors	ENST00000493463	ensembl	human	known	69_37n	missense	123	23.46	38	SNP	0.513	C
EPHB4	2050	genome.wustl.edu	37	7	100417260	100417260	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:100417260C>T	ENST00000358173.3	-	6	1684	c.1216G>A	c.(1216-1218)Gtc>Atc	p.V406I	EPHB4_ENST00000360620.3_Missense_Mutation_p.V406I|EPHB4_ENST00000477446.1_5'UTR|RN7SL750P_ENST00000582814.1_RNA	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	406	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					AATGCAGTGACCTCAAAGGTA	0.622																																					GBM(200;2113 3072 25865 52728)	dbGAP											0													84.0	77.0	79.0					7																	100417260		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1216G>A	7.37:g.100417260C>T	ENSP00000350896:p.Val406Ile		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.V406I	ENST00000358173.3	37	c.1216	CCDS5706.1	7	.	.	.	.	.	.	.	.	.	.	C	5.274	0.235940	0.10023	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.70749	-0.51;-0.51	5.46	5.46	0.80206	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.46442	D	0.000290	T	0.56499	0.1989	L	0.31207	0.915	0.43724	D	0.996207	P;B;P	0.43857	0.767;0.37;0.819	B;B;B	0.39771	0.279;0.114;0.309	T	0.58470	-0.7631	10	0.05620	T	0.96	.	16.7802	0.85561	0.0:1.0:0.0:0.0	.	406;406;406	B5A970;Q96L35;P54760	.;.;EPHB4_HUMAN	I	406	ENSP00000353833:V406I;ENSP00000350896:V406I	ENSP00000350896:V406I	V	-	1	0	EPHB4	100255196	1.000000	0.71417	0.978000	0.43139	0.637000	0.38172	1.060000	0.30530	2.563000	0.86464	0.655000	0.94253	GTC	EPHB4	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196411		0.622	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB4	HGNC	protein_coding	OTTHUMT00000347222.1	17	0.00	0	C	NM_004444		100417260	100417260	-1	no_errors	ENST00000358173	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.951	T
ESF1	51575	genome.wustl.edu	37	20	13698067	13698067	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr20:13698067T>G	ENST00000202816.1	-	13	2317	c.2210A>C	c.(2209-2211)aAg>aCg	p.K737T		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	737	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						CTTTTTCTTCTTTTTGCTCAG	0.398																																						dbGAP											0													226.0	197.0	207.0					20																	13698067		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.2210A>C	20.37:g.13698067T>G	ENSP00000202816:p.Lys737Thr		Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	pfam_NUC153	p.K737T	ENST00000202816.1	37	c.2210	CCDS13117.1	20	.	.	.	.	.	.	.	.	.	.	T	17.75	3.466299	0.63625	.	.	ENSG00000089048	ENST00000202816	T	0.31247	1.5	5.87	5.87	0.94306	.	0.124806	0.53938	D	0.000058	T	0.34454	0.0898	M	0.70595	2.14	0.39030	D	0.959927	P	0.42692	0.787	B	0.40199	0.322	T	0.39522	-0.9610	10	0.66056	D	0.02	-11.4968	10.5917	0.45314	0.0:0.0723:0.0:0.9277	.	737	Q9H501	ESF1_HUMAN	T	737	ENSP00000202816:K737T	ENSP00000202816:K737T	K	-	2	0	ESF1	13646067	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.778000	0.47726	2.371000	0.80710	0.533000	0.62120	AAG	ESF1	-	NULL	ENSG00000089048		0.398	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESF1	HGNC	protein_coding	OTTHUMT00000078049.1	594	0.00	0	T	NM_016649		13698067	13698067	-1	no_errors	ENST00000202816	ensembl	human	known	69_37n	missense	222	36.83	130	SNP	1.000	G
EXT2	2132	genome.wustl.edu	37	11	44228488	44228488	+	Missense_Mutation	SNP	C	C	A	rs75987184	byFrequency	TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr11:44228488C>A	ENST00000343631.3	+	10	1770	c.1641C>A	c.(1639-1641)gaC>gaA	p.D547E	EXT2_ENST00000358681.4_Missense_Mutation_p.D557E|EXT2_ENST00000533608.1_Missense_Mutation_p.D547E|EXT2_ENST00000395673.3_Missense_Mutation_p.D580E			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	547					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						TGACCTCTGACGAGCTGCAAT	0.363			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																													dbGAP	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	0													154.0	151.0	152.0					11																	44228488		2203	4299	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.1641C>A	11.37:g.44228488C>A	ENSP00000342656:p.Asp547Glu		B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.D580E	ENST00000343631.3	37	c.1740	CCDS7908.1	11	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470507	0.26423	.	.	ENSG00000151348	ENST00000533608;ENST00000358681;ENST00000395673;ENST00000343631	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.91	-11.8	0.00035	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.84813	0.5555	M	0.64997	1.995	0.42909	D	0.994258	B;D;D;D;D	0.89917	0.038;1.0;1.0;1.0;1.0	B;D;D;D;D	0.97110	0.03;0.998;1.0;0.999;0.999	D	0.95043	0.8180	10	0.51188	T	0.08	-10.5562	21.2521	0.99949	0.0:0.7054:0.073:0.2216	.	547;557;557;547;560	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	E	547;557;580;547	ENSP00000431173:D547E;ENSP00000351509:D557E;ENSP00000379032:D580E;ENSP00000342656:D547E	ENSP00000342656:D547E	D	+	3	2	EXT2	44185064	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	-2.004000	0.01461	-3.608000	0.00133	-3.828000	0.00019	GAC	EXT2	-	pfam_HexNAc_Trfase_a	ENSG00000151348		0.363	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXT2	HGNC	protein_coding	OTTHUMT00000390074.1	226	0.00	0	C	NM_000401		44228488	44228488	+1	no_errors	ENST00000395673	ensembl	human	known	69_37n	missense	205	19.29	49	SNP	0.008	A
F5	2153	genome.wustl.edu	37	1	169511128	169511128	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:169511128G>A	ENST00000367797.3	-	13	3401	c.3200C>T	c.(3199-3201)tCg>tTg	p.S1067L	F5_ENST00000367796.3_Missense_Mutation_p.S1072L	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1067	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AAGCACCAACGAATGCTTAAG	0.438																																						dbGAP											0													218.0	203.0	208.0					1																	169511128		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3200C>T	1.37:g.169511128G>A	ENSP00000356771:p.Ser1067Leu		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S1072L	ENST00000367797.3	37	c.3215	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.545008	0.65198	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.22743	1.94;1.94	5.24	5.24	0.73138	.	5.251100	0.00357	N	0.000030	T	0.29556	0.0737	M	0.66939	2.045	0.25763	N	0.984922	D	0.67145	0.996	P	0.54664	0.758	T	0.05037	-1.0910	9	0.38643	T	0.18	-1.2083	14.3965	0.67015	0.0:0.0:1.0:0.0	.	1067	P12259	FA5_HUMAN	L	1067;1072	ENSP00000356771:S1067L;ENSP00000356770:S1072L	ENSP00000356770:S1072L	S	-	2	0	F5	167777752	0.741000	0.28217	0.021000	0.16686	0.006000	0.05464	3.424000	0.52764	2.449000	0.82847	0.573000	0.79308	TCG	F5	-	NULL	ENSG00000198734		0.438	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	239	0.00	0	G	NM_000130		169511128	169511128	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	152	39.76	101	SNP	0.091	A
FAM124A	220108	genome.wustl.edu	37	13	51826195	51826195	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr13:51826195C>T	ENST00000322475.8	+	3	827	c.692C>T	c.(691-693)cCg>cTg	p.P231L	FAM124A_ENST00000280057.6_Missense_Mutation_p.P267L	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	231										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		GACCAGTGCCCGGTGCCCACC	0.602																																						dbGAP											0													55.0	55.0	55.0					13																	51826195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.692C>T	13.37:g.51826195C>T	ENSP00000324625:p.Pro231Leu		A2A324|Q8N8P9|Q8NE66|Q96NJ9	Missense_Mutation	SNP	NULL	p.P267L	ENST00000322475.8	37	c.800	CCDS55900.1	13	.	.	.	.	.	.	.	.	.	.	C	16.48	3.135321	0.56828	.	.	ENSG00000150510	ENST00000322475;ENST00000280057	T;T	0.50813	0.73;0.73	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.69691	0.3139	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.65796	-0.6081	10	0.33940	T	0.23	-24.1868	19.0145	0.92888	0.0:1.0:0.0:0.0	.	231;267;231	Q86V42;Q86V42-2;Q86V42-3	F124A_HUMAN;.;.	L	231;267	ENSP00000324625:P231L;ENSP00000280057:P267L	ENSP00000280057:P267L	P	+	2	0	FAM124A	50724196	1.000000	0.71417	0.331000	0.25455	0.156000	0.22039	7.487000	0.81328	2.735000	0.93741	0.655000	0.94253	CCG	FAM124A	-	NULL	ENSG00000150510		0.602	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM124A	HGNC	protein_coding	OTTHUMT00000045019.3	11	0.00	0	C	NM_145019		51826195	51826195	+1	no_errors	ENST00000280057	ensembl	human	known	69_37n	missense	4	75.00	12	SNP	0.998	T
FAM166A	401565	genome.wustl.edu	37	9	140142119	140142119	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr9:140142119C>T	ENST00000344774.4	-	1	103	c.49G>A	c.(49-51)Gtc>Atc	p.V17I	FAM166A_ENST00000388932.2_Missense_Mutation_p.V17I	NM_001001710.1	NP_001001710.1	Q6J272	F166A_HUMAN	family with sequence similarity 166, member A	17						nucleus (GO:0005634)				kidney(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(2)	15						CACCCAGGGACATAGTGAGGC	0.632																																						dbGAP											0													158.0	142.0	147.0					9																	140142119		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC132916	CCDS35186.1	9q34.3	2008-08-08			ENSG00000188163	ENSG00000188163			33818	protein-coding gene	gene with protein product							Standard	XR_245332		Approved		uc004cmi.1	Q6J272	OTTHUMG00000159545	ENST00000344774.4:c.49G>A	9.37:g.140142119C>T	ENSP00000344729:p.Val17Ile		A6NND9|Q8N830	Missense_Mutation	SNP	pfam_UPF0573/UPF0605	p.V17I	ENST00000344774.4	37	c.49	CCDS35186.1	9	.	.	.	.	.	.	.	.	.	.	C	0.041	-1.283798	0.01398	.	.	ENSG00000188163	ENST00000344774;ENST00000388932;ENST00000484720	T;T;T	0.37752	1.18;1.18;1.18	4.43	2.08	0.27032	.	0.074273	0.52532	N	0.000080	T	0.08670	0.0215	N	0.00869	-1.13	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32481	-0.9905	10	0.02654	T	1	-19.6749	6.5679	0.22523	0.0:0.1999:0.0:0.8001	.	17	Q6J272	F166A_HUMAN	I	17	ENSP00000344729:V17I;ENSP00000373584:V17I;ENSP00000420741:V17I	ENSP00000344729:V17I	V	-	1	0	FAM166A	139261940	0.199000	0.23386	0.967000	0.41034	0.367000	0.29736	0.235000	0.17948	0.258000	0.21686	-0.340000	0.08031	GTC	FAM166A	-	pfam_UPF0573/UPF0605	ENSG00000188163		0.632	FAM166A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM166A	HGNC	protein_coding	OTTHUMT00000356125.1	153	0.00	0	C	NM_001001710		140142119	140142119	-1	no_errors	ENST00000344774	ensembl	human	known	69_37n	missense	36	79.78	142	SNP	0.989	T
FAM98A	25940	genome.wustl.edu	37	2	33810192	33810192	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr2:33810192C>G	ENST00000238823.8	-	8	1348	c.1208G>C	c.(1207-1209)gGt>gCt	p.G403A	FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000403368.1_3'UTR|FAM98A_ENST00000441530.2_Missense_Mutation_p.G208A			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	404	Gly-rich.						poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TGGCTGGAAACCTGAATCTCG	0.537																																						dbGAP											0													215.0	194.0	201.0					2																	33810192		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.1208G>C	2.37:g.33810192C>G	ENSP00000238823:p.Gly403Ala		B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	pfam_Uncharacterised_FAM98	p.G403A	ENST00000238823.8	37	c.1208	CCDS33179.1	2	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662896	0.47572	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000441530	T;D	0.97870	0.63;-4.58	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.93009	0.7775	N	0.08118	0	0.49915	D	0.999832	P;P;P;P	0.39424	0.673;0.673;0.666;0.673	B;B;B;B	0.34180	0.137;0.137;0.177;0.137	D	0.92651	0.6133	10	0.31617	T	0.26	-6.8676	19.5324	0.95234	0.0:1.0:0.0:0.0	.	404;234;403;241	Q8NCA5;B4DY25;Q8NCA5-2;B3KTW4	FA98A_HUMAN;.;.;.	A	403;404;208	ENSP00000238823:G403A;ENSP00000408716:G208A	ENSP00000238823:G403A	G	-	2	0	FAM98A	33663696	1.000000	0.71417	0.976000	0.42696	0.884000	0.51177	5.599000	0.67592	2.617000	0.88574	0.491000	0.48974	GGT	FAM98A	-	NULL	ENSG00000119812		0.537	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM98A	HGNC	protein_coding	OTTHUMT00000325457.2	265	0.00	0	C	NM_015475		33810192	33810192	-1	no_errors	ENST00000238823	ensembl	human	known	69_37n	missense	274	31.34	126	SNP	1.000	G
FANCG	2189	genome.wustl.edu	37	9	35078182	35078182	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr9:35078182G>C	ENST00000378643.3	-	4	957	c.466C>G	c.(466-468)Ctt>Gtt	p.L156V	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	156					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGGTCCCCAAGACGGTCAGCA	0.597			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	0													75.0	79.0	77.0					9																	35078182		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.466C>G	9.37:g.35078182G>C	ENSP00000367910:p.Leu156Val			Missense_Mutation	SNP	superfamily_Sig_transdc_His_kin_Hpt_dom,smart_TPR_repeat	p.L156V	ENST00000378643.3	37	c.466	CCDS6574.1	9	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393609	0.62066	.	.	ENSG00000221829	ENST00000378643;ENST00000543657;ENST00000448890	T;D	0.83591	-0.22;-1.74	5.51	5.51	0.81932	.	.	.	.	.	D	0.88804	0.6536	M	0.73598	2.24	0.20307	N	0.999912	D	0.61080	0.989	P	0.55391	0.775	T	0.82750	-0.0303	9	0.54805	T	0.06	-0.3678	16.1355	0.81481	0.0:0.0:1.0:0.0	.	156	O15287	FANCG_HUMAN	V	156	ENSP00000367910:L156V;ENSP00000409607:L156V	ENSP00000367910:L156V	L	-	1	0	FANCG	35068182	0.004000	0.15560	0.863000	0.33907	0.608000	0.37181	0.920000	0.28705	2.605000	0.88082	0.655000	0.94253	CTT	FANCG	-	superfamily_Sig_transdc_His_kin_Hpt_dom	ENSG00000221829		0.597	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCG	HGNC	protein_coding	OTTHUMT00000052269.1	21	0.00	0	G	NM_004629		35078182	35078182	-1	no_errors	ENST00000378643	ensembl	human	known	69_37n	missense	41	19.23	10	SNP	0.151	C
FCGBP	8857	genome.wustl.edu	37	19	40383993	40383993	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:40383993T>A	ENST00000221347.6	-	21	9624	c.9617A>T	c.(9616-9618)aAc>aTc	p.N3206I		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3206	TIL 7.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCGCAGCCGTTGTTGAGGGG	0.657																																						dbGAP											0													2.0	2.0	2.0					19																	40383993		1042	2482	3524	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.9617A>T	19.37:g.40383993T>A	ENSP00000221347:p.Asn3206Ile		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.N3206I	ENST00000221347.6	37	c.9617	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	T	8.622	0.891655	0.17613	.	.	ENSG00000090920	ENST00000221347	T	0.18657	2.2	3.44	-0.441	0.12257	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (1);	.	.	.	.	T	0.25306	0.0615	L	0.28556	0.865	0.09310	N	1	D	0.76494	0.999	D	0.72982	0.979	T	0.15435	-1.0437	9	0.44086	T	0.13	.	3.0453	0.06152	0.1484:0.4615:0.2747:0.1154	.	3206	Q9Y6R7	FCGBP_HUMAN	I	3206	ENSP00000221347:N3206I	ENSP00000221347:N3206I	N	-	2	0	FCGBP	45075833	0.000000	0.05858	0.055000	0.19348	0.051000	0.14879	-1.271000	0.02828	0.547000	0.28938	-0.548000	0.04221	AAC	FCGBP	-	superfamily_TIL_dom	ENSG00000090920		0.657	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	26	0.00	0	T	NM_003890		40383993	40383993	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	47	16.95	10	SNP	0.000	A
FCN1	2219	genome.wustl.edu	37	9	137808243	137808243	+	Silent	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr9:137808243C>A	ENST00000371806.3	-	2	259	c.168G>T	c.(166-168)ctG>ctT	p.L56L		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	56	Collagen-like.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)			endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		GGGCCCCGGGCAGCCCCGGGC	0.672																																						dbGAP											0													97.0	119.0	111.0					9																	137808243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.168G>T	9.37:g.137808243C>A			Q5VYV5|Q92596	Silent	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Collagen,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.L56	ENST00000371806.3	37	c.168	CCDS6985.1	9																																																																																			FCN1	-	pfam_Collagen	ENSG00000085265		0.672	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCN1	HGNC	protein_coding	OTTHUMT00000054963.1	36	0.00	0	C	NM_002003		137808243	137808243	-1	no_errors	ENST00000371806	ensembl	human	known	69_37n	silent	24	48.94	23	SNP	0.992	A
FKBPL	63943	genome.wustl.edu	37	6	32097227	32097227	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:32097227G>C	ENST00000375156.3	-	2	601	c.331C>G	c.(331-333)Cgt>Ggt	p.R111G	ATF6B_ENST00000468502.1_5'Flank|ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	111					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										CCATGGCCACGGATTACGATC	0.552																																						dbGAP											0													94.0	103.0	100.0					6																	32097227		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.331C>G	6.37:g.32097227G>C	ENSP00000364298:p.Arg111Gly		A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R111G	ENST00000375156.3	37	c.331	CCDS4738.1	6	.	.	.	.	.	.	.	.	.	.	G	10.57	1.387264	0.25031	.	.	ENSG00000204315	ENST00000375156	T	0.80909	-1.43	5.23	3.4	0.38934	.	0.877322	0.09667	N	0.771736	T	0.51483	0.1677	N	0.19112	0.55	0.09310	N	1	B	0.15473	0.013	B	0.17433	0.018	T	0.50136	-0.8863	10	0.42905	T	0.14	0.4441	11.2398	0.48962	0.0:0.0:0.5165:0.4835	.	111	Q9UIM3	FKBPL_HUMAN	G	111	ENSP00000364298:R111G	ENSP00000364298:R111G	R	-	1	0	FKBPL	32205205	0.001000	0.12720	0.012000	0.15200	0.821000	0.46438	0.437000	0.21543	0.740000	0.32651	0.462000	0.41574	CGT	FKBPL	-	NULL	ENSG00000204315		0.552	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBPL	HGNC	protein_coding	OTTHUMT00000076221.2	71	0.00	0	G			32097227	32097227	-1	no_errors	ENST00000375156	ensembl	human	known	69_37n	missense	78	41.35	55	SNP	0.002	C
MROH5	389690	genome.wustl.edu	37	8	142489405	142489405	+	RNA	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr8:142489405G>A	ENST00000430863.1	-	0	1077					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GTGGCCGCCAGCCCCAAGGTC	0.662																																						dbGAP											0													12.0	17.0	15.0					8																	142489405		1942	4109	6051	-	-	-			0					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142489405G>A				Silent	SNP	NULL	p.L333	ENST00000430863.1	37	c.997		8																																																																																			AC100803.1	-	NULL	ENSG00000226807		0.662	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	Clone_based_vega_gene	polymorphic_pseudogene	OTTHUMT00000342412.4	14	0.00	0	G	NM_207414		142489405	142489405	-1	pseudogene	ENST00000430863	ensembl	human	known	69_37n	silent	1	92.31	12	SNP	0.280	A
FRS3	10817	genome.wustl.edu	37	6	41738737	41738737	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:41738737C>T	ENST00000373018.3	-	7	1350	c.1099G>A	c.(1099-1101)Gag>Aag	p.E367K	FRS3_ENST00000259748.2_Missense_Mutation_p.E367K	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	367					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AGTGGGGTCTCGTCCTCCTCA	0.672																																						dbGAP											0													46.0	47.0	46.0					6																	41738737		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.1099G>A	6.37:g.41738737C>T	ENSP00000362109:p.Glu367Lys		Q5T3D5	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.E367K	ENST00000373018.3	37	c.1099	CCDS4860.1	6	.	.	.	.	.	.	.	.	.	.	C	13.48	2.248600	0.39797	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	T;T	0.22539	1.95;1.95	5.76	4.84	0.62591	.	0.164709	0.56097	D	0.000038	T	0.06416	0.0165	L	0.40543	1.245	0.43819	D	0.996387	P	0.45569	0.861	B	0.32465	0.146	T	0.15492	-1.0435	10	0.28530	T	0.3	-29.9855	9.4662	0.38813	0.0:0.78:0.1448:0.0752	.	367	O43559	FRS3_HUMAN	K	367	ENSP00000362109:E367K;ENSP00000259748:E367K	ENSP00000259748:E367K	E	-	1	0	FRS3	41846715	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.286000	0.51724	2.728000	0.93425	0.655000	0.94253	GAG	FRS3	-	NULL	ENSG00000137218		0.672	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRS3	HGNC	protein_coding	OTTHUMT00000040532.2	10	0.00	0	C	NM_006653		41738737	41738737	-1	no_errors	ENST00000259748	ensembl	human	known	69_37n	missense	9	60.87	14	SNP	1.000	T
GCN1L1	10985	genome.wustl.edu	37	12	120565720	120565720	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr12:120565720C>T	ENST00000300648.6	-	58	7961	c.7949G>A	c.(7948-7950)aGg>aAg	p.R2650K		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2650					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTTCAGGGACCTTCGGTTAAC	0.582																																						dbGAP											0													64.0	68.0	67.0					12																	120565720		2001	4175	6176	-	-	-	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.7949G>A	12.37:g.120565720C>T	ENSP00000300648:p.Arg2650Lys		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.R2650K	ENST00000300648.6	37	c.7949	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882221	0.33255	.	.	ENSG00000089154	ENST00000300648	T	0.44083	0.93	5.52	5.52	0.82312	Armadillo-type fold (1);	0.056989	0.64402	D	0.000003	T	0.34861	0.0912	L	0.34521	1.04	0.58432	D	0.999999	B	0.15719	0.014	B	0.19666	0.026	T	0.16394	-1.0404	10	0.10377	T	0.69	-25.9756	19.7987	0.96497	0.0:1.0:0.0:0.0	.	2650	Q92616	GCN1L_HUMAN	K	2650	ENSP00000300648:R2650K	ENSP00000300648:R2650K	R	-	2	0	GCN1L1	119050103	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	7.046000	0.76592	2.767000	0.95098	0.655000	0.94253	AGG	GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.582	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	30	0.00	0	C			120565720	120565720	-1	no_errors	ENST00000300648	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	1.000	T
HEATR2	54919	genome.wustl.edu	37	7	825272	825272	+	Silent	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:825272C>T	ENST00000297440.6	+	13	2570	c.2550C>T	c.(2548-2550)gcC>gcT	p.A850A	HEATR2_ENST00000313147.5_Intron|HEATR2_ENST00000403952.3_Silent_p.A275A	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	850						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		ATGTGCAGGCCGTGCCAGCCA	0.612																																						dbGAP											0													53.0	47.0	49.0					7																	825272		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.2550C>T	7.37:g.825272C>T			Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.R652C	ENST00000297440.6	37	c.1954	CCDS34580.1	7	.	.	.	.	.	.	.	.	.	.	C	1.243	-0.620722	0.03636	.	.	ENSG00000164818	ENST00000440747	.	.	.	4.11	0.919	0.19392	.	.	.	.	.	T	0.25680	0.0625	.	.	.	0.18873	N	0.999989	.	.	.	.	.	.	T	0.25222	-1.0138	4	.	.	.	-24.0576	5.6449	0.17584	0.0:0.4975:0.3891:0.1134	.	.	.	.	C	652	.	.	R	+	1	0	HEATR2	791798	0.042000	0.20092	0.107000	0.21349	0.853000	0.48598	-0.024000	0.12435	0.449000	0.26747	0.462000	0.41574	CGT	HEATR2	-	NULL	ENSG00000164818		0.612	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR2	HGNC	protein_coding	OTTHUMT00000322542.1	24	0.00	0	C	NM_017802		825272	825272	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000440747	ensembl	human	novel	69_37n	missense	41	22.22	12	SNP	0.079	T
HECW1	23072	genome.wustl.edu	37	7	43601517	43601517	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:43601517C>A	ENST00000395891.2	+	30	5418	c.4813C>A	c.(4813-4815)Ctt>Att	p.L1605I	HECW1_ENST00000453890.1_Missense_Mutation_p.L1571I	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1605	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CACCTTTGGACTTGAGTGAGG	0.488																																						dbGAP											0													100.0	98.0	99.0					7																	43601517		2038	4193	6231	-	-	-	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4813C>A	7.37:g.43601517C>A	ENSP00000379228:p.Leu1605Ile		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.L1605I	ENST00000395891.2	37	c.4813	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276663	0.80580	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.64991	-0.13;-0.13	5.93	5.93	0.95920	HECT (3);	0.000000	0.85682	D	0.000000	T	0.69593	0.3128	N	0.21373	0.66	0.80722	D	1	D;P	0.76494	0.999;0.699	D;P	0.87578	0.998;0.759	T	0.65417	-0.6173	10	0.28530	T	0.3	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	1571;1605	B4DH42;Q76N89	.;HECW1_HUMAN	I	1605;1571;1605	ENSP00000379228:L1605I;ENSP00000407774:L1571I	ENSP00000265522:L1605I	L	+	1	0	HECW1	43568042	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.802000	0.85969	2.814000	0.96858	0.591000	0.81541	CTT	HECW1	-	pfam_HECT,smart_HECT,pfscan_HECT	ENSG00000002746		0.488	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	93	0.00	0	C	NM_015052		43601517	43601517	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	missense	149	23.20	45	SNP	1.000	A
GIMAP2	26157	genome.wustl.edu	37	7	150389497	150389497	+	Silent	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:150389497C>T	ENST00000223293.5	+	3	217	c.123C>T	c.(121-123)agC>agT	p.S41S		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	41	AIG1-type G.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGGGAACAGCATCCTCAGGA	0.502																																						dbGAP											0													77.0	68.0	71.0					7																	150389497		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.123C>T	7.37:g.150389497C>T			Q96L25	Silent	SNP	pfam_AIG1	p.S41	ENST00000223293.5	37	c.123	CCDS5905.1	7																																																																																			GIMAP2	-	pfam_AIG1	ENSG00000106560		0.502	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP2	HGNC	protein_coding	OTTHUMT00000348948.1	37	0.00	0	C	NM_015660		150389497	150389497	+1	no_errors	ENST00000223293	ensembl	human	known	69_37n	silent	14	65.85	27	SNP	1.000	T
HELZ	9931	genome.wustl.edu	37	17	65082989	65082989	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:65082989G>T	ENST00000358691.5	-	32	5616	c.5450C>A	c.(5449-5451)cCg>cAg	p.P1817Q	HELZ_ENST00000580168.1_Missense_Mutation_p.P1818Q	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1817						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TCCATTGCACGGAATGTTCTG	0.473																																						dbGAP											0													146.0	150.0	149.0					17																	65082989		2023	4192	6215	-	-	-	SO:0001583	missense	0			D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.5450C>A	17.37:g.65082989G>T	ENSP00000351524:p.Pro1817Gln		I6L9H4	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.P1817Q	ENST00000358691.5	37	c.5450	CCDS42374.1	17	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005029	0.54254	.	.	ENSG00000198265	ENST00000358691	D	0.93426	-3.22	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.93641	0.7969	L	0.32530	0.975	0.80722	D	1	D;D	0.55385	0.971;0.971	P;P	0.54460	0.753;0.753	D	0.94022	0.7293	10	0.87932	D	0	-13.8795	20.2885	0.98538	0.0:0.0:1.0:0.0	.	1818;1817	B7ZLW2;P42694	.;HELZ_HUMAN	Q	1817	ENSP00000351524:P1817Q	ENSP00000351524:P1817Q	P	-	2	0	HELZ	62513451	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.102000	0.94226	2.791000	0.96007	0.650000	0.86243	CCG	HELZ	-	NULL	ENSG00000198265		0.473	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HELZ	HGNC	protein_coding	OTTHUMT00000447068.1	150	0.00	0	G	NM_014877		65082989	65082989	-1	no_errors	ENST00000358691	ensembl	human	known	69_37n	missense	122	32.22	58	SNP	1.000	T
HIPK1	204851	genome.wustl.edu	37	1	114483129	114483129	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:114483129T>G	ENST00000369558.1	+	2	356	c.124T>G	c.(124-126)Tat>Gat	p.Y42D	HIPK1_ENST00000369561.4_Missense_Mutation_p.Y42D|HIPK1_ENST00000426820.2_Missense_Mutation_p.Y42D|HIPK1_ENST00000369555.2_Missense_Mutation_p.Y42D|HIPK1_ENST00000369559.4_Missense_Mutation_p.Y42D|HIPK1_ENST00000369554.2_Missense_Mutation_p.Y42D			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	42					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAACGACAAATATTATACCCA	0.522																																						dbGAP											0													213.0	228.0	223.0					1																	114483129		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.124T>G	1.37:g.114483129T>G	ENSP00000358571:p.Tyr42Asp		A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y42D	ENST00000369558.1	37	c.124	CCDS867.1	1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.778050	0.49786	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000514621;ENST00000503968	T;T;T;T;T;T;T;T;T	0.51325	0.76;0.77;0.8;0.8;0.8;0.8;0.8;0.74;0.71	5.02	5.02	0.67125	.	0.000000	0.64402	D	0.000013	T	0.46889	0.1416	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.80764	0.979;0.994	T	0.45411	-0.9263	10	0.36615	T	0.2	.	14.7674	0.69648	0.0:0.0:0.0:1.0	.	42;42	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	D	113;42;42;42;42;42;42;42;42	ENSP00000407442:Y113D;ENSP00000358572:Y42D;ENSP00000409673:Y42D;ENSP00000358567:Y42D;ENSP00000358568:Y42D;ENSP00000358571:Y42D;ENSP00000358574:Y42D;ENSP00000422322:Y42D;ENSP00000426695:Y42D	ENSP00000358567:Y42D	Y	+	1	0	HIPK1	114284652	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.830000	0.55768	1.881000	0.54492	0.528000	0.53228	TAT	HIPK1	-	NULL	ENSG00000163349		0.522	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	HGNC	protein_coding	OTTHUMT00000033127.1	116	0.00	0	T	NM_198268		114483129	114483129	+1	no_errors	ENST00000369558	ensembl	human	known	69_37n	missense	17	86.92	113	SNP	1.000	G
HMGXB3	22993	genome.wustl.edu	37	5	149425158	149425158	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr5:149425158G>C	ENST00000502717.1	+	16	3324	c.2860G>C	c.(2860-2862)Gtt>Ctt	p.V954L	HMGXB3_ENST00000503427.1_Missense_Mutation_p.V922L	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	1200					phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						TGATGCGTCTGTTATTGCCCC	0.512																																						dbGAP											0													132.0	106.0	114.0					5																	149425158		692	1591	2283	-	-	-	SO:0001583	missense	0			D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.2860G>C	5.37:g.149425158G>C	ENSP00000421917:p.Val954Leu		G5E9Y4|Q86UG3|Q9UMF4	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.V954L	ENST00000502717.1	37	c.2860	CCDS54935.1	5	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481432	0.63849	.	.	ENSG00000113716	ENST00000503427;ENST00000502717	.	.	.	5.76	5.76	0.90799	.	0.051924	0.64402	D	0.000001	T	0.41442	0.1159	L	0.51422	1.61	0.43211	D	0.995079	P	0.36733	0.567	B	0.29267	0.1	T	0.47971	-0.9075	9	0.87932	D	0	-14.0137	7.549	0.27783	0.1954:0.0:0.8046:0.0	.	1200	Q12766	HMGX3_HUMAN	L	922;954	.	ENSP00000421917:V954L	V	+	1	0	HMGXB3	149405351	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	7.224000	0.78042	2.728000	0.93425	0.655000	0.94253	GTT	HMGXB3	-	NULL	ENSG00000113716		0.512	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGXB3	HGNC	protein_coding	OTTHUMT00000373771.1	116	0.00	0	G	XM_001717202		149425158	149425158	+1	no_errors	ENST00000502717	ensembl	human	known	69_37n	missense	15	89.61	138	SNP	1.000	C
HSPA12A	259217	genome.wustl.edu	37	10	118434446	118434446	+	Missense_Mutation	SNP	C	C	T	rs555217651		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr10:118434446C>T	ENST00000369209.3	-	12	1978	c.1874G>A	c.(1873-1875)cGc>cAc	p.R625H	RP11-498B4.5_ENST00000433600.1_RNA	NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	625						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		GAGATCCAGGCGGAGCGTGCC	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17238	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	84.0	83.0					10																	118434446		2032	4193	6225	-	-	-	SO:0001583	missense	0			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1874G>A	10.37:g.118434446C>T	ENSP00000358211:p.Arg625His			Missense_Mutation	SNP	NULL	p.R625H	ENST00000369209.3	37	c.1874	CCDS41569.1	10	.	.	.	.	.	.	.	.	.	.	C	10.26	1.299989	0.23650	.	.	ENSG00000165868	ENST00000369209	T	0.44083	0.93	5.78	5.78	0.91487	.	0.050467	0.64402	D	0.000001	T	0.33990	0.0882	N	0.24115	0.695	0.48901	D	0.999721	B	0.23442	0.085	B	0.16722	0.016	T	0.04961	-1.0915	10	0.37606	T	0.19	.	20.0124	0.97464	0.0:1.0:0.0:0.0	.	625	O43301	HS12A_HUMAN	H	625	ENSP00000358211:R625H	ENSP00000358211:R625H	R	-	2	0	HSPA12A	118424436	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	5.743000	0.68655	2.749000	0.94314	0.655000	0.94253	CGC	HSPA12A	-	NULL	ENSG00000165868		0.587	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12A	HGNC	protein_coding	OTTHUMT00000050530.1	11	0.00	0	C	NM_025015		118434446	118434446	-1	no_errors	ENST00000369209	ensembl	human	known	69_37n	missense	5	84.38	27	SNP	1.000	T
HTR5A	3361	genome.wustl.edu	37	7	154863184	154863184	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:154863184G>T	ENST00000287907.2	+	1	1151	c.575G>T	c.(574-576)tGc>tTc	p.C192F	HTR5A-AS1_ENST00000543018.1_5'UTR|HTR5A-AS1_ENST00000395731.2_5'UTR|HTR5A-AS1_ENST00000493904.1_5'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	192					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	AGCGAGGAGTGCCAGGTAAGC	0.602																																						dbGAP											0													84.0	67.0	73.0					7																	154863184		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.575G>T	7.37:g.154863184G>T	ENSP00000287907:p.Cys192Phe		Q2M2D2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT5A_rcpt,prints_5HT_rcpt	p.C192F	ENST00000287907.2	37	c.575	CCDS5936.1	7	.	.	.	.	.	.	.	.	.	.	G	18.10	3.549644	0.65311	.	.	ENSG00000157219	ENST00000287907	T	0.62639	0.01	4.77	4.77	0.60923	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.77685	0.4167	H	0.95645	3.7	0.80722	D	1	B	0.27625	0.183	B	0.35312	0.2	T	0.81911	-0.0716	10	0.72032	D	0.01	.	18.0029	0.89202	0.0:0.0:1.0:0.0	.	192	P47898	5HT5A_HUMAN	F	192	ENSP00000287907:C192F	ENSP00000287907:C192F	C	+	2	0	HTR5A	154494117	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.211000	0.95120	2.489000	0.83994	0.655000	0.94253	TGC	HTR5A	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000157219		0.602	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	HGNC	protein_coding	OTTHUMT00000322240.1	26	0.00	0	G	NM_024012		154863184	154863184	+1	no_errors	ENST00000287907	ensembl	human	known	69_37n	missense	26	62.32	43	SNP	1.000	T
KIF24	347240	genome.wustl.edu	37	9	34269280	34269280	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr9:34269280G>T	ENST00000402558.2	-	7	1442	c.1418C>A	c.(1417-1419)gCa>gAa	p.A473E	KIF24_ENST00000379166.2_Missense_Mutation_p.A473E|KIF24_ENST00000379174.3_Missense_Mutation_p.A339E|KIF24_ENST00000345050.2_Missense_Mutation_p.A339E			Q5T7B8	KIF24_HUMAN	kinesin family member 24	473	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			ATTTATTTCTGCACCTTCCAT	0.408																																						dbGAP											0													147.0	144.0	145.0					9																	34269280		1865	4108	5973	-	-	-	SO:0001583	missense	0			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.1418C>A	9.37:g.34269280G>T	ENSP00000384433:p.Ala473Glu		Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_SAM_type1,superfamily_SAM/pointed,smart_Kinesin_motor_dom,pfscan_SAM,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A473E	ENST00000402558.2	37	c.1418	CCDS6551.2	9	.	.	.	.	.	.	.	.	.	.	G	33	5.232909	0.95207	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94	5.42	5.42	0.78866	Kinesin, motor domain (4);	0.155531	0.30510	N	0.009471	D	0.92064	0.7485	H	0.98542	4.26	0.51482	D	0.99992	D;D	0.71674	0.998;0.998	D;D	0.74348	0.971;0.983	D	0.94783	0.7955	10	0.87932	D	0	.	19.2382	0.93871	0.0:0.0:1.0:0.0	.	473;473	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	E	473;339;473;339;473	ENSP00000384433:A473E;ENSP00000368472:A339E;ENSP00000368464:A473E;ENSP00000340179:A339E	ENSP00000340179:A339E	A	-	2	0	KIF24	34259280	1.000000	0.71417	0.959000	0.39883	0.994000	0.84299	6.301000	0.72782	2.722000	0.93159	0.650000	0.86243	GCA	KIF24	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000186638		0.408	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF24	HGNC	protein_coding	OTTHUMT00000052150.5	224	0.00	0	G			34269280	34269280	-1	no_errors	ENST00000379166	ensembl	human	known	69_37n	missense	135	21.51	37	SNP	1.000	T
KRT2	3849	genome.wustl.edu	37	12	53042093	53042093	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr12:53042093G>A	ENST00000309680.3	-	5	1007	c.986C>T	c.(985-987)aCt>aTt	p.T329I		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	329	Linker 12.|Rod.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		GTTGGTGTCAGTGACACTCTG	0.547																																						dbGAP											0													233.0	193.0	207.0					12																	53042093		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.986C>T	12.37:g.53042093G>A	ENSP00000310861:p.Thr329Ile		Q4VAQ2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.T329I	ENST00000309680.3	37	c.986	CCDS8835.1	12	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632763	0.47049	.	.	ENSG00000172867	ENST00000309680	T	0.75704	-0.96	4.33	3.43	0.39272	Filament (1);	.	.	.	.	T	0.67002	0.2847	L	0.41824	1.3	0.29684	N	0.841463	P	0.42123	0.771	B	0.41135	0.348	T	0.65869	-0.6063	9	0.87932	D	0	.	10.3056	0.43678	0.0:0.3461:0.5241:0.1298	.	329	P35908	K22E_HUMAN	I	329	ENSP00000310861:T329I	ENSP00000310861:T329I	T	-	2	0	KRT2	51328360	0.004000	0.15560	0.789000	0.31954	0.583000	0.36354	0.049000	0.14099	1.187000	0.43000	0.563000	0.77884	ACT	KRT2	-	pfam_F,superfamily_Prefoldin	ENSG00000172867		0.547	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT2	HGNC	protein_coding	OTTHUMT00000405704.1	91	0.00	0	G	NM_000423		53042093	53042093	-1	no_errors	ENST00000309680	ensembl	human	known	69_37n	missense	60	42.31	44	SNP	0.867	A
LEPR	3953	genome.wustl.edu	37	1	66036458	66036458	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:66036458G>A	ENST00000349533.6	+	4	528	c.343G>A	c.(343-345)Gta>Ata	p.V115I	LEPR_ENST00000371059.3_Missense_Mutation_p.V115I|LEPR_ENST00000344610.8_Missense_Mutation_p.V115I|LEPR_ENST00000371058.1_Missense_Mutation_p.V115I|LEPR_ENST00000406510.3_5'UTR|LEPR_ENST00000371060.3_Missense_Mutation_p.V115I|LEPR_ENST00000462765.1_3'UTR|snoU13_ENST00000459362.1_RNA	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TGTTTCAACAGTAAATTCTTT	0.313																																						dbGAP											0													52.0	54.0	53.0					1																	66036458		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.343G>A	1.37:g.66036458G>A	ENSP00000330393:p.Val115Ile		Q6FHL5	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V115I	ENST00000349533.6	37	c.343	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	G	4.714	0.132691	0.09032	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.56611	0.48;0.48;0.48;0.45;0.48	5.69	2.54	0.30619	.	1.111250	0.06547	N	0.744238	T	0.25975	0.0633	L	0.58669	1.825	0.18873	N	0.999988	B;B;B;B	0.21452	0.003;0.005;0.002;0.056	B;B;B;B	0.20767	0.006;0.004;0.014;0.031	T	0.29027	-1.0025	10	0.23891	T	0.37	-0.7171	7.6838	0.28528	0.2863:0.0:0.7137:0.0	.	115;115;115;115	P48357-4;P48357;P48357-2;P48357-3	.;LEPR_HUMAN;.;.	I	115	ENSP00000340884:V115I;ENSP00000330393:V115I;ENSP00000360099:V115I;ENSP00000360098:V115I;ENSP00000360097:V115I	ENSP00000340884:V115I	V	+	1	0	LEPR	65809046	0.000000	0.05858	0.008000	0.14137	0.131000	0.20780	0.590000	0.23954	0.250000	0.21479	0.557000	0.71058	GTA	LEPR	-	NULL	ENSG00000116678		0.313	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	132	0.00	0	G	NM_002303		66036458	66036458	+1	no_errors	ENST00000349533	ensembl	human	known	69_37n	missense	71	14.46	12	SNP	0.058	A
LMAN2	10960	genome.wustl.edu	37	5	176778492	176778492	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr5:176778492G>A	ENST00000303127.7	-	1	361	c.157C>T	c.(157-159)Cat>Tat	p.H53Y	LMAN2_ENST00000506310.1_5'UTR|LMAN2_ENST00000515209.1_Missense_Mutation_p.H53Y	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	53	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCTTGAGATGTTCACTGTTG	0.577																																						dbGAP											0													85.0	75.0	78.0					5																	176778492		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.157C>T	5.37:g.176778492G>A	ENSP00000303366:p.His53Tyr		Q53HH1	Missense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl	p.H53Y	ENST00000303127.7	37	c.157	CCDS4417.1	5	.	.	.	.	.	.	.	.	.	.	G	5.597	0.294984	0.10622	.	.	ENSG00000169223	ENST00000303127;ENST00000515209;ENST00000514458;ENST00000502560	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.14	5.14	0.70334	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.049904	0.85682	D	0.000000	T	0.29458	0.0734	N	0.01789	-0.72	0.51482	D	0.99992	B;B	0.12013	0.005;0.005	B;B	0.06405	0.002;0.002	T	0.36163	-0.9759	10	0.02654	T	1	-12.7685	11.0725	0.48012	0.0854:0.0:0.9146:0.0	.	53;53	Q12907;D6RBV2	LMAN2_HUMAN;.	Y	53	ENSP00000303366:H53Y;ENSP00000423998:H53Y;ENSP00000424132:H53Y;ENSP00000425229:H53Y	ENSP00000303366:H53Y	H	-	1	0	LMAN2	176711098	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.933000	0.70130	2.685000	0.91497	0.644000	0.83932	CAT	LMAN2	-	pfam_Lectin_leg,superfamily_ConA-like_lec_gl	ENSG00000169223		0.577	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMAN2	HGNC	protein_coding	OTTHUMT00000253434.1	37	0.00	0	G	NM_006816		176778492	176778492	-1	no_errors	ENST00000303127	ensembl	human	known	69_37n	missense	34	50.00	34	SNP	1.000	A
LRIT2	340745	genome.wustl.edu	37	10	85984799	85984799	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr10:85984799C>T	ENST00000372113.4	-	2	187	c.182G>A	c.(181-183)aGa>aAa	p.R61K	LRIT2_ENST00000538192.1_Missense_Mutation_p.R61K	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	61						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						ATTTTCAATTCTCACTTGCTT	0.428																																						dbGAP											0													74.0	82.0	79.0					10																	85984799		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.182G>A	10.37:g.85984799C>T	ENSP00000361185:p.Arg61Lys		B7ZME6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R61K	ENST00000372113.4	37	c.182	CCDS31234.1	10	.	.	.	.	.	.	.	.	.	.	C	17.20	3.327829	0.60743	.	.	ENSG00000204033	ENST00000372113;ENST00000538192	T;T	0.51817	0.69;0.69	5.9	3.09	0.35607	.	0.000000	0.85682	D	0.000000	T	0.50051	0.1593	M	0.64170	1.965	0.48830	D	0.999717	B;B	0.29162	0.235;0.235	B;B	0.39068	0.289;0.19	T	0.50276	-0.8847	10	0.72032	D	0.01	.	10.355	0.43958	0.0:0.7868:0.0:0.2132	.	61;61	B7ZME6;A6NDA9	.;LRIT2_HUMAN	K	61	ENSP00000361185:R61K;ENSP00000438264:R61K	ENSP00000361185:R61K	R	-	2	0	LRIT2	85974779	1.000000	0.71417	0.221000	0.23827	0.979000	0.70002	3.871000	0.56077	0.413000	0.25759	0.650000	0.86243	AGA	LRIT2	-	NULL	ENSG00000204033		0.428	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT2	HGNC	protein_coding	OTTHUMT00000049110.4	67	0.00	0	C	XM_291697		85984799	85984799	-1	no_errors	ENST00000538192	ensembl	human	known	69_37n	missense	4	84.62	22	SNP	1.000	T
LRRC27	80313	genome.wustl.edu	37	10	134151186	134151186	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr10:134151186A>G	ENST00000368614.3	+	3	433	c.328A>G	c.(328-330)Att>Gtt	p.I110V	LRRC27_ENST00000392638.2_Missense_Mutation_p.I110V|LRRC27_ENST00000432555.2_5'UTR|LRRC27_ENST00000368612.1_Missense_Mutation_p.I48V|LRRC27_ENST00000356571.4_Missense_Mutation_p.I110V|LRRC27_ENST00000368610.3_Missense_Mutation_p.I48V|LRRC27_ENST00000344079.5_Missense_Mutation_p.I110V|LRRC27_ENST00000368615.3_Missense_Mutation_p.I110V|LRRC27_ENST00000368613.4_Missense_Mutation_p.I110V	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27	110										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		TCCTTCTGGGATTGGAGCTCA	0.433																																						dbGAP											0													77.0	75.0	76.0					10																	134151186		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.328A>G	10.37:g.134151186A>G	ENSP00000357603:p.Ile110Val		A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.I110V	ENST00000368614.3	37	c.328	CCDS31316.1	10	.	.	.	.	.	.	.	.	.	.	A	9.122	1.009254	0.19277	.	.	ENSG00000148814	ENST00000368615;ENST00000392638;ENST00000344079;ENST00000356571;ENST00000368614;ENST00000368613;ENST00000368612;ENST00000368610	T;T;T;T;T;T;T;T	0.66099	0.46;0.46;0.46;-0.19;0.46;0.46;0.56;0.56	4.84	2.46	0.29980	.	0.000000	0.43747	D	0.000531	T	0.66655	0.2811	L	0.45744	1.44	0.80722	D	1	D;D;D;D	0.71674	0.998;0.976;0.992;0.996	D;D;D;D	0.79108	0.958;0.931;0.992;0.99	T	0.62737	-0.6791	10	0.48119	T	0.1	-15.3681	4.6218	0.12455	0.7402:0.0:0.0925:0.1673	.	110;48;110;110	Q9C0I9-4;Q9C0I9-2;Q9C0I9;Q9C0I9-3	.;.;LRC27_HUMAN;.	V	110;110;110;110;110;110;48;48	ENSP00000357604:I110V;ENSP00000376413:I110V;ENSP00000342641:I110V;ENSP00000348978:I110V;ENSP00000357603:I110V;ENSP00000357602:I110V;ENSP00000357601:I48V;ENSP00000357599:I48V	ENSP00000342641:I110V	I	+	1	0	LRRC27	134001176	1.000000	0.71417	0.699000	0.30290	0.007000	0.05969	1.861000	0.39438	0.295000	0.22570	-0.258000	0.10820	ATT	LRRC27	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000148814		0.433	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC27	HGNC	protein_coding	OTTHUMT00000051058.2	93	0.00	0	A	XM_290462		134151186	134151186	+1	no_errors	ENST00000368613	ensembl	human	known	69_37n	missense	35	52.70	39	SNP	0.950	G
LRRC37A	9884	genome.wustl.edu	37	17	44415042	44415042	+	Splice_Site	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:44415042G>T	ENST00000320254.5	+	14	5059	c.5056G>T	c.(5056-5058)Gac>Tac	p.D1686Y	ARL17B_ENST00000434041.2_Intron|ARL17B_ENST00000571246.1_Intron|ARL17B_ENST00000575960.1_Intron|LRRC37A_ENST00000393465.3_Splice_Site_p.D1621Y|ARL17B_ENST00000575698.1_Intron|ARL17B_ENST00000570618.1_Intron|LRRC37A_ENST00000496930.1_Splice_Site_p.D724Y	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	1686						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TTATCCCAGGGACAGCGAAGC	0.493																																						dbGAP											0													2.0	3.0	3.0					17																	44415042		693	873	1566	-	-	-	SO:0001630	splice_region_variant	0			BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.5055-1G>T	17.37:g.44415042G>T			Q68DY2|Q8IWC7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.D1686Y	ENST00000320254.5	37	c.5056	CCDS11504.2	17	.	.	.	.	.	.	.	.	.	.	g	10.98	1.504724	0.26949	.	.	ENSG00000176681	ENST00000496930;ENST00000393466;ENST00000393465;ENST00000320254	T;T;T	0.61392	1.46;0.11;0.26	2.26	1.28	0.21552	.	.	.	.	.	T	0.46347	0.1388	L	0.29908	0.895	0.09310	N	0.999999	D;D	0.67145	0.996;0.996	P;P	0.47941	0.562;0.562	T	0.34900	-0.9810	9	0.72032	D	0.01	.	4.7832	0.13213	0.1837:0.0:0.8163:0.0	.	806;1686	Q5YKG5;A6NMS7	.;L37A1_HUMAN	Y	724;1686;1621;1686	ENSP00000437021:D724Y;ENSP00000377108:D1621Y;ENSP00000326324:D1686Y	ENSP00000326324:D1686Y	D	+	1	0	LRRC37A	41770800	0.797000	0.28877	0.100000	0.21137	0.083000	0.17756	0.491000	0.22419	0.515000	0.28320	0.184000	0.17185	GAC	LRRC37A	-	NULL	ENSG00000176681		0.493	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC37A	HGNC	protein_coding	OTTHUMT00000313519.3	65	0.00	0	G	NM_014834	Missense_Mutation	44415042	44415042	+1	no_errors	ENST00000320254	ensembl	human	known	69_37n	missense	78	21.78	22	SNP	0.122	T
LRRC7	57554	genome.wustl.edu	37	1	70460297	70460297	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:70460297C>A	ENST00000035383.5	+	9	901	c.871C>A	c.(871-873)Cta>Ata	p.L291I	LRRC7_ENST00000415775.2_5'UTR|LRRC7_ENST00000310961.5_Missense_Mutation_p.L296I	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	291						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						ACTTACAATGCTACCCAATAC	0.328																																						dbGAP											0													106.0	110.0	109.0					1																	70460297		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.871C>A	1.37:g.70460297C>A	ENSP00000035383:p.Leu291Ile		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.L291I	ENST00000035383.5	37	c.871	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173439	0.38413	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.26067	1.89;1.76	5.4	-0.126	0.13515	.	0.000000	0.64402	D	0.000003	T	0.21103	0.0508	L	0.35249	1.045	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.02610	-1.1134	10	0.42905	T	0.14	.	9.6188	0.39708	0.0:0.4401:0.0:0.5599	.	291	Q96NW7	LRRC7_HUMAN	I	296;291;114	ENSP00000309245:L296I;ENSP00000035383:L291I	ENSP00000035383:L291I	L	+	1	2	LRRC7	70232885	0.800000	0.28916	0.434000	0.26772	0.401000	0.30781	1.364000	0.34171	0.084000	0.17077	0.655000	0.94253	CTA	LRRC7	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000033122		0.328	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	202	0.00	0	C	NM_020794		70460297	70460297	+1	no_errors	ENST00000035383	ensembl	human	known	69_37n	missense	111	23.45	34	SNP	0.152	A
LRRK1	79705	genome.wustl.edu	37	15	101567954	101567954	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr15:101567954G>T	ENST00000388948.3	+	19	2997	c.2638G>T	c.(2638-2640)Gag>Tag	p.E880*	LRRK1_ENST00000284395.5_Nonsense_Mutation_p.E877*	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCAGCTGGTGGAGCAGACGCC	0.652																																						dbGAP											0													25.0	37.0	33.0					15																	101567954		2172	4270	6442	-	-	-	SO:0001587	stop_gained	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.2638G>T	15.37:g.101567954G>T	ENSP00000373600:p.Glu880*			Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.E880*	ENST00000388948.3	37	c.2638	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	G	44	11.199614	0.99530	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	.	.	.	4.46	4.46	0.54185	.	0.115210	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	17.5082	0.87753	0.0:0.0:1.0:0.0	.	.	.	.	X	880;877	.	ENSP00000284395:E877X	E	+	1	0	LRRK1	99385477	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.346000	0.79347	2.195000	0.70347	0.563000	0.77884	GAG	LRRK1	-	NULL	ENSG00000154237		0.652	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	15	0.00	0	G	NM_024652		101567954	101567954	+1	no_errors	ENST00000388948	ensembl	human	known	69_37n	nonsense	64	16.67	13	SNP	1.000	T
LRRTM1	347730	genome.wustl.edu	37	2	80529665	80529665	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr2:80529665T>A	ENST00000295057.3	-	2	1936	c.1280A>T	c.(1279-1281)aAg>aTg	p.K427M	CTNNA2_ENST00000541047.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.K427M|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000496558.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	427					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CGTGACCACCTTGTGGATCTG	0.657										HNSCC(69;0.2)																												dbGAP											0													77.0	68.0	71.0					2																	80529665		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1280A>T	2.37:g.80529665T>A	ENSP00000295057:p.Lys427Met		A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.K427M	ENST00000295057.3	37	c.1280	CCDS1966.1	2	.	.	.	.	.	.	.	.	.	.	T	18.27	3.586024	0.66105	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.49139	0.79;0.79	5.32	5.32	0.75619	.	0.000000	0.85682	U	0.000000	T	0.61375	0.2342	L	0.58810	1.83	0.80722	D	1	D	0.69078	0.997	P	0.61132	0.884	T	0.61417	-0.7067	9	.	.	.	.	15.2769	0.73748	0.0:0.0:0.0:1.0	.	427	Q86UE6	LRRT1_HUMAN	M	427	ENSP00000295057:K427M;ENSP00000386646:K427M	.	K	-	2	0	LRRTM1	80383176	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	6.273000	0.72581	1.985000	0.57927	0.533000	0.62120	AAG	LRRTM1	-	NULL	ENSG00000162951		0.657	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM1	HGNC	protein_coding	OTTHUMT00000313614.1	19	0.00	0	T	NM_178839		80529665	80529665	-1	no_errors	ENST00000295057	ensembl	human	known	69_37n	missense	30	32.61	15	SNP	1.000	A
LSM14B	149986	genome.wustl.edu	37	20	60705737	60705737	+	Silent	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr20:60705737G>T	ENST00000279068.6	+	6	985	c.825G>T	c.(823-825)ctG>ctT	p.L275L	LSM14B_ENST00000253001.4_Silent_p.L275L	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	275	DFDF. {ECO:0000255|PROSITE- ProRule:PRU00845}.				multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			AGAAGAAACTGAATTTTAAAG	0.418																																						dbGAP											0													62.0	61.0	61.0					20																	60705737		1820	4076	5896	-	-	-	SO:0001819	synonymous_variant	0			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.825G>T	20.37:g.60705737G>T			Q6PFW8|Q96LH8	Silent	SNP	pfam_FDF_dom,superfamily_LSM_dom	p.L275	ENST00000279068.6	37	c.825	CCDS46626.1	20																																																																																			LSM14B	-	NULL	ENSG00000149657		0.418	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM14B	HGNC	protein_coding	OTTHUMT00000079996.4	118	0.00	0	G	NM_144703		60705737	60705737	+1	no_errors	ENST00000253001	ensembl	human	known	69_37n	silent	81	24.30	26	SNP	1.000	T
MAN1A1	4121	genome.wustl.edu	37	6	119501033	119501033	+	Missense_Mutation	SNP	A	A	G	rs199809553		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:119501033A>G	ENST00000368468.3	-	13	2354	c.1913T>C	c.(1912-1914)cTc>cCc	p.L638P		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	638					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.L638P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		GAGGATAGGGAGAAGATGTGC	0.358																																					Ovarian(136;8 1825 12608 33541 47587)	dbGAP											1	Substitution - Missense(1)	large_intestine(1)											95.0	95.0	95.0					6																	119501033		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1913T>C	6.37:g.119501033A>G	ENSP00000357453:p.Leu638Pro		E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.L638P	ENST00000368468.3	37	c.1913	CCDS5122.1	6	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	A	21.3	4.122755	0.77436	.	.	ENSG00000111885	ENST00000368468	T	0.81078	-1.45	5.76	5.76	0.90799	.	0.133094	0.52532	D	0.000067	D	0.93154	0.7820	H	0.98466	4.24	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	D	0.95728	0.8772	10	0.87932	D	0	-19.6038	16.071	0.80936	1.0:0.0:0.0:0.0	.	638	P33908	MA1A1_HUMAN	P	638	ENSP00000357453:L638P	ENSP00000357453:L638P	L	-	2	0	MAN1A1	119542732	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.923000	0.92808	2.199000	0.70637	0.528000	0.53228	CTC	MAN1A1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47	ENSG00000111885		0.358	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1A1	HGNC	protein_coding	OTTHUMT00000042015.1	216	0.00	0	A	NM_005907		119501033	119501033	-1	no_errors	ENST00000368468	ensembl	human	known	69_37n	missense	166	21.70	46	SNP	1.000	G
MAP2K2	5605	genome.wustl.edu	37	19	4117473	4117473	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:4117473C>T	ENST00000262948.5	-	2	500	c.247G>A	c.(247-249)Ggc>Agc	p.G83S	MAP2K2_ENST00000599345.1_5'UTR|MAP2K2_ENST00000394867.4_5'UTR	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	83	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	ACCACCCCGCCGTTGCCCGCG	0.627																																						dbGAP											0													57.0	54.0	55.0					19																	4117473		2203	4300	6503	-	-	-	SO:0001583	missense	0			L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.247G>A	19.37:g.4117473C>T	ENSP00000262948:p.Gly83Ser			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G83S	ENST00000262948.5	37	c.247	CCDS12120.1	19	.	.	.	.	.	.	.	.	.	.	c	33	5.239525	0.95240	.	.	ENSG00000126934	ENST00000262948	D	0.93426	-3.22	4.67	4.67	0.58626	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92041	0.7478	N	0.04805	-0.155	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.94489	0.7700	10	0.87932	D	0	-30.747	16.1587	0.81683	0.0:1.0:0.0:0.0	.	83	P36507	MP2K2_HUMAN	S	83	ENSP00000262948:G83S	ENSP00000262948:G83S	G	-	1	0	MAP2K2	4068473	1.000000	0.71417	0.992000	0.48379	0.840000	0.47671	7.507000	0.81676	2.139000	0.66308	0.555000	0.69702	GGC	MAP2K2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000126934		0.627	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K2	HGNC	protein_coding	OTTHUMT00000258957.2	48	0.00	0	C			4117473	4117473	-1	no_errors	ENST00000262948	ensembl	human	known	69_37n	missense	37	45.71	32	SNP	1.000	T
MCOLN1	57192	genome.wustl.edu	37	19	7589918	7589918	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:7589918C>A	ENST00000264079.6	+	2	228	c.103C>A	c.(103-105)Ccc>Acc	p.P35T		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	35					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCCTCCGACACCCCCAGAAGA	0.622																																						dbGAP											0													25.0	27.0	27.0					19																	7589918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.103C>A	19.37:g.7589918C>A	ENSP00000264079:p.Pro35Thr		D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Missense_Mutation	SNP	pfam_PKD1_2_channel,superfamily_Glycoside_hydrolase_SF	p.P35T	ENST00000264079.6	37	c.103	CCDS12180.1	19	.	.	.	.	.	.	.	.	.	.	C	11.70	1.715677	0.30413	.	.	ENSG00000090674	ENST00000264079	D	0.83163	-1.69	4.64	1.31	0.21738	.	0.789832	0.11926	N	0.516180	T	0.68329	0.2989	L	0.27053	0.805	0.19775	N	0.999959	B;B	0.10296	0.003;0.003	B;B	0.06405	0.002;0.002	T	0.49762	-0.8905	10	0.15066	T	0.55	.	6.9232	0.24399	0.0:0.6969:0.0:0.3031	.	35;35	Q53HA8;Q9GZU1	.;MCLN1_HUMAN	T	35	ENSP00000264079:P35T	ENSP00000264079:P35T	P	+	1	0	MCOLN1	7495918	0.972000	0.33761	0.004000	0.12327	0.385000	0.30292	0.000000	0.12993	0.259000	0.21709	0.655000	0.94253	CCC	MCOLN1	-	NULL	ENSG00000090674		0.622	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN1	HGNC	protein_coding	OTTHUMT00000458974.2	15	0.00	0	C	NM_020533		7589918	7589918	+1	no_errors	ENST00000264079	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	0.015	A
MED13	9969	genome.wustl.edu	37	17	60087928	60087928	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:60087928A>T	ENST00000397786.2	-	9	2026	c.1950T>A	c.(1948-1950)agT>agA	p.S650R		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	650					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CTGATGTTACACTTTCCTGTC	0.338																																						dbGAP											0													66.0	59.0	61.0					17																	60087928		1846	4085	5931	-	-	-	SO:0001583	missense	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.1950T>A	17.37:g.60087928A>T	ENSP00000380888:p.Ser650Arg		B2RU05|O60334	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.S650R	ENST00000397786.2	37	c.1950	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	A	9.842	1.191287	0.21954	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.74947	-0.89	5.62	5.62	0.85841	.	0.467384	0.24564	N	0.037448	T	0.66626	0.2808	L	0.42245	1.32	0.33779	D	0.624089	B;B	0.25441	0.126;0.09	B;B	0.25291	0.059;0.024	T	0.71971	-0.4431	10	0.37606	T	0.19	-2.2454	11.7381	0.51778	0.929:0.0:0.071:0.0	.	163;650	Q9P0Q5;Q9UHV7	.;MED13_HUMAN	R	650;649	ENSP00000380888:S650R	ENSP00000262436:S649R	S	-	3	2	MED13	57442710	0.996000	0.38824	1.000000	0.80357	0.994000	0.84299	2.540000	0.45727	2.131000	0.65755	0.477000	0.44152	AGT	MED13	-	NULL	ENSG00000108510		0.338	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1	198	0.00	0	A	NM_005121		60087928	60087928	-1	no_errors	ENST00000397786	ensembl	human	known	69_37n	missense	96	31.91	45	SNP	1.000	T
MIB1	57534	genome.wustl.edu	37	18	19438538	19438538	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr18:19438538C>G	ENST00000261537.6	+	20	3075	c.2811C>G	c.(2809-2811)gaC>gaG	p.D937E	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	937					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			TACAAAAGGACAAGGATAATA	0.294																																						dbGAP											0													109.0	114.0	112.0					18																	19438538		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2811C>G	18.37:g.19438538C>G	ENSP00000261537:p.Asp937Glu		B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Mib_Herc2,pfam_Znf_ZZ,superfamily_Ankyrin_rpt-contain_dom,smart_Znf_ZZ,smart_Ankyrin_rpt,smart_Znf_RING,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_RING,pfscan_Znf_ZZ	p.D937E	ENST00000261537.6	37	c.2811	CCDS11871.1	18	.	.	.	.	.	.	.	.	.	.	C	13.84	2.357418	0.41801	.	.	ENSG00000101752	ENST00000261537	T	0.34859	1.34	5.64	2.91	0.33838	.	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	L	0.36672	1.1	0.58432	D	0.999996	P	0.44690	0.841	P	0.55824	0.785	T	0.10042	-1.0647	10	0.31617	T	0.26	-15.2318	12.173	0.54169	0.0:0.8413:0.0:0.1587	.	937	Q86YT6	MIB1_HUMAN	E	937	ENSP00000261537:D937E	ENSP00000261537:D937E	D	+	3	2	MIB1	17692536	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.270000	0.51600	0.764000	0.33197	0.591000	0.81541	GAC	MIB1	-	NULL	ENSG00000101752		0.294	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIB1	HGNC	protein_coding	OTTHUMT00000254675.1	161	0.00	0	C	NM_020774		19438538	19438538	+1	no_errors	ENST00000261537	ensembl	human	known	69_37n	missense	100	18.55	23	SNP	1.000	G
MICAL1	64780	genome.wustl.edu	37	6	109766449	109766449	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:109766449C>G	ENST00000358807.3	-	22	3143	c.2832G>C	c.(2830-2832)gaG>gaC	p.E944D	MICAL1_ENST00000358577.3_Missense_Mutation_p.E858D|MICAL1_ENST00000368952.4_Missense_Mutation_p.E963D	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	944					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		CGGCCTCTAGCTCCCTCAAGG	0.557																																						dbGAP											0													59.0	59.0	59.0					6																	109766449		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2832G>C	6.37:g.109766449C>G	ENSP00000351664:p.Glu944Asp		B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.E963D	ENST00000358807.3	37	c.2889	CCDS5076.1	6	.	.	.	.	.	.	.	.	.	.	C	5.411	0.260948	0.10239	.	.	ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957;ENST00000335266	T;T;T	0.41758	0.99;0.99;0.99	5.4	-0.743	0.11105	Domain of unknown function DUF3585 (1);	0.206167	0.40385	N	0.001112	T	0.11281	0.0275	L	0.41356	1.27	0.33472	D	0.586282	B;B;B	0.24768	0.011;0.111;0.006	B;B;B	0.26416	0.027;0.069;0.028	T	0.04621	-1.0938	10	0.36615	T	0.2	.	1.9028	0.03271	0.1375:0.4393:0.1351:0.2881	.	963;858;944	B7Z3R5;Q8TDZ2-2;Q8TDZ2	.;.;MICA1_HUMAN	D	944;963;858;468;200	ENSP00000351664:E944D;ENSP00000357948:E963D;ENSP00000351385:E858D	ENSP00000335372:E200D	E	-	3	2	MICAL1	109873142	0.797000	0.28877	0.996000	0.52242	0.051000	0.14879	-0.213000	0.09305	-0.061000	0.13110	-0.345000	0.07892	GAG	MICAL1	-	pfam_DUF3585	ENSG00000135596		0.557	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL1	HGNC	protein_coding	OTTHUMT00000041759.2	48	0.00	0	C	NM_022765		109766449	109766449	-1	no_errors	ENST00000368952	ensembl	human	known	69_37n	missense	221	18.08	49	SNP	0.950	G
MIR670	100313777	genome.wustl.edu	37	11	43581217	43581217	+	RNA	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr11:43581217G>A	ENST00000390142.1	+	0	12					NR_031577.1				microRNA 670																		TTTAGGGGTGGACCTGATGTC	0.502																																						dbGAP											0													325.0	296.0	305.0					11																	43581217		692	1591	2283	-	-	-			0					11	2011-09-12			ENSG00000211568	ENSG00000211568		"""ncRNAs / Micro RNAs"""	37304	non-coding RNA	RNA, micro							Standard	NR_031577		Approved	hsa-mir-670	uc021qgk.1				11.37:g.43581217G>A				RNA	SNP	-	NULL	ENST00000390142.1	37	NULL		11																																																																																			MIR670	-	-	ENSG00000211568		0.502	MIR670-201	KNOWN	basic	miRNA	MIR670	HGNC	miRNA		242	0.00	0	G	NR_031577		43581217	43581217	+1	no_errors	ENST00000390142	ensembl	human	known	69_37n	rna	373	21.64	103	SNP	0.994	A
MKRN1	23608	genome.wustl.edu	37	7	140154472	140154472	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:140154472A>T	ENST00000255977.2	-	8	1518	c.1294T>A	c.(1294-1296)Ttt>Att	p.F432I	MKRN1_ENST00000474576.1_Missense_Mutation_p.F368I|MKRN1_ENST00000437223.2_Missense_Mutation_p.F166I	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	432					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					TCGTTGTCAAAGGGGTTGCTG	0.498																																						dbGAP											0													112.0	94.0	100.0					7																	140154472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.1294T>A	7.37:g.140154472A>T	ENSP00000255977:p.Phe432Ile		A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.F432I	ENST00000255977.2	37	c.1294	CCDS5860.1	7	.	.	.	.	.	.	.	.	.	.	A	14.24	2.477396	0.44044	.	.	ENSG00000133606	ENST00000255977;ENST00000539898;ENST00000437223;ENST00000474576	T;T;T	0.29142	2.95;1.58;2.29	5.06	5.06	0.68205	.	0.140842	0.46758	D	0.000276	T	0.42268	0.1195	L	0.54323	1.7	0.48696	D	0.999696	D	0.58268	0.982	P	0.54664	0.758	T	0.14868	-1.0457	10	0.27082	T	0.32	.	14.9777	0.71286	1.0:0.0:0.0:0.0	.	432	Q9UHC7	MKRN1_HUMAN	I	432;368;166;368	ENSP00000255977:F432I;ENSP00000439823:F166I;ENSP00000417863:F368I	ENSP00000255977:F432I	F	-	1	0	MKRN1	139800941	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.755000	0.62198	2.125000	0.65367	0.528000	0.53228	TTT	MKRN1	-	NULL	ENSG00000133606		0.498	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN1	HGNC	protein_coding	OTTHUMT00000348752.1	321	0.00	0	A	NM_013446		140154472	140154472	-1	no_errors	ENST00000255977	ensembl	human	known	69_37n	missense	30	86.59	213	SNP	1.000	T
MNDA	4332	genome.wustl.edu	37	1	158818988	158818988	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:158818988delG	ENST00000368141.4	+	7	1446	c.1185delG	c.(1183-1185)aagfs	p.K395fs		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	395					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AGGTCATCAAGGCCAAGAAAA	0.333																																						dbGAP											0													89.0	83.0	85.0					1																	158818988		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.1185delG	1.37:g.158818988delG	ENSP00000357123:p.Lys395fs			Frame_Shift_Del	DEL	pfam_HIN200/IF120x,pfam_DAPIN,pfscan_DAPIN,pfscan_HIN200/IF120x	p.A396fs	ENST00000368141.4	37	c.1185	CCDS1177.1	1																																																																																			MNDA	-	NULL	ENSG00000163563		0.333	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNDA	HGNC	protein_coding	OTTHUMT00000059069.1	269	0.00	0	G	NM_002432		158818988	158818988	+1	no_errors	ENST00000368141	ensembl	human	known	69_37n	frame_shift_del	137	16.77	28	DEL	0.105	-
MUC16	94025	genome.wustl.edu	37	19	9050021	9050021	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:9050021G>A	ENST00000397910.4	-	5	31813	c.31610C>T	c.(31609-31611)aCg>aTg	p.T10537M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10539	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAGGATGTCGTTTCTGGAAC	0.493																																						dbGAP											0													375.0	345.0	355.0					19																	9050021		2036	4187	6223	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31610C>T	19.37:g.9050021G>A	ENSP00000381008:p.Thr10537Met		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T10537M	ENST00000397910.4	37	c.31610	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	4.808	0.150300	0.09185	.	.	ENSG00000181143	ENST00000397910	T	0.02579	4.24	3.08	-4.36	0.03645	.	.	.	.	.	T	0.01189	0.0039	N	0.00926	-1.1	.	.	.	B	0.09022	0.002	B	0.06405	0.002	T	0.47394	-0.9121	8	0.87932	D	0	.	11.4785	0.50312	0.3307:0.0:0.6693:0.0	.	10537	B5ME49	.	M	10537	ENSP00000381008:T10537M	ENSP00000381008:T10537M	T	-	2	0	MUC16	8911021	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-0.882000	0.04174	-1.334000	0.02244	-0.821000	0.03111	ACG	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	391	0.00	0	G	NM_024690		9050021	9050021	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	76	89.94	706	SNP	0.000	A
MUC16	94025	genome.wustl.edu	37	19	9087467	9087467	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:9087467G>T	ENST00000397910.4	-	1	4551	c.4348C>A	c.(4348-4350)Cag>Aag	p.Q1450K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1450	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATTGTGGTCTGCTCACTGGGA	0.498																																						dbGAP											0													109.0	107.0	108.0					19																	9087467		1970	4146	6116	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4348C>A	19.37:g.9087467G>T	ENSP00000381008:p.Gln1450Lys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.Q1450K	ENST00000397910.4	37	c.4348	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	5.009	0.187415	0.09547	.	.	ENSG00000181143	ENST00000397910	T	0.02258	4.37	1.01	-0.228	0.13098	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	.	.	.	P	0.39424	0.673	B	0.31812	0.136	T	0.47623	-0.9103	8	0.87932	D	0	.	4.6965	0.12806	0.0:0.4072:0.5928:0.0	.	1450	B5ME49	.	K	1450	ENSP00000381008:Q1450K	ENSP00000381008:Q1450K	Q	-	1	0	MUC16	8948467	0.001000	0.12720	0.121000	0.21740	0.329000	0.28539	-0.365000	0.07573	-0.028000	0.13850	0.313000	0.20887	CAG	MUC16	-	NULL	ENSG00000181143		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	103	0.00	0	G	NM_024690		9087467	9087467	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	97	42.26	71	SNP	0.200	T
MYBL2	4605	genome.wustl.edu	37	20	42343796	42343796	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr20:42343796C>A	ENST00000217026.4	+	13	1974	c.1847C>A	c.(1846-1848)tCt>tAt	p.S616Y	MYBL2_ENST00000396863.4_Missense_Mutation_p.S592Y	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	616					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CCTTCAAACTCTTCCAGCCTC	0.537																																						dbGAP											0													161.0	167.0	165.0					20																	42343796		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1847C>A	20.37:g.42343796C>A	ENSP00000217026:p.Ser616Tyr		B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S616Y	ENST00000217026.4	37	c.1847	CCDS13322.1	20	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422407	0.62622	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.16196	2.36;2.37	4.44	4.44	0.53790	.	5.978440	0.00508	N	0.000164	T	0.27832	0.0685	N	0.08118	0	0.09310	N	1	D;D	0.71674	0.998;0.963	D;P	0.67725	0.953;0.751	T	0.56768	-0.7924	10	0.54805	T	0.06	-8.4692	14.3762	0.66879	0.0:1.0:0.0:0.0	.	592;616	F8W6N6;P10244	.;MYBB_HUMAN	Y	592;616	ENSP00000380072:S592Y;ENSP00000217026:S616Y	ENSP00000217026:S616Y	S	+	2	0	MYBL2	41777210	0.998000	0.40836	0.015000	0.15790	0.296000	0.27459	5.132000	0.64758	2.186000	0.69663	0.491000	0.48974	TCT	MYBL2	-	NULL	ENSG00000101057		0.537	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL2	HGNC	protein_coding	OTTHUMT00000080408.1	113	0.00	0	C	NM_002466		42343796	42343796	+1	no_errors	ENST00000217026	ensembl	human	known	69_37n	missense	15	73.68	42	SNP	0.039	A
MYH14	79784	genome.wustl.edu	37	19	50805047	50805047	+	Missense_Mutation	SNP	C	C	A	rs187789045		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:50805047C>A	ENST00000596571.1	+	37	5476	c.5476C>A	c.(5476-5478)Cgt>Agt	p.R1826S	MYH14_ENST00000425460.1_Missense_Mutation_p.R1834S|MYH14_ENST00000376970.2_Missense_Mutation_p.R1859S|MYH14_ENST00000601313.1_Missense_Mutation_p.R1867S|MYH14_ENST00000440075.2_Missense_Mutation_p.R1867S|MYH14_ENST00000262269.8_Missense_Mutation_p.R1867S|MYH14_ENST00000598205.1_Missense_Mutation_p.R1834S			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1826					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGCTGGGGCCCGTGCCCGCCA	0.637																																						dbGAP											0													31.0	37.0	35.0					19																	50805047		2078	4207	6285	-	-	-	SO:0001583	missense	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5476C>A	19.37:g.50805047C>A	ENSP00000472819:p.Arg1826Ser		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1867S	ENST00000596571.1	37	c.5599	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	C	18.15	3.558866	0.65538	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	4.14	0.254	0.15557	Myosin tail (1);	.	.	.	.	T	0.78502	0.4293	L	0.43152	1.355	0.33018	D	0.528485	D;P;P	0.56035	0.974;0.942;0.929	P;P;P	0.56823	0.807;0.745;0.628	T	0.80839	-0.1203	9	0.59425	D	0.04	.	10.9008	0.47051	0.4673:0.5327:0.0:0.0	.	1867;1826;1834	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	S	1867;1859;1834;1610;1867	ENSP00000406273:R1867S;ENSP00000366169:R1859S;ENSP00000407879:R1834S;ENSP00000262269:R1867S	ENSP00000262269:R1867S	R	+	1	0	MYH14	55496859	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.325000	0.59234	0.432000	0.26286	0.591000	0.81541	CGT	MYH14	-	pfam_Myosin_tail	ENSG00000105357		0.637	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	10	0.00	0	C	NM_024729		50805047	50805047	+1	no_errors	ENST00000262269	ensembl	human	known	69_37n	missense	33	34.00	17	SNP	0.997	A
MYH6	4624	genome.wustl.edu	37	14	23874978	23874978	+	Splice_Site	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr14:23874978G>A	ENST00000356287.3	-	3	232	c.203C>T	c.(202-204)aCg>aTg	p.T68M	MYH6_ENST00000405093.3_Splice_Site_p.T68M			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	68					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CACAGTCACCGTCTGGAGGGG	0.612																																						dbGAP											0													193.0	139.0	157.0					14																	23874978		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.202-1C>T	14.37:g.23874978G>A			A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T68M	ENST00000356287.3	37	c.203	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	.	15.23	2.773164	0.49680	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.82619	-1.63;-1.63	3.82	3.82	0.43975	Myosin, N-terminal, SH3-like (1);	.	.	.	.	D	0.89312	0.6679	M	0.73217	2.22	0.54753	D	0.99998	D;D	0.56968	0.978;0.978	D;D	0.64776	0.929;0.929	D	0.90307	0.4334	9	0.54805	T	0.06	.	15.8313	0.78752	0.0:0.0:1.0:0.0	.	68;68	D9YZU2;P13533	.;MYH6_HUMAN	M	68	ENSP00000386041:T68M;ENSP00000348634:T68M	ENSP00000348634:T68M	T	-	2	0	MYH6	22944818	1.000000	0.71417	0.984000	0.44739	0.127000	0.20565	9.436000	0.97532	2.102000	0.63906	0.486000	0.48141	ACG	MYH6	-	pfam_Myosin_N	ENSG00000197616		0.612	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	89	0.00	0	G		Missense_Mutation	23874978	23874978	-1	no_errors	ENST00000356287	ensembl	human	known	69_37n	missense	49	45.56	41	SNP	1.000	A
MYOM1	8736	genome.wustl.edu	37	18	3094191	3094191	+	Missense_Mutation	SNP	C	C	G	rs149588924	byFrequency	TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr18:3094191C>G	ENST00000356443.4	-	26	4174	c.3841G>C	c.(3841-3843)Gag>Cag	p.E1281Q	RNU7-25P_ENST00000516544.1_RNA|MYOM1_ENST00000261606.7_Missense_Mutation_p.E1185Q|MYOM1_ENST00000400569.3_Missense_Mutation_p.E1281Q	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1281					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ATTTCCTTCTCGTTAAATATG	0.403																																						dbGAP											0													76.0	73.0	74.0					18																	3094191		1811	4080	5891	-	-	-	SO:0001583	missense	0			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.3841G>C	18.37:g.3094191C>G	ENSP00000348821:p.Glu1281Gln		Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E1281Q	ENST00000356443.4	37	c.3841	CCDS45824.1	18	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640402	0.67244	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.04917	3.53;3.53;3.53	5.55	5.55	0.83447	Immunoglobulin-like fold (1);	0.350509	0.35040	N	0.003491	T	0.09291	0.0229	L	0.29908	0.895	0.38668	D	0.952232	B;B	0.31730	0.337;0.228	B;B	0.40009	0.316;0.132	T	0.41610	-0.9499	10	0.22706	T	0.39	.	19.6982	0.96039	0.0:1.0:0.0:0.0	.	1185;1281	P52179-2;P52179	.;MYOM1_HUMAN	Q	1281;1281;1185	ENSP00000348821:E1281Q;ENSP00000383413:E1281Q;ENSP00000261606:E1185Q	ENSP00000261606:E1185Q	E	-	1	0	MYOM1	3084191	1.000000	0.71417	0.728000	0.30774	0.986000	0.74619	5.914000	0.69964	2.894000	0.99253	0.655000	0.94253	GAG	MYOM1	-	smart_Ig_sub	ENSG00000101605		0.403	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	HGNC	protein_coding	OTTHUMT00000441037.2	198	0.00	0	C	NM_003803		3094191	3094191	-1	no_errors	ENST00000356443	ensembl	human	known	69_37n	missense	171	20.83	45	SNP	1.000	G
NBPF14	25832	genome.wustl.edu	37	1	148004597	148004597	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:148004597A>T	ENST00000369219.1	-	22	2733	c.2717T>A	c.(2716-2718)gTg>gAg	p.V906E				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	906	NBPF 10. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					GAGACTTGTCACCGTCAAAGT	0.473																																						dbGAP											0													57.0	85.0	76.0					1																	148004597		2020	4194	6214	-	-	-	SO:0001583	missense	0			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.2717T>A	1.37:g.148004597A>T	ENSP00000358221:p.Val906Glu		Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	pfam_NBPF_dom	p.V906E	ENST00000369219.1	37	c.2717		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	9.466|9.466	1.094433|1.094433	0.20471|0.20471	.|.	.|.	ENSG00000122497|ENSG00000122497	ENST00000369219;ENST00000369368|ENST00000310701	T|.	0.05081|.	3.5|.	0.512|0.512	-1.02|-1.02	0.10135|0.10135	DUF1220 (1);|.	.|.	.|.	.|.	.|.	T|.	0.16085|.	0.0387|.	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	1|1	P;D;D|.	0.59357|.	0.833;0.985;0.966|.	B;D;P|.	0.66196|.	0.151;0.942;0.656|.	T|.	0.32134|.	-0.9918|.	8|.	0.62326|.	D|.	0.03|.	.|.	.|.	.|.	.|.	.|.	254;887;906|.	F8WEX8;B4DH59;Q5TI25|.	.;.;NBPFE_HUMAN|.	E|R	906;254|912	ENSP00000358221:V906E|.	ENSP00000358221:V906E|.	V|X	-|-	2|1	0|0	NBPF14|NBPF14	146471221|146471221	0.808000|0.808000	0.29022|0.29022	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.779000|-0.779000	0.04659|0.04659	-0.459000|-0.459000	0.07013|0.07013	0.355000|0.355000	0.21935|0.21935	GTG|TGA	NBPF14	-	NULL	ENSG00000122497		0.473	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	NBPF14	HGNC	protein_coding		495	0.20	1	A	NM_015383		148004597	148004597	-1	no_errors	ENST00000369219	ensembl	human	known	69_37n	missense	370	19.61	91	SNP	0.000	T
NIPBL	25836	genome.wustl.edu	37	5	37008133	37008134	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr5:37008133_37008134insT	ENST00000282516.8	+	19	4762_4763	c.4263_4264insT	c.(4264-4266)tttfs	p.F1422fs	NIPBL_ENST00000448238.2_Frame_Shift_Ins_p.F1422fs	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	1422					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.F1423fs*15(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GAATAACACCATTTTTTGTGGA	0.302																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(2)																																								-	-	-	SO:0001589	frameshift_variant	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4269dupT	5.37:g.37008139_37008139dupT	ENSP00000282516:p.Phe1422fs		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Frame_Shift_Ins	INS	superfamily_ARM-type_fold	p.V1423fs	ENST00000282516.8	37	c.4263_4264	CCDS3920.1	5																																																																																			NIPBL	-	NULL	ENSG00000164190		0.302	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	263	0.00	0	-	NM_015384		37008133	37008134	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	frame_shift_ins	71	51.37	75	INS	0.998:1.000	T
NLRP8	126205	genome.wustl.edu	37	19	56485096	56485096	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:56485096C>G	ENST00000291971.3	+	7	2684	c.2613C>G	c.(2611-2613)caC>caG	p.H871Q	NLRP8_ENST00000590542.1_Missense_Mutation_p.H852Q	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	871					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TGCTGACCCACCTGAGCTTGG	0.512																																						dbGAP											0													172.0	162.0	165.0					19																	56485096		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2613C>G	19.37:g.56485096C>G	ENSP00000291971:p.His871Gln		Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.H871Q	ENST00000291971.3	37	c.2613	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548964	0.45383	.	.	ENSG00000179709	ENST00000291971	T	0.54071	0.59	2.04	-1.92	0.07618	.	.	.	.	.	T	0.60753	0.2293	L	0.54908	1.71	0.20489	N	0.999895	D;D	0.64830	0.958;0.994	P;D	0.73380	0.824;0.98	T	0.52764	-0.8532	9	0.72032	D	0.01	.	6.1926	0.20532	0.0:0.6907:0.0:0.3093	.	852;871	Q86W28-2;Q86W28	.;NALP8_HUMAN	Q	871	ENSP00000291971:H871Q	ENSP00000291971:H871Q	H	+	3	2	NLRP8	61176908	0.606000	0.26949	0.718000	0.30602	0.343000	0.28985	-0.288000	0.08377	-0.426000	0.07360	0.514000	0.50259	CAC	NLRP8	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000179709		0.512	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	50	0.00	0	C	NM_176811		56485096	56485096	+1	no_errors	ENST00000291971	ensembl	human	known	69_37n	missense	7	90.41	66	SNP	0.773	G
NR6A1	2649	genome.wustl.edu	37	9	127316795	127316795	+	Missense_Mutation	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr9:127316795C>T	ENST00000487099.2	-	3	354	c.197G>A	c.(196-198)cGc>cAc	p.R66H	NR6A1_ENST00000416460.2_Missense_Mutation_p.R62H|NR6A1_ENST00000373584.3_Missense_Mutation_p.R62H|NR6A1_ENST00000344523.4_Missense_Mutation_p.R66H	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	66					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						GCCTGTAGCGCGGTCCCCACA	0.473																																					Esophageal Squamous(192;272 2884 6208 20560)	dbGAP											0													100.0	93.0	96.0					9																	127316795		2203	4300	6503	-	-	-	SO:0001583	missense	0			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.197G>A	9.37:g.127316795C>T	ENSP00000420267:p.Arg66His		O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R66H	ENST00000487099.2	37	c.197	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951627	0.92660	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	D;D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34;-4.34	5.57	5.57	0.84162	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.97945	0.9324	L	0.54908	1.71	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.998	D	0.99004	1.0812	10	0.87932	D	0	.	18.5447	0.91042	0.0:1.0:0.0:0.0	.	62;66;62	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	H	66;62;62;66;24	ENSP00000420267:R66H;ENSP00000362686:R62H;ENSP00000413701:R62H;ENSP00000341135:R66H;ENSP00000420587:R24H	ENSP00000341135:R66H	R	-	2	0	NR6A1	126356616	1.000000	0.71417	0.968000	0.41197	0.986000	0.74619	7.786000	0.85741	2.614000	0.88457	0.563000	0.77884	CGC	NR6A1	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	ENSG00000148200		0.473	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	HGNC	protein_coding	OTTHUMT00000054043.4	31	0.00	0	C			127316795	127316795	-1	no_errors	ENST00000487099	ensembl	human	known	69_37n	missense	37	38.33	23	SNP	0.999	T
TENM1	10178	genome.wustl.edu	37	X	123630946	123630946	+	Silent	SNP	A	A	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chrX:123630946A>G	ENST00000371130.3	-	20	3678	c.3615T>C	c.(3613-3615)gaT>gaC	p.D1205D	TENM1_ENST00000461429.1_5'UTR|TENM1_ENST00000422452.2_Silent_p.D1205D	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1205					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACACACTGCCATCAGGGCCAG	0.463																																						dbGAP											0													103.0	95.0	98.0					X																	123630946		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3615T>C	X.37:g.123630946A>G			B2RTR5|Q5JZ17	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.D1205	ENST00000371130.3	37	c.3615	CCDS14609.1	X																																																																																			ODZ1	-	NULL	ENSG00000009694		0.463	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	175	0.00	0	A	NM_014253		123630946	123630946	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	silent	75	38.52	47	SNP	1.000	G
OR13G1	441933	genome.wustl.edu	37	1	247836055	247836055	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:247836055G>T	ENST00000359688.2	-	1	310	c.289C>A	c.(289-291)Cag>Aag	p.Q97K	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AAGAAGAGCTGGGACATGCAG	0.483																																						dbGAP											0													83.0	67.0	72.0					1																	247836055		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.289C>A	1.37:g.247836055G>T	ENSP00000352717:p.Gln97Lys		B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q97K	ENST00000359688.2	37	c.289	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690865	0.68271	.	.	ENSG00000197437	ENST00000359688	T	0.00462	7.26	4.2	3.29	0.37713	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41396	D	0.000882	T	0.02533	0.0077	H	0.98133	4.155	0.36000	D	0.837335	D	0.89917	1.0	D	0.91635	0.999	T	0.04053	-1.0981	10	0.87932	D	0	-28.8643	10.017	0.42020	0.1009:0.0:0.8991:0.0	.	97	Q8NGZ3	O13G1_HUMAN	K	97	ENSP00000352717:Q97K	ENSP00000352717:Q97K	Q	-	1	0	OR13G1	245902678	1.000000	0.71417	0.038000	0.18304	0.822000	0.46500	8.375000	0.90135	1.114000	0.41781	0.563000	0.77884	CAG	OR13G1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197437		0.483	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	HGNC	protein_coding	OTTHUMT00000096869.1	39	0.00	0	G	NM_001005487		247836055	247836055	-1	no_errors	ENST00000359688	ensembl	human	known	69_37n	missense	99	18.70	23	SNP	0.959	T
OR2T2	401992	genome.wustl.edu	37	1	248616764	248616764	+	Silent	SNP	C	C	T	rs376553658		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:248616764C>T	ENST00000342927.3	+	1	688	c.666C>T	c.(664-666)atC>atT	p.I222I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACACGCACATCCTCCTGACTG	0.542																																						dbGAP											0													182.0	125.0	144.0					1																	248616764		2186	4264	6450	-	-	-	SO:0001819	synonymous_variant	0			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.666C>T	1.37:g.248616764C>T			B2RNM1|B9EH01	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I222	ENST00000342927.3	37	c.666	CCDS31116.1	1																																																																																			OR2T2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000196240		0.542	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	87	0.00	0	C	NM_001004136		248616764	248616764	+1	no_errors	ENST00000342927	ensembl	human	known	69_37n	silent	42	30.00	18	SNP	0.001	T
OR5B17	219965	genome.wustl.edu	37	11	58125977	58125977	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr11:58125977T>C	ENST00000357377.3	-	1	565	c.566A>G	c.(565-567)gAg>gGg	p.E189G		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AATGTGTTTCTCAGAGCAGGT	0.363																																						dbGAP											0													70.0	63.0	65.0					11																	58125977		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.566A>G	11.37:g.58125977T>C	ENSP00000349945:p.Glu189Gly		Q6IEX1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.E189G	ENST00000357377.3	37	c.566	CCDS31548.1	11	.	.	.	.	.	.	.	.	.	.	t	12.00	1.807064	0.31961	.	.	ENSG00000197786	ENST00000357377	T	0.00158	8.65	3.27	3.27	0.37495	GPCR, rhodopsin-like superfamily (1);	0.404286	0.17777	U	0.162380	T	0.00144	0.0004	L	0.28556	0.865	0.25786	N	0.984673	B	0.02656	0.0	B	0.06405	0.002	T	0.26292	-1.0107	10	0.72032	D	0.01	-2.0461	10.6254	0.45504	0.0:0.0:0.0:1.0	.	189	Q8NGF7	OR5BH_HUMAN	G	189	ENSP00000349945:E189G	ENSP00000349945:E189G	E	-	2	0	OR5B17	57882553	0.174000	0.23070	0.170000	0.22879	0.015000	0.08874	3.200000	0.51051	1.363000	0.46019	0.378000	0.23410	GAG	OR5B17	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000197786		0.363	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B17	HGNC	protein_coding	OTTHUMT00000394708.2	61	0.00	0	T	NM_001005489		58125977	58125977	-1	no_errors	ENST00000357377	ensembl	human	known	69_37n	missense	21	68.66	46	SNP	0.906	C
OR6K2	81448	genome.wustl.edu	37	1	158669493	158669493	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:158669493G>T	ENST00000359610.2	-	1	993	c.950C>A	c.(949-951)cCa>cAa	p.P317Q		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					TGAGGTCCCTGGTCTTACGGA	0.373																																						dbGAP											0													71.0	69.0	70.0					1																	158669493		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.950C>A	1.37:g.158669493G>T	ENSP00000352626:p.Pro317Gln		B9EH33|Q6IFR6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P317Q	ENST00000359610.2	37	c.950	CCDS30902.1	1	.	.	.	.	.	.	.	.	.	.	G	8.104	0.777252	0.16120	.	.	ENSG00000196171	ENST00000359610	T	0.00995	5.46	4.39	0.176	0.15049	.	.	.	.	.	T	0.00271	0.0008	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43212	-0.9405	9	0.72032	D	0.01	5.169	3.1322	0.06428	0.176:0.1527:0.5382:0.1331	.	317	Q8NGY2	OR6K2_HUMAN	Q	317	ENSP00000352626:P317Q	ENSP00000352626:P317Q	P	-	2	0	OR6K2	156936117	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.096000	0.11059	-0.288000	0.09051	-1.367000	0.01198	CCA	OR6K2	-	NULL	ENSG00000196171		0.373	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K2	HGNC	protein_coding	OTTHUMT00000059061.1	172	0.00	0	G	NM_001005279		158669493	158669493	-1	no_errors	ENST00000359610	ensembl	human	known	69_37n	missense	79	40.74	55	SNP	0.001	T
PCYT1B	9468	genome.wustl.edu	37	X	24608286	24608286	+	Missense_Mutation	SNP	T	T	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chrX:24608286T>C	ENST00000379144.2	-	4	470	c.340A>G	c.(340-342)Agt>Ggt	p.S114G	PCYT1B_ENST00000356768.4_Missense_Mutation_p.S114G|PCYT1B_ENST00000379145.1_Missense_Mutation_p.S96G	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	114					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	AGATCATCACTGCAAACTAAA	0.473																																						dbGAP											0													108.0	86.0	93.0					X																	24608286		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.340A>G	X.37:g.24608286T>C	ENSP00000368439:p.Ser114Gly		A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	pfam_Cytidylyltransf,tigrfam_Cyt_trans-rel	p.S114G	ENST00000379144.2	37	c.340	CCDS14213.1	X	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451051	0.63290	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	D;D;D	0.96554	-4.05;-4.05;-4.05	5.44	5.44	0.79542	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.000000	0.85682	D	0.000000	D	0.95487	0.8534	M	0.67569	2.06	0.80722	D	1	B;B;B	0.33919	0.378;0.432;0.432	B;B;B	0.39299	0.15;0.195;0.296	D	0.94279	0.7518	10	0.26408	T	0.33	-14.4587	14.5606	0.68133	0.0:0.0:0.0:1.0	.	114;96;114	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	G	96;114;114	ENSP00000368440:S96G;ENSP00000368439:S114G;ENSP00000349211:S114G	ENSP00000349211:S114G	S	-	1	0	PCYT1B	24518207	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.525000	0.81892	2.015000	0.59207	0.486000	0.48141	AGT	PCYT1B	-	pfam_Cytidylyltransf,tigrfam_Cyt_trans-rel	ENSG00000102230		0.473	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1B	HGNC	protein_coding	OTTHUMT00000056103.1	106	0.00	0	T	NM_004845		24608286	24608286	-1	no_errors	ENST00000379144	ensembl	human	known	69_37n	missense	12	83.33	60	SNP	1.000	C
PLEKHA5	54477	genome.wustl.edu	37	12	19511185	19511185	+	Silent	SNP	A	A	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr12:19511185A>G	ENST00000299275.6	+	21	2670	c.2664A>G	c.(2662-2664)gaA>gaG	p.E888E	PLEKHA5_ENST00000424268.1_Silent_p.E877E|PLEKHA5_ENST00000317589.4_Silent_p.E951E|PLEKHA5_ENST00000355397.3_Silent_p.E946E|PLEKHA5_ENST00000538714.1_Silent_p.E946E|PLEKHA5_ENST00000359180.3_Silent_p.E832E|PLEKHA5_ENST00000543806.1_Silent_p.E870E|PLEKHA5_ENST00000539256.1_Silent_p.E646E|PLEKHA5_ENST00000429027.2_Silent_p.E1054E	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	888					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GTGCAGTGGAACAGCTCTGTT	0.363																																					Pancreas(196;329 2193 11246 14234 19524)	dbGAP											0													89.0	77.0	81.0					12																	19511185		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2664A>G	12.37:g.19511185A>G			A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Silent	SNP	pfam_Pleckstrin_homology,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_WW_Rsp5_WWP	p.E951	ENST00000299275.6	37	c.2853	CCDS8682.1	12																																																																																			PLEKHA5	-	NULL	ENSG00000052126		0.363	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	HGNC	protein_coding	OTTHUMT00000397013.1	120	0.00	0	A	NM_019012		19511185	19511185	+1	no_errors	ENST00000317589	ensembl	human	known	69_37n	silent	93	37.09	56	SNP	0.047	G
PRICKLE1	144165	genome.wustl.edu	37	12	42853647	42853647	+	Missense_Mutation	SNP	T	T	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr12:42853647T>G	ENST00000455697.1	-	8	2745	c.2460A>C	c.(2458-2460)aaA>aaC	p.K820N	RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.K820N|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.K820N|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.K820N|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.K820N	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	820	Poly-Lys.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		TGTGTCCCTTTTTCTTCTTGG	0.408																																						dbGAP											0													185.0	176.0	179.0					12																	42853647		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.2460A>C	12.37:g.42853647T>G	ENSP00000401060:p.Lys820Asn		Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.K820N	ENST00000455697.1	37	c.2460	CCDS8742.1	12	.	.	.	.	.	.	.	.	.	.	T	14.10	2.434720	0.43224	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	5.27	4.12	0.48240	.	0.041580	0.85682	D	0.000000	T	0.41373	0.1156	N	0.08118	0	0.54753	D	0.99998	P	0.46706	0.883	B	0.41860	0.368	T	0.45906	-0.9229	10	0.87932	D	0	-26.0649	9.1227	0.36797	0.0:0.1614:0.0:0.8386	.	820	Q96MT3	PRIC1_HUMAN	N	820	ENSP00000401060:K820N;ENSP00000398947:K820N;ENSP00000448359:K820N;ENSP00000345064:K820N;ENSP00000449819:K820N	ENSP00000345064:K820N	K	-	3	2	PRICKLE1	41139914	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.340000	0.33896	0.948000	0.37687	0.533000	0.62120	AAA	PRICKLE1	-	NULL	ENSG00000139174		0.408	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRICKLE1	HGNC	protein_coding	OTTHUMT00000404069.1	350	0.00	0	T			42853647	42853647	-1	no_errors	ENST00000345127	ensembl	human	known	69_37n	missense	215	46.68	190	SNP	1.000	G
PRPF4B	8899	genome.wustl.edu	37	6	4032461	4032461	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:4032461G>C	ENST00000337659.6	+	2	810	c.710G>C	c.(709-711)aGg>aCg	p.R237T	PRPF4B_ENST00000538861.1_Missense_Mutation_p.R223T	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	237	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GATCAAGCAAGGAAATCAAAA	0.363																																						dbGAP											0													132.0	143.0	139.0					6																	4032461		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.710G>C	6.37:g.4032461G>C	ENSP00000337194:p.Arg237Thr		A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R237T	ENST00000337659.6	37	c.710	CCDS4488.1	6	.	.	.	.	.	.	.	.	.	.	G	15.16	2.752265	0.49362	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.68765	-0.35;-0.33	5.41	5.41	0.78517	.	0.067493	0.64402	D	0.000010	T	0.51822	0.1697	L	0.46157	1.445	0.51482	D	0.999925	B	0.09022	0.002	B	0.12156	0.007	T	0.48222	-0.9054	10	0.41790	T	0.15	.	19.5612	0.95373	0.0:0.0:1.0:0.0	.	237	Q13523	PRP4B_HUMAN	T	237;223	ENSP00000337194:R237T;ENSP00000439331:R223T	ENSP00000337194:R237T	R	+	2	0	PRPF4B	3977460	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.759000	0.68785	2.687000	0.91594	0.655000	0.94253	AGG	PRPF4B	-	NULL	ENSG00000112739		0.363	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	HGNC	protein_coding	OTTHUMT00000314018.2	109	0.00	0	G			4032461	4032461	+1	no_errors	ENST00000337659	ensembl	human	known	69_37n	missense	52	42.86	39	SNP	1.000	C
RARRES1	5918	genome.wustl.edu	37	3	158431599	158431600	+	Frame_Shift_Ins	INS	-	-	T	rs367969956		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr3:158431599_158431600insT	ENST00000237696.5	-	2	605_606	c.325_326insA	c.(325-327)cgcfs	p.R109fs	RARRES1_ENST00000498640.1_5'UTR|RARRES1_ENST00000479756.1_Frame_Shift_Ins_p.R109fs	NM_206963.1	NP_996846.1	P49788	TIG1_HUMAN	retinoic acid receptor responder (tazarotene induced) 1	109					negative regulation of cell proliferation (GO:0008285)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)	TGGGTTGTAGCGCTCTGTGCTG	0.381																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U27185	CCDS3184.1, CCDS54665.1	3q25.32	2013-07-29			ENSG00000118849	ENSG00000118849			9867	protein-coding gene	gene with protein product	"""latexin-like"""	605090				8601727, 9270552	Standard	NM_002888		Approved	TIG1, LXNL	uc003fci.3	P49788	OTTHUMG00000158834	ENST00000237696.5:c.325_326insA	3.37:g.158431599_158431600insT	ENSP00000237696:p.Arg109fs		Q8N1D7	Frame_Shift_Ins	INS	pfam_Prot_inh_latexin,pirsf_Prot_inh_latexin	p.R109fs	ENST00000237696.5	37	c.326_325	CCDS3184.1	3																																																																																			RARRES1	-	pfam_Prot_inh_latexin,pirsf_Prot_inh_latexin	ENSG00000118849		0.381	RARRES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARRES1	HGNC	protein_coding	OTTHUMT00000352358.1	150	0.00	0	-			158431599	158431600	-1	no_errors	ENST00000237696	ensembl	human	known	69_37n	frame_shift_ins	170	26.09	60	INS	0.001:0.000	T
RC3H1	149041	genome.wustl.edu	37	1	173916616	173916616	+	Silent	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:173916616C>G	ENST00000367696.2	-	15	2979	c.2628G>C	c.(2626-2628)gtG>gtC	p.V876V	RC3H1_ENST00000367694.2_Silent_p.V876V|RC3H1_ENST00000258349.4_Silent_p.V876V			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	876					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						CAAACCGAGACACTGTTGGTC	0.478																																						dbGAP											0													146.0	145.0	145.0					1																	173916616		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2628G>C	1.37:g.173916616C>G			B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Silent	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.V876	ENST00000367696.2	37	c.2628	CCDS30940.1	1																																																																																			RC3H1	-	NULL	ENSG00000135870		0.478	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H1	HGNC	protein_coding	OTTHUMT00000090733.2	201	0.00	0	C	NM_172071		173916616	173916616	-1	no_errors	ENST00000258349	ensembl	human	known	69_37n	silent	197	18.60	45	SNP	0.077	G
RNF26	79102	genome.wustl.edu	37	11	119206393	119206393	+	Silent	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr11:119206393C>T	ENST00000311413.4	+	1	1157	c.561C>T	c.(559-561)ttC>ttT	p.F187F	RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	187						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		TGGCTGCCTTCCTAGCCCACA	0.627																																						dbGAP											0													107.0	89.0	95.0					11																	119206393		2199	4295	6494	-	-	-	SO:0001819	synonymous_variant	0			AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.561C>T	11.37:g.119206393C>T			Q542Y8	Silent	SNP	pfscan_Znf_RING	p.F187	ENST00000311413.4	37	c.561	CCDS8419.1	11																																																																																			RNF26	-	NULL	ENSG00000173456		0.627	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF26	HGNC	protein_coding	OTTHUMT00000388220.1	39	0.00	0	C	NM_032015		119206393	119206393	+1	no_errors	ENST00000311413	ensembl	human	known	69_37n	silent	7	90.91	70	SNP	0.991	T
RNPC3	55599	genome.wustl.edu	37	1	104068843	104068843	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:104068843G>C	ENST00000533099.1	+	2	387	c.151G>C	c.(151-153)Ggg>Cgg	p.G51R	RP11-153F1.1_ENST00000447322.2_RNA|RNPC3_ENST00000524631.1_Missense_Mutation_p.G51R|RN7SKP285_ENST00000410137.1_RNA|RNPC3_ENST00000423855.2_Missense_Mutation_p.G51R|RP11-153F1.1_ENST00000444810.1_RNA			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	51	Necessary for interaction with PDCD7.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		GAAGTACTTCGGGGCTCAGTC	0.642																																						dbGAP											0													56.0	53.0	54.0					1																	104068843		692	1591	2283	-	-	-	SO:0001583	missense	0			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.151G>C	1.37:g.104068843G>C	ENSP00000432886:p.Gly51Arg		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G51R	ENST00000533099.1	37	c.151	CCDS781.1	1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105379	0.77096	.	.	ENSG00000185946	ENST00000524631;ENST00000531883;ENST00000533099;ENST00000423855	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	4.95	4.95	0.65309	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.79191	0.4404	H	0.98883	4.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.87313	0.2313	10	0.72032	D	0.01	-4.4368	16.1396	0.81513	0.0:0.0:1.0:0.0	.	51;51	A8K1C9;Q96LT9	.;RBM40_HUMAN	R	51	ENSP00000437278:G51R;ENSP00000431344:G51R;ENSP00000432886:G51R;ENSP00000391432:G51R	ENSP00000391432:G51R	G	+	1	0	RNPC3	103841431	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	7.366000	0.79548	2.564000	0.86499	0.462000	0.41574	GGG	RNPC3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000185946		0.642	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1	43	0.00	0	G	NM_017619		104068843	104068843	+1	no_errors	ENST00000423855	ensembl	human	known	69_37n	missense	44	33.33	22	SNP	1.000	C
ROBO1	6091	genome.wustl.edu	37	3	78737828	78737828	+	Silent	SNP	T	T	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr3:78737828T>A	ENST00000464233.1	-	9	1253	c.1140A>T	c.(1138-1140)ccA>ccT	p.P380P	ROBO1_ENST00000495273.1_Silent_p.P344P|ROBO1_ENST00000436010.2_Silent_p.P341P|ROBO1_ENST00000467549.1_Silent_p.P344P	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	380	Ig-like C2-type 4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AGAAAATAGCTGGTTGAGGAT	0.418																																						dbGAP											0													61.0	54.0	56.0					3																	78737828		1851	4095	5946	-	-	-	SO:0001819	synonymous_variant	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1140A>T	3.37:g.78737828T>A			B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P380	ENST00000464233.1	37	c.1140	CCDS54611.1	3																																																																																			ROBO1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000169855		0.418	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	153	0.00	0	T	NM_002941		78737828	78737828	-1	no_errors	ENST00000464233	ensembl	human	known	69_37n	silent	19	79.57	74	SNP	1.000	A
RPTOR	57521	genome.wustl.edu	37	17	78811786	78811786	+	Missense_Mutation	SNP	A	A	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:78811786A>T	ENST00000306801.3	+	10	1563	c.1201A>T	c.(1201-1203)Act>Tct	p.T401S	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.T401S|RPTOR_ENST00000537330.1_Missense_Mutation_p.T216S	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	401					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CGAGGAAGGCACTGCGTTTCG	0.607																																						dbGAP											0													110.0	78.0	89.0					17																	78811786		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.1201A>T	17.37:g.78811786A>T	ENSP00000307272:p.Thr401Ser		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.T401S	ENST00000306801.3	37	c.1201	CCDS11773.1	17	.	.	.	.	.	.	.	.	.	.	A	9.073	0.997454	0.19043	.	.	ENSG00000141564	ENST00000537330;ENST00000306801;ENST00000544334	T;T;T	0.34667	1.35;1.35;1.35	5.27	5.27	0.74061	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.39384	0.1076	N	0.19112	0.55	0.58432	D	0.999992	D;B;B	0.56035	0.974;0.065;0.205	D;B;B	0.67725	0.953;0.023;0.022	T	0.13072	-1.0523	10	0.10377	T	0.69	.	13.1464	0.59463	1.0:0.0:0.0:0.0	.	401;216;401	F5H7J5;F5GXV9;Q8N122	.;.;RPTOR_HUMAN	S	216;401;401	ENSP00000440947:T216S;ENSP00000307272:T401S;ENSP00000442479:T401S	ENSP00000307272:T401S	T	+	1	0	RPTOR	76426381	1.000000	0.71417	0.981000	0.43875	0.385000	0.30292	8.087000	0.89521	1.990000	0.58119	0.455000	0.32223	ACT	RPTOR	-	superfamily_ARM-type_fold	ENSG00000141564		0.607	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	20	0.00	0	A	NM_020761		78811786	78811786	+1	no_errors	ENST00000306801	ensembl	human	known	69_37n	missense	32	28.89	13	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237801707	237801707	+	Silent	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:237801707G>A	ENST00000366574.2	+	45	7160	c.6843G>A	c.(6841-6843)gtG>gtA	p.V2281V	RYR2_ENST00000360064.6_Silent_p.V2279V|RYR2_ENST00000542537.1_Silent_p.V2265V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2281	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGATGCTGGTGTCTAAGGGCT	0.423																																						dbGAP											0													264.0	258.0	260.0					1																	237801707		1918	4141	6059	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6843G>A	1.37:g.237801707G>A			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.V2279	ENST00000366574.2	37	c.6837	CCDS55691.1	1																																																																																			RYR2	-	pfam_Ca-rel_channel	ENSG00000198626		0.423	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	376	0.00	0	G	NM_001035		237801707	237801707	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	564	16.37	111	SNP	0.080	A
RYR2	6262	genome.wustl.edu	37	1	237947615	237947615	+	Missense_Mutation	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:237947615G>T	ENST00000366574.2	+	90	12920	c.12603G>T	c.(12601-12603)caG>caT	p.Q4201H	RYR2_ENST00000360064.6_Missense_Mutation_p.Q4207H|RYR2_ENST00000542537.1_Missense_Mutation_p.Q4185H|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4201			Q -> R (in CPVT1). {ECO:0000269|PubMed:11157710}.		BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGAAATGCAGCTGGCGGCTC	0.517																																						dbGAP											0													76.0	81.0	79.0					1																	237947615		2008	4192	6200	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12603G>T	1.37:g.237947615G>T	ENSP00000355533:p.Gln4201His		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.Q4207H	ENST00000366574.2	37	c.12621	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.574893	0.65878	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.97752	-4.52;-4.52;-4.52	5.54	3.67	0.42095	.	0.000000	0.64402	D	0.000009	D	0.98523	0.9507	M	0.87827	2.91	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.87578	0.998;0.921	D	0.98481	1.0605	10	0.87932	D	0	.	9.2585	0.37597	0.2568:0.0:0.7432:0.0	.	1175;4201	B4DGV4;Q92736	.;RYR2_HUMAN	H	4201;4207;4185;1175	ENSP00000355533:Q4201H;ENSP00000353174:Q4207H;ENSP00000443798:Q4185H	ENSP00000353174:Q4207H	Q	+	3	2	RYR2	236014238	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.942000	0.49018	0.710000	0.31997	0.655000	0.94253	CAG	RYR2	-	NULL	ENSG00000198626		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	55	0.00	0	G	NM_001035		237947615	237947615	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	212	13.11	32	SNP	1.000	T
RYR3	6263	genome.wustl.edu	37	15	34034597	34034597	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr15:34034597C>G	ENST00000389232.4	+	52	7921	c.7851C>G	c.(7849-7851)atC>atG	p.I2617M	RYR3_ENST00000415757.3_Missense_Mutation_p.I2617M	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2617	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGGAATACATCGTCACCAAGT	0.413																																						dbGAP											0													83.0	80.0	81.0					15																	34034597		1891	4119	6010	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7851C>G	15.37:g.34034597C>G	ENSP00000373884:p.Ile2617Met		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.I2617M	ENST00000389232.4	37	c.7851	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	13.88	2.368892	0.42003	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.91180	-2.8;-2.8	5.48	-5.12	0.02893	Ryanodine receptor Ryr (1);	0.480513	0.20907	N	0.083536	D	0.89522	0.6739	L	0.48986	1.54	0.32212	N	0.576435	B;D	0.58268	0.05;0.982	B;D	0.71656	0.025;0.974	D	0.84926	0.0857	10	0.30854	T	0.27	.	5.3952	0.16265	0.0868:0.1353:0.1842:0.5938	.	2617;2617	Q15413-2;Q15413	.;RYR3_HUMAN	M	2617	ENSP00000373884:I2617M;ENSP00000399610:I2617M	ENSP00000354735:I2617M	I	+	3	3	RYR3	31821889	0.078000	0.21339	0.959000	0.39883	0.991000	0.79684	-0.661000	0.05311	-0.700000	0.05070	-0.189000	0.12847	ATC	RYR3	-	pfam_Ryanodine_rcpt,superfamily_ARM-type_fold	ENSG00000198838		0.413	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	157	0.00	0	C			34034597	34034597	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	18	64.00	32	SNP	0.203	G
SEMA3C	10512	genome.wustl.edu	37	7	80447661	80447662	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:80447661_80447662GC>AT	ENST00000265361.3	-	5	961_962	c.400_401GC>AT	c.(400-402)GCt>ATt	p.A134I	SEMA3C_ENST00000419255.2_Missense_Mutation_p.A134I|SEMA3C_ENST00000536800.1_Intron|SEMA3C_ENST00000544525.1_Missense_Mutation_p.A152I	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	134	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGGACTGAAAGCGCCACTCCCA	0.391																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.400_401delinsAT	7.37:g.80447661_80447662delinsAT	ENSP00000265361:p.Ala134Ile		B4DRL8	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Ig_I-set,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.A152V|p.A152T	ENST00000265361.3	37	c.455|c.454	CCDS5596.1	7																																																																																			SEMA3C	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000075223		0.391	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3C	HGNC	protein_coding	OTTHUMT00000253279.1	145|147	0.00	0	G|C	NM_006379		80447661|80447662	80447661|80447662	-1	no_errors	ENST00000544525	ensembl	human	known	69_37n	missense	65|66	27.78|27.47	25	SNP	1.000	A|T
SHE	126669	genome.wustl.edu	37	1	154458425	154458425	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:154458425G>A	ENST00000304760.2	-	5	1381	c.1295C>T	c.(1294-1296)gCc>gTc	p.A432V		NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	432	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.									breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTACTTTAGGGCAATGGAGTA	0.488																																						dbGAP											0													116.0	96.0	103.0					1																	154458425		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.1295C>T	1.37:g.154458425G>A	ENSP00000307369:p.Ala432Val		Q8TEQ5	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.A432V	ENST00000304760.2	37	c.1295	CCDS30877.1	1	.	.	.	.	.	.	.	.	.	.	G	30	5.051981	0.93793	.	.	ENSG00000169291	ENST00000304760	T	0.64260	-0.09	5.41	5.41	0.78517	SH2 motif (4);	0.000000	0.85682	D	0.000000	T	0.68604	0.3019	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67043	-0.5770	10	0.48119	T	0.1	-23.2344	17.9533	0.89061	0.0:0.0:1.0:0.0	.	432	Q5VZ18	SHE_HUMAN	V	432	ENSP00000307369:A432V	ENSP00000307369:A432V	A	-	2	0	SHE	152725049	1.000000	0.71417	0.972000	0.41901	0.932000	0.56968	8.982000	0.93471	2.826000	0.97356	0.561000	0.74099	GCC	SHE	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000169291		0.488	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHE	HGNC	protein_coding	OTTHUMT00000087910.2	111	0.00	0	G	NM_001010846		154458425	154458425	-1	no_errors	ENST00000304760	ensembl	human	known	69_37n	missense	96	23.62	30	SNP	1.000	A
SIGLEC6	946	genome.wustl.edu	37	19	52034507	52034507	+	Silent	SNP	G	G	T	rs78225194	byFrequency	TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:52034507G>T	ENST00000425629.3	-	2	488	c.334C>A	c.(334-336)Cgg>Agg	p.R112R	SIGLEC6_ENST00000343300.4_Silent_p.R112R|SIGLEC6_ENST00000359982.4_Silent_p.R112R|SIGLEC6_ENST00000391797.3_Silent_p.R112R|SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000346477.3_Silent_p.R112R|SIGLEC6_ENST00000436458.1_Silent_p.R76R	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	112	Ig-like V-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		TCCCTCCTCCGGGCATCTCTG	0.527																																						dbGAP											0													80.0	87.0	85.0					19																	52034507		2185	4290	6475	-	-	-	SO:0001819	synonymous_variant	0			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.334C>A	19.37:g.52034507G>T			A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R112	ENST00000425629.3	37	c.334	CCDS12834.3	19																																																																																			SIGLEC6	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000105492		0.527	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	85	0.00	0	G	NM_001245		52034507	52034507	-1	no_errors	ENST00000425629	ensembl	human	known	69_37n	silent	6	93.88	92	SNP	0.000	T
SLC28A3	64078	genome.wustl.edu	37	9	86902989	86902989	+	Silent	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr9:86902989G>T	ENST00000376238.4	-	12	1303	c.1254C>A	c.(1252-1254)ctC>ctA	p.L418L	RP11-380F14.2_ENST00000419815.1_RNA|SLC28A3_ENST00000537648.1_Silent_p.L349L	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	418			L -> I (in dbSNP:rs11568405). {ECO:0000269|PubMed:15738947}.		pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	TGGCATTCTTGAGGGTTATTT	0.473																																					Ovarian(106;425 1539 34835 42413 43572)	dbGAP											0													167.0	169.0	169.0					9																	86902989		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1254C>A	9.37:g.86902989G>T			A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Silent	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.L418	ENST00000376238.4	37	c.1254	CCDS6670.1	9																																																																																			SLC28A3	-	pfam_Nucleos_tra2_C,tigrfam_C_nuclsd_transpt_met_bac	ENSG00000197506		0.473	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC28A3	HGNC	protein_coding	OTTHUMT00000052874.1	362	0.00	0	G	NM_022127		86902989	86902989	-1	no_errors	ENST00000376238	ensembl	human	known	69_37n	silent	40	78.38	145	SNP	0.930	T
SLC44A3	126969	genome.wustl.edu	37	1	95330335	95330335	+	Silent	SNP	G	G	C	rs149609295	byFrequency	TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:95330335G>C	ENST00000271227.6	+	11	1377	c.1275G>C	c.(1273-1275)tcG>tcC	p.S425S	SLC44A3_ENST00000527077.1_Silent_p.S357S|SLC44A3_ENST00000446120.2_Silent_p.S389S|SLC44A3_ENST00000467909.1_Silent_p.S377S|SLC44A3_ENST00000529450.1_Silent_p.S393S|SLC44A3_ENST00000532427.1_Silent_p.S345S|SLC44A3_ENST00000530397.1_3'UTR	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	425					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	CCATCCTTTCGTCTCTCTCCA	0.393																																						dbGAP											0													206.0	194.0	198.0					1																	95330335		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1275G>C	1.37:g.95330335G>C			B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Silent	SNP	pfam_Choline_transptr-like	p.S425	ENST00000271227.6	37	c.1275	CCDS44176.1	1																																																																																			SLC44A3	-	pfam_Choline_transptr-like	ENSG00000143036		0.393	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A3	HGNC	protein_coding	OTTHUMT00000029544.3	233	0.00	0	G	NM_152369		95330335	95330335	+1	no_errors	ENST00000271227	ensembl	human	known	69_37n	silent	73	38.33	46	SNP	0.005	C
SLC30A1	7779	genome.wustl.edu	37	1	211751857	211751857	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:211751857G>A	ENST00000367001.4	-	1	227	c.98C>T	c.(97-99)tCg>tTg	p.S33L		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	33					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		CGCCAGCGACGAGGTCACCCG	0.692																																						dbGAP											0													40.0	39.0	39.0					1																	211751857		2193	4297	6490	-	-	-	SO:0001583	missense	0			AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.98C>T	1.37:g.211751857G>A	ENSP00000355968:p.Ser33Leu		Q0VAK9|Q9BZF6	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.S33L	ENST00000367001.4	37	c.98	CCDS1499.1	1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389784	0.61956	.	.	ENSG00000170385	ENST00000367001	T	0.64438	-0.1	3.49	2.56	0.30785	.	0.482838	0.19944	N	0.102567	T	0.57227	0.2039	L	0.56340	1.77	0.32687	N	0.51474	B	0.28584	0.216	B	0.35688	0.208	T	0.64198	-0.6464	10	0.56958	D	0.05	-0.3366	7.9329	0.29912	0.0:0.1767:0.6408:0.1825	.	33	Q9Y6M5	ZNT1_HUMAN	L	33	ENSP00000355968:S33L	ENSP00000355968:S33L	S	-	2	0	SLC30A1	209818480	1.000000	0.71417	0.812000	0.32479	0.995000	0.86356	3.829000	0.55760	0.663000	0.31027	0.400000	0.26472	TCG	SLC30A1	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000170385		0.692	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A1	HGNC	protein_coding	OTTHUMT00000104738.2	15	0.00	0	G			211751857	211751857	-1	no_errors	ENST00000367001	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.998	A
SLC9A2	6549	genome.wustl.edu	37	2	103321040	103321040	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr2:103321040C>G	ENST00000233969.2	+	10	2025	c.1883C>G	c.(1882-1884)aCa>aGa	p.T628R		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	628					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						ACAGCCGACACAAGTGAGAGA	0.438																																						dbGAP											0													86.0	80.0	82.0					2																	103321040		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1883C>G	2.37:g.103321040C>G	ENSP00000233969:p.Thr628Arg		B2RMS2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.T628R	ENST00000233969.2	37	c.1883	CCDS2062.1	2	.	.	.	.	.	.	.	.	.	.	C	11.12	1.545229	0.27652	.	.	ENSG00000115616	ENST00000233969	T	0.41758	0.99	5.25	5.25	0.73442	.	1.240150	0.05276	N	0.518528	T	0.36552	0.0971	L	0.34521	1.04	0.33867	D	0.634503	P	0.39903	0.694	B	0.37239	0.244	T	0.16276	-1.0408	10	0.16896	T	0.51	.	14.0968	0.65027	0.1505:0.8495:0.0:0.0	.	628	Q9UBY0	SL9A2_HUMAN	R	628	ENSP00000233969:T628R	ENSP00000233969:T628R	T	+	2	0	SLC9A2	102687472	0.985000	0.35326	0.947000	0.38551	0.458000	0.32498	2.973000	0.49264	2.594000	0.87642	0.655000	0.94253	ACA	SLC9A2	-	prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	ENSG00000115616		0.438	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	HGNC	protein_coding	OTTHUMT00000253292.2	87	0.00	0	C			103321040	103321040	+1	no_errors	ENST00000233969	ensembl	human	known	69_37n	missense	186	17.26	39	SNP	0.987	G
SMARCA2	6595	genome.wustl.edu	37	9	2058393	2058393	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr9:2058393C>G	ENST00000382203.1	+	8	1659	c.1450C>G	c.(1450-1452)Cat>Gat	p.H484D	SMARCA2_ENST00000349721.2_Missense_Mutation_p.H484D|SMARCA2_ENST00000357248.2_Missense_Mutation_p.H484D|SMARCA2_ENST00000382194.1_Missense_Mutation_p.H484D			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	484	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GGCAACTTGGCATGCCAACAC	0.478																																						dbGAP											0													133.0	125.0	128.0					9																	2058393		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1450C>G	9.37:g.2058393C>G	ENSP00000371638:p.His484Asp		B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.H484D	ENST00000382203.1	37	c.1450	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	C	19.77	3.888757	0.72524	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000382203;ENST00000382194	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	5.52	5.52	0.82312	Helicase/SANT-associated, DNA binding (1);HAS subgroup (1);HSA (1);	0.000000	0.85682	D	0.000000	D	0.90693	0.7080	M	0.89904	3.07	0.80722	D	1	D;D;D	0.62365	0.988;0.989;0.991	D;D;D	0.78314	0.93;0.985;0.991	D	0.92159	0.5734	10	0.87932	D	0	-18.6277	19.4388	0.94809	0.0:1.0:0.0:0.0	.	85;484;484	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	D	484	ENSP00000265773:H484D;ENSP00000349788:H484D;ENSP00000392081:H484D;ENSP00000371638:H484D;ENSP00000371629:H484D	ENSP00000265773:H484D	H	+	1	0	SMARCA2	2048393	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.743000	0.85020	2.590000	0.87494	0.655000	0.94253	CAT	SMARCA2	-	pfam_HSA,smart_HAS_subgr,pfscan_Helicase/SANT-assoc_DNA-bd	ENSG00000080503		0.478	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	116	0.00	0	C	NM_003070		2058393	2058393	+1	no_errors	ENST00000349721	ensembl	human	known	69_37n	missense	247	13.33	38	SNP	1.000	G
SNAP91	9892	genome.wustl.edu	37	6	84324580	84324580	+	Splice_Site	SNP	C	C	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:84324580C>T	ENST00000439399.2	-	11	1196	c.880G>A	c.(880-882)Gaa>Aaa	p.E294K	SNAP91_ENST00000195649.6_Splice_Site_p.E294K|SNAP91_ENST00000521743.1_Splice_Site_p.E294K|SNAP91_ENST00000369694.2_Splice_Site_p.E294K|SNAP91_ENST00000520302.1_Intron|SNAP91_ENST00000521485.1_Splice_Site_p.E294K|SNAP91_ENST00000428679.2_Intron|SNAP91_ENST00000437520.1_Intron|SNAP91_ENST00000520213.1_Intron	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	294					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		ACTCACCCTTCACTTAAGTTC	0.289																																						dbGAP											0													49.0	46.0	47.0					6																	84324580		1816	4065	5881	-	-	-	SO:0001630	splice_region_variant	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.879-1G>A	6.37:g.84324580C>T			A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	pfam_ANTH,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.E294K	ENST00000439399.2	37	c.880	CCDS47455.1	6	.	.	.	.	.	.	.	.	.	.	C	16.14	3.039484	0.55003	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000521743	T;T;T;T;T	0.13538	2.58;2.59;2.59;2.58;2.59	5.82	4.95	0.65309	.	.	.	.	.	T	0.06600	0.0169	N	0.14661	0.345	0.80722	D	1	.	.	.	.	.	.	T	0.23511	-1.0186	7	0.62326	D	0.03	.	12.2716	0.54710	0.1699:0.8301:0.0:0.0	.	.	.	.	K	294	ENSP00000429776:E294K;ENSP00000358708:E294K;ENSP00000400459:E294K;ENSP00000195649:E294K;ENSP00000428215:E294K	ENSP00000195649:E294K	E	-	1	0	SNAP91	84381299	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.238000	0.58688	1.448000	0.47680	-0.319000	0.08680	GAA	SNAP91	-	NULL	ENSG00000065609		0.289	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	184	0.00	0	C		Missense_Mutation	84324580	84324580	-1	no_errors	ENST00000369694	ensembl	human	known	69_37n	missense	57	54.76	69	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158646004	158646004	+	Missense_Mutation	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr1:158646004C>A	ENST00000368147.4	-	8	1219	c.1039G>T	c.(1039-1041)Gat>Tat	p.D347Y		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	347					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GAGACCAGATCTTCTTTCATC	0.473																																						dbGAP											0													195.0	184.0	188.0					1																	158646004		1922	4137	6059	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1039G>T	1.37:g.158646004C>A	ENSP00000357129:p.Asp347Tyr		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.D347Y	ENST00000368147.4	37	c.1039	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418139	0.83449	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.37584	1.19;1.19	4.95	4.95	0.65309	.	0.248593	0.21031	N	0.081342	T	0.55146	0.1902	M	0.78049	2.395	0.58432	D	0.999996	D	0.64830	0.994	D	0.70227	0.968	T	0.60224	-0.7305	10	0.87932	D	0	.	16.9386	0.86209	0.0:1.0:0.0:0.0	.	347	P02549	SPTA1_HUMAN	Y	347	ENSP00000357130:D347Y;ENSP00000357129:D347Y	ENSP00000357129:D347Y	D	-	1	0	SPTA1	156912628	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	4.981000	0.63819	2.546000	0.85860	0.655000	0.94253	GAT	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	115	0.00	0	C	NM_003126		158646004	158646004	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	71	44.96	58	SNP	1.000	A
SPTBN1	6711	genome.wustl.edu	37	2	54859818	54859818	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr2:54859818C>G	ENST00000356805.4	+	17	3961	c.3680C>G	c.(3679-3681)gCt>gGt	p.A1227G	SPTBN1_ENST00000333896.5_Missense_Mutation_p.A1214G	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1227					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AAGATCAATGCTGTGGTGGAG	0.502																																						dbGAP											0													121.0	107.0	111.0					2																	54859818		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3680C>G	2.37:g.54859818C>G	ENSP00000349259:p.Ala1227Gly		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.A1227G	ENST00000356805.4	37	c.3680	CCDS33198.1	2	.	.	.	.	.	.	.	.	.	.	C	7.387	0.630087	0.14257	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.52295	0.67;0.67	5.46	4.58	0.56647	.	0.228496	0.44902	N	0.000410	T	0.26882	0.0658	N	0.04162	-0.26	0.42659	D	0.993472	B;B	0.02656	0.0;0.0	B;B	0.11329	0.003;0.006	T	0.05784	-1.0864	10	0.15952	T	0.53	.	16.2553	0.82515	0.0:0.8671:0.1329:0.0	.	1214;1227	Q01082-3;Q01082	.;SPTB2_HUMAN	G	1227;1214	ENSP00000349259:A1227G;ENSP00000334156:A1214G	ENSP00000334156:A1214G	A	+	2	0	SPTBN1	54713322	0.549000	0.26481	0.991000	0.47740	0.913000	0.54294	1.013000	0.29937	1.294000	0.44707	-0.176000	0.13171	GCT	SPTBN1	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000115306		0.502	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	HGNC	protein_coding	OTTHUMT00000258115.3	99	0.00	0	C			54859818	54859818	+1	no_errors	ENST00000356805	ensembl	human	known	69_37n	missense	21	85.06	131	SNP	0.992	G
STAC2	342667	genome.wustl.edu	37	17	37369302	37369302	+	Missense_Mutation	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:37369302G>C	ENST00000333461.5	-	10	1446	c.1077C>G	c.(1075-1077)tgC>tgG	p.C359W		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	359					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						AGAAGGGTTGGCAGCAGCGCC	0.612																																						dbGAP											0													73.0	71.0	72.0					17																	37369302		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.1077C>G	17.37:g.37369302G>C	ENSP00000327509:p.Cys359Trp		Q32MA3	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_SH3_domain,prints_p67phox	p.C359W	ENST00000333461.5	37	c.1077	CCDS11335.1	17	.	.	.	.	.	.	.	.	.	.	g	15.98	2.993187	0.54041	.	.	ENSG00000141750	ENST00000333461	T	0.79749	-1.3	5.15	0.898	0.19264	Src homology-3 domain (1);	0.367562	0.32106	N	0.006568	T	0.73837	0.3638	N	0.22421	0.69	0.48511	D	0.999665	D	0.63880	0.993	P	0.55923	0.787	T	0.70385	-0.4886	10	0.87932	D	0	-8.3957	4.8187	0.13379	0.3017:0.0:0.5573:0.141	.	359	Q6ZMT1	STAC2_HUMAN	W	359	ENSP00000327509:C359W	ENSP00000327509:C359W	C	-	3	2	STAC2	34622828	0.960000	0.32886	0.984000	0.44739	0.691000	0.40173	0.439000	0.21575	-0.037000	0.13646	-0.379000	0.06801	TGC	STAC2	-	superfamily_SH3_domain	ENSG00000141750		0.612	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC2	HGNC	protein_coding	OTTHUMT00000444533.2	30	0.00	0	G	NM_198993		37369302	37369302	-1	no_errors	ENST00000333461	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	0.994	C
SYNE1	23345	genome.wustl.edu	37	6	152546921	152546921	+	Missense_Mutation	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:152546921C>G	ENST00000367255.5	-	116	21887	c.21286G>C	c.(21286-21288)Gtc>Ctc	p.V7096L	SYNE1_ENST00000423061.1_Missense_Mutation_p.V7025L|SYNE1_ENST00000356820.4_Missense_Mutation_p.V1620L|SYNE1_ENST00000341594.5_Missense_Mutation_p.V6708L|SYNE1_ENST00000265368.4_Missense_Mutation_p.V7096L|SYNE1_ENST00000448038.1_Missense_Mutation_p.V7025L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7096					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATGCTAGAGACGTCTTCTTTC	0.418										HNSCC(10;0.0054)																												dbGAP											0													209.0	195.0	200.0					6																	152546921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21286G>C	6.37:g.152546921C>G	ENSP00000356224:p.Val7096Leu		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.V7096L	ENST00000367255.5	37	c.21286	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728553	0.30593	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;1.71	5.62	4.74	0.60224	.	0.419077	0.20459	N	0.091937	T	0.35068	0.0919	L	0.54323	1.7	0.34013	D	0.651712	B;B;B	0.32693	0.38;0.38;0.329	B;B;B	0.38562	0.276;0.276;0.18	T	0.24728	-1.0152	10	0.30854	T	0.27	.	15.4593	0.75342	0.0:0.9301:0.0:0.0699	.	7096;7096;7025	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	L	7096;7025;7096;7025;6708;1620;18	ENSP00000356224:V7096L;ENSP00000396024:V7025L;ENSP00000265368:V7096L;ENSP00000390975:V7025L;ENSP00000341887:V6708L;ENSP00000349276:V1620L;ENSP00000356220:V18L	ENSP00000265368:V7096L	V	-	1	0	SYNE1	152588614	1.000000	0.71417	0.861000	0.33841	0.653000	0.38743	5.963000	0.70372	2.810000	0.96702	0.650000	0.86243	GTC	SYNE1	-	pfam_Spectrin_repeat,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.418	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	572	0.00	0	C	NM_182961		152546921	152546921	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	456	26.60	166	SNP	0.992	G
SYNE3	161176	genome.wustl.edu	37	14	95918641	95918641	+	Missense_Mutation	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr14:95918641G>A	ENST00000334258.5	-	6	1231	c.1217C>T	c.(1216-1218)cCt>cTt	p.P406L	SYNE3_ENST00000553340.1_Missense_Mutation_p.P406L|SYNE3_ENST00000557275.1_Missense_Mutation_p.P406L|SYNE3_ENST00000554873.1_Missense_Mutation_p.P163L	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	406					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						CAGGTTGTGAGGGAAGACGAT	0.622											OREG0022900	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													109.0	91.0	97.0					14																	95918641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1217C>T	14.37:g.95918641G>A	ENSP00000334308:p.Pro406Leu	1316	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.P406L	ENST00000334258.5	37	c.1217	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	G	8.083	0.772857	0.16051	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.34275	3.49;1.37;3.49;2.91	4.68	1.61	0.23674	.	1.277740	0.05634	N	0.582213	T	0.27313	0.0670	L	0.38838	1.175	0.31968	N	0.607486	B;B;B	0.13145	0.007;0.007;0.004	B;B;B	0.16289	0.01;0.015;0.004	T	0.36089	-0.9762	10	0.09338	T	0.73	-6.8636	8.6987	0.34312	0.075:0.0:0.6602:0.2648	.	406;406;406	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	L	406;163;406;406	ENSP00000334308:P406L;ENSP00000452154:P163L;ENSP00000450562:P406L;ENSP00000450774:P406L	ENSP00000334308:P406L	P	-	2	0	C14orf49	94988394	1.000000	0.71417	0.010000	0.14722	0.021000	0.10359	3.811000	0.55620	0.506000	0.28125	0.462000	0.41574	CCT	SYNE3	-	NULL	ENSG00000176438		0.622	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	37	0.00	0	G	NM_152592		95918641	95918641	-1	no_errors	ENST00000334258	ensembl	human	known	69_37n	missense	4	92.16	47	SNP	0.508	A
SYNGR4	23546	genome.wustl.edu	37	19	48879377	48879377	+	Silent	SNP	A	A	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:48879377A>T	ENST00000344846.2	+	5	757	c.507A>T	c.(505-507)cgA>cgT	p.R169R	SYNGR4_ENST00000595322.1_Nonsense_Mutation_p.K74*|SYNGR4_ENST00000601610.1_Nonsense_Mutation_p.K146*	NM_012451.3	NP_036583.2	O95473	SNG4_HUMAN	synaptogyrin 4	169	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		AGGACCTCCGAAATGATGCTC	0.602																																						dbGAP											0													110.0	102.0	105.0					19																	48879377		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ011733	CCDS12717.1	19q13.3	2008-07-04				ENSG00000105467			11502	protein-coding gene	gene with protein product		608373					Standard	NM_012451		Approved		uc002piz.3	O95473		ENST00000344846.2:c.507A>T	19.37:g.48879377A>T			Q3KP58	Silent	SNP	pfam_MARVEL-like_dom,pirsf_Synaptogyrin	p.R169	ENST00000344846.2	37	c.507	CCDS12717.1	19																																																																																			SYNGR4	-	pirsf_Synaptogyrin	ENSG00000105467		0.602	SYNGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR4	HGNC	protein_coding	OTTHUMT00000465704.1	33	0.00	0	A			48879377	48879377	+1	no_errors	ENST00000344846	ensembl	human	known	69_37n	silent	7	90.28	65	SNP	0.000	T
TAF1	6872	genome.wustl.edu	37	X	70604808	70604808	+	Missense_Mutation	SNP	A	A	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chrX:70604808A>G	ENST00000373790.4	+	14	2183	c.2132A>G	c.(2131-2133)gAt>gGt	p.D711G	TAF1_ENST00000449580.1_Missense_Mutation_p.D711G|TAF1_ENST00000423759.1_Missense_Mutation_p.D732G|TAF1_ENST00000276072.3_Missense_Mutation_p.D732G	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	711	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				CCTGGAAAAGATCCTGGAGCA	0.398																																						dbGAP											0													106.0	95.0	98.0					X																	70604808		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2132A>G	X.37:g.70604808A>G	ENSP00000362895:p.Asp711Gly		A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D711G	ENST00000373790.4	37	c.2132	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	24.5	4.539655	0.85917	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.43	5.43	0.79202	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.68787	0.3039	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.988	T	0.75534	-0.3284	10	0.87932	D	0	.	14.5152	0.67814	1.0:0.0:0.0:0.0	.	711;732	P21675;P21675-2	TAF1_HUMAN;.	G	711;711;732;732	ENSP00000362895:D711G;ENSP00000389000:D711G;ENSP00000406549:D732G;ENSP00000276072:D732G	ENSP00000276072:D732G	D	+	2	0	TAF1	70521533	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.910000	0.92685	1.808000	0.52836	0.481000	0.45027	GAT	TAF1	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000147133		0.398	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	300	0.00	0	A	NM_004606		70604808	70604808	+1	no_errors	ENST00000449580	ensembl	human	known	69_37n	missense	23	83.45	116	SNP	1.000	G
TBCCD1	55171	genome.wustl.edu	37	3	186272045	186272045	+	Silent	SNP	T	T	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr3:186272045T>G	ENST00000424280.1	-	6	2021	c.1542A>C	c.(1540-1542)acA>acC	p.T514T	TBCCD1_ENST00000479590.1_5'UTR|TBCCD1_ENST00000446782.1_Silent_p.T418T|TBCCD1_ENST00000338733.5_Silent_p.T514T	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	514					cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		ATACTCACTTTGTCAAATGAG	0.378																																						dbGAP											0													68.0	75.0	72.0					3																	186272045		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.1542A>C	3.37:g.186272045T>G			B3KW69|D3DNU6|G5E9J4	Silent	SNP	pfam_Tubulin-bd_cofactor_C,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif	p.T514	ENST00000424280.1	37	c.1542	CCDS3276.1	3																																																																																			TBCCD1	-	NULL	ENSG00000113838		0.378	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCCD1	HGNC	protein_coding	OTTHUMT00000344774.1	50	0.00	0	T	NM_018138		186272045	186272045	-1	no_errors	ENST00000338733	ensembl	human	known	69_37n	silent	39	20.41	10	SNP	1.000	G
TBX18	9096	genome.wustl.edu	37	6	85457662	85457662	+	Silent	SNP	G	G	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr6:85457662G>T	ENST00000369663.5	-	5	1252	c.915C>A	c.(913-915)acC>acA	p.T305T	TBX18_ENST00000606521.1_5'UTR|TBX18_ENST00000606784.1_Silent_p.T147T	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	305					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		AGGCAGTGACGGTTGTGAAGA	0.438																																						dbGAP											0													114.0	97.0	103.0					6																	85457662		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.915C>A	6.37:g.85457662G>T			A2RU13|Q7Z6U4|Q9UJI6	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.T305	ENST00000369663.5	37	c.915	CCDS34495.1	6																																																																																			TBX18	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	ENSG00000112837		0.438	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX18	HGNC	protein_coding	OTTHUMT00000041378.2	141	0.00	0	G	NM_001080508		85457662	85457662	-1	no_errors	ENST00000369663	ensembl	human	known	69_37n	silent	82	55.91	104	SNP	0.975	T
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	167	0.00	0	G	NM_000546		7578212	7578212	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	26	84.02	142	SNP	0.893	A
TRBV30	28557	genome.wustl.edu	37	7	142510440	142510440	+	RNA	SNP	C	C	G			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:142510440C>G	ENST00000417977.2	-	0	277									T cell receptor beta variable 30 (gene/pseudogene)																		CTGCCTGCAGCCTGTCGGTAC	0.612																																						dbGAP											0													33.0	38.0	36.0					7																	142510440		1937	4134	6071	-	-	-			0			L36092		7q34	2012-02-07	2008-09-12		ENSG00000237254	ENSG00000237254		"""T cell receptors / TRB locus"""	12214	other	T cell receptor gene			"""T cell receptor beta variable 30"""			8650574	Standard	NG_001333		Approved	TCRBV20S1A1N2, TCRBV30S1			OTTHUMG00000158907		7.37:g.142510440C>G				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_V-set_subgr,pfscan_Ig-like	p.A56P	ENST00000417977.2	37	c.166		7																																																																																			TRBV30	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000237254		0.612	TRBV30-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV30	HGNC	TR_V_gene	OTTHUMT00000352519.1	43	0.00	0	C	NG_001333		142510440	142510440	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000417977	ensembl	human	known	69_37n	missense	35	36.36	20	SNP	0.008	G
TRIM41	90933	genome.wustl.edu	37	5	180661772	180661772	+	Silent	SNP	T	T	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr5:180661772T>C	ENST00000315073.5	+	6	2600	c.1890T>C	c.(1888-1890)ccT>ccC	p.P630P	TRIM41_ENST00000351937.5_Intron|TRIM41_ENST00000510072.1_3'UTR	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	630	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCTCTGCCCTTGATTATCCT	0.627																																						dbGAP											0													62.0	69.0	67.0					5																	180661772		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.1890T>C	5.37:g.180661772T>C			B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,pfam_DUF3631,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P630	ENST00000315073.5	37	c.1890	CCDS4466.1	5																																																																																			TRIM41	-	superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000146063		0.627	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM41	HGNC	protein_coding	OTTHUMT00000253574.3	34	0.00	0	T	NM_201627		180661772	180661772	+1	no_errors	ENST00000315073	ensembl	human	known	69_37n	silent	36	48.57	34	SNP	0.994	C
TRIM56	81844	genome.wustl.edu	37	7	100730642	100730642	+	Missense_Mutation	SNP	G	G	T	rs375013952		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:100730642G>T	ENST00000306085.6	+	3	346	c.49G>T	c.(49-51)Gac>Tac	p.D17Y		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	17					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTGAGCAGCGACTTCCTGGC	0.627																																					Ovarian(89;1092 1379 22756 38989 39611)	dbGAP											0													80.0	92.0	88.0					7																	100730642		2077	4217	6294	-	-	-	SO:0001583	missense	0			BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.49G>T	7.37:g.100730642G>T	ENSP00000305161:p.Asp17Tyr		Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_CheY-like_superfamily,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.D17Y	ENST00000306085.6	37	c.49	CCDS43625.1	7	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224063	0.58668	.	.	ENSG00000169871	ENST00000306085;ENST00000412507	T;T	0.20069	2.1;2.1	3.71	2.81	0.32909	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.44483	D	0.000455	T	0.41305	0.1153	M	0.73753	2.245	0.26715	N	0.97089	D;D	0.71674	0.996;0.998	D;D	0.70227	0.93;0.968	T	0.13980	-1.0489	10	0.72032	D	0.01	.	9.1958	0.37226	0.0:0.2223:0.7777:0.0	.	17;17	C9JI91;Q9BRZ2	.;TRI56_HUMAN	Y	17	ENSP00000305161:D17Y;ENSP00000404186:D17Y	ENSP00000305161:D17Y	D	+	1	0	TRIM56	100517362	.	.	0.996000	0.52242	0.962000	0.63368	.	.	1.112000	0.41740	0.655000	0.94253	GAC	TRIM56	-	NULL	ENSG00000169871		0.627	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM56	HGNC	protein_coding	OTTHUMT00000347185.1	11	0.00	0	G	NM_030961		100730642	100730642	+1	no_errors	ENST00000306085	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	0.954	T
WDFY4	57705	genome.wustl.edu	37	10	50022127	50022127	+	Splice_Site	SNP	G	G	C			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr10:50022127G>C	ENST00000325239.5	+	30	5367	c.5340G>C	c.(5338-5340)caG>caC	p.Q1780H	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1780						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCATGAGCCAGGTGAGACCCA	0.572											OREG0007651	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																										dbGAP											0													47.0	48.0	48.0					10																	50022127		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.5340+1G>C	10.37:g.50022127G>C		966	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1780H	ENST00000325239.5	37	c.5340	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.59|14.59	2.582335|2.582335	0.46006|0.46006	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002;ENST00000374161|ENST00000426033;ENST00000325239	.|T	.|0.57752	.|0.38	5.83|5.83	4.92|4.92	0.64577|0.64577	.|.	.|0.235595	.|0.35970	.|N	.|0.002865	T|T	0.58764|0.58764	0.2145|0.2145	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|P;B	.|0.50617	.|0.937;0.303	.|P;B	.|0.52267	.|0.694;0.172	T|T	0.57705|0.57705	-0.7765|-0.7765	5|9	.|.	.|.	.|.	.|.	11.2173|11.2173	0.48833|0.48833	0.0862:0.0:0.9138:0.0|0.0862:0.0:0.9138:0.0	.|.	.|308;1780	.|F2Z372;Q6ZS81	.|.;WDFY4_HUMAN	P|H	871;327|1780	.|ENSP00000320563:Q1780H	.|.	A|Q	+|+	1|3	0|2	WDFY4|WDFY4	49692133|49692133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.908000|0.908000	0.53690|0.53690	4.116000|4.116000	0.57871|0.57871	2.757000|2.757000	0.94681|0.94681	0.591000|0.591000	0.81541|0.81541	GCC|CAG	WDFY4	-	NULL	ENSG00000128815		0.572	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		16	0.00	0	G	XM_033379	Missense_Mutation	50022127	50022127	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	missense	35	27.08	13	SNP	1.000	C
WDR17	116966	genome.wustl.edu	37	4	177036997	177036998	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr4:177036997_177036998insA	ENST00000280190.4	+	4	402_403	c.246_247insA	c.(247-249)aaafs	p.K83fs	WDR17_ENST00000508596.1_Frame_Shift_Ins_p.K59fs|WDR17_ENST00000507824.2_Frame_Shift_Ins_p.K83fs|WDR17_ENST00000393643.2_Frame_Shift_Ins_p.K59fs			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	83										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGTCTGAACATAAAAAAACAAT	0.302																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.253dupA	4.37:g.177037004_177037004dupA	ENSP00000280190:p.Lys83fs		E7EQX0|Q0QD35	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T84fs	ENST00000280190.4	37	c.246_247	CCDS3825.1	4																																																																																			WDR17	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000150627		0.302	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	295	0.00	0	-			177036997	177036998	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	frame_shift_ins	81	22.86	24	INS	1.000:1.000	A
MAP3K19	80122	genome.wustl.edu	37	2	135744731	135744731	+	Missense_Mutation	SNP	T	T	G	rs376573579		TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr2:135744731T>G	ENST00000375845.3	-	7	1741	c.1711A>C	c.(1711-1713)Aca>Cca	p.T571P	MAP3K19_ENST00000358371.4_Missense_Mutation_p.T458P|MAP3K19_ENST00000392915.1_Missense_Mutation_p.T588P|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000375844.3_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	571							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										AAAATTTGTGTTTTTATGCTG	0.423																																						dbGAP											0													86.0	89.0	88.0					2																	135744731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.1711A>C	2.37:g.135744731T>G	ENSP00000365005:p.Thr571Pro		B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T571P	ENST00000375845.3	37	c.1711	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	T	3.397	-0.123061	0.06795	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915	T;T;T	0.73047	-0.71;-0.68;1.65	5.81	-1.66	0.08265	.	0.632171	0.14172	N	0.336660	T	0.57051	0.2027	L	0.46157	1.445	0.20926	N	0.999821	B;B;B	0.10296	0.001;0.003;0.002	B;B;B	0.11329	0.002;0.006;0.002	T	0.46652	-0.9176	10	0.48119	T	0.1	.	5.8083	0.18452	0.0958:0.0583:0.2968:0.5491	.	458;588;571	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	P	571;458;588	ENSP00000365005:T571P;ENSP00000351140:T458P;ENSP00000376647:T588P	ENSP00000351140:T458P	T	-	1	0	YSK4	135461201	0.800000	0.28916	0.919000	0.36401	0.045000	0.14185	0.971000	0.29396	-0.457000	0.07033	-1.139000	0.01908	ACA	YSK4	-	NULL	ENSG00000176601		0.423	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	HGNC	protein_coding	OTTHUMT00000158244.1	227	0.00	0	T	NM_025052		135744731	135744731	-1	no_errors	ENST00000375845	ensembl	human	known	69_37n	missense	121	36.32	69	SNP	0.085	G
ZBBX	79740	genome.wustl.edu	37	3	167023671	167023671	+	Missense_Mutation	SNP	T	T	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr3:167023671T>A	ENST00000392766.2	-	17	1825	c.1485A>T	c.(1483-1485)aaA>aaT	p.K495N	ZBBX_ENST00000392767.2_Missense_Mutation_p.K495N|ZBBX_ENST00000392764.1_Missense_Mutation_p.K466N|ZBBX_ENST00000307529.5_Missense_Mutation_p.K495N|ZBBX_ENST00000455345.2_Missense_Mutation_p.K495N	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	495						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TTTCCTCAATTTTTTCAATGT	0.328																																						dbGAP											0													51.0	45.0	47.0					3																	167023671		1807	4071	5878	-	-	-	SO:0001583	missense	0			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1485A>T	3.37:g.167023671T>A	ENSP00000376519:p.Lys495Asn		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	pfam_Znf_B-box	p.K495N	ENST00000392766.2	37	c.1485	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	T	12.04	1.818896	0.32145	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.11495	2.94;2.94;2.93;2.93;2.77	5.54	-4.38	0.03622	.	0.446312	0.25741	N	0.028619	T	0.06872	0.0175	L	0.50333	1.59	0.09310	N	1	B;B	0.12630	0.004;0.006	B;B	0.11329	0.006;0.004	T	0.22034	-1.0228	10	0.48119	T	0.1	-0.328	1.4133	0.02296	0.1207:0.2515:0.2762:0.3516	.	495;495	A8MT70-2;A8MT70	.;ZBBX_HUMAN	N	495;495;495;495;466	ENSP00000376519:K495N;ENSP00000376520:K495N;ENSP00000390232:K495N;ENSP00000305065:K495N;ENSP00000376517:K466N	ENSP00000305065:K495N	K	-	3	2	ZBBX	168506365	0.001000	0.12720	0.000000	0.03702	0.025000	0.11179	-0.106000	0.10890	-0.904000	0.03876	0.528000	0.53228	AAA	ZBBX	-	NULL	ENSG00000169064		0.328	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3	221	0.00	0	T	NM_024687		167023671	167023671	-1	no_errors	ENST00000307529	ensembl	human	known	69_37n	missense	135	16.56	27	SNP	0.000	A
ZC3HAV1	56829	genome.wustl.edu	37	7	138732379	138732379	+	Silent	SNP	C	C	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr7:138732379C>A	ENST00000242351.5	-	13	2986	c.2670G>T	c.(2668-2670)gtG>gtT	p.V890V	ZC3HAV1_ENST00000464606.1_Silent_p.V1012V	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	890	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TATATTCAATCACATATTGTG	0.428																																						dbGAP											0													137.0	130.0	132.0					7																	138732379		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2670G>T	7.37:g.138732379C>A			A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.V890	ENST00000242351.5	37	c.2670	CCDS5851.1	7																																																																																			ZC3HAV1	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000105939		0.428	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1	HGNC	protein_coding	OTTHUMT00000348915.1	119	0.00	0	C	NM_020119		138732379	138732379	-1	no_errors	ENST00000242351	ensembl	human	known	69_37n	silent	40	42.03	29	SNP	1.000	A
ZNF761	388561	genome.wustl.edu	37	19	53959355	53959355	+	RNA	SNP	A	A	T			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:53959355A>T	ENST00000454407.1	+	0	2047							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		CAAGACCTTTAGTTGGAAGTC	0.453																																						dbGAP											0													103.0	101.0	102.0					19																	53959355		2203	4300	6503	-	-	-			0			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959355A>T			Q6ZNB9	RNA	SNP	-	NULL	ENST00000454407.1	37	NULL		19																																																																																			ZNF761	-	-	ENSG00000160336		0.453	ZNF761-203	KNOWN	basic	processed_transcript	ZNF761	HGNC	processed_transcript		94	0.00	0	A	NM_001008401		53959355	53959355	+1	no_errors	ENST00000334095	ensembl	human	known	69_37n	rna	38	61.22	60	SNP	0.010	T
ZNF761	388561	genome.wustl.edu	37	19	53959652	53959652	+	RNA	SNP	G	G	A			TCGA-AO-A124-01A-11D-A10M-09	TCGA-AO-A124-10A-01D-A10M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	987528ac-437a-4eb8-a335-4f2076d5c006	0c4d979c-75f8-49bd-8e65-f980cbeae267	g.chr19:53959652G>A	ENST00000454407.1	+	0	2344							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TCATACCGGAGAGAAACCTTA	0.413																																						dbGAP											0													107.0	112.0	110.0					19																	53959652		2203	4300	6503	-	-	-			0			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959652G>A			Q6ZNB9	RNA	SNP	-	NULL	ENST00000454407.1	37	NULL		19																																																																																			ZNF761	-	-	ENSG00000160336		0.413	ZNF761-203	KNOWN	basic	processed_transcript	ZNF761	HGNC	processed_transcript		182	0.00	0	G	NM_001008401		53959652	53959652	+1	no_errors	ENST00000334095	ensembl	human	known	69_37n	rna	136	24.02	43	SNP	1.000	A
