#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB11	8647	genome.wustl.edu	37	2	169826001	169826001	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:169826001C>A	ENST00000263817.6	-	16	1994	c.1870G>T	c.(1870-1872)Gat>Tat	p.D624Y		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	624	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ATGATGGTATCTGCAGCTCTG	0.433																																						dbGAP											0													104.0	96.0	98.0					2																	169826001		1967	4168	6135	-	-	-	SO:0001583	missense	0			AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.1870G>T	2.37:g.169826001C>A	ENSP00000263817:p.Asp624Tyr		Q53TL2|Q9UNB2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.D624Y	ENST00000263817.6	37	c.1870	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	C	18.02	3.531120	0.64972	.	.	ENSG00000073734	ENST00000263817	D	0.82081	-1.57	5.5	5.5	0.81552	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.94089	0.8105	H	0.95645	3.7	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.73380	0.98;0.98	D	0.95481	0.8560	10	0.87932	D	0	.	19.3783	0.94521	0.0:1.0:0.0:0.0	.	66;624	B4DZQ8;O95342	.;ABCBB_HUMAN	Y	624	ENSP00000263817:D624Y	ENSP00000263817:D624Y	D	-	1	0	ABCB11	169534247	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	4.882000	0.63121	2.573000	0.86826	0.585000	0.79938	GAT	ABCB11	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000073734		0.433	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	179	0.00	0	C	NM_003742		169826001	169826001	-1	no_errors	ENST00000263817	ensembl	human	known	69_37n	missense	68	26.88	25	SNP	1.000	A
ABCC9	10060	genome.wustl.edu	37	12	22086720	22086720	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:22086720C>G	ENST00000261201.4	-	2	279	c.280G>C	c.(280-282)Gac>Cac	p.D94H	ABCC9_ENST00000261200.4_Missense_Mutation_p.D94H|ABCC9_ENST00000538350.1_Missense_Mutation_p.D94H|ABCC9_ENST00000326684.4_Missense_Mutation_p.D94H|ABCC9_ENST00000345162.2_Missense_Mutation_p.D94H	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	94					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	ACTTACGAGTCTGAAACAATG	0.398																																						dbGAP											0													148.0	128.0	135.0					12																	22086720		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.280G>C	12.37:g.22086720C>G	ENSP00000261201:p.Asp94His		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.D94H	ENST00000261201.4	37	c.280	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709354	0.48517	.	.	ENSG00000069431	ENST00000261200;ENST00000261201;ENST00000345162;ENST00000326684;ENST00000538350	D;D;D;D;D	0.97209	-4.29;-4.29;-4.29;-4.29;-4.29	4.62	4.62	0.57501	.	0.094391	0.64402	D	0.000001	D	0.96244	0.8775	M	0.68952	2.095	0.44798	D	0.997805	B;B;B;B	0.23854	0.079;0.044;0.092;0.058	B;B;B;B	0.27262	0.067;0.047;0.078;0.035	D	0.95024	0.8163	10	0.72032	D	0.01	.	18.0058	0.89209	0.0:1.0:0.0:0.0	.	94;94;94;94	G3V1N6;Q8N4N7;O60706;O60706-2	.;.;ABCC9_HUMAN;.	H	94	ENSP00000261200:D94H;ENSP00000261201:D94H;ENSP00000261202:D94H;ENSP00000317518:D94H;ENSP00000442604:D94H	ENSP00000261200:D94H	D	-	1	0	ABCC9	21977987	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	4.202000	0.58446	2.573000	0.86826	0.471000	0.43371	GAC	ABCC9	-	NULL	ENSG00000069431		0.398	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	183	0.00	0	C	NM_005691		22086720	22086720	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	missense	90	14.15	15	SNP	1.000	G
ABCG5	64240	genome.wustl.edu	37	2	44065696	44065696	+	Silent	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:44065696G>C	ENST00000260645.1	-	1	262	c.123C>G	c.(121-123)ctC>ctG	p.L41L	ABCG5_ENST00000543989.1_5'UTR|ABCG5_ENST00000405322.1_5'UTR|ABCG8_ENST00000272286.2_5'Flank	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	41					ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	AGGAGGCATGGAGGATGCCCA	0.677																																						dbGAP											0													11.0	13.0	12.0					2																	44065696		2198	4289	6487	-	-	-	SO:0001819	synonymous_variant	0			T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.123C>G	2.37:g.44065696G>C			Q2T9G2|Q96QZ2|Q96QZ3	Silent	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L41	ENST00000260645.1	37	c.123	CCDS1814.1	2																																																																																			ABCG5	-	NULL	ENSG00000138075		0.677	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG5	HGNC	protein_coding	OTTHUMT00000250675.1	15	0.00	0	G	NM_022436		44065696	44065696	-1	no_errors	ENST00000260645	ensembl	human	known	69_37n	silent	26	21.21	7	SNP	0.016	C
ACOT4	122970	genome.wustl.edu	37	14	74062026	74062026	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:74062026G>C	ENST00000326303.4	+	3	1188	c.934G>C	c.(934-936)Gag>Cag	p.E312Q		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	312					acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		GATTCCAATAGAGAAGGCCCA	0.507																																						dbGAP											0													72.0	70.0	70.0					14																	74062026		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.934G>C	14.37:g.74062026G>C	ENSP00000323071:p.Glu312Gln		Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Missense_Mutation	SNP	pfam_BAAT_C,pfam_Thio_Ohase/aa_AcTrfase,pirsf_Acyl-CoA_thioEstase_long-chain	p.E312Q	ENST00000326303.4	37	c.934	CCDS9817.1	14	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246187	0.80024	.	.	ENSG00000177465	ENST00000326303	T	0.49432	0.78	5.63	4.74	0.60224	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.219003	0.46758	D	0.000264	T	0.68183	0.2973	M	0.83118	2.625	0.58432	D	0.999999	D	0.71674	0.998	D	0.63283	0.913	T	0.74074	-0.3782	10	0.72032	D	0.01	-12.1161	13.9349	0.64020	0.0738:0.0:0.9262:0.0	.	312	Q8N9L9	ACOT4_HUMAN	Q	312	ENSP00000323071:E312Q	ENSP00000323071:E312Q	E	+	1	0	ACOT4	73131779	1.000000	0.71417	0.923000	0.36655	0.885000	0.51271	8.890000	0.92477	1.370000	0.46153	0.561000	0.74099	GAG	ACOT4	-	pfam_BAAT_C,pirsf_Acyl-CoA_thioEstase_long-chain	ENSG00000177465		0.507	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT4	HGNC	protein_coding	OTTHUMT00000404298.2	55	0.00	0	G	NM_152331		74062026	74062026	+1	no_errors	ENST00000326303	ensembl	human	known	69_37n	missense	67	26.09	24	SNP	0.999	C
ADAM18	8749	genome.wustl.edu	37	8	39495172	39495172	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr8:39495172G>T	ENST00000265707.5	+	9	822	c.777G>T	c.(775-777)tgG>tgT	p.W259C	ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000379866.1_Missense_Mutation_p.W235C	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	259	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TTTTGGCATGGAAACGGGACT	0.358																																						dbGAP											0													108.0	104.0	105.0					8																	39495172		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.777G>T	8.37:g.39495172G>T	ENSP00000265707:p.Trp259Cys		B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.W259C	ENST00000265707.5	37	c.777	CCDS6113.1	8	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819554	0.50633	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000522198	T;T	0.74842	-0.88;-0.88	5.3	4.42	0.53409	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.310895	0.23859	N	0.043865	D	0.82536	0.5058	M	0.64080	1.96	0.80722	D	1	P;D	0.53151	0.948;0.958	D;D	0.68765	0.932;0.96	D	0.83620	0.0139	10	0.72032	D	0.01	.	11.2439	0.48985	0.0:0.0:0.8176:0.1824	.	235;259	Q9Y3Q7-2;Q9Y3Q7	.;ADA18_HUMAN	C	259;235;191	ENSP00000265707:W259C;ENSP00000369195:W235C	ENSP00000265707:W259C	W	+	3	0	ADAM18	39614329	1.000000	0.71417	0.983000	0.44433	0.733000	0.41908	3.927000	0.56499	1.473000	0.48159	0.650000	0.86243	TGG	ADAM18	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000168619		0.358	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM18	HGNC	protein_coding	OTTHUMT00000376916.1	253	0.00	0	G	NM_014237		39495172	39495172	+1	no_errors	ENST00000265707	ensembl	human	known	69_37n	missense	71	23.66	22	SNP	1.000	T
ADAMTS1	9510	genome.wustl.edu	37	21	28212328	28212328	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr21:28212328C>G	ENST00000284984.3	-	6	2172	c.1718G>C	c.(1717-1719)aGa>aCa	p.R573T		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	573	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		ACCGCACGTTCTCGAACAGTC	0.488																																						dbGAP											0													106.0	89.0	95.0					21																	28212328		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1718G>C	21.37:g.28212328C>G	ENSP00000284984:p.Arg573Thr		D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS1,prints_Peptidase_M12B_ADAM-TS	p.R573T	ENST00000284984.3	37	c.1718	CCDS33524.1	21	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125920	0.77436	.	.	ENSG00000154734	ENST00000284984	T	0.51574	0.7	5.11	5.11	0.69529	.	.	.	.	.	T	0.72755	0.3500	M	0.82923	2.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76410	-0.2969	9	0.87932	D	0	.	19.0887	0.93217	0.0:1.0:0.0:0.0	.	573	Q9UHI8	ATS1_HUMAN	T	573	ENSP00000284984:R573T	ENSP00000284984:R573T	R	-	2	0	ADAMTS1	27134199	1.000000	0.71417	0.932000	0.37286	0.484000	0.33280	7.320000	0.79064	2.826000	0.97356	0.655000	0.94253	AGA	ADAMTS1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS	ENSG00000154734		0.488	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS1	HGNC	protein_coding	OTTHUMT00000171650.2	229	0.00	0	C			28212328	28212328	-1	no_errors	ENST00000284984	ensembl	human	known	69_37n	missense	105	17.83	23	SNP	1.000	G
ADAMTSL1	92949	genome.wustl.edu	37	9	18662042	18662042	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:18662042G>A	ENST00000380548.4	+	9	1395	c.1056G>A	c.(1054-1056)caG>caA	p.Q352Q	ADAMTSL1_ENST00000380566.4_Silent_p.Q352Q|ADAMTSL1_ENST00000327883.7_Silent_p.Q352Q|ADAMTSL1_ENST00000276935.6_Silent_p.Q352Q	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	352						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCAAGCTTCAGGAGTGCAACT	0.418																																						dbGAP											0													152.0	134.0	140.0					9																	18662042		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.1056G>A	9.37:g.18662042G>A			A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_ADAM_spacer1,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Thrombospondin_1_rpt	p.Q352	ENST00000380548.4	37	c.1056	CCDS47954.1	9																																																																																			ADAMTSL1	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt	ENSG00000178031		0.418	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	124	0.00	0	G			18662042	18662042	+1	no_errors	ENST00000327883	ensembl	human	known	69_37n	silent	57	19.72	14	SNP	1.000	A
ADORA1	134	genome.wustl.edu	37	1	203134926	203134926	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:203134926G>A	ENST00000367236.4	+	3	1800	c.879G>A	c.(877-879)caG>caA	p.Q293Q	ADORA1_ENST00000472535.1_3'UTR|ADORA1_ENST00000367235.1_3'UTR|ADORA1_ENST00000337894.4_Silent_p.Q293Q|ADORA1_ENST00000309502.3_Silent_p.Q293Q	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor	293					activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	TCCGCATCCAGAAGTTCCGCG	0.557																																						dbGAP											0													207.0	151.0	170.0					1																	203134926		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.879G>A	1.37:g.203134926G>A			A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adenosn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Adeno_A1_rcpt	p.Q293	ENST00000367236.4	37	c.879	CCDS1434.1	1																																																																																			ADORA1	-	pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn	ENSG00000163485		0.557	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA1	HGNC	protein_coding	OTTHUMT00000100273.1	236	0.00	0	G	NM_000674		203134926	203134926	+1	no_errors	ENST00000309502	ensembl	human	known	69_37n	silent	97	19.17	23	SNP	1.000	A
ADRA1D	146	genome.wustl.edu	37	20	4229170	4229170	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr20:4229170C>T	ENST00000379453.4	-	1	551	c.435G>A	c.(433-435)ctG>ctA	p.L145L		NM_000678.3	NP_000669.1	P25100	ADA1D_HUMAN	adrenoceptor alpha 1D	145					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			endometrium(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	14					Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CGGTGGCGCTCAGCAGCAGGT	0.632																																						dbGAP											0													47.0	59.0	55.0					20																	4229170		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U03864	CCDS13079.1	20p13	2012-08-08	2012-05-09		ENSG00000171873	ENSG00000171873		"""GPCR / Class A : Adrenoceptors : alpha"""	280	protein-coding gene	gene with protein product		104219	"""adrenergic, alpha-1D-, receptor"""			8039425	Standard	NM_000678		Approved	ADRA1R, ADRA1A, ADRA1	uc002wkr.2	P25100	OTTHUMG00000031779	ENST00000379453.4:c.435G>A	20.37:g.4229170C>T			Q9NPY0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Adren_rcpt_A1A,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.L145	ENST00000379453.4	37	c.435	CCDS13079.1	20																																																																																			ADRA1D	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000171873		0.632	ADRA1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRA1D	HGNC	protein_coding	OTTHUMT00000077812.2	60	0.00	0	C	NM_000678		4229170	4229170	-1	no_errors	ENST00000379453	ensembl	human	known	69_37n	silent	66	16.46	13	SNP	0.997	T
GMPPB	29925	genome.wustl.edu	37	3	49756806	49756806	+	3'UTR	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:49756806G>C	ENST00000480687.1	-	0	3578				RNF123_ENST00000433785.1_Intron|RNF123_ENST00000327697.6_Intron|RNF123_ENST00000497099.1_Intron|AMIGO3_ENST00000535833.1_Silent_p.L31L|AMIGO3_ENST00000320431.7_Silent_p.L31L			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGCAGTTGTGGAGCGCACGGG	0.652											OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													56.0	62.0	60.0					3																	49756806		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*2379C>G	3.37:g.49756806G>C		964	A8K6N5|Q9H7U3	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L31	ENST00000480687.1	37	c.93	CCDS2803.1	3																																																																																			AMIGO3	-	NULL	ENSG00000176020		0.652	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO3	HGNC	protein_coding	OTTHUMT00000350291.1	36	0.00	0	G	NM_013334		49756806	49756806	-1	no_errors	ENST00000320431	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	0.021	C
ALCAM	214	genome.wustl.edu	37	3	105271008	105271008	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:105271008G>A	ENST00000306107.5	+	13	2028	c.1528G>A	c.(1528-1530)Gag>Aag	p.E510K	ALCAM_ENST00000486979.2_Missense_Mutation_p.E459K|ALCAM_ENST00000472644.2_Intron|ALCAM_ENST00000389927.4_Missense_Mutation_p.E232K	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	510					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						AGAACACGATGAGGCAGACGA	0.323																																						dbGAP											0													91.0	84.0	87.0					3																	105271008		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.1528G>A	3.37:g.105271008G>A	ENSP00000305988:p.Glu510Lys		B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like	p.E510K	ENST00000306107.5	37	c.1528	CCDS33810.1	3	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337963	0.60963	.	.	ENSG00000170017	ENST00000306107;ENST00000486979;ENST00000389927	T;T;T	0.58210	0.48;0.35;1.17	5.71	5.71	0.89125	.	0.345825	0.32608	N	0.005864	T	0.34019	0.0883	N	0.08118	0	0.49299	D	0.999777	P;P	0.48089	0.905;0.629	B;B	0.39706	0.225;0.307	T	0.17745	-1.0359	10	0.15499	T	0.54	-6.3265	19.8379	0.96666	0.0:0.0:1.0:0.0	.	232;510	Q6ZS95;Q13740	.;CD166_HUMAN	K	510;459;232	ENSP00000305988:E510K;ENSP00000418213:E459K;ENSP00000374577:E232K	ENSP00000305988:E510K	E	+	1	0	ALCAM	106753698	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.400000	0.73252	2.693000	0.91896	0.650000	0.86243	GAG	ALCAM	-	NULL	ENSG00000170017		0.323	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALCAM	HGNC	protein_coding	OTTHUMT00000353764.1	192	0.00	0	G	NM_001627		105271008	105271008	+1	no_errors	ENST00000306107	ensembl	human	known	69_37n	missense	90	12.62	13	SNP	1.000	A
ANK3	288	genome.wustl.edu	37	10	62038849	62038849	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr10:62038849C>G	ENST00000280772.2	-	3	465	c.274G>C	c.(274-276)Gag>Cag	p.E92Q	ANK3_ENST00000373827.2_Missense_Mutation_p.E86Q|ANK3_ENST00000503366.1_Missense_Mutation_p.E75Q	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	92					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TGCAGCAGCTCAGAAACAACC	0.438																																						dbGAP											0													106.0	108.0	107.0					10																	62038849		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.274G>C	10.37:g.62038849C>G	ENSP00000280772:p.Glu92Gln		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.E92Q	ENST00000280772.2	37	c.274	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.183778	0.94885	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000503925	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.37	5.37	0.77165	Ankyrin repeat-containing domain (4);	0.000000	0.42964	D	0.000637	T	0.69369	0.3103	N	0.20328	0.56	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.994;1.0;0.998	T	0.73665	-0.3911	10	0.87932	D	0	.	19.2966	0.94124	0.0:1.0:0.0:0.0	.	75;86;92	E9PE32;Q5CZH9;Q12955	.;.;ANK3_HUMAN	Q	92;86;75;54;66	ENSP00000280772:E92Q;ENSP00000362933:E86Q;ENSP00000425236:E75Q;ENSP00000426011:E66Q	ENSP00000280772:E92Q	E	-	1	0	ANK3	61708855	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.783000	0.68982	2.793000	0.96121	0.655000	0.94253	GAG	ANK3	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151150		0.438	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	151	0.00	0	C	NM_020987		62038849	62038849	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	75	19.35	18	SNP	1.000	G
ANKRD31	256006	genome.wustl.edu	37	5	74441898	74441898	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:74441898G>C	ENST00000274361.3	-	14	3529	c.3338C>G	c.(3337-3339)tCt>tGt	p.S1113C	ANKRD31_ENST00000504022.1_Intron|ANKRD31_ENST00000506364.2_Missense_Mutation_p.S1113C	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	1113										endometrium(1)|kidney(4)	5						AGTGGAATGAGAATCTATATT	0.318																																						dbGAP											0													191.0	155.0	166.0					5																	74441898		692	1589	2281	-	-	-	SO:0001583	missense	0			AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.3338C>G	5.37:g.74441898G>C	ENSP00000274361:p.Ser1113Cys			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S1113C	ENST00000274361.3	37	c.3338		5	.	.	.	.	.	.	.	.	.	.	G	6.670	0.492247	0.12702	.	.	ENSG00000145700	ENST00000274361	T	0.60672	0.17	5.14	1.44	0.22558	.	.	.	.	.	T	0.40423	0.1116	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.32877	-0.9890	7	0.54805	T	0.06	.	6.8179	0.23841	0.7049:0.0:0.2951:0.0	.	.	.	.	C	1113	ENSP00000274361:S1113C	ENSP00000274361:S1113C	S	-	2	0	ANKRD31	74477654	0.350000	0.24878	0.000000	0.03702	0.038000	0.13279	2.258000	0.43249	0.065000	0.16485	-0.469000	0.05056	TCT	ANKRD31	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000145700		0.318	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	HGNC	protein_coding		243	0.00	0	G	NM_001164443		74441898	74441898	-1	no_errors	ENST00000274361	ensembl	human	known	69_37n	missense	65	19.75	16	SNP	0.000	C
ANO8	57719	genome.wustl.edu	37	19	17444235	17444235	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:17444235C>G	ENST00000159087.4	-	3	504	c.346G>C	c.(346-348)Gag>Cag	p.E116Q	GTPBP3_ENST00000361619.5_5'Flank	NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	116					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						ACTCGCCTCTCATACGTGGCG	0.647																																						dbGAP											0													116.0	117.0	117.0					19																	17444235		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.346G>C	19.37:g.17444235C>G	ENSP00000159087:p.Glu116Gln		A6NIJ0	Missense_Mutation	SNP	pfam_Anoctamin	p.E116Q	ENST00000159087.4	37	c.346	CCDS32949.1	19	.	.	.	.	.	.	.	.	.	.	c	30	5.056788	0.93793	.	.	ENSG00000074855	ENST00000159087	T	0.62498	0.02	5.12	5.12	0.69794	.	0.104924	0.64402	D	0.000007	T	0.75620	0.3874	M	0.73598	2.24	0.40713	D	0.982596	D	0.53745	0.962	P	0.58577	0.841	T	0.78380	-0.2226	10	0.51188	T	0.08	.	16.0656	0.80867	0.0:1.0:0.0:0.0	.	116	Q9HCE9	ANO8_HUMAN	Q	116	ENSP00000159087:E116Q	ENSP00000159087:E116Q	E	-	1	0	ANO8	17305235	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	7.002000	0.76304	2.392000	0.81423	0.550000	0.68814	GAG	ANO8	-	NULL	ENSG00000074855		0.647	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO8	HGNC	protein_coding	OTTHUMT00000462943.1	115	0.00	0	C	XM_050644		17444235	17444235	-1	no_errors	ENST00000159087	ensembl	human	known	69_37n	missense	80	20.00	20	SNP	1.000	G
ARHGEF33	100271715	genome.wustl.edu	37	2	39184142	39184142	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:39184142C>T	ENST00000536934.1	+	12	1409	c.1324C>T	c.(1324-1326)Caa>Taa	p.Q442*	ARHGEF33_ENST00000409978.1_Nonsense_Mutation_p.Q442*|ARHGEF33_ENST00000398800.4_Nonsense_Mutation_p.Q442*			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	442							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						CCTGCTGTTTCAATGCAATGA	0.463																																						dbGAP											0													145.0	114.0	124.0					2																	39184142		692	1591	2283	-	-	-	SO:0001587	stop_gained	0				CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.1324C>T	2.37:g.39184142C>T	ENSP00000445586:p.Gln442*		J3KPX2	Nonsense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_Prefoldin,smart_DH-domain,pfscan_DH-domain	p.Q442*	ENST00000536934.1	37	c.1324		2	.	.	.	.	.	.	.	.	.	.	C	38	7.263846	0.98171	.	.	ENSG00000214694	ENST00000409978;ENST00000398800;ENST00000536934	.	.	.	5.26	5.26	0.73747	.	0.000000	0.64402	U	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-9.7166	19.225	0.93815	0.0:1.0:0.0:0.0	.	.	.	.	X	442	.	ENSP00000381780:Q442X	Q	+	1	0	ARHGEF33	39037646	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.184000	0.72008	2.600000	0.87896	0.650000	0.86243	CAA	ARHGEF33	-	superfamily_DH-domain	ENSG00000214694		0.463	ARHGEF33-202	KNOWN	basic	protein_coding	ARHGEF33	HGNC	protein_coding		200	0.00	0	C	NM_001145451		39184142	39184142	+1	no_errors	ENST00000398800	ensembl	human	known	69_37n	nonsense	94	12.84	14	SNP	1.000	T
ARHGEF9	23229	genome.wustl.edu	37	X	62885817	62885817	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:62885817G>T	ENST00000253401.6	-	7	1805	c.1005C>A	c.(1003-1005)aaC>aaA	p.N335K	ARHGEF9_ENST00000374872.1_Missense_Mutation_p.N314K|ARHGEF9_ENST00000433323.2_Intron|ARHGEF9_ENST00000495564.1_Intron|ARHGEF9_ENST00000374878.1_Missense_Mutation_p.N333K|ARHGEF9_ENST00000374870.4_Missense_Mutation_p.N233K|ARHGEF9_ENST00000437457.2_Missense_Mutation_p.N282K	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	335	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N335K(1)|p.N333K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						CCCGCTGCTGGTTGCGGCCGT	0.577																																						dbGAP											2	Substitution - Missense(2)	endometrium(2)											110.0	86.0	94.0					X																	62885817		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.1005C>A	X.37:g.62885817G>T	ENSP00000253401:p.Asn335Lys		A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.N335K	ENST00000253401.6	37	c.1005	CCDS35315.1	X	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535456	0.45176	.	.	ENSG00000131089	ENST00000253401;ENST00000374878;ENST00000437457;ENST00000374870;ENST00000374872	T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86	5.08	3.32	0.38043	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.094560	0.64402	D	0.000001	T	0.47248	0.1435	N	0.04297	-0.235	0.80722	D	1	B;B;B	0.20459	0.005;0.045;0.045	B;B;B	0.26416	0.026;0.069;0.043	T	0.39722	-0.9600	10	0.02654	T	1	.	9.6486	0.39883	0.176:0.0:0.824:0.0	.	282;333;335	B4DHC7;B1AMR4;O43307	.;.;ARHG9_HUMAN	K	335;333;282;233;314	ENSP00000253401:N335K;ENSP00000364012:N333K;ENSP00000399994:N282K;ENSP00000364004:N233K;ENSP00000364006:N314K	ENSP00000253401:N335K	N	-	3	2	ARHGEF9	62802542	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.173000	0.50839	0.392000	0.25172	-0.192000	0.12808	AAC	ARHGEF9	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000131089		0.577	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	HGNC	protein_coding	OTTHUMT00000056937.1	217	0.00	0	G			62885817	62885817	-1	no_errors	ENST00000253401	ensembl	human	known	69_37n	missense	166	16.50	33	SNP	1.000	T
ARID2	196528	genome.wustl.edu	37	12	46245928	46245928	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:46245928C>G	ENST00000334344.6	+	15	4194	c.4022C>G	c.(4021-4023)tCa>tGa	p.S1341*	ARID2_ENST00000422737.1_Nonsense_Mutation_p.S1192*|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000444670.1_Nonsense_Mutation_p.S951*|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1341					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AAACAGAACTCAGAACAAATA	0.368			"""N, S, F"""		hepatocellular carcinoma																																	dbGAP		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0													65.0	63.0	64.0					12																	46245928		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4022C>G	12.37:g.46245928C>G	ENSP00000335044:p.Ser1341*		Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S1341*	ENST00000334344.6	37	c.4022	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	C	43	9.892624	0.99289	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	.	.	.	6.07	2.94	0.34122	.	0.574954	0.19434	N	0.114344	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4222	6.9783	0.24688	0.0:0.6069:0.0:0.3931	.	.	.	.	X	1341;458;458;1192;951	.	ENSP00000335044:S1341X	S	+	2	0	ARID2	44532195	0.993000	0.37304	0.983000	0.44433	0.970000	0.65996	0.785000	0.26830	0.902000	0.36520	0.655000	0.94253	TCA	ARID2	-	NULL	ENSG00000189079		0.368	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	88	0.00	0	C	XM_350875		46245928	46245928	+1	no_errors	ENST00000334344	ensembl	human	known	69_37n	nonsense	56	13.85	9	SNP	0.797	G
ARMCX5	64860	genome.wustl.edu	37	X	101858368	101858368	+	Silent	SNP	T	T	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:101858368T>C	ENST00000604957.1	+	1	3921	c.1299T>C	c.(1297-1299)taT>taC	p.Y433Y	RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000541409.1_Silent_p.Y433Y|ARMCX5_ENST00000537008.1_Silent_p.Y433Y|ARMCX5_ENST00000536530.1_Silent_p.Y433Y|ARMCX5_ENST00000246174.2_Silent_p.Y433Y|RP4-769N13.6_ENST00000476910.2_RNA|ARMCX5_ENST00000372742.1_Silent_p.Y433Y	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	433										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						TTACCAGTTATATTCCAGATT	0.373																																						dbGAP											0													55.0	53.0	54.0					X																	101858368		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1299T>C	X.37:g.101858368T>C			B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.Y433	ENST00000604957.1	37	c.1299	CCDS14500.1	X																																																																																			ARMCX5	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000125962		0.373	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX5	HGNC	protein_coding	OTTHUMT00000469659.1	135	0.00	0	T	NM_022838		101858368	101858368	+1	no_errors	ENST00000246174	ensembl	human	known	69_37n	silent	43	15.69	8	SNP	0.051	C
ATF7IP2	80063	genome.wustl.edu	37	16	10567815	10567815	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:10567815G>C	ENST00000396560.2	+	10	1745	c.1518G>C	c.(1516-1518)ttG>ttC	p.L506F	ATF7IP2_ENST00000356427.2_Missense_Mutation_p.L506F|ATF7IP2_ENST00000543967.1_Missense_Mutation_p.L50F|ATF7IP2_ENST00000324570.5_Intron|ATF7IP2_ENST00000396559.1_Intron	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	506					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						TAATTGATTTGACAAAAGAAG	0.299																																						dbGAP											0													38.0	40.0	39.0					16																	10567815		2196	4300	6496	-	-	-	SO:0001583	missense	0			AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.1518G>C	16.37:g.10567815G>C	ENSP00000379808:p.Leu506Phe		B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.L506F	ENST00000396560.2	37	c.1518	CCDS10540.1	16	.	.	.	.	.	.	.	.	.	.	G	8.746	0.920184	0.17982	.	.	ENSG00000166669	ENST00000543967;ENST00000396560;ENST00000356427	T;T;T	0.31247	1.53;1.5;1.5	4.32	1.2	0.21068	.	0.309106	0.21998	N	0.066050	T	0.27559	0.0677	L	0.58101	1.795	0.80722	D	1	B	0.22003	0.063	B	0.27887	0.084	T	0.08597	-1.0714	10	0.59425	D	0.04	-0.9932	6.2186	0.20669	0.334:0.0:0.666:0.0	.	506	Q5U623	MCAF2_HUMAN	F	50;506;506	ENSP00000446119:L50F;ENSP00000379808:L506F;ENSP00000348799:L506F	ENSP00000348799:L506F	L	+	3	2	ATF7IP2	10475316	0.998000	0.40836	0.981000	0.43875	0.464000	0.32679	1.414000	0.34736	0.320000	0.23234	0.579000	0.79373	TTG	ATF7IP2	-	NULL	ENSG00000166669		0.299	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF7IP2	HGNC	protein_coding	OTTHUMT00000251961.1	121	0.00	0	G	NM_024997		10567815	10567815	+1	no_errors	ENST00000356427	ensembl	human	known	69_37n	missense	80	10.11	9	SNP	0.988	C
ATP13A4	84239	genome.wustl.edu	37	3	193151690	193151690	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:193151690G>C	ENST00000342695.4	-	25	3108	c.2786C>G	c.(2785-2787)tCa>tGa	p.S929*	ATP13A4_ENST00000392443.3_Nonsense_Mutation_p.S910*	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	929						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CTGGTAATTTGAAAGGCTGTT	0.353																																						dbGAP											0													99.0	108.0	105.0					3																	193151690		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.2786C>G	3.37:g.193151690G>C	ENSP00000339182:p.Ser929*		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.S929*	ENST00000342695.4	37	c.2786	CCDS3304.2	3	.	.	.	.	.	.	.	.	.	.	G	41	8.553996	0.98861	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	.	.	.	5.38	5.38	0.77491	.	0.246508	0.26959	N	0.021628	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.8604	14.2565	0.66055	0.0:0.15:0.85:0.0	.	.	.	.	X	910;929	.	ENSP00000339182:S929X	S	-	2	0	ATP13A4	194634384	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.104000	0.50306	2.509000	0.84616	0.655000	0.94253	TCA	ATP13A4	-	tigrfam_ATPase_P-typ_unknown-pump-sp	ENSG00000127249		0.353	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4	HGNC	protein_coding	OTTHUMT00000157244.4	232	0.00	0	G	NM_032279		193151690	193151690	-1	no_errors	ENST00000342695	ensembl	human	known	69_37n	nonsense	140	19.08	33	SNP	1.000	C
ATP13A3	79572	genome.wustl.edu	37	3	194158079	194158079	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:194158079C>T	ENST00000439040.1	-	19	2751	c.1960G>A	c.(1960-1962)Gcg>Acg	p.A654T	ATP13A3_ENST00000256031.4_Missense_Mutation_p.A654T			Q9H7F0	AT133_HUMAN	ATPase type 13A3	654						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		GCCTCGGGCGCTCCTTTCATG	0.463																																						dbGAP											0													108.0	106.0	106.0					3																	194158079		1866	4095	5961	-	-	-	SO:0001583	missense	0			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.1960G>A	3.37:g.194158079C>T	ENSP00000416508:p.Ala654Thr		Q8NC11|Q96KS1	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.A654T	ENST00000439040.1	37	c.1960	CCDS43187.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.205457	0.95033	.	.	ENSG00000133657	ENST00000439040;ENST00000256031;ENST00000310773	D;D	0.86694	-2.16;-2.16	6.08	6.08	0.98989	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.95968	0.8687	H	0.95079	3.62	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	D	0.96231	0.9168	10	0.87932	D	0	-0.2019	20.6634	0.99662	0.0:1.0:0.0:0.0	.	654	Q9H7F0	AT133_HUMAN	T	654;654;392	ENSP00000416508:A654T;ENSP00000256031:A654T	ENSP00000256031:A654T	A	-	1	0	ATP13A3	195639368	1.000000	0.71417	0.991000	0.47740	0.627000	0.37826	5.612000	0.67681	2.894000	0.99253	0.655000	0.94253	GCG	ATP13A3	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000133657		0.463	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP13A3	HGNC	protein_coding	OTTHUMT00000342799.2	118	0.00	0	C	NM_024524		194158079	194158079	-1	no_errors	ENST00000256031	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	T
ATP6V0E2	155066	genome.wustl.edu	37	7	149575859	149575859	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:149575859G>A	ENST00000425642.2	+	3	268	c.245G>A	c.(244-246)tGa>tAa	p.*82*	ATP6V0E2_ENST00000464662.1_Silent_p.*82*|ATP6V0E2-AS1_ENST00000464939.1_RNA|RP11-445N20.3_ENST00000608912.1_lincRNA|ATP6V0E2_ENST00000495408.1_3'UTR|ATP6V0E2_ENST00000479613.1_Intron|ATP6V0E2_ENST00000456496.2_Silent_p.*131*|ATP6V0E2_ENST00000421974.2_Intron|ATP6V0E2_ENST00000606024.1_Intron			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2	0					ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			CTGTGGGAGTGACCCGCCGCC	0.652																																						dbGAP											0													39.0	44.0	42.0					7																	149575859		1893	4113	6006	-	-	-	SO:0001819	synonymous_variant	0			AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094	ENST00000425642.2:c.245G>A	7.37:g.149575859G>A			A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Silent	SNP	pfam_ATPase_V0-cplx_esu	p.*131	ENST00000425642.2	37	c.392		7	.	.	.	.	.	.	.	.	.	.	.	7.833	0.720227	0.15372	.	.	ENSG00000171130	ENST00000307445	.	.	.	5.24	4.36	0.52297	.	.	.	.	.	T	0.71904	0.3395	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74791	-0.3545	5	0.87932	D	0	.	11.682	0.51463	0.0869:0.0:0.9131:0.0	.	.	.	.	N	13	.	ENSP00000304519:D13N	D	+	1	0	ATP6V0E2	149206792	1.000000	0.71417	0.998000	0.56505	0.501000	0.33797	1.185000	0.32065	1.209000	0.43321	0.467000	0.42956	GAC	ATP6V0E2	-	NULL	ENSG00000171130		0.652	ATP6V0E2-010	KNOWN	basic|appris_principal	protein_coding	ATP6V0E2	HGNC	protein_coding	OTTHUMT00000470874.1	45	0.00	0	G	NM_145230		149575859	149575859	+1	no_errors	ENST00000456496	ensembl	human	known	69_37n	silent	29	31.82	14	SNP	1.000	A
ATP7A	538	genome.wustl.edu	37	X	77294386	77294386	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:77294386G>A	ENST00000341514.6	+	18	3719	c.3564G>A	c.(3562-3564)atG>atA	p.M1188I	ATP7A_ENST00000350425.4_Missense_Mutation_p.M191I|ATP7A_ENST00000343533.5_Missense_Mutation_p.M1110I	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1188					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	GGGAGTGGATGATTAGAAATG	0.363																																						dbGAP											0													203.0	191.0	195.0					X																	77294386		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.3564G>A	X.37:g.77294386G>A	ENSP00000345728:p.Met1188Ile		B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_HG_scavenger,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.M1188I	ENST00000341514.6	37	c.3564	CCDS35339.1	X	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609620	0.87258	.	.	ENSG00000165240	ENST00000343533;ENST00000350425;ENST00000341514	D;D;D	0.85088	-1.94;-1.94;-1.94	4.57	4.57	0.56435	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.085625	0.85682	D	0.000000	D	0.87233	0.6126	L	0.41356	1.27	0.80722	D	1	P	0.38767	0.646	P	0.52066	0.689	D	0.88453	0.3050	10	0.62326	D	0.03	-11.604	16.667	0.85255	0.0:0.0:1.0:0.0	.	1188	Q04656	ATP7A_HUMAN	I	1110;191;1188	ENSP00000343026:M1110I;ENSP00000343678:M191I;ENSP00000345728:M1188I	ENSP00000345728:M1188I	M	+	3	0	ATP7A	77181042	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.697000	0.98697	1.847000	0.53656	0.544000	0.68410	ATG	ATP7A	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_heavy-metal	ENSG00000165240		0.363	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7A	HGNC	protein_coding	OTTHUMT00000057306.1	297	0.00	0	G	NM_000052		77294386	77294386	+1	no_errors	ENST00000341514	ensembl	human	known	69_37n	missense	144	22.58	42	SNP	1.000	A
B2M	567	genome.wustl.edu	37	15	45003751	45003751	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr15:45003751C>T	ENST00000558401.1	+	1	77	c.7C>T	c.(7-9)Cgc>Tgc	p.R3C	B2M_ENST00000559916.1_Missense_Mutation_p.R3C|B2M_ENST00000544417.1_Missense_Mutation_p.R3C|PATL2_ENST00000558573.1_5'Flank	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	3					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CGAGATGTCTCGCTCCGTGGC	0.612																																						dbGAP											0													127.0	93.0	104.0					15																	45003751		2198	4298	6496	-	-	-	SO:0001583	missense	0			AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.7C>T	15.37:g.45003751C>T	ENSP00000452780:p.Arg3Cys		P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	p.R3C	ENST00000558401.1	37	c.7	CCDS10113.1	15	.	.	.	.	.	.	.	.	.	.	C	17.18	3.324820	0.60634	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01323	5.01	5.35	-1.07	0.09968	.	.	.	.	.	T	0.02533	0.0077	M	0.71581	2.175	0.09310	N	1	D;D;D	0.71674	0.998;0.996;0.996	P;P;P	0.47528	0.534;0.549;0.549	T	0.38757	-0.9646	9	0.56958	D	0.05	.	3.2754	0.06897	0.1328:0.3303:0.387:0.15	.	3;3;3	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	C	3	ENSP00000437604:R3C	ENSP00000340858:R3C	R	+	1	0	B2M	42791043	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.832000	0.04400	-0.239000	0.09710	-0.152000	0.13540	CGC	B2M	-	NULL	ENSG00000166710		0.612	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	B2M	HGNC	protein_coding	OTTHUMT00000254007.2	116	0.00	0	C	NM_004048		45003751	45003751	+1	no_errors	ENST00000544417	ensembl	human	known	69_37n	missense	45	18.18	10	SNP	0.000	T
BIRC6	57448	genome.wustl.edu	37	2	32770872	32770872	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:32770872C>T	ENST00000421745.2	+	63	12889	c.12755C>T	c.(12754-12756)tCt>tTt	p.S4252F		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4252					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GTCTGTCTCTCTGCTTTGAGC	0.403																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													198.0	163.0	175.0					2																	32770872		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12755C>T	2.37:g.32770872C>T	ENSP00000393596:p.Ser4252Phe		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.S4252F	ENST00000421745.2	37	c.12755	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	C	32	5.170739	0.94807	.	.	ENSG00000115760	ENST00000421745	T	0.78816	-1.21	5.18	5.18	0.71444	.	0.123933	0.56097	D	0.000028	D	0.86493	0.5946	L	0.56769	1.78	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	D	0.87023	0.2130	10	0.56958	D	0.05	.	18.7585	0.91840	0.0:1.0:0.0:0.0	.	4252	Q9NR09	BIRC6_HUMAN	F	4252	ENSP00000393596:S4252F	ENSP00000393596:S4252F	S	+	2	0	BIRC6	32624376	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.815000	0.86186	2.406000	0.81754	0.586000	0.80456	TCT	BIRC6	-	NULL	ENSG00000115760		0.403	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	266	0.00	0	C	NM_016252		32770872	32770872	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	109	14.84	19	SNP	1.000	T
BAZ2B	29994	genome.wustl.edu	37	2	160231237	160231237	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:160231237C>T	ENST00000392783.2	-	26	4528	c.4033G>A	c.(4033-4035)Gaa>Aaa	p.E1345K	BAZ2B_ENST00000355831.2_Missense_Mutation_p.E1311K|BAZ2B_ENST00000343439.5_Missense_Mutation_p.E1245K|BAZ2B_ENST00000392782.1_Missense_Mutation_p.E1309K	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TCCAGCTCTTCAACACTTGCT	0.299																																						dbGAP											0													124.0	115.0	118.0					2																	160231237		1829	4083	5912	-	-	-	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.4033G>A	2.37:g.160231237C>T	ENSP00000376534:p.Glu1345Lys		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.E1345K	ENST00000392783.2	37	c.4033	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284761	0.59867	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.30182	1.54;1.54;1.54;4.34	5.07	5.07	0.68467	.	0.000000	0.37809	U	0.001938	T	0.57562	0.2062	M	0.75777	2.31	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.77557	0.99;0.99	T	0.60767	-0.7198	10	0.54805	T	0.06	-16.2959	18.4517	0.90705	0.0:1.0:0.0:0.0	.	1309;1345	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	K	1309;1345;1311;1245	ENSP00000376533:E1309K;ENSP00000376534:E1345K;ENSP00000348087:E1311K;ENSP00000339670:E1245K	ENSP00000339670:E1245K	E	-	1	0	BAZ2B	159939483	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.087000	0.76893	2.345000	0.79718	0.591000	0.81541	GAA	BAZ2B	-	NULL	ENSG00000123636		0.299	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	400	0.00	0	C			160231237	160231237	-1	no_errors	ENST00000392783	ensembl	human	known	69_37n	missense	116	17.14	24	SNP	1.000	T
BLM	641	genome.wustl.edu	37	15	91352454	91352454	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr15:91352454C>T	ENST00000355112.3	+	20	3957	c.3839C>T	c.(3838-3840)tCa>tTa	p.S1280L	BLM_ENST00000560509.1_Missense_Mutation_p.S1149L|BLM_ENST00000560136.1_3'UTR	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	1280	HRDC. {ECO:0000255|PROSITE- ProRule:PRU00328}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			GAAGTGATTTCAGTATTACAG	0.408			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													dbGAP	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													170.0	165.0	167.0					15																	91352454		2198	4298	6496	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.3839C>T	15.37:g.91352454C>T	ENSP00000347232:p.Ser1280Leu		Q52M96	Missense_Mutation	SNP	pfam_RQC_domain,pfam_BDHCT,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/RNaseD_C,superfamily_HRDC-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.S1280L	ENST00000355112.3	37	c.3839	CCDS10363.1	15	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866210	0.51588	.	.	ENSG00000197299	ENST00000355112;ENST00000536925;ENST00000543977	T	0.44881	0.91	5.88	4.92	0.64577	HRDC-like (1);Helicase/RNase D C-terminal, HRDC domain (3);	0.677058	0.15367	N	0.266043	T	0.30603	0.0770	L	0.27053	0.805	0.19775	N	0.999958	B;B	0.10296	0.0;0.003	B;B	0.25759	0.001;0.063	T	0.08146	-1.0736	10	0.33940	T	0.23	-20.2155	9.1552	0.36988	0.1632:0.6792:0.1575:0.0	.	1280;1280	B2RAN0;P54132	.;BLM_HUMAN	L	1280;910;467	ENSP00000347232:S1280L	ENSP00000347232:S1280L	S	+	2	0	BLM	89153458	1.000000	0.71417	0.955000	0.39395	0.910000	0.53928	3.949000	0.56668	2.774000	0.95407	0.655000	0.94253	TCA	BLM	-	pfam_Helicase/RNaseD_C,superfamily_HRDC-like,smart_Helicase/RNaseD_C,pfscan_Helicase/RNaseD_C	ENSG00000197299		0.408	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	223	0.00	0	C			91352454	91352454	+1	no_errors	ENST00000355112	ensembl	human	known	69_37n	missense	57	24.00	18	SNP	0.716	T
BMPER	168667	genome.wustl.edu	37	7	34125658	34125658	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:34125658G>A	ENST00000297161.2	+	14	2073	c.1699G>A	c.(1699-1701)Gag>Aag	p.E567K	BMPER_ENST00000426693.1_Missense_Mutation_p.E567K	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	567	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CAAATCCTGGGAGTTTCAGAC	0.507																																						dbGAP											0													68.0	72.0	71.0					7																	34125658		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1699G>A	7.37:g.34125658G>A	ENSP00000297161:p.Glu567Lys		A8K1P8|Q8TF36	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_VWF_C,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_C,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,pfscan_VWF_C	p.E567K	ENST00000297161.2	37	c.1699	CCDS5442.1	7	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702580	0.48307	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.75938	-0.98;-0.98	6.08	6.08	0.98989	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.148180	0.64402	D	0.000005	T	0.61602	0.2360	N	0.20530	0.585	0.80722	D	1	B	0.23990	0.095	B	0.24394	0.053	T	0.58696	-0.7591	10	0.06757	T	0.87	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	567	Q8N8U9	BMPER_HUMAN	K	567	ENSP00000297161:E567K;ENSP00000393950:E567K	ENSP00000297161:E567K	E	+	1	0	BMPER	34092183	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.003000	0.70701	2.894000	0.99253	0.655000	0.94253	GAG	BMPER	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000164619		0.507	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPER	HGNC	protein_coding	OTTHUMT00000250570.2	89	0.00	0	G	NM_133468		34125658	34125658	+1	no_errors	ENST00000297161	ensembl	human	known	69_37n	missense	53	17.19	11	SNP	1.000	A
BTN2A1	11120	genome.wustl.edu	37	6	26463541	26463541	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:26463541C>G	ENST00000312541.5	+	4	748	c.500C>G	c.(499-501)tCt>tGt	p.S167C	BTN2A1_ENST00000541522.1_Missense_Mutation_p.S106C|BTN2A1_ENST00000429381.1_Missense_Mutation_p.S167C|BTN2A1_ENST00000469185.1_Missense_Mutation_p.S167C	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	167					lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						GAGTGCATATCTAGAGGGTGG	0.587																																						dbGAP											0													75.0	72.0	73.0					6																	26463541		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.500C>G	6.37:g.26463541C>G	ENSP00000312158:p.Ser167Cys		B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.S167C	ENST00000312541.5	37	c.500	CCDS4613.1	6	.	.	.	.	.	.	.	.	.	.	C	15.05	2.719238	0.48728	.	.	ENSG00000112763	ENST00000312541;ENST00000541522;ENST00000429381;ENST00000265424;ENST00000469185	D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56	2.88	2.88	0.33553	CD80-like, immunoglobulin C2-set (1);	0.000000	0.52532	D	0.000061	D	0.91520	0.7322	H	0.95328	3.655	0.33325	D	0.567814	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91442	0.5174	10	0.87932	D	0	.	11.9438	0.52915	0.0:1.0:0.0:0.0	.	167;167	Q96AV7;Q7KYR7	.;BT2A1_HUMAN	C	167;106;167;167;167	ENSP00000312158:S167C;ENSP00000443909:S106C;ENSP00000416945:S167C;ENSP00000419043:S167C	ENSP00000265424:S167C	S	+	2	0	BTN2A1	26571520	0.860000	0.29831	0.799000	0.32177	0.481000	0.33189	4.218000	0.58554	1.896000	0.54893	0.561000	0.74099	TCT	BTN2A1	-	pfam_CD80_C2-set	ENSG00000112763		0.587	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A1	HGNC	protein_coding	OTTHUMT00000040122.2	93	0.00	0	C	NM_007049		26463541	26463541	+1	no_errors	ENST00000312541	ensembl	human	known	69_37n	missense	78	22.00	22	SNP	0.937	G
C10orf76	79591	genome.wustl.edu	37	10	103699622	103699622	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr10:103699622G>A	ENST00000370033.4	-	23	1898	c.1779C>T	c.(1777-1779)atC>atT	p.I593I		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	593						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		TTCCTTACCTGATATTAACCA	0.423																																						dbGAP											0													132.0	126.0	128.0					10																	103699622		1885	4104	5989	-	-	-	SO:0001819	synonymous_variant	0			AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.1779C>T	10.37:g.103699622G>A			Q2TB87|Q9H8Z9	Silent	SNP	pfam_DUF1741,superfamily_ARM-type_fold	p.I593	ENST00000370033.4	37	c.1779	CCDS41563.1	10																																																																																			C10orf76	-	pfam_DUF1741	ENSG00000120029		0.423	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf76	HGNC	protein_coding	OTTHUMT00000050007.1	157	0.00	0	G	NM_024541		103699622	103699622	-1	no_errors	ENST00000370033	ensembl	human	known	69_37n	silent	76	17.39	16	SNP	1.000	A
C11orf49	79096	genome.wustl.edu	37	11	47178576	47178576	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:47178576delT	ENST00000278460.7	+	6	513	c.454delT	c.(454-456)ttcfs	p.F152fs	C11orf49_ENST00000536126.1_Frame_Shift_Del_p.F55fs|C11orf49_ENST00000378615.3_Frame_Shift_Del_p.F152fs|C11orf49_ENST00000395460.2_Frame_Shift_Del_p.F152fs|C11orf49_ENST00000378618.2_Frame_Shift_Del_p.F152fs|C11orf49_ENST00000527268.1_3'UTR|C11orf49_ENST00000543718.1_Frame_Shift_Del_p.F68fs	NM_001003677.1|NM_024113.3	NP_001003677.1|NP_077018.1	Q9H6J7	CK049_HUMAN	chromosome 11 open reading frame 49	152						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(1)	11						GGTTCCAGAATTCCTGGACAG	0.582																																						dbGAP											0													64.0	50.0	55.0					11																	47178576		2201	4299	6500	-	-	-	SO:0001589	frameshift_variant	0			AL136575	CCDS7925.1, CCDS31479.1, CCDS31480.1, CCDS41641.1	11p11.2	2006-02-02			ENSG00000149179	ENSG00000149179			28720	protein-coding gene	gene with protein product							Standard	NM_001003677		Approved	FLJ22210, MGC4707	uc001ndr.4	Q9H6J7	OTTHUMG00000166725	ENST00000278460.7:c.454delT	11.37:g.47178576delT	ENSP00000278460:p.Phe152fs		D3DQQ8|E9PAX7|Q7L077|Q96CS8|Q9BQH4|Q9BUW5	Frame_Shift_Del	DEL	NULL	p.F152fs	ENST00000278460.7	37	c.454	CCDS7925.1	11																																																																																			C11orf49	-	NULL	ENSG00000149179		0.582	C11orf49-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf49	HGNC	protein_coding	OTTHUMT00000391218.1	66	0.00	0	T	NM_024113		47178576	47178576	+1	no_errors	ENST00000378615	ensembl	human	known	69_37n	frame_shift_del	48	15.52	9	DEL	1.000	-
BRICD5	283870	genome.wustl.edu	37	16	2260649	2260649	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:2260649C>T	ENST00000562360.1	-	2	53	c.54G>A	c.(52-54)gtG>gtA	p.V18V	BRICD5_ENST00000328540.3_Silent_p.V18V|RP11-304L19.8_ENST00000561544.1_lincRNA|BRICD5_ENST00000566018.1_Silent_p.V18V			Q6PL45	BRID5_HUMAN	BRICHOS domain containing 5	18						integral component of membrane (GO:0016021)											GCTTGGTCTTCACCTGGGCGT	0.677																																						dbGAP											0													25.0	29.0	28.0					16																	2260649		2192	4297	6489	-	-	-	SO:0001819	synonymous_variant	0			BC039154	CCDS10463.1	16p13.3	2012-10-10	2012-10-10	2012-10-10	ENSG00000182685	ENSG00000182685		"""BRICHOS domain containing"""	28309	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 79"""	C16orf79		12477932	Standard	NM_182563		Approved	MGC21830	uc002cpi.2	Q6PL45	OTTHUMG00000128831	ENST00000562360.1:c.54G>A	16.37:g.2260649C>T			C9J7K2|Q8IXU9	Silent	SNP	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	p.V18	ENST00000562360.1	37	c.54	CCDS10463.1	16																																																																																			C16orf79	-	NULL	ENSG00000182685		0.677	BRICD5-002	KNOWN	basic|CCDS	protein_coding	C16orf79	HGNC	protein_coding	OTTHUMT00000435091.1	55	0.00	0	C	NM_182563		2260649	2260649	-1	no_errors	ENST00000562360	ensembl	human	known	69_37n	silent	77	10.47	9	SNP	0.998	T
C19orf47	126526	genome.wustl.edu	37	19	40834429	40834429	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:40834429C>T	ENST00000582783.1	-	6	453	c.441G>A	c.(439-441)ctG>ctA	p.L147L	C19orf47_ENST00000392035.2_Silent_p.L80L	NM_001256440.1	NP_001243369.1	Q8N9M1	CS047_HUMAN	chromosome 19 open reading frame 47	147						nucleus (GO:0005634)				endometrium(5)|kidney(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20			Lung(22;0.000636)			AGTCATGGTTCAGGCTGTTGG	0.602																																						dbGAP											0													179.0	182.0	181.0					19																	40834429		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834131	CCDS58662.1	19q13.2	2012-07-20			ENSG00000160392	ENSG00000160392			26723	protein-coding gene	gene with protein product						12477932	Standard	NM_001256440		Approved	FLJ36888	uc002oni.5	Q8N9M1	OTTHUMG00000179028	ENST00000582783.1:c.441G>A	19.37:g.40834429C>T			Q8IZ33|Q8N0V9	Silent	SNP	superfamily_SAM/pointed	p.L147	ENST00000582783.1	37	c.441	CCDS58662.1	19																																																																																			C19orf47	-	NULL	ENSG00000160392		0.602	C19orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf47	HGNC	protein_coding	OTTHUMT00000444488.1	495	0.00	0	C	NM_178830		40834429	40834429	-1	no_errors	ENST00000582783	ensembl	human	known	69_37n	silent	241	16.61	48	SNP	1.000	T
ZGRF1	55345	genome.wustl.edu	37	4	113540297	113540297	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:113540297C>G	ENST00000505019.1	-	6	1026	c.901G>C	c.(901-903)Gag>Cag	p.E301Q	C4orf21_ENST00000445203.2_Missense_Mutation_p.E270Q|C4orf21_ENST00000309071.5_Missense_Mutation_p.E301Q	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		301						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TCAGCACACTCTTCCTGTTGA	0.368																																						dbGAP											0													106.0	109.0	108.0					4																	113540297		2203	4299	6502	-	-	-	SO:0001583	missense	0																														ENST00000505019.1:c.901G>C	4.37:g.113540297C>G	ENSP00000424737:p.Glu301Gln		B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	pfam_DUF2439,pfam_Znf_GRF	p.E301Q	ENST00000505019.1	37	c.901		4	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654505	0.47467	.	.	ENSG00000138658	ENST00000505019;ENST00000309071;ENST00000445203	D;T;T	0.84800	-1.9;1.61;1.19	5.37	2.56	0.30785	.	1.229040	0.05781	N	0.608672	T	0.76793	0.4037	L	0.29908	0.895	0.09310	N	1	B;B	0.33694	0.421;0.358	B;B	0.30646	0.109;0.118	T	0.65150	-0.6238	10	0.52906	T	0.07	-0.2053	6.2065	0.20606	0.0:0.5682:0.0:0.4318	.	301;301	Q86YA3;G5EA02	CD021_HUMAN;.	Q	301;301;270	ENSP00000424737:E301Q;ENSP00000309095:E301Q;ENSP00000390505:E270Q	ENSP00000309095:E301Q	E	-	1	0	C4orf21	113759746	0.000000	0.05858	0.005000	0.12908	0.781000	0.44180	-0.492000	0.06467	0.552000	0.29026	0.563000	0.77884	GAG	C4orf21	-	NULL	ENSG00000138658		0.368	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	HGNC	protein_coding	OTTHUMT00000256413.1	109	0.00	0	C			113540297	113540297	-1	no_errors	ENST00000505019	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.024	G
CAMSAP3	57662	genome.wustl.edu	37	19	7677124	7677124	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:7677124G>C	ENST00000160298.4	+	11	1846	c.1745G>C	c.(1744-1746)gGa>gCa	p.G582A	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.G609A	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	582					epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						GCTGAGGCCGGAGCGGGGTCC	0.652																																						dbGAP											0													6.0	8.0	7.0					19																	7677124		1864	4044	5908	-	-	-	SO:0001583	missense	0			AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1745G>C	19.37:g.7677124G>C	ENSP00000160298:p.Gly582Ala		Q8NDF1	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.G609A	ENST00000160298.4	37	c.1826	CCDS42489.1	19	.	.	.	.	.	.	.	.	.	.	g	4.541	0.100385	0.08731	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.15372	2.43;2.43	3.96	0.463	0.16700	.	9.094200	0.00166	N	0.000012	T	0.10380	0.0254	L	0.27053	0.805	0.09310	N	1	P;B	0.43788	0.817;0.001	B;B	0.33454	0.164;0.002	T	0.23226	-1.0194	10	0.26408	T	0.33	-7.0398	4.9594	0.14059	0.2618:0.1654:0.5728:0.0	.	582;609	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	A	609;582	ENSP00000416797:G609A;ENSP00000160298:G582A	ENSP00000160298:G582A	G	+	2	0	KIAA1543	7583124	0.005000	0.15991	0.005000	0.12908	0.947000	0.59692	1.190000	0.32126	0.107000	0.17824	0.544000	0.68410	GGA	CAMSAP3	-	NULL	ENSG00000076826		0.652	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAMSAP3	HGNC	protein_coding	OTTHUMT00000459300.1	12	0.00	0	G	XM_048362		7677124	7677124	+1	no_errors	ENST00000446248	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.000	C
CASR	846	genome.wustl.edu	37	3	121975980	121975980	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:121975980G>A	ENST00000490131.1	+	3	610	c.238G>A	c.(238-240)Gag>Aag	p.E80K	CASR_ENST00000296154.5_Missense_Mutation_p.E80K|CASR_ENST00000498619.1_Missense_Mutation_p.E80K	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	80					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TGCCATAGAGGAGATAAACAG	0.468																																						dbGAP											0													104.0	105.0	104.0					3																	121975980		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.238G>A	3.37:g.121975980G>A	ENSP00000418685:p.Glu80Lys		Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.E80K	ENST00000490131.1	37	c.238	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.619613	0.96649	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.84589	-1.87;-1.87;-1.87	5.84	5.84	0.93424	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91942	0.7448	M	0.67569	2.06	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.995;0.996	D	0.91773	0.5429	10	0.62326	D	0.03	.	19.1433	0.93455	0.0:0.0:1.0:0.0	.	80;80	E7ENE0;P41180	.;CASR_HUMAN	K	80	ENSP00000418685:E80K;ENSP00000420194:E80K;ENSP00000296154:E80K	ENSP00000296154:E80K	E	+	1	0	CASR	123458670	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.869000	0.99810	2.760000	0.94817	0.655000	0.94253	GAG	CASR	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3	ENSG00000036828		0.468	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	164	0.00	0	G	NM_000388		121975980	121975980	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	88	21.24	24	SNP	1.000	A
CASZ1	54897	genome.wustl.edu	37	1	10720544	10720544	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:10720544G>A	ENST00000377022.3	-	6	872	c.555C>T	c.(553-555)ttC>ttT	p.F185F	CASZ1_ENST00000344008.5_Silent_p.F185F|CASZ1_ENST00000478728.2_5'Flank	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	185					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		ACATGCCGAGGAACTCGGTCA	0.647																																						dbGAP											0													33.0	35.0	35.0					1																	10720544		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.555C>T	1.37:g.10720544G>A			Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F185	ENST00000377022.3	37	c.555	CCDS41246.1	1																																																																																			CASZ1	-	NULL	ENSG00000130940		0.647	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	57	0.00	0	G	NM_017766		10720544	10720544	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	silent	37	19.57	9	SNP	1.000	A
CCDC170	80129	genome.wustl.edu	37	6	151907144	151907144	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:151907144C>T	ENST00000239374.7	+	7	1312	c.1213C>T	c.(1213-1215)Cag>Tag	p.Q405*	CCDC170_ENST00000367290.5_Nonsense_Mutation_p.Q405*	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	405																	GGAGACTCTTCAGGGTCAGCT	0.478																																						dbGAP											0													65.0	64.0	64.0					6																	151907144		1894	4123	6017	-	-	-	SO:0001587	stop_gained	0			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1213C>T	6.37:g.151907144C>T	ENSP00000239374:p.Gln405*		Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Nonsense_Mutation	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.Q405*	ENST00000239374.7	37	c.1213	CCDS43515.1	6	.	.	.	.	.	.	.	.	.	.	C	38	7.007328	0.97998	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	.	.	.	5.76	5.76	0.90799	.	0.139018	0.49916	D	0.000128	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-13.3127	15.0865	0.72158	0.0:0.8584:0.1416:0.0	.	.	.	.	X	405	.	ENSP00000239374:Q405X	Q	+	1	0	C6orf97	151948837	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.890000	0.48609	2.709000	0.92574	0.591000	0.81541	CAG	CCDC170	-	NULL	ENSG00000120262		0.478	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2	173	0.00	0	C	NM_025059		151907144	151907144	+1	no_errors	ENST00000367290	ensembl	human	known	69_37n	nonsense	62	17.33	13	SNP	1.000	T
CCDC47	57003	genome.wustl.edu	37	17	61838664	61838664	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr17:61838664G>A	ENST00000225726.5	-	5	977	c.595C>T	c.(595-597)Cag>Tag	p.Q199*	CCDC47_ENST00000582252.1_Nonsense_Mutation_p.Q199*|CCDC47_ENST00000403162.3_Nonsense_Mutation_p.Q199*	NM_020198.2	NP_064583.2	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47	199					calcium ion homeostasis (GO:0055074)|ER overload response (GO:0006983)|osteoblast differentiation (GO:0001649)|post-embryonic development (GO:0009791)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	18						TCATTCTCCTGGTTCAACTTT	0.473																																						dbGAP											0													324.0	263.0	284.0					17																	61838664		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF226054	CCDS11643.1	17q23.3	2005-12-19				ENSG00000108588			24856	protein-coding gene	gene with protein product						12477932	Standard	NM_020198		Approved	GK001	uc002jbs.4	Q96A33		ENST00000225726.5:c.595C>T	17.37:g.61838664G>A	ENSP00000225726:p.Gln199*		B2RAS8|D3DU20|Q96D00|Q96JZ7|Q9H3E4|Q9NRG3	Nonsense_Mutation	SNP	pfam_DUF1682	p.Q199*	ENST00000225726.5	37	c.595	CCDS11643.1	17	.	.	.	.	.	.	.	.	.	.	G	38	6.952917	0.97960	.	.	ENSG00000108588	ENST00000225726;ENST00000403162	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.3001	18.5119	0.90920	0.0:0.0:1.0:0.0	.	.	.	.	X	199	.	ENSP00000225726:Q199X	Q	-	1	0	CCDC47	59192396	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.662000	0.98603	2.680000	0.91292	0.591000	0.81541	CAG	CCDC47	-	pfam_DUF1682	ENSG00000108588		0.473	CCDC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC47	HGNC	protein_coding	OTTHUMT00000444016.2	361	0.28	1	G	NM_020198		61838664	61838664	-1	no_errors	ENST00000225726	ensembl	human	known	69_37n	nonsense	133	19.88	33	SNP	1.000	A
CD274	29126	genome.wustl.edu	37	9	5466805	5466805	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:5466805G>C	ENST00000381577.3	+	6	912	c.826G>C	c.(826-828)Gat>Cat	p.D276H	CD274_ENST00000381573.4_Missense_Mutation_p.D162H|CD274_ENST00000498261.1_3'UTR	NM_014143.3	NP_054862.1	Q9NZQ7	PD1L1_HUMAN	CD274 molecule	276					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D276Y(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)		TGGCATCCAAGATACAAACTC	0.348			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																	dbGAP		Dom	yes		9	9p24	29126	CD274 molecule		L	1	Substitution - Missense(1)	large_intestine(1)											126.0	120.0	122.0					9																	5466805		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF177937	CCDS6464.1, CCDS59118.1	9p24.1	2014-01-30	2006-03-28	2005-02-25	ENSG00000120217	ENSG00000120217		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17635	protein-coding gene	gene with protein product	"""B7 homolog 1"""	605402	"""programmed cell death 1 ligand 1"", ""CD274 antigen"""	PDCD1LG1		11015443, 10581077	Standard	NM_014143		Approved	B7-H, B7H1, PD-L1, PDL1, B7-H1	uc003zje.3	Q9NZQ7	OTTHUMG00000019503	ENST00000381577.3:c.826G>C	9.37:g.5466805G>C	ENSP00000370989:p.Asp276His		B2RBA2|B4DU27|Q14CJ2|Q2V8D5|Q66RK1|Q6WEX4|Q9NUZ5	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_C1-set,smart_Ig_sub,pfscan_Ig-like	p.D276H	ENST00000381577.3	37	c.826	CCDS6464.1	9	.	.	.	.	.	.	.	.	.	.	G	7.524	0.657228	0.14580	.	.	ENSG00000120217	ENST00000381573;ENST00000381577	T;T	0.37915	1.17;5.15	4.16	2.34	0.29019	.	0.463942	0.19810	N	0.105544	T	0.33177	0.0854	L	0.36672	1.1	0.09310	N	1	D;B	0.58970	0.984;0.303	P;B	0.50440	0.641;0.219	T	0.10520	-1.0626	10	0.72032	D	0.01	-8.3026	6.4937	0.22130	0.2158:0.0:0.7842:0.0	.	162;276	Q2V8D5;Q9NZQ7	.;PD1L1_HUMAN	H	162;276	ENSP00000370985:D162H;ENSP00000370989:D276H	ENSP00000370985:D162H	D	+	1	0	CD274	5456805	0.008000	0.16893	0.002000	0.10522	0.008000	0.06430	0.629000	0.24538	0.718000	0.32166	-0.258000	0.10820	GAT	CD274	-	NULL	ENSG00000120217		0.348	CD274-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD274	HGNC	protein_coding	OTTHUMT00000051631.2	238	0.00	0	G	NM_014143		5466805	5466805	+1	no_errors	ENST00000381577	ensembl	human	known	69_37n	missense	82	13.68	13	SNP	0.003	C
CDCP1	64866	genome.wustl.edu	37	3	45127171	45127171	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:45127171G>T	ENST00000296129.1	-	9	2604	c.2470C>A	c.(2470-2472)Ccc>Acc	p.P824T		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	824						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TTCAGTAAGGGAATGTCTGTG	0.532																																						dbGAP											0													159.0	150.0	153.0					3																	45127171		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.2470C>A	3.37:g.45127171G>T	ENSP00000296129:p.Pro824Thr		Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	superfamily_CUB	p.P824T	ENST00000296129.1	37	c.2470	CCDS2727.1	3	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393833	0.42410	.	.	ENSG00000163814	ENST00000296129	T	0.40756	1.02	5.67	5.67	0.87782	.	0.327137	0.32836	N	0.005594	T	0.60843	0.2300	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.60627	-0.7226	10	0.51188	T	0.08	.	13.2883	0.60255	0.0753:0.0:0.9247:0.0	.	824	Q9H5V8	CDCP1_HUMAN	T	824	ENSP00000296129:P824T	ENSP00000296129:P824T	P	-	1	0	CDCP1	45102175	0.987000	0.35691	0.750000	0.31169	0.029000	0.11900	2.044000	0.41241	2.680000	0.91292	0.563000	0.77884	CCC	CDCP1	-	NULL	ENSG00000163814		0.532	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCP1	HGNC	protein_coding	OTTHUMT00000256748.3	202	0.00	0	G	NM_022842		45127171	45127171	-1	no_errors	ENST00000296129	ensembl	human	known	69_37n	missense	65	25.84	23	SNP	0.977	T
CDR2	1039	genome.wustl.edu	37	16	22358885	22358885	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:22358885C>T	ENST00000268383.2	-	5	1073	c.766G>A	c.(766-768)Gag>Aag	p.E256K		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	256						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		TGTCGCATCTCTGCCACCTCG	0.552																																						dbGAP											0													81.0	82.0	81.0					16																	22358885		2197	4300	6497	-	-	-	SO:0001583	missense	0			M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.766G>A	16.37:g.22358885C>T	ENSP00000268383:p.Glu256Lys		A8K8A8|Q13977	Missense_Mutation	SNP	NULL	p.E256K	ENST00000268383.2	37	c.766	CCDS32404.1	16	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269499	0.80469	.	.	ENSG00000140743	ENST00000268383	T	0.52057	0.68	5.58	5.58	0.84498	.	0.096806	0.64402	D	0.000001	T	0.64832	0.2634	M	0.76574	2.34	0.48632	D	0.999689	D	0.59767	0.986	P	0.56163	0.793	T	0.63152	-0.6701	10	0.36615	T	0.2	-30.7129	19.5747	0.95438	0.0:1.0:0.0:0.0	.	256	Q01850	CDR2_HUMAN	K	256	ENSP00000268383:E256K	ENSP00000268383:E256K	E	-	1	0	CDR2	22266386	0.996000	0.38824	0.955000	0.39395	0.722000	0.41435	3.417000	0.52714	2.618000	0.88619	0.655000	0.94253	GAG	CDR2	-	NULL	ENSG00000140743		0.552	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR2	HGNC	protein_coding	OTTHUMT00000430081.1	130	0.00	0	C			22358885	22358885	-1	no_errors	ENST00000268383	ensembl	human	known	69_37n	missense	66	14.29	11	SNP	0.974	T
CEND1	51286	genome.wustl.edu	37	11	788469	788469	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:788469C>T	ENST00000330106.4	-	2	283	c.108G>A	c.(106-108)ttG>ttA	p.L36L	CEND1_ENST00000524587.1_5'UTR	NM_016564.3	NP_057648.2	Q8N111	CEND_HUMAN	cell cycle exit and neuronal differentiation 1	36					adult walking behavior (GO:0007628)|cerebellar granular layer maturation (GO:0021686)|cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|radial glia guided migration of cerebellar granule cell (GO:0021933)	integral component of membrane (GO:0016021)				prostate(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGGCTTGGTCAAGGGGGCTT	0.692																																						dbGAP											0													55.0	72.0	66.0					11																	788469		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			AK074547	CCDS7714.1	11p15.5	2006-06-14			ENSG00000184524	ENSG00000184524			24153	protein-coding gene	gene with protein product		608213				11311134	Standard	NM_016564		Approved	FLJ90066, BM88	uc001lrh.1	Q8N111	OTTHUMG00000133308	ENST00000330106.4:c.108G>A	11.37:g.788469C>T			Q9NYM6	Silent	SNP	NULL	p.L36	ENST00000330106.4	37	c.108	CCDS7714.1	11																																																																																			CEND1	-	NULL	ENSG00000184524		0.692	CEND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEND1	HGNC	protein_coding	OTTHUMT00000257105.1	71	0.00	0	C	NM_016564		788469	788469	-1	no_errors	ENST00000330106	ensembl	human	known	69_37n	silent	30	21.05	8	SNP	0.000	T
CENPJ	55835	genome.wustl.edu	37	13	25459796	25459796	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr13:25459796C>T	ENST00000381884.4	-	12	3499	c.3314G>A	c.(3313-3315)cGa>cAa	p.R1105Q	CENPJ_ENST00000545981.1_Missense_Mutation_p.E1077K|CENPJ_ENST00000493190.1_5'UTR	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	1105					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		CTTGGATCTTCGAGGTGGATT	0.308																																						dbGAP											0													91.0	97.0	95.0					13																	25459796		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.3314G>A	13.37:g.25459796C>T	ENSP00000371308:p.Arg1105Gln		Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	pfam_Tcp10/CenJ_C	p.R1105Q	ENST00000381884.4	37	c.3314	CCDS9310.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.350|5.350	0.249886|0.249886	0.10130|0.10130	.|.	.|.	ENSG00000151849|ENSG00000151849	ENST00000545981|ENST00000381884	T|T	0.24350|0.34859	1.86|1.34	5.25|5.25	0.668|0.668	0.17912|0.17912	.|.	.|0.547984	.|0.18204	.|N	.|0.148415	T|T	0.24509|0.24509	0.0594|0.0594	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	1|1	.|B	.|0.21688	.|0.059	.|B	.|0.08055	.|0.003	T|T	0.18681|0.18681	-1.0329|-1.0329	7|10	0.16420|0.22109	T|T	0.52|0.4	.|.	7.6322|7.6322	0.28247|0.28247	0.0:0.5664:0.0:0.4336|0.0:0.5664:0.0:0.4336	.|.	.|1105	.|Q9HC77	.|CENPJ_HUMAN	K|Q	1077|1105	ENSP00000441090:E1077K|ENSP00000371308:R1105Q	ENSP00000441090:E1077K|ENSP00000371308:R1105Q	E|R	-|-	1|2	0|0	CENPJ|CENPJ	24357796|24357796	0.968000|0.968000	0.33430|0.33430	0.056000|0.056000	0.19401|0.19401	0.022000|0.022000	0.10575|0.10575	-0.190000|-0.190000	0.09615|0.09615	-0.022000|-0.022000	0.13986|0.13986	-0.218000|-0.218000	0.12543|0.12543	GAA|CGA	CENPJ	-	NULL	ENSG00000151849		0.308	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPJ	HGNC	protein_coding	OTTHUMT00000044209.1	212	0.00	0	C	NM_018451		25459796	25459796	-1	no_errors	ENST00000381884	ensembl	human	known	69_37n	missense	140	13.58	22	SNP	0.127	T
CEP128	145508	genome.wustl.edu	37	14	80971345	80971345	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:80971345C>A	ENST00000555265.1	-	24	3466	c.3091G>T	c.(3091-3093)Gaa>Taa	p.E1031*	CEP128_ENST00000281129.3_Nonsense_Mutation_p.E1031*|CEP128_ENST00000553717.1_5'UTR			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	1031						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TGGGAACCTTCCAGAAAGGTT	0.428																																						dbGAP											0													58.0	55.0	56.0					14																	80971345		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.3091G>T	14.37:g.80971345C>A	ENSP00000451162:p.Glu1031*		B9EK52|Q86X97|Q96ML4	Nonsense_Mutation	SNP	NULL	p.E1031*	ENST00000555265.1	37	c.3091	CCDS32130.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	9.098518|9.098518	0.99064|0.99064	.|.	.|.	ENSG00000100629|ENSG00000100629	ENST00000281129;ENST00000555265|ENST00000556061	.|.	.|.	.|.	5.05|5.05	4.14|4.14	0.48551|0.48551	.|.	0.503993|.	0.18389|.	N|.	0.142732|.	.|T	.|0.40222	.|0.1108	.|.	.|.	.|.	0.20873|0.20873	N|N	0.999839|0.999839	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.22977	.|-1.0201	.|4	0.40728|.	T|.	0.16|.	.|.	11.1846|11.1846	0.48648|0.48648	0.0:0.8145:0.1855:0.0|0.0:0.8145:0.1855:0.0	.|.	.|.	.|.	.|.	X|V	1031|96	.|.	ENSP00000281129:E1031X|.	E|G	-|-	1|2	0|0	CEP128|CEP128	80041098|80041098	0.250000|0.250000	0.23951|0.23951	0.004000|0.004000	0.12327|0.12327	0.003000|0.003000	0.03518|0.03518	1.922000|1.922000	0.40045|0.40045	1.314000|1.314000	0.45095|0.45095	0.650000|0.650000	0.86243|0.86243	GAA|GGA	CEP128	-	NULL	ENSG00000100629		0.428	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1	70	0.00	0	C	NM_152446		80971345	80971345	-1	no_errors	ENST00000281129	ensembl	human	known	69_37n	nonsense	46	14.81	8	SNP	0.007	A
CFTR	1080	genome.wustl.edu	37	7	117188830	117188830	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:117188830G>C	ENST00000003084.6	+	10	1477	c.1345G>C	c.(1345-1347)Gaa>Caa	p.E449Q	CFTR_ENST00000454343.1_Intron	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	449	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TTTCAAGATAGAAAGAGGACA	0.383									Cystic Fibrosis																													dbGAP											0													27.0	28.0	27.0					7																	117188830		2202	4297	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1345G>C	7.37:g.117188830G>C	ENSP00000003084:p.Glu449Gln		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.E449Q	ENST00000003084.6	37	c.1345	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861201	0.51482	.	.	ENSG00000001626	ENST00000003084;ENST00000426809	D;D	0.94092	-3.35;-3.35	4.85	3.95	0.45737	ABC transporter, transmembrane domain, type 1 (1);ABC transporter-like (1);	0.101101	0.64402	D	0.000003	D	0.83353	0.5236	N	0.10618	0.005	0.80722	D	1	P	0.46327	0.876	B	0.37239	0.244	T	0.82637	-0.0359	10	0.28530	T	0.3	-14.8954	13.7468	0.62881	0.0763:0.0:0.9237:0.0	.	449	P13569	CFTR_HUMAN	Q	449;419	ENSP00000003084:E449Q;ENSP00000389119:E419Q	ENSP00000003084:E449Q	E	+	1	0	CFTR	116976066	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.065000	0.64344	1.135000	0.42183	0.650000	0.86243	GAA	CFTR	-	superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter-like,tigrfam_cAMP_cl_channel	ENSG00000001626		0.383	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	235	0.00	0	G	NM_000492		117188830	117188830	+1	no_errors	ENST00000003084	ensembl	human	known	69_37n	missense	121	22.93	36	SNP	1.000	C
COA4	51287	genome.wustl.edu	37	11	73584201	73584201	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:73584201C>T	ENST00000355693.4	-	2	470	c.223G>A	c.(223-225)Gag>Aag	p.E75K	COA4_ENST00000545127.1_Missense_Mutation_p.E75K|COA4_ENST00000537581.1_5'Flank|COA4_ENST00000537289.1_Missense_Mutation_p.E75K|COA4_ENST00000541455.1_Missense_Mutation_p.E84K	NM_016565.2	NP_057649.2	Q9NYJ1	COA4_HUMAN	cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae)	75						mitochondrion (GO:0005739)											CTCTGCAGCTCCTCTTGCCGC	0.612																																						dbGAP											0													109.0	81.0	90.0					11																	73584201		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF242180	CCDS8225.1	11q13.4	2013-10-18	2012-10-15	2012-10-15		ENSG00000181924		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Mitochondrial respiratory chain complex assembly factors"""	24604	protein-coding gene	gene with protein product		608016	"""coiled-coil-helix-coiled-coil-helix domain containing 8"""	CHCHD8		11085516, 20624914	Standard	NM_016565		Approved	E2IG2, CMC3	uc001ouj.3	Q9NYJ1		ENST00000355693.4:c.223G>A	11.37:g.73584201C>T	ENSP00000347919:p.Glu75Lys		B2RAA0|Q69YU4	Missense_Mutation	SNP	NULL	p.E84K	ENST00000355693.4	37	c.250	CCDS8225.1	11	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949401	0.73787	.	.	ENSG00000181924	ENST00000355693;ENST00000545127;ENST00000541455;ENST00000537289	.	.	.	6.02	4.16	0.48862	.	0.110127	0.64402	D	0.000006	T	0.30479	0.0766	.	.	.	0.34706	D	0.727269	P	0.39480	0.675	B	0.30105	0.111	T	0.39981	-0.9587	8	0.27082	T	0.32	-8.8691	10.8435	0.46730	0.0:0.8476:0.0:0.1524	.	75	Q9NYJ1	CHCH8_HUMAN	K	75;75;84;75	.	ENSP00000347919:E75K	E	-	1	0	CHCHD8	73261849	1.000000	0.71417	0.998000	0.56505	0.407000	0.30961	5.013000	0.64023	0.889000	0.36185	0.655000	0.94253	GAG	CHCHD8	-	NULL	ENSG00000181924		0.612	COA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD8	HGNC	protein_coding	OTTHUMT00000397878.1	72	0.00	0	C	NM_016565		73584201	73584201	-1	no_errors	ENST00000541455	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	1.000	T
CHGB	1114	genome.wustl.edu	37	20	5904085	5904085	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr20:5904085C>T	ENST00000378961.4	+	4	1499	c.1295C>T	c.(1294-1296)tCt>tTt	p.S432F		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	432						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						TATTTCATGTCTGACACCAGA	0.542																																						dbGAP											0													90.0	89.0	89.0					20																	5904085		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1295C>T	20.37:g.5904085C>T	ENSP00000368244:p.Ser432Phe		A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	pfam_Granin,prints_Chromogranin_AB	p.S432F	ENST00000378961.4	37	c.1295	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	C	3.873	-0.027594	0.07589	.	.	ENSG00000089199	ENST00000378961	T	0.01787	4.64	5.12	-3.79	0.04320	.	1.415750	0.04195	N	0.329046	T	0.01421	0.0046	N	0.22421	0.69	0.09310	N	1	B	0.29862	0.259	B	0.31016	0.123	T	0.45512	-0.9256	10	0.40728	T	0.16	2.0118	1.9847	0.03434	0.1301:0.1945:0.1881:0.4873	.	432	P05060	SCG1_HUMAN	F	432	ENSP00000368244:S432F	ENSP00000368244:S432F	S	+	2	0	CHGB	5852085	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.656000	0.05342	-0.337000	0.08426	0.655000	0.94253	TCT	CHGB	-	pfam_Granin	ENSG00000089199		0.542	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	HGNC	protein_coding	OTTHUMT00000077897.2	75	0.00	0	C	NM_001819		5904085	5904085	+1	no_errors	ENST00000378961	ensembl	human	known	69_37n	missense	58	17.14	12	SNP	0.000	T
COL5A3	50509	genome.wustl.edu	37	19	10108093	10108093	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:10108093G>C	ENST00000264828.3	-	11	1302	c.1217C>G	c.(1216-1218)tCa>tGa	p.S406*	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	406	Collagen-like 1.|Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGGAGGGCCTGAGGGGCCAAC	0.592																																						dbGAP											0													21.0	24.0	23.0					19																	10108093		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1217C>G	19.37:g.10108093G>C	ENSP00000264828:p.Ser406*		Q9NZQ6	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.S406*	ENST00000264828.3	37	c.1217	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.372715	0.97515	.	.	ENSG00000080573	ENST00000264828	.	.	.	4.14	0.102	0.14522	.	0.405081	0.22341	U	0.061334	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	4.6185	0.12438	0.2343:0.1751:0.5906:0.0	.	.	.	.	X	406	.	ENSP00000264828:S406X	S	-	2	0	COL5A3	9969093	0.934000	0.31675	0.778000	0.31720	0.834000	0.47266	2.432000	0.44784	-0.082000	0.12640	0.313000	0.20887	TCA	COL5A3	-	pfam_Collagen	ENSG00000080573		0.592	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	55	0.00	0	G	NM_015719		10108093	10108093	-1	no_errors	ENST00000264828	ensembl	human	known	69_37n	nonsense	39	22.00	11	SNP	0.691	C
CLASRP	11129	genome.wustl.edu	37	19	45572374	45572374	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:45572374G>A	ENST00000221455.3	+	17	1917	c.1819G>A	c.(1819-1821)Gag>Aag	p.E607K	CLASRP_ENST00000544944.2_Missense_Mutation_p.E588K|CLASRP_ENST00000391953.4_Missense_Mutation_p.E545K	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	607	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GCAGGAGCATGAGCGGCAGGT	0.602																																						dbGAP											0													114.0	128.0	123.0					19																	45572374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1819G>A	19.37:g.45572374G>A	ENSP00000221455:p.Glu607Lys		B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	pfam_SWAP_N_domain	p.E607K	ENST00000221455.3	37	c.1819	CCDS12652.2	19	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199445	0.79015	.	.	ENSG00000104859	ENST00000221455;ENST00000391953;ENST00000544944	T;T;T	0.50277	2.42;0.75;1.5	5.16	5.16	0.70880	.	0.000000	0.36555	U	0.002537	T	0.27663	0.0680	N	0.08118	0	0.37846	D	0.929211	B;B;B	0.23128	0.08;0.041;0.004	B;B;B	0.20955	0.032;0.018;0.002	T	0.17048	-1.0382	10	0.21014	T	0.42	-22.9701	14.0318	0.64619	0.0:0.0:1.0:0.0	.	545;588;607	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	K	607;545;588	ENSP00000221455:E607K;ENSP00000375815:E545K;ENSP00000438702:E588K	ENSP00000221455:E607K	E	+	1	0	CLASRP	50264214	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	4.542000	0.60677	2.706000	0.92434	0.555000	0.69702	GAG	CLASRP	-	NULL	ENSG00000104859		0.602	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLASRP	HGNC	protein_coding	OTTHUMT00000316749.1	133	0.00	0	G	NM_007056		45572374	45572374	+1	no_errors	ENST00000221455	ensembl	human	known	69_37n	missense	120	21.05	32	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16950687	16950687	+	lincRNA	SNP	G	G	T	rs1762940		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:16950687G>T	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GCCCCTGGGGGCCCGTGCCTG	0.667																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950687G>T			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.667	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	8	0.00	0	G	NR_026752.1		16950687	16950687	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	16	23.81	5	SNP	0.003	T
CWC22	57703	genome.wustl.edu	37	2	180851479	180851479	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:180851479C>G	ENST00000410053.3	-	4	448	c.149G>C	c.(148-150)aGa>aCa	p.R50T	CWC22_ENST00000295749.6_Missense_Mutation_p.R50T	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	50	Arg-rich.				mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						ATAGTCTGATCTGCTGTAATC	0.348																																						dbGAP											0													91.0	83.0	85.0					2																	180851479		1838	4096	5934	-	-	-	SO:0001583	missense	0				CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.149G>C	2.37:g.180851479C>G	ENSP00000387006:p.Arg50Thr		Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.R50T	ENST00000410053.3	37	c.149	CCDS46465.1	2	.	.	.	.	.	.	.	.	.	.	C	10.92	1.487144	0.26686	.	.	ENSG00000163510	ENST00000410053;ENST00000295749;ENST00000404136	T;T;T	0.28069	1.94;1.94;1.63	5.82	2.03	0.26663	.	0.514420	0.24132	N	0.041243	T	0.32164	0.0820	M	0.69823	2.125	0.30192	N	0.799412	B	0.24963	0.115	B	0.28139	0.086	T	0.32955	-0.9887	10	0.62326	D	0.03	-12.0577	9.0879	0.36592	0.0:0.71:0.0:0.29	.	50	Q9HCG8	CWC22_HUMAN	T	50	ENSP00000387006:R50T;ENSP00000295749:R50T;ENSP00000384159:R50T	ENSP00000295749:R50T	R	-	2	0	CWC22	180559724	0.973000	0.33851	0.908000	0.35775	0.212000	0.24457	0.842000	0.27627	0.395000	0.25257	0.655000	0.94253	AGA	CWC22	-	NULL	ENSG00000163510		0.348	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CWC22	HGNC	protein_coding	OTTHUMT00000334537.1	268	0.00	0	C	NM_020943		180851479	180851479	-1	no_errors	ENST00000295749	ensembl	human	known	69_37n	missense	109	18.05	24	SNP	0.982	G
CXXC4	80319	genome.wustl.edu	37	4	105412003	105412003	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:105412003G>A	ENST00000426831.1	-	1	464	c.450C>T	c.(448-450)aaC>aaT	p.N150N	CXXC4_ENST00000466963.1_Intron|AC004053.1_ENST00000500179.1_RNA|AC093628.1_ENST00000606234.1_RNA|CXXC4_ENST00000394767.2_Silent_p.N319N			Q9H2H0	CXXC4_HUMAN	CXXC finger protein 4	150					negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)	DNA binding (GO:0003677)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		AGACGCCACAGTTGATGAGCC	0.542																																						dbGAP											0													87.0	94.0	92.0					4																	105412003		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3665.1, CCDS3665.2	4q22-q24	2014-02-18	2011-12-01		ENSG00000168772	ENSG00000168772			24593	protein-coding gene	gene with protein product	"""Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex)"""	611645				11113207	Standard	NM_025212		Approved	IDAX	uc003hxf.2	Q9H2H0	OTTHUMG00000131121	ENST00000426831.1:c.450C>T	4.37:g.105412003G>A				Silent	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.N319	ENST00000426831.1	37	c.957		4																																																																																			CXXC4	-	pfam_Znf_CXXC,pfscan_Znf_CXXC	ENSG00000168772		0.542	CXXC4-201	KNOWN	basic	protein_coding	CXXC4	HGNC	protein_coding		145	0.00	0	G	NM_025212		105412003	105412003	-1	no_errors	ENST00000394767	ensembl	human	known	69_37n	silent	73	24.74	24	SNP	1.000	A
CXorf57	55086	genome.wustl.edu	37	X	105879798	105879798	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:105879798G>C	ENST00000372548.4	+	7	1438	c.1329G>C	c.(1327-1329)ttG>ttC	p.L443F	CXorf57_ENST00000372544.2_Missense_Mutation_p.L443F	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	443							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						GTACACAGTTGAAAGTTGTCA	0.338																																						dbGAP											0													156.0	140.0	145.0					X																	105879798		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.1329G>C	X.37:g.105879798G>C	ENSP00000361628:p.Leu443Phe		H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.L443F	ENST00000372548.4	37	c.1329	CCDS14519.1	X	.	.	.	.	.	.	.	.	.	.	g	13.86	2.362843	0.41902	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	T;T;T	0.53857	0.61;0.64;0.6	4.44	4.44	0.53790	.	0.286459	0.36555	N	0.002521	T	0.64929	0.2643	L	0.54323	1.7	0.29800	N	0.832487	D;D;B	0.71674	0.998;0.998;0.001	D;D;B	0.66351	0.943;0.943;0.003	T	0.63892	-0.6534	10	0.51188	T	0.08	-7.7293	13.5784	0.61888	0.0:0.0:1.0:0.0	.	443;443;443	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	F	443;443;251	ENSP00000361623:L443F;ENSP00000361628:L443F;ENSP00000405866:L251F	ENSP00000361623:L443F	L	+	3	2	CXorf57	105766454	1.000000	0.71417	0.998000	0.56505	0.849000	0.48306	4.275000	0.58927	2.142000	0.66516	0.425000	0.28330	TTG	CXorf57	-	NULL	ENSG00000147231		0.338	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	HGNC	protein_coding	OTTHUMT00000057800.2	324	0.00	0	G	NM_018015		105879798	105879798	+1	no_errors	ENST00000372548	ensembl	human	known	69_37n	missense	151	15.38	28	SNP	1.000	C
CYP4Z1	199974	genome.wustl.edu	37	1	47581263	47581263	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:47581263C>T	ENST00000334194.3	+	10	1267	c.1264C>T	c.(1264-1266)Cag>Tag	p.Q422*	CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4Z1_ENST00000471598.1_3'UTR	NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	422						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						GGAAGACCCTCAGGTATGATT	0.448																																						dbGAP											0													100.0	91.0	94.0					1																	47581263		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.1264C>T	1.37:g.47581263C>T	ENSP00000334246:p.Gln422*		Q5VVE4	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.Q422*	ENST00000334194.3	37	c.1264	CCDS545.1	1	.	.	.	.	.	.	.	.	.	.	c	23.3	4.394632	0.83011	.	.	ENSG00000186160	ENST00000334194	.	.	.	2.7	-5.4	0.02656	.	1.200010	0.06394	U	0.717526	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	9.7337	0.40376	0.1305:0.6126:0.2569:0.0	.	.	.	.	X	422	.	ENSP00000334246:Q422X	Q	+	1	0	CYP4Z1	47353850	0.015000	0.18098	0.000000	0.03702	0.857000	0.48899	-0.794000	0.04584	-2.872000	0.00322	-1.243000	0.01532	CAG	CYP4Z1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000186160		0.448	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4Z1	HGNC	protein_coding	OTTHUMT00000022020.1	230	0.00	0	C	NM_178134		47581263	47581263	+1	no_errors	ENST00000334194	ensembl	human	known	69_37n	nonsense	111	16.42	22	SNP	0.002	T
DCAF12L1	139170	genome.wustl.edu	37	X	125685470	125685470	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:125685470G>C	ENST00000371126.1	-	1	1364	c.1122C>G	c.(1120-1122)ttC>ttG	p.F374L		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	374								p.F374F(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						GGACGTCATAGAAGAGCAGGG	0.632																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											39.0	42.0	41.0					X																	125685470		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1122C>G	X.37:g.125685470G>C	ENSP00000360167:p.Phe374Leu		Q8IYK3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F374L	ENST00000371126.1	37	c.1122	CCDS14610.1	X	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903342	0.52333	.	.	ENSG00000198889	ENST00000371126	T	0.60299	0.2	3.64	2.77	0.32553	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.37623	N	0.002003	T	0.69975	0.3171	M	0.83774	2.66	0.36920	D	0.891352	D	0.69078	0.997	D	0.75020	0.985	T	0.70655	-0.4812	10	0.25106	T	0.35	.	5.2063	0.15293	0.2667:0.0:0.7333:0.0	.	374	Q5VU92	DC121_HUMAN	L	374	ENSP00000360167:F374L	ENSP00000360167:F374L	F	-	3	2	DCAF12L1	125513151	1.000000	0.71417	0.984000	0.44739	0.400000	0.30750	3.547000	0.53663	0.921000	0.36994	0.429000	0.28392	TTC	DCAF12L1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198889		0.632	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	31	0.00	0	G	NM_178470		125685470	125685470	-1	no_errors	ENST00000371126	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	1.000	C
DCHS1	8642	genome.wustl.edu	37	11	6661191	6661191	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:6661191C>T	ENST00000299441.3	-	2	2065	c.1654G>A	c.(1654-1656)Gat>Aat	p.D552N		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	552	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D552N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGCCACCATCTGTGGCCACC	0.547																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											86.0	87.0	86.0					11																	6661191		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.1654G>A	11.37:g.6661191C>T	ENSP00000299441:p.Asp552Asn		O15098	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D552N	ENST00000299441.3	37	c.1654	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174818	0.78564	.	.	ENSG00000166341	ENST00000299441	T	0.79940	-1.32	5.18	5.18	0.71444	Cadherin (4);Cadherin-like (1);	0.355526	0.20375	N	0.093580	D	0.92133	0.7506	M	0.92923	3.36	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.92459	0.5976	10	0.44086	T	0.13	.	18.0581	0.89369	0.0:1.0:0.0:0.0	.	552	Q96JQ0	PCD16_HUMAN	N	552	ENSP00000299441:D552N	ENSP00000299441:D552N	D	-	1	0	DCHS1	6617767	1.000000	0.71417	0.973000	0.42090	0.783000	0.44284	7.759000	0.85235	2.588000	0.87417	0.579000	0.79373	GAT	DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.547	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	113	0.00	0	C	NM_003737		6661191	6661191	-1	no_errors	ENST00000299441	ensembl	human	known	69_37n	missense	55	24.66	18	SNP	1.000	T
DCLRE1C	64421	genome.wustl.edu	37	10	14977484	14977484	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr10:14977484C>G	ENST00000378278.2	-	6	479	c.442G>C	c.(442-444)Gag>Cag	p.E148Q	DCLRE1C_ENST00000378289.4_Missense_Mutation_p.E148Q|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.E28Q|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.E28Q|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.E33Q|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.E28Q|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.E28Q|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.E33Q|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.E28Q|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.E33Q			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	148					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						TGCAGAAGCTCCATTCTAGCA	0.428								Non-homologous end-joining																														dbGAP											0													108.0	116.0	113.0					10																	14977484		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.442G>C	10.37:g.14977484C>G	ENSP00000367527:p.Glu148Gln		D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	pfam_DRMBL	p.E148Q	ENST00000378278.2	37	c.442	CCDS31149.1	10	.	.	.	.	.	.	.	.	.	.	C	21.4	4.139332	0.77775	.	.	ENSG00000152457	ENST00000378289;ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000418843;ENST00000378241;ENST00000456122	T;T;T;T;T;T;T;T;T;T;T;T;T	0.80994	-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-0.96;-1.44;-0.66;-1.11	5.41	5.41	0.78517	Beta-lactamase-like (1);	0.044068	0.85682	D	0.000000	D	0.84727	0.5536	L	0.28740	0.885	0.58432	D	0.999999	B;D;B	0.89917	0.032;1.0;0.256	B;D;B	0.74348	0.064;0.983;0.212	D	0.84111	0.0401	10	0.41790	T	0.15	.	19.5802	0.95464	0.0:1.0:0.0:0.0	.	148;33;148	Q96SD1-4;Q96SD1-3;Q96SD1	.;.;DCR1C_HUMAN	Q	148;28;33;33;33;28;28;28;148;28;2;28;33	ENSP00000367538:E148Q;ENSP00000400529:E28Q;ENSP00000367492:E33Q;ENSP00000350349:E33Q;ENSP00000367496:E33Q;ENSP00000380030:E28Q;ENSP00000367503:E28Q;ENSP00000367502:E28Q;ENSP00000367527:E148Q;ENSP00000367506:E28Q;ENSP00000391428:E2Q;ENSP00000367487:E28Q;ENSP00000413180:E33Q	ENSP00000350349:E33Q	E	-	1	0	DCLRE1C	15017490	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.366000	0.79548	2.712000	0.92718	0.650000	0.86243	GAG	DCLRE1C	-	NULL	ENSG00000152457		0.428	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	62	0.00	0	C	NM_022487		14977484	14977484	-1	no_errors	ENST00000378278	ensembl	human	known	69_37n	missense	52	17.19	11	SNP	1.000	G
DCTN4	51164	genome.wustl.edu	37	5	150135984	150135984	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:150135984C>G	ENST00000447998.2	-	2	316	c.201G>C	c.(199-201)aaG>aaC	p.K67N	DCTN4_ENST00000521093.1_5'UTR|DCTN4_ENST00000424236.1_Missense_Mutation_p.K10N|DCTN4_ENST00000446090.2_Missense_Mutation_p.K67N	NM_016221.3	NP_057305.1	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62)	67					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	10		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTTACCTATTCTTTTTTAGTT	0.383																																						dbGAP											0													54.0	58.0	57.0					5																	150135984		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF195120	CCDS4310.1, CCDS47310.1, CCDS47311.1	5q31-q32	2008-05-23			ENSG00000132912	ENSG00000132912			15518	protein-coding gene	gene with protein product		614758				10843801, 16554302	Standard	NM_016221		Approved		uc010jhi.3	Q9UJW0	OTTHUMG00000130079	ENST00000447998.2:c.201G>C	5.37:g.150135984C>G	ENSP00000416968:p.Lys67Asn		B3KWW0|D3DQH0|E5RGT5|Q8TAN8	Missense_Mutation	SNP	pfam_Dynactin_p62	p.K67N	ENST00000447998.2	37	c.201	CCDS4310.1	5	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946494	0.53186	.	.	ENSG00000132912	ENST00000447998;ENST00000424236;ENST00000446090;ENST00000518015;ENST00000521533	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62	5.04	1.8	0.24995	.	0.000000	0.85682	D	0.000000	T	0.34106	0.0886	M	0.64676	1.99	0.80722	D	1	P;P	0.40332	0.665;0.713	B;B	0.43950	0.31;0.437	T	0.10567	-1.0624	10	0.38643	T	0.18	-6.1377	11.3569	0.49621	0.0:0.7631:0.0:0.2369	.	67;67	Q9UJW0-3;Q9UJW0	.;DCTN4_HUMAN	N	67;10;67;10;10	ENSP00000416968:K67N;ENSP00000411251:K10N;ENSP00000414906:K67N;ENSP00000430993:K10N;ENSP00000430183:K10N	ENSP00000411251:K10N	K	-	3	2	DCTN4	150116177	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	3.914000	0.56401	0.518000	0.28383	-0.140000	0.14226	AAG	DCTN4	-	pfam_Dynactin_p62	ENSG00000132912		0.383	DCTN4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCTN4	HGNC	protein_coding	OTTHUMT00000252372.1	140	0.00	0	C			150135984	150135984	-1	no_errors	ENST00000446090	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	G
DDB1	1642	genome.wustl.edu	37	11	61099077	61099077	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:61099077G>A	ENST00000301764.7	-	2	545	c.148C>T	c.(148-150)Cgg>Tgg	p.R50W	DDB1_ENST00000450997.2_Missense_Mutation_p.R50W|DAK_ENST00000394900.3_5'Flank	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	50	Interaction with CDT1.|WD repeat beta-propeller A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						TTGACGGGCCGAAGCCCCTCG	0.517								Nucleotide excision repair (NER)																														dbGAP											0													108.0	92.0	98.0					11																	61099077		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.148C>T	11.37:g.61099077G>A	ENSP00000301764:p.Arg50Trp		A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.R50W	ENST00000301764.7	37	c.148	CCDS31576.1	11	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218171	0.79464	.	.	ENSG00000167986	ENST00000301764;ENST00000450997;ENST00000543658;ENST00000542337;ENST00000543627	T;T	0.47528	1.43;0.84	5.32	5.32	0.75619	.	0.062096	0.64402	D	0.000006	T	0.67069	0.2854	M	0.81682	2.555	0.30000	N	0.816062	D;D;D;D	0.89917	0.978;1.0;1.0;0.999	B;P;P;P	0.62014	0.442;0.897;0.792;0.852	T	0.69818	-0.5042	10	0.72032	D	0.01	-17.9691	13.9179	0.63911	0.0:0.0:0.848:0.152	.	50;50;50;50	B4DG00;F5GY55;B7Z2A1;Q16531	.;.;.;DDB1_HUMAN	W	50	ENSP00000301764:R50W;ENSP00000388705:R50W	ENSP00000301764:R50W	R	-	1	2	DDB1	60855653	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	3.596000	0.54024	2.487000	0.83934	0.655000	0.94253	CGG	DDB1	-	NULL	ENSG00000167986		0.517	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DDB1	HGNC	protein_coding	OTTHUMT00000398816.1	190	0.00	0	G	NM_001923		61099077	61099077	-1	no_errors	ENST00000301764	ensembl	human	known	69_37n	missense	81	28.70	33	SNP	1.000	A
DLG1	1739	genome.wustl.edu	37	3	197023229	197023229	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:197023229G>A	ENST00000419354.1	-	3	425	c.139C>T	c.(139-141)Cag>Tag	p.Q47*	DLG1_ENST00000314062.3_Nonsense_Mutation_p.Q47*|MIR4797_ENST00000577559.1_RNA|DLG1_ENST00000448528.2_Nonsense_Mutation_p.Q47*|DLG1-AS1_ENST00000430666.1_RNA|DLG1_ENST00000450955.1_Nonsense_Mutation_p.Q47*|DLG1-AS1_ENST00000414529.1_RNA|DLG1_ENST00000392382.2_Nonsense_Mutation_p.Q47*|DLG1_ENST00000346964.2_Nonsense_Mutation_p.Q47*|DLG1_ENST00000485409.1_5'UTR|DLG1_ENST00000357674.4_Nonsense_Mutation_p.Q47*|DLG1_ENST00000422288.1_Nonsense_Mutation_p.Q47*			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	47	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		ATTAAAGCCTGAAAGAGGTTG	0.358																																						dbGAP											0													133.0	139.0	137.0					3																	197023229		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.139C>T	3.37:g.197023229G>A	ENSP00000407531:p.Gln47*		A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Nonsense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.Q47*	ENST00000419354.1	37	c.139	CCDS43194.1	3	.	.	.	.	.	.	.	.	.	.	G	40	8.198644	0.98701	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000422288;ENST00000448528;ENST00000392382;ENST00000450955;ENST00000456699;ENST00000392380;ENST00000419553;ENST00000436682;ENST00000412364	.	.	.	4.99	4.99	0.66335	.	0.138647	0.49916	D	0.000134	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.5941	0.84791	0.0:0.0:1.0:0.0	.	.	.	.	X	47	.	ENSP00000321087:Q47X	Q	-	1	0	DLG1	198507626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.359000	0.90093	2.693000	0.91896	0.585000	0.79938	CAG	DLG1	-	pfam_L27_1,smart_L27,pirsf_M-assoc_guanylate_kinase,pfscan_L27	ENSG00000075711		0.358	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	299	0.00	0	G	NM_004087		197023229	197023229	-1	no_errors	ENST00000346964	ensembl	human	known	69_37n	nonsense	112	20.57	29	SNP	1.000	A
DMKN	93099	genome.wustl.edu	37	19	35990898	35990898	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:35990898C>A	ENST00000339686.3	-	13	1497	c.1321G>T	c.(1321-1323)Gcc>Tcc	p.A441S	DMKN_ENST00000414866.2_Missense_Mutation_p.A154S|DMKN_ENST00000462126.1_5'UTR|DMKN_ENST00000402589.2_Missense_Mutation_p.A168S|DMKN_ENST00000436012.1_Missense_Mutation_p.A137S|DMKN_ENST00000429837.1_Missense_Mutation_p.A414S|DMKN_ENST00000419602.1_Missense_Mutation_p.A430S|DMKN_ENST00000443640.1_Missense_Mutation_p.A218S|DMKN_ENST00000602781.1_Missense_Mutation_p.A168S|DMKN_ENST00000480502.1_Missense_Mutation_p.A149S|DMKN_ENST00000492341.2_Missense_Mutation_p.A88S|DMKN_ENST00000472252.2_Missense_Mutation_p.A88S|DMKN_ENST00000467637.1_Missense_Mutation_p.A166S|DMKN_ENST00000408915.2_Missense_Mutation_p.A55S	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	441						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCACCATAGGCAGTGGGATAC	0.542																																						dbGAP											0													224.0	190.0	202.0					19																	35990898		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.1321G>T	19.37:g.35990898C>A	ENSP00000342012:p.Ala441Ser		A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	NULL	p.A441S	ENST00000339686.3	37	c.1321	CCDS12463.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.50|13.50	2.255841|2.255841	0.39896|0.39896	.|.	.|.	ENSG00000161249|ENSG00000161249	ENST00000408915;ENST00000402589;ENST00000339686;ENST00000436012;ENST00000414866;ENST00000429837;ENST00000419602;ENST00000443640|ENST00000434389	T;T;T;T;T;T;T;T|.	0.28069|.	1.63;1.63;1.63;1.63;1.63;1.63;1.63;1.63|.	4.45|4.45	-0.893|-0.893	0.10567|0.10567	.|.	1.450360|.	0.04776|.	N|.	0.428889|.	T|T	0.29817|0.29817	0.0745|0.0745	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B;B;B;D;P;B;B;B;B|.	0.57257|.	0.417;0.012;0.015;0.026;0.979;0.955;0.026;0.026;0.026;0.047|.	B;B;B;B;P;P;B;B;B;B|.	0.53401|.	0.085;0.006;0.015;0.015;0.725;0.725;0.015;0.015;0.015;0.022|.	T|T	0.30357|0.30357	-0.9981|-0.9981	10|5	0.42905|.	T|.	0.14|.	-0.8297|-0.8297	7.5097|7.5097	0.27566|0.27566	0.2078:0.5122:0.2801:0.0|0.2078:0.5122:0.2801:0.0	.|.	111;97;117;135;430;414;441;154;218;55|.	Q6E0U4-12;Q6E0U4-11;Q6E0U4-10;Q6E0U4-9;C9J4P6;Q6E0U4-4;Q6E0U4;Q6E0U4-8;C9IYI1;Q6E0U4-15|.	.;.;.;.;.;.;DMKN_HUMAN;.;.;.|.	S|F	55;168;441;137;154;414;430;218|165	ENSP00000386225:A55S;ENSP00000384509:A168S;ENSP00000342012:A441S;ENSP00000412075:A137S;ENSP00000392222:A154S;ENSP00000405503:A414S;ENSP00000391036:A430S;ENSP00000406864:A218S|.	ENSP00000342012:A441S|.	A|C	-|-	1|2	0|0	DMKN|DMKN	40682738|40682738	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.690000|-0.690000	0.05138|0.05138	-0.169000|-0.169000	0.10834|0.10834	-0.305000|-0.305000	0.09177|0.09177	GCC|TGC	DMKN	-	NULL	ENSG00000161249		0.542	DMKN-001	KNOWN	basic|CCDS	protein_coding	DMKN	HGNC	protein_coding	OTTHUMT00000109461.2	191	0.00	0	C	NM_033317		35990898	35990898	-1	no_errors	ENST00000339686	ensembl	human	known	69_37n	missense	173	14.36	29	SNP	0.000	A
DNAH10	196385	genome.wustl.edu	37	12	124362321	124362321	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:124362321G>A	ENST00000409039.3	+	47	7909	c.7884G>A	c.(7882-7884)ctG>ctA	p.L2628L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2628	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTGGCAAGCTGACATTCTGCA	0.453																																						dbGAP											0													93.0	101.0	98.0					12																	124362321		2128	4249	6377	-	-	-	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7884G>A	12.37:g.124362321G>A			C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.L2628	ENST00000409039.3	37	c.7884	CCDS9255.2	12																																																																																			DNAH10	-	NULL	ENSG00000197653		0.453	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	203	0.00	0	G			124362321	124362321	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	silent	69	31.68	32	SNP	1.000	A
DNAH11	8701	genome.wustl.edu	37	7	21658797	21658797	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:21658797G>A	ENST00000409508.3	+	24	4365	c.4334G>A	c.(4333-4335)cGa>cAa	p.R1445Q	DNAH11_ENST00000465593.1_3'UTR|DNAH11_ENST00000328843.6_Missense_Mutation_p.R1450Q	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1450	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GATGATGTCCGAAGGATTGTG	0.443									Kartagener syndrome																													dbGAP											0													63.0	66.0	65.0					7																	21658797		1932	4134	6066	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4334G>A	7.37:g.21658797G>A	ENSP00000475939:p.Arg1445Gln		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R1450Q	ENST00000409508.3	37	c.4349		7	.	.	.	.	.	.	.	.	.	.	G	8.970	0.972732	0.18736	.	.	ENSG00000105877	ENST00000328843	T	0.60548	0.18	5.63	-3.78	0.04333	Dynein heavy chain, domain-2 (1);	1.061170	0.07317	N	0.876911	T	0.38799	0.1054	.	.	.	0.19575	N	0.999963	B	0.27316	0.175	B	0.21151	0.033	T	0.23154	-1.0196	9	0.34782	T	0.22	.	8.7343	0.34519	0.5298:0.0:0.3731:0.0971	.	1450	Q96DT5	DYH11_HUMAN	Q	1450	ENSP00000330671:R1450Q	ENSP00000330671:R1450Q	R	+	2	0	DNAH11	21625322	0.000000	0.05858	0.001000	0.08648	0.070000	0.16714	-0.307000	0.08167	-0.528000	0.06366	-0.748000	0.03510	CGA	DNAH11	-	pfam_Dynein_heavy_dom-2	ENSG00000105877		0.443	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	179	0.00	0	G	NM_003777		21658797	21658797	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	80	23.81	25	SNP	0.001	A
DOK6	220164	genome.wustl.edu	37	18	67068499	67068499	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr18:67068499G>A	ENST00000382713.5	+	1	209	c.19G>A	c.(19-21)Gac>Aac	p.D7N		NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6	7										central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				CAACTTTAACGACATAGTCAA	0.687																																						dbGAP											0													45.0	38.0	40.0					18																	67068499		2201	4300	6501	-	-	-	SO:0001583	missense	0			AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.19G>A	18.37:g.67068499G>A	ENSP00000372160:p.Asp7Asn		A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.D7N	ENST00000382713.5	37	c.19	CCDS32841.1	18	.	.	.	.	.	.	.	.	.	.	G	33	5.251693	0.95336	.	.	ENSG00000206052	ENST00000382713	T	0.72942	-0.7	3.55	3.55	0.40652	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.79799	0.4508	M	0.64997	1.995	0.58432	D	0.999991	D	0.76494	0.999	D	0.65443	0.935	T	0.81028	-0.1118	10	0.48119	T	0.1	.	14.2159	0.65792	0.0:0.0:1.0:0.0	.	7	Q6PKX4	DOK6_HUMAN	N	7	ENSP00000372160:D7N	ENSP00000372160:D7N	D	+	1	0	DOK6	65219479	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.158000	0.71851	1.960000	0.56953	0.655000	0.94253	GAC	DOK6	-	NULL	ENSG00000206052		0.687	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK6	HGNC	protein_coding	OTTHUMT00000442969.1	68	0.00	0	G	NM_152721		67068499	67068499	+1	no_errors	ENST00000382713	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	1.000	A
DSE	29940	genome.wustl.edu	37	6	116758321	116758321	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:116758321C>T	ENST00000331677.3	+	7	3134	c.2690C>T	c.(2689-2691)tCt>tTt	p.S897F	DSE_ENST00000359564.2_Missense_Mutation_p.S897F|DSE_ENST00000452085.3_Missense_Mutation_p.S897F|DSE_ENST00000537543.1_Missense_Mutation_p.S916F			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	897					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		CCATCACTGTCTGCTTCCTAT	0.463																																						dbGAP											0													147.0	116.0	126.0					6																	116758321		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2690C>T	6.37:g.116758321C>T	ENSP00000332151:p.Ser897Phe		Q5R3K6	Missense_Mutation	SNP	superfamily_Chondroitin_lyas	p.S916F	ENST00000331677.3	37	c.2747	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884399	0.51908	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.21734	2.0;1.99;2.0;2.0	6.16	6.16	0.99307	.	0.112301	0.64402	D	0.000007	T	0.21387	0.0515	N	0.24115	0.695	0.80722	D	1	D;D	0.54207	0.965;0.965	P;P	0.54312	0.748;0.748	T	0.01401	-1.1364	10	0.87932	D	0	-22.4445	20.8598	0.99761	0.0:1.0:0.0:0.0	.	916;897	B7Z765;Q9UL01	.;DSE_HUMAN	F	897;916;897;897	ENSP00000404049:S897F;ENSP00000441152:S916F;ENSP00000332151:S897F;ENSP00000352567:S897F	ENSP00000332151:S897F	S	+	2	0	DSE	116865014	1.000000	0.71417	0.283000	0.24790	0.431000	0.31685	5.694000	0.68272	2.937000	0.99478	0.650000	0.86243	TCT	DSE	-	NULL	ENSG00000111817		0.463	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	147	0.00	0	C	NM_013352		116758321	116758321	+1	no_errors	ENST00000537543	ensembl	human	known	69_37n	missense	79	23.30	24	SNP	0.904	T
DTWD1	56986	genome.wustl.edu	37	15	49935542	49935542	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr15:49935542G>C	ENST00000251250.6	+	6	889	c.682G>C	c.(682-684)Gag>Cag	p.E228Q	DTWD1_ENST00000403028.3_Missense_Mutation_p.E228Q|DTWD1_ENST00000558653.1_Missense_Mutation_p.E228Q|DTWD1_ENST00000415425.1_Missense_Mutation_p.E141Q	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	228										endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		GTTACAAGTTGAGTTGAAAAC	0.299																																						dbGAP											0													24.0	24.0	24.0					15																	49935542		2192	4293	6485	-	-	-	SO:0001583	missense	0			BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.682G>C	15.37:g.49935542G>C	ENSP00000251250:p.Glu228Gln		Q567Q3|Q8WVG9|Q9NRU6	Missense_Mutation	SNP	pfam_DTW	p.E228Q	ENST00000251250.6	37	c.682	CCDS10132.1	15	.	.	.	.	.	.	.	.	.	.	G	19.29	3.799720	0.70567	.	.	ENSG00000104047	ENST00000403028;ENST00000251250;ENST00000415425	T;T	0.24538	1.85;1.85	5.52	4.61	0.57282	DTW (1);	0.000000	0.85682	D	0.000000	T	0.47911	0.1471	M	0.66506	2.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75020	0.974;0.985	T	0.44952	-0.9294	9	.	.	.	-13.2184	14.3639	0.66792	0.0709:0.0:0.9291:0.0	.	141;228	Q8N5C7-2;Q8N5C7	.;DTWD1_HUMAN	Q	228;228;141	ENSP00000385399:E228Q;ENSP00000251250:E228Q	.	E	+	1	0	DTWD1	47722834	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.825000	0.86693	1.339000	0.45563	-0.140000	0.14226	GAG	DTWD1	-	pfam_DTW	ENSG00000104047		0.299	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTWD1	HGNC	protein_coding	OTTHUMT00000254431.2	16	0.00	0	G	NM_020234		49935542	49935542	+1	no_errors	ENST00000251250	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	1.000	C
EGR1	1958	genome.wustl.edu	37	5	137802624	137802624	+	Silent	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:137802624G>C	ENST00000239938.4	+	2	758	c.486G>C	c.(484-486)gtG>gtC	p.V162V		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	162					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GTGGCCTAGTGAGCATGACCA	0.652																																						dbGAP											0													111.0	114.0	113.0					5																	137802624		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.486G>C	5.37:g.137802624G>C				Silent	SNP	pfam_DUF3432,pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V162	ENST00000239938.4	37	c.486	CCDS4206.1	5																																																																																			EGR1	-	pfam_DUF3446	ENSG00000120738		0.652	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR1	HGNC	protein_coding	OTTHUMT00000251274.1	80	0.00	0	G	NM_001964		137802624	137802624	+1	no_errors	ENST00000239938	ensembl	human	known	69_37n	silent	34	17.07	7	SNP	1.000	C
ELF3	1999	genome.wustl.edu	37	1	201984496	201984496	+	3'UTR	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:201984496C>T	ENST00000359651.3	+	0	4353				RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367284.5_3'UTR|ELF3_ENST00000367283.3_3'UTR					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						CCACTCGAGGCCTGCAAACCT	0.562																																						dbGAP											0													28.0	28.0	28.0					1																	201984496		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.*45C>T	1.37:g.201984496C>T				RNA	SNP	-	NULL	ENST00000359651.3	37	NULL	CCDS1419.1	1																																																																																			ELF3	-	-	ENSG00000163435		0.562	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELF3	HGNC	protein_coding	OTTHUMT00000087360.1	53	0.00	0	C	NM_004433		201984496	201984496	+1	no_errors	ENST00000475698	ensembl	human	known	69_37n	rna	49	18.33	11	SNP	0.003	T
ELL3	80237	genome.wustl.edu	37	15	44068711	44068711	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr15:44068711C>T	ENST00000319359.3	-	2	805	c.164G>A	c.(163-165)cGa>cAa	p.R55Q	RP11-296A16.1_ENST00000417761.2_3'UTR|ELL3_ENST00000497465.1_5'Flank|SERF2_ENST00000381359.1_5'Flank	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	55					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)			cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		ACTTACCCCTCGGTGGCCTTG	0.657											OREG0003939	type=REGULATORY REGION|Gene=ELL3|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													120.0	84.0	96.0					15																	44068711		2184	4276	6460	-	-	-	SO:0001583	missense	0			AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.164G>A	15.37:g.44068711C>T	ENSP00000320346:p.Arg55Gln	921	B3KQ66|B3KX08|Q6I9Z7|Q9H634	Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.R55Q	ENST00000319359.3	37	c.164	CCDS10102.1	15	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076312	0.76415	.	.	ENSG00000128886	ENST00000319359;ENST00000433927	T;T	0.26810	1.71;1.71	4.89	4.89	0.63831	.	0.455087	0.18697	N	0.133716	T	0.39009	0.1062	L	0.46614	1.455	0.30318	N	0.787884	D	0.89917	1.0	D	0.87578	0.998	T	0.08597	-1.0714	10	0.07644	T	0.81	-19.0055	13.4166	0.60972	0.0:1.0:0.0:0.0	.	55	Q9HB65	ELL3_HUMAN	Q	55;85	ENSP00000320346:R55Q;ENSP00000404209:R85Q	ENSP00000320346:R55Q	R	-	2	0	ELL3	41856003	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.478000	0.53158	2.546000	0.85860	0.563000	0.77884	CGA	ELL3	-	pfam_RNA_pol_II_elong_fac_ELL	ENSG00000128886		0.657	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL3	HGNC	protein_coding	OTTHUMT00000133236.2	205	0.00	0	C	NM_025165		44068711	44068711	-1	no_errors	ENST00000319359	ensembl	human	known	69_37n	missense	91	27.20	34	SNP	1.000	T
ENPP2	5168	genome.wustl.edu	37	8	120602768	120602768	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr8:120602768G>A	ENST00000075322.6	-	13	1242	c.1184C>T	c.(1183-1185)tCc>tTc	p.S395F	ENPP2_ENST00000259486.6_Missense_Mutation_p.S447F|ENPP2_ENST00000522167.1_Missense_Mutation_p.S34F|ENPP2_ENST00000427067.2_Missense_Mutation_p.S391F|ENPP2_ENST00000522826.1_Missense_Mutation_p.S395F	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	395					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.S447Y(1)|p.S395Y(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GCTAAATTTGGATCGAATTCT	0.338																																					Melanoma(20;305 879 2501 4818 31020)	dbGAP											2	Substitution - Missense(2)	lung(2)											87.0	85.0	86.0					8																	120602768		2203	4300	6503	-	-	-	SO:0001583	missense	0			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.1184C>T	8.37:g.120602768G>A	ENSP00000075322:p.Ser395Phe		A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.S447F	ENST00000075322.6	37	c.1340	CCDS34936.1	8	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246115	0.80024	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522167;ENST00000522826;ENST00000075322	T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68	5.66	5.66	0.87406	Alkaline-phosphatase-like, core domain (1);	0.781800	0.12824	N	0.436179	T	0.78868	0.4351	L	0.47190	1.495	0.44409	D	0.997329	B;P;B;P	0.48016	0.263;0.723;0.391;0.904	P;P;B;P	0.54312	0.639;0.639;0.346;0.748	T	0.78542	-0.2164	10	0.87932	D	0	.	19.7534	0.96277	0.0:0.0:1.0:0.0	.	395;395;447;34	E9PHP7;Q13822;Q13822-2;E5RIA2	.;ENPP2_HUMAN;.;.	F	447;391;34;395;395	ENSP00000259486:S447F;ENSP00000403315:S391F;ENSP00000429476:S34F;ENSP00000428291:S395F;ENSP00000075322:S395F	ENSP00000075322:S395F	S	-	2	0	ENPP2	120671949	1.000000	0.71417	0.937000	0.37676	0.577000	0.36160	9.357000	0.97099	2.673000	0.90976	0.650000	0.86243	TCC	ENPP2	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000136960		0.338	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENPP2	HGNC	protein_coding	OTTHUMT00000381390.1	184	0.54	1	G			120602768	120602768	-1	no_errors	ENST00000259486	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	0.995	A
EPB41L5	57669	genome.wustl.edu	37	2	120848015	120848015	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:120848015C>G	ENST00000263713.5	+	12	1180	c.966C>G	c.(964-966)ttC>ttG	p.F322L	EPB41L5_ENST00000443902.2_Missense_Mutation_p.F322L|EPB41L5_ENST00000443124.1_Missense_Mutation_p.F322L|EPB41L5_ENST00000331393.4_Missense_Mutation_p.F322L|EPB41L5_ENST00000452780.1_Missense_Mutation_p.F322L	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	322	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						ATCATGCTTTCTTCCGCCTTC	0.388																																						dbGAP											0													149.0	139.0	143.0					2																	120848015		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.966C>G	2.37:g.120848015C>G	ENSP00000263713:p.Phe322Leu		Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.F322L	ENST00000263713.5	37	c.966	CCDS2130.1	2	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194200	0.78902	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000331393;ENST00000443124;ENST00000452780	D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47	5.41	2.65	0.31530	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.95604	0.8571	H	0.96142	3.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.999;1.0;0.999	D	0.94724	0.7903	10	0.87932	D	0	.	10.329	0.43812	0.0:0.788:0.0:0.212	.	322;322;322;322	Q9HCM4-3;Q9HCM4-4;Q9HCM4-2;Q9HCM4	.;.;.;E41L5_HUMAN	L	322	ENSP00000263713:F322L;ENSP00000393856:F322L;ENSP00000329687:F322L;ENSP00000393722:F322L;ENSP00000390439:F322L	ENSP00000263713:F322L	F	+	3	2	EPB41L5	120564485	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	2.580000	0.46068	0.361000	0.24292	0.585000	0.79938	TTC	EPB41L5	-	pfam_FERM_PH-like_C,pfscan_FERM_domain	ENSG00000115109		0.388	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	176	0.56	1	C	NM_020909		120848015	120848015	+1	no_errors	ENST00000263713	ensembl	human	known	69_37n	missense	92	18.42	21	SNP	1.000	G
EPHA5	2044	genome.wustl.edu	37	4	66201769	66201769	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:66201769C>T	ENST00000273854.3	-	16	3333	c.2733G>A	c.(2731-2733)atG>atA	p.M911I	EPHA5_ENST00000354839.4_Missense_Mutation_p.M889I|EPHA5_ENST00000432638.2_Missense_Mutation_p.M748I|EPHA5_ENST00000511294.1_Missense_Mutation_p.M912I	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	911	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AGCAATCCAGCATTAACTGAT	0.463										TSP Lung(17;0.13)																												dbGAP											0													126.0	109.0	115.0					4																	66201769		2203	4299	6502	-	-	-	SO:0001583	missense	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2733G>A	4.37:g.66201769C>T	ENSP00000273854:p.Met911Ile		Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.M911I	ENST00000273854.3	37	c.2733	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	C	34	5.364461	0.95877	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03	5.93	5.93	0.95920	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.90714	0.7086	L	0.48642	1.525	0.80722	D	1	D;D;D;D	0.67145	0.988;0.98;0.985;0.996	D;D;D;D	0.79108	0.992;0.934;0.987;0.99	D	0.90703	0.4622	10	0.87932	D	0	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	890;912;889;911	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	I	911;748;889;912	ENSP00000273854:M911I;ENSP00000389208:M748I;ENSP00000346899:M889I;ENSP00000427638:M912I	ENSP00000273854:M911I	M	-	3	0	EPHA5	65884364	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	ATG	EPHA5	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000145242		0.463	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	256	0.00	0	C	NM_004439		66201769	66201769	-1	no_errors	ENST00000273854	ensembl	human	known	69_37n	missense	99	12.39	14	SNP	1.000	T
EPS8	2059	genome.wustl.edu	37	12	15774268	15774268	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:15774268delC	ENST00000281172.5	-	21	2888	c.2452delG	c.(2452-2454)gaafs	p.E818fs	EPS8_ENST00000542903.1_Frame_Shift_Del_p.E558fs|EPS8_ENST00000543523.1_Frame_Shift_Del_p.E818fs|EPS8_ENST00000543612.1_Frame_Shift_Del_p.E818fs|EPS8_ENST00000540613.1_Frame_Shift_Del_p.E558fs	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	818	Effector region. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CTGCTTCCTTCATCAAAAGAT	0.393																																						dbGAP											0													88.0	81.0	84.0					12																	15774268		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2452delG	12.37:g.15774268delC	ENSP00000281172:p.Glu818fs		A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Frame_Shift_Del	DEL	pfam_PTB,pfam_SH3_domain,pfam_PTyr_interaction_dom,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTyr_interaction_dom,smart_SH3_domain,pfscan_SH3_domain	p.E818fs	ENST00000281172.5	37	c.2452	CCDS31753.1	12																																																																																			EPS8	-	NULL	ENSG00000151491		0.393	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	HGNC	protein_coding	OTTHUMT00000401093.1	271	0.00	0	C			15774268	15774268	-1	no_errors	ENST00000281172	ensembl	human	known	69_37n	frame_shift_del	72	16.67	15	DEL	1.000	-
EPS8	2059	genome.wustl.edu	37	12	15774271	15774271	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:15774271C>T	ENST00000281172.5	-	21	2885	c.2449G>A	c.(2449-2451)Gat>Aat	p.D817N	EPS8_ENST00000542903.1_Missense_Mutation_p.D557N|EPS8_ENST00000543523.1_Missense_Mutation_p.D817N|EPS8_ENST00000543612.1_Missense_Mutation_p.D817N|EPS8_ENST00000540613.1_Missense_Mutation_p.D557N	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	817	Effector region. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CTTCCTTCATCAAAAGATTCC	0.388																																						dbGAP											0													89.0	82.0	85.0					12																	15774271		2202	4300	6502	-	-	-	SO:0001583	missense	0			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2449G>A	12.37:g.15774271C>T	ENSP00000281172:p.Asp817Asn		A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	pfam_PTB,pfam_SH3_domain,pfam_PTyr_interaction_dom,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTyr_interaction_dom,smart_SH3_domain,pfscan_SH3_domain	p.D817N	ENST00000281172.5	37	c.2449	CCDS31753.1	12	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811931	0.90707	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903	T;T;T;T;T	0.10005	3.06;3.06;3.06;2.92;2.92	5.54	5.54	0.83059	.	0.058726	0.64402	D	0.000003	T	0.14787	0.0357	N	0.19112	0.55	0.54753	D	0.999987	D	0.57257	0.979	P	0.54270	0.747	T	0.10245	-1.0638	10	0.26408	T	0.33	-19.207	17.6791	0.88238	0.0:1.0:0.0:0.0	.	817	Q12929	EPS8_HUMAN	N	817;817;817;557;557	ENSP00000441867:D817N;ENSP00000281172:D817N;ENSP00000442388:D817N;ENSP00000441888:D557N;ENSP00000437806:D557N	ENSP00000281172:D817N	D	-	1	0	EPS8	15665538	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.859000	0.75467	2.598000	0.87819	0.650000	0.86243	GAT	EPS8	-	NULL	ENSG00000151491		0.388	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	HGNC	protein_coding	OTTHUMT00000401093.1	271	0.00	0	C			15774271	15774271	-1	no_errors	ENST00000281172	ensembl	human	known	69_37n	missense	71	19.78	18	SNP	1.000	T
ETAA1	54465	genome.wustl.edu	37	2	67637053	67637053	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:67637053G>C	ENST00000272342.5	+	6	2794	c.2664G>C	c.(2662-2664)gaG>gaC	p.E888D		NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	888	Poly-Glu.					cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						AGGAAGAAGAGAAAAATAGAA	0.343																																						dbGAP											0													77.0	95.0	89.0					2																	67637053		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.2664G>C	2.37:g.67637053G>C	ENSP00000272342:p.Glu888Asp		Q05BT7|Q53SC4	Missense_Mutation	SNP	NULL	p.E888D	ENST00000272342.5	37	c.2664	CCDS1882.1	2	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476484	0.63737	.	.	ENSG00000143971	ENST00000272342	T	0.30981	1.51	5.77	1.34	0.21922	.	0.186659	0.45126	N	0.000395	T	0.29256	0.0728	M	0.70275	2.135	0.29376	N	0.86366	P	0.47034	0.889	B	0.42827	0.399	T	0.26052	-1.0114	10	0.62326	D	0.03	-6.8631	4.4347	0.11545	0.3515:0.0:0.4939:0.1546	.	888	Q9NY74	ETAA1_HUMAN	D	888	ENSP00000272342:E888D	ENSP00000272342:E888D	E	+	3	2	ETAA1	67490557	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	0.380000	0.20602	0.342000	0.23796	0.591000	0.81541	GAG	ETAA1	-	NULL	ENSG00000143971		0.343	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	HGNC	protein_coding	OTTHUMT00000251735.1	87	0.00	0	G	NM_019002		67637053	67637053	+1	no_errors	ENST00000272342	ensembl	human	known	69_37n	missense	106	15.20	19	SNP	0.999	C
EVI5	7813	genome.wustl.edu	37	1	93170218	93170218	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:93170218G>A	ENST00000370331.1	-	3	374	c.365C>T	c.(364-366)tCa>tTa	p.S122L	EVI5_ENST00000540033.1_Missense_Mutation_p.S122L|EVI5_ENST00000543509.1_Missense_Mutation_p.S122L	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	122	Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Ser-rich.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		GCTAGAGGCTGATGAACTCGA	0.363																																						dbGAP											0													152.0	153.0	153.0					1																	93170218		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.365C>T	1.37:g.93170218G>A	ENSP00000359356:p.Ser122Leu		A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S122L	ENST00000370331.1	37	c.365	CCDS30774.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.286771	0.95517	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509	T;T;T	0.06294	3.32;3.32;3.33	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.15739	0.0379	L	0.57536	1.79	0.80722	D	1	D;D	0.64830	0.994;0.989	D;P	0.66602	0.945;0.883	T	0.00482	-1.1713	10	0.87932	D	0	-11.5044	19.525	0.95201	0.0:0.0:1.0:0.0	.	122;122	F5H4R0;O60447	.;EVI5_HUMAN	L	122	ENSP00000359356:S122L;ENSP00000440826:S122L;ENSP00000445019:S122L	ENSP00000359356:S122L	S	-	2	0	EVI5	92942806	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.476000	0.97823	2.630000	0.89119	0.650000	0.86243	TCA	EVI5	-	NULL	ENSG00000067208		0.363	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVI5	HGNC	protein_coding	OTTHUMT00000030047.1	307	0.00	0	G	NM_005665		93170218	93170218	-1	no_errors	ENST00000543509	ensembl	human	known	69_37n	missense	205	15.98	39	SNP	1.000	A
FAM13C	220965	genome.wustl.edu	37	10	61029863	61029863	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr10:61029863G>T	ENST00000373868.2	-	7	686	c.599C>A	c.(598-600)tCa>tAa	p.S200*	FAM13C_ENST00000419214.2_Nonsense_Mutation_p.S200*|FAM13C_ENST00000435852.2_Nonsense_Mutation_p.S200*|FAM13C_ENST00000442566.3_Nonsense_Mutation_p.S221*|FAM13C_ENST00000373867.3_Nonsense_Mutation_p.S117*|FAM13C_ENST00000277705.6_Nonsense_Mutation_p.S221*|FAM13C_ENST00000422313.2_Nonsense_Mutation_p.S200*|FAM13C_ENST00000468840.2_Nonsense_Mutation_p.S117*	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	200										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTGGACTGGTGAGGGGTCTGG	0.468																																						dbGAP											0													79.0	70.0	73.0					10																	61029863		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.599C>A	10.37:g.61029863G>T	ENSP00000362975:p.Ser200*		B7ZB77|Q5T631|Q6P2M3|Q99787	Nonsense_Mutation	SNP	NULL	p.S200*	ENST00000373868.2	37	c.599	CCDS7255.1	10	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125818	0.77436	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313	.	.	.	5.53	-1.38	0.09027	.	0.926269	0.09067	N	0.853382	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	0.9889	8.3165	0.32104	0.6712:0.1184:0.2104:0.0	.	.	.	.	X	117;200;221;221;200;117;200;200	.	ENSP00000277705:S221X	S	-	2	0	FAM13C	60699869	0.004000	0.15560	0.003000	0.11579	0.605000	0.37080	0.712000	0.25779	-0.045000	0.13468	0.655000	0.94253	TCA	FAM13C	-	NULL	ENSG00000148541		0.468	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	72	0.00	0	G			61029863	61029863	-1	no_errors	ENST00000373868	ensembl	human	known	69_37n	nonsense	84	20.75	22	SNP	0.001	T
FAM160A1	729830	genome.wustl.edu	37	4	152499108	152499108	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:152499108C>T	ENST00000505231.1	+	3	771	c.612C>T	c.(610-612)ttC>ttT	p.F204F	FAM160A1_ENST00000435205.1_Silent_p.F204F|RN7SKP35_ENST00000517210.1_RNA			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	204										endometrium(2)|kidney(1)	3						TGATTCCCTTCATTCACCGAG	0.502																																						dbGAP											0													149.0	124.0	132.0					4																	152499108		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.612C>T	4.37:g.152499108C>T			Q6ZUS2	Silent	SNP	pfam_RetinoicA-induced_16-like	p.F204	ENST00000505231.1	37	c.612	CCDS47146.1	4																																																																																			FAM160A1	-	pfam_RetinoicA-induced_16-like	ENSG00000164142		0.502	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160A1	HGNC	protein_coding	OTTHUMT00000365691.1	163	0.61	1	C	NM_001109977		152499108	152499108	+1	no_errors	ENST00000435205	ensembl	human	known	69_37n	silent	121	12.23	17	SNP	1.000	T
FAM160A2	84067	genome.wustl.edu	37	11	6232761	6232761	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:6232761G>A	ENST00000449352.2	-	12	3157	c.2894C>T	c.(2893-2895)tCa>tTa	p.S965L	FAM160A2_ENST00000529360.1_5'UTR|FAM160A2_ENST00000265978.4_Missense_Mutation_p.S979L			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	965					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCCACAGCCTGAGATGAGAGG	0.557																																						dbGAP											0													73.0	80.0	78.0					11																	6232761		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.2894C>T	11.37:g.6232761G>A	ENSP00000416918:p.Ser965Leu		Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.S979L	ENST00000449352.2	37	c.2936	CCDS44530.1	11	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499614	0.64298	.	.	ENSG00000051009	ENST00000449352;ENST00000265978	T;T	0.10192	2.9;2.9	4.56	4.56	0.56223	.	0.000000	0.46442	D	0.000293	T	0.09642	0.0237	L	0.29908	0.895	0.80722	D	1	B;B	0.33238	0.281;0.403	B;B	0.33121	0.076;0.158	T	0.10941	-1.0608	10	0.87932	D	0	-5.9199	12.6964	0.57005	0.0:0.0:1.0:0.0	.	965;979	Q8N612;Q8N612-2	F16A2_HUMAN;.	L	965;979	ENSP00000416918:S965L;ENSP00000265978:S979L	ENSP00000265978:S979L	S	-	2	0	FAM160A2	6189337	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.347000	0.65998	2.333000	0.79357	0.650000	0.86243	TCA	FAM160A2	-	NULL	ENSG00000051009		0.557	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	HGNC	protein_coding	OTTHUMT00000383759.1	55	0.00	0	G	NM_032127		6232761	6232761	-1	no_errors	ENST00000265978	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	0.991	A
FAM189A1	23359	genome.wustl.edu	37	15	29415586	29415586	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr15:29415586C>G	ENST00000261275.4	-	11	1575	c.1576G>C	c.(1576-1578)Gag>Cag	p.E526Q		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	526						integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						GCCTCCTCCTCGAGGCGCTCC	0.612																																						dbGAP											0													38.0	36.0	37.0					15																	29415586		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.1576G>C	15.37:g.29415586C>G	ENSP00000261275:p.Glu526Gln		A0PK09	Missense_Mutation	SNP	pfam_CD20-like	p.E526Q	ENST00000261275.4	37	c.1576	CCDS45198.1	15	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962635	0.53400	.	.	ENSG00000104059	ENST00000261275	T	0.09445	2.98	5.36	-4.85	0.03142	.	0.543603	0.20752	N	0.086321	T	0.06005	0.0156	L	0.36672	1.1	0.20074	N	0.999939	B	0.31503	0.326	B	0.24848	0.056	T	0.15093	-1.0449	10	0.56958	D	0.05	-1.6338	6.554	0.22450	0.0:0.1743:0.2349:0.5908	.	526	O60320	F1891_HUMAN	Q	526	ENSP00000261275:E526Q	ENSP00000261275:E526Q	E	-	1	0	FAM189A1	27202878	1.000000	0.71417	0.000000	0.03702	0.003000	0.03518	0.836000	0.27545	-0.816000	0.04340	-0.172000	0.13284	GAG	FAM189A1	-	NULL	ENSG00000104059		0.612	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A1	HGNC	protein_coding	OTTHUMT00000417254.1	63	0.00	0	C	NM_015307		29415586	29415586	-1	no_errors	ENST00000261275	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	0.885	G
FAM35A	54537	genome.wustl.edu	37	10	88946909	88946909	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr10:88946909G>A	ENST00000298784.1	+	8	2374	c.2260G>A	c.(2260-2262)Gag>Aag	p.E754K	FAM35A_ENST00000298786.4_Missense_Mutation_p.E823K	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	754										endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						AAAGCTGATAGAGAAGATTCT	0.388																																					Ovarian(175;703 2004 25460 32514 43441)	dbGAP											0													147.0	123.0	131.0					10																	88946909		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.2260G>A	10.37:g.88946909G>A	ENSP00000298784:p.Glu754Lys		O95885|Q9H991	Missense_Mutation	SNP	NULL	p.E823K	ENST00000298784.1	37	c.2467	CCDS7383.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.29|17.29	3.352138|3.352138	0.61183|0.61183	.|.	.|.	ENSG00000122376|ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313|ENST00000342900	T;T;T|.	0.26518|.	1.73;1.78;1.78|.	3.13|3.13	2.09|2.09	0.27110|0.27110	.|.	0.142052|.	0.47852|.	U|.	0.000215|.	T|T	0.53753|0.53753	0.1816|0.1816	M|M	0.62723|0.62723	1.935|1.935	0.25772|0.25772	N|N	0.984826|0.984826	P;D|.	0.71674|.	0.95;0.998|.	P;D|.	0.68483|.	0.59;0.958|.	T|T	0.47959|0.47959	-0.9076|-0.9076	10|5	0.62326|.	D|.	0.03|.	-19.0278|-19.0278	12.6107|12.6107	0.56549|0.56549	0.0:0.1683:0.8317:0.0|0.0:0.1683:0.8317:0.0	.|.	477;754|.	Q5VSZ0;Q86V20|.	.;FA35A_HUMAN|.	K|K	823;754;754|477	ENSP00000298786:E823K;ENSP00000298784:E754K;ENSP00000351064:E754K|.	ENSP00000298784:E754K|.	E|R	+|+	1|2	0|0	FAM35A|FAM35A	88936889|88936889	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.703000|0.703000	0.40648|0.40648	4.249000|4.249000	0.58766|0.58766	1.775000|1.775000	0.52247|0.52247	0.194000|0.194000	0.17425|0.17425	GAG|AGA	FAM35A	-	NULL	ENSG00000122376		0.388	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM35A	HGNC	protein_coding	OTTHUMT00000049196.2	365	0.00	0	G	NM_019054		88946909	88946909	+1	no_errors	ENST00000298786	ensembl	human	known	69_37n	missense	91	18.58	21	SNP	0.992	A
FAM83C	128876	genome.wustl.edu	37	20	33876299	33876299	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr20:33876299G>A	ENST00000374408.3	-	3	867	c.771C>T	c.(769-771)ctC>ctT	p.L257L	FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	257										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CACAGTCAATGAGGACGAACT	0.632																																						dbGAP											0													69.0	67.0	68.0					20																	33876299		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.771C>T	20.37:g.33876299G>A			Q14D67|Q5JWN6|Q8N276	Silent	SNP	pfam_DUF1669	p.L257	ENST00000374408.3	37	c.771	CCDS13251.1	20																																																																																			FAM83C	-	pfam_DUF1669	ENSG00000125998		0.632	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83C	HGNC	protein_coding	OTTHUMT00000078854.3	73	0.00	0	G			33876299	33876299	-1	no_errors	ENST00000374408	ensembl	human	known	69_37n	silent	58	21.62	16	SNP	1.000	A
FARSB	10056	genome.wustl.edu	37	2	223464670	223464670	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:223464670C>T	ENST00000281828.6	-	16	1858	c.1595G>A	c.(1594-1596)gGa>gAa	p.G532E	FARSB_ENST00000536361.1_Missense_Mutation_p.G433E	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	532					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	GATCACATATCCCCCCTTGTC	0.453																																						dbGAP											0													197.0	174.0	182.0					2																	223464670		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.1595G>A	2.37:g.223464670C>T	ENSP00000281828:p.Gly532Glu		B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	pfam_B3/B4_tRNA-bd,pfam_tRNA_synthase_B5-dom,superfamily_DNA-bd_dom_put,superfamily_Phe-tRNA_synthase_B3/B4,smart_B3/B4_tRNA-bd,smart_tRNA_synthase_B5-dom,tigrfam_Phe-tRNA-synth_IIc_bsu_arc	p.G532E	ENST00000281828.6	37	c.1595	CCDS2454.1	2	.	.	.	.	.	.	.	.	.	.	C	18.19	3.570061	0.65765	.	.	ENSG00000116120	ENST00000281828;ENST00000536361	.	.	.	5.62	4.74	0.60224	.	0.000000	0.52532	D	0.000061	T	0.80259	0.4590	M	0.86573	2.825	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.81914	0.992;0.995	T	0.80518	-0.1347	9	0.27785	T	0.31	-12.5172	14.7208	0.69305	0.0:0.9302:0.0:0.0698	.	532;532	A8K666;Q9NSD9	.;SYFB_HUMAN	E	532;433	.	ENSP00000281828:G532E	G	-	2	0	FARSB	223172914	1.000000	0.71417	0.697000	0.30258	0.397000	0.30659	7.237000	0.78164	1.381000	0.46364	0.655000	0.94253	GGA	FARSB	-	tigrfam_Phe-tRNA-synth_IIc_bsu_arc	ENSG00000116120		0.453	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARSB	HGNC	protein_coding	OTTHUMT00000256855.2	268	0.00	0	C	NM_005687		223464670	223464670	-1	no_errors	ENST00000281828	ensembl	human	known	69_37n	missense	53	24.29	17	SNP	0.997	T
FCGBP	8857	genome.wustl.edu	37	19	40377034	40377034	+	Silent	SNP	G	G	A	rs201304305	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:40377034G>A	ENST00000221347.6	-	24	11395	c.11388C>T	c.(11386-11388)aaC>aaT	p.N3796N	FCGBP_ENST00000595713.1_5'UTR	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3796	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGGGGTCGCCGTTGTAGTTCC	0.597																																						dbGAP											0													4.0	4.0	4.0					19																	40377034		1716	3539	5255	-	-	-	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11388C>T	19.37:g.40377034G>A			O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.N3796	ENST00000221347.6	37	c.11388	CCDS12546.1	19																																																																																			FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	22	0.00	0	G	NM_003890		40377034	40377034	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	silent	48	21.31	13	SNP	0.470	A
FGD4	121512	genome.wustl.edu	37	12	32791666	32791666	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:32791666G>A	ENST00000427716.2	+	16	2404	c.1980G>A	c.(1978-1980)caG>caA	p.Q660Q	FGD4_ENST00000266482.3_Silent_p.Q412Q|FGD4_ENST00000531134.1_Silent_p.Q745Q|FGD4_ENST00000534526.2_Silent_p.Q797Q|FGD4_ENST00000546442.1_Silent_p.Q567Q|FGD4_ENST00000525053.1_Silent_p.Q772Q	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	660	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					AACCTTGGCAGAAAGCTTGGT	0.453																																						dbGAP											0													146.0	134.0	138.0					12																	32791666		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.1980G>A	12.37:g.32791666G>A			Q6ULS2|Q8TCP6	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.Q660	ENST00000427716.2	37	c.1980	CCDS8727.1	12																																																																																			FGD4	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000139132		0.453	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD4	HGNC	protein_coding	OTTHUMT00000268017.1	284	0.00	0	G	NM_139241		32791666	32791666	+1	no_errors	ENST00000427716	ensembl	human	known	69_37n	silent	106	23.74	33	SNP	1.000	A
FOXJ3	22887	genome.wustl.edu	37	1	42654583	42654583	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:42654583C>G	ENST00000372572.1	-	13	1781	c.1470G>C	c.(1468-1470)atG>atC	p.M490I	FOXJ3_ENST00000361776.1_Missense_Mutation_p.M456I|FOXJ3_ENST00000545068.1_Missense_Mutation_p.M490I|FOXJ3_ENST00000372573.1_Missense_Mutation_p.M490I|FOXJ3_ENST00000372571.1_Missense_Mutation_p.M4I|FOXJ3_ENST00000361346.1_Missense_Mutation_p.M490I	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	490					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTGCCTGTCTCATACTCTCCA	0.363																																						dbGAP											0													54.0	54.0	54.0					1																	42654583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.1470G>C	1.37:g.42654583C>G	ENSP00000361653:p.Met490Ile		A7MBL7|A7MD18|D3DPW2|Q9NSS7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.M490I	ENST00000372572.1	37	c.1470	CCDS30689.1	1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361102	0.82353	.	.	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000372571;ENST00000361346;ENST00000361776;ENST00000545068	D;D;D;D;D	0.95756	-3.8;-3.8;-3.8;-3.77;-3.8	5.8	4.87	0.63330	.	0.152246	0.53938	D	0.000047	D	0.93973	0.8070	M	0.61703	1.905	0.53005	D	0.999964	B	0.22276	0.067	B	0.20767	0.031	D	0.91912	0.5540	10	0.72032	D	0.01	.	14.4656	0.67482	0.0:0.8518:0.1482:0.0	.	490	Q9UPW0	FOXJ3_HUMAN	I	490;490;4;490;456;490	ENSP00000361654:M490I;ENSP00000361653:M490I;ENSP00000354620:M490I;ENSP00000354449:M456I;ENSP00000439044:M490I	ENSP00000354620:M490I	M	-	3	0	FOXJ3	42427170	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.680000	0.74518	1.417000	0.47077	0.655000	0.94253	ATG	FOXJ3	-	NULL	ENSG00000198815		0.363	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FOXJ3	HGNC	protein_coding	OTTHUMT00000018310.1	89	0.00	0	C	NM_014947		42654583	42654583	-1	no_errors	ENST00000361346	ensembl	human	known	69_37n	missense	48	21.31	13	SNP	1.000	G
FRAS1	80144	genome.wustl.edu	37	4	79328836	79328836	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:79328836G>A	ENST00000325942.6	+	31	4589	c.4149G>A	c.(4147-4149)gtG>gtA	p.V1383V	FRAS1_ENST00000264895.6_Silent_p.V1383V	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1383					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TCCTTCTAGTGAATATGCCTG	0.542																																						dbGAP											0													75.0	77.0	76.0					4																	79328836		2036	4188	6224	-	-	-	SO:0001819	synonymous_variant	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4149G>A	4.37:g.79328836G>A			A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EGF-like,smart_Calx_beta,pfscan_VWF_C	p.V1383	ENST00000325942.6	37	c.4149	CCDS54772.1	4																																																																																			FRAS1	-	NULL	ENSG00000138759		0.542	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	96	0.00	0	G			79328836	79328836	+1	no_errors	ENST00000264895	ensembl	human	known	69_37n	silent	87	13.86	14	SNP	0.989	A
FSTL5	56884	genome.wustl.edu	37	4	162680647	162680647	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:162680647C>G	ENST00000306100.5	-	6	1079	c.643G>C	c.(643-645)Gat>Cat	p.D215H	FSTL5_ENST00000379164.4_Missense_Mutation_p.D214H|FSTL5_ENST00000427802.2_Missense_Mutation_p.D214H|FSTL5_ENST00000536695.1_Missense_Mutation_p.D214H	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	215	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.D215N(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AAAGTACAATCAAAGAGATCC	0.299																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											90.0	97.0	95.0					4																	162680647		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.643G>C	4.37:g.162680647C>G	ENSP00000305334:p.Asp215His		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Kazal-type_dom,pfam_Ig_V-set,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_HAND_2,pfscan_Ig-like	p.D215H	ENST00000306100.5	37	c.643	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002747	0.35320	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.24350	1.86;1.86;1.86;1.86	5.37	5.37	0.77165	EF-hand-like domain (1);	0.204942	0.49916	D	0.000131	T	0.45296	0.1335	M	0.80028	2.48	0.51482	D	0.999926	P;P;P	0.50710	0.93;0.938;0.877	P;P;B	0.50231	0.635;0.537;0.365	T	0.49872	-0.8893	10	0.56958	D	0.05	.	18.078	0.89433	0.0:1.0:0.0:0.0	.	214;214;215	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	H	215;214;214;214	ENSP00000305334:D215H;ENSP00000368462:D214H;ENSP00000389270:D214H;ENSP00000440409:D214H	ENSP00000305334:D215H	D	-	1	0	FSTL5	162900097	1.000000	0.71417	0.524000	0.27887	0.044000	0.14063	4.088000	0.57678	2.510000	0.84645	0.579000	0.79373	GAT	FSTL5	-	NULL	ENSG00000168843		0.299	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	HGNC	protein_coding	OTTHUMT00000364773.2	145	0.00	0	C	NM_020116		162680647	162680647	-1	no_errors	ENST00000306100	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	1.000	G
GAD1	2571	genome.wustl.edu	37	2	171709249	171709249	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:171709249C>T	ENST00000358196.3	+	13	1760	c.1210C>T	c.(1210-1212)Cac>Tac	p.H404Y		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	404					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						CTGGAACCCTCACAAGATGAT	0.517																																						dbGAP											0													180.0	140.0	153.0					2																	171709249		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1210C>T	2.37:g.171709249C>T	ENSP00000350928:p.His404Tyr		Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.H404Y	ENST00000358196.3	37	c.1210	CCDS2239.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.375957	0.95923	.	.	ENSG00000128683	ENST00000358196	T	0.58797	0.31	5.91	5.91	0.95273	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.85427	0.5694	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89411	0.3703	10	0.87932	D	0	-18.8217	20.2983	0.98569	0.0:1.0:0.0:0.0	.	404	Q99259	DCE1_HUMAN	Y	404	ENSP00000350928:H404Y	ENSP00000350928:H404Y	H	+	1	0	GAD1	171417495	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.802000	0.96397	0.655000	0.94253	CAC	GAD1	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000128683		0.517	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAD1	HGNC	protein_coding	OTTHUMT00000102664.2	278	0.36	1	C			171709249	171709249	+1	no_errors	ENST00000358196	ensembl	human	known	69_37n	missense	128	14.67	22	SNP	1.000	T
GAS6	2621	genome.wustl.edu	37	13	114529991	114529991	+	Silent	SNP	G	G	A	rs569174728		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr13:114529991G>A	ENST00000327773.6	-	12	1601	c.1455C>T	c.(1453-1455)ttC>ttT	p.F485F	GAS6_ENST00000450766.1_Silent_p.F212F|GAS6_ENST00000357389.3_Silent_p.F528F|GAS6_ENST00000418959.3_Silent_p.F186F|GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000355761.4_Silent_p.F431F	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	528	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				TGTAGAAGGCGAAGCCGCTCC	0.572													g|||	1	0.000199681	0.0008	0.0	5008	,	,		14129	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													129.0	102.0	111.0					13																	114529991		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.1455C>T	13.37:g.114529991G>A			B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Silent	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd,pfam_GLA_domain,superfamily_ConA-like_lec_gl,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.F528	ENST00000327773.6	37	c.1584	CCDS45072.1	13																																																																																			GAS6	-	superfamily_ConA-like_lec_gl,pfscan_Laminin_G	ENSG00000183087		0.572	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAS6	HGNC	protein_coding	OTTHUMT00000045946.2	110	0.00	0	G	NM_000820		114529991	114529991	-1	no_errors	ENST00000357389	ensembl	human	known	69_37n	silent	44	26.67	16	SNP	0.998	A
GCC2	9648	genome.wustl.edu	37	2	109109048	109109048	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:109109048G>C	ENST00000309863.6	+	19	4963	c.4249G>C	c.(4249-4251)Gag>Cag	p.E1417Q		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1417					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						AATACAGTCAGAGAACATGAT	0.398																																						dbGAP											0													81.0	68.0	72.0					2																	109109048		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.4249G>C	2.37:g.109109048G>C	ENSP00000307939:p.Glu1417Gln		A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.E1417Q	ENST00000309863.6	37	c.4249	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400741	0.83120	.	.	ENSG00000135968	ENST00000309863	T	0.45276	0.9	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.57007	0.2024	L	0.36672	1.1	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.52697	-0.8541	10	0.40728	T	0.16	.	19.5669	0.95397	0.0:0.0:1.0:0.0	.	1417	Q8IWJ2	GCC2_HUMAN	Q	1417	ENSP00000307939:E1417Q	ENSP00000307939:E1417Q	E	+	1	0	GCC2	108475480	1.000000	0.71417	0.991000	0.47740	0.874000	0.50279	8.993000	0.93524	2.694000	0.91930	0.655000	0.94253	GAG	GCC2	-	NULL	ENSG00000135968		0.398	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	102	0.00	0	G	NM_014635		109109048	109109048	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	missense	53	20.90	14	SNP	1.000	C
GDAP1L1	78997	genome.wustl.edu	37	20	42893315	42893315	+	Intron	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr20:42893315G>A	ENST00000342560.5	+	5	848				GDAP1L1_ENST00000537864.1_Intron	NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1											endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			AGgtggttaagaggatgggct	0.532																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194			4213	protein-coding gene	gene with protein product							Standard	NM_024034		Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.760+116G>A	20.37:g.42893315G>A			B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold	p.E239K	ENST00000342560.5	37	c.715	CCDS13328.1	20	.	.	.	.	.	.	.	.	.	.	G	1.619	-0.521948	0.04171	.	.	ENSG00000124194	ENST00000445952	.	.	.	3.88	-2.47	0.06442	.	.	.	.	.	T	0.30727	0.0774	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33675	-0.9859	4	.	.	.	.	8.3452	0.32268	0.5815:0.0:0.4185:0.0	.	.	.	.	K	239	.	.	E	+	1	0	GDAP1L1	42326729	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.051000	0.11885	-0.540000	0.06265	-1.800000	0.00619	GAG	GDAP1L1	-	NULL	ENSG00000124194		0.532	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP1L1	HGNC	protein_coding	OTTHUMT00000079356.1	24	0.00	0	G	NM_024034		42893315	42893315	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000445952	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	0.000	A
GIMAP1	170575	genome.wustl.edu	37	7	150417814	150417814	+	Missense_Mutation	SNP	G	G	A	rs537240577	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:150417814G>A	ENST00000307194.5	+	3	862	c.722G>A	c.(721-723)cGg>cAg	p.R241Q		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	241					B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAGCGGCTCCGGCGGGTGGCG	0.706													G|||	3	0.000599042	0.0	0.0029	5008	,	,		14481	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													10.0	12.0	11.0					7																	150417814		2123	4150	6273	-	-	-	SO:0001583	missense	0			AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.722G>A	7.37:g.150417814G>A	ENSP00000302833:p.Arg241Gln		B2RCI3|Q8NAZ0	Missense_Mutation	SNP	pfam_AIG1	p.R241Q	ENST00000307194.5	37	c.722	CCDS5906.1	7	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461332	0.43736	.	.	ENSG00000213203	ENST00000307194	T	0.07021	3.23	4.51	-0.551	0.11822	.	1.927680	0.04097	U	0.312211	T	0.06416	0.0165	L	0.29908	0.895	0.09310	N	1	B	0.22909	0.077	B	0.08055	0.003	T	0.38156	-0.9674	10	0.34782	T	0.22	.	4.3474	0.11139	0.297:0.3023:0.4007:0.0	.	241	Q8WWP7	GIMA1_HUMAN	Q	241	ENSP00000302833:R241Q	ENSP00000302833:R241Q	R	+	2	0	GIMAP1	150048747	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.355000	0.02612	-0.187000	0.10516	-0.145000	0.13849	CGG	GIMAP1	-	NULL	ENSG00000213203		0.706	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP1	HGNC	protein_coding	OTTHUMT00000348951.2	25	0.00	0	G	NM_130759		150417814	150417814	+1	no_errors	ENST00000307194	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.000	A
GLIS3	169792	genome.wustl.edu	37	9	4286347	4286347	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:4286347G>A	ENST00000381971.3	-	2	672	c.79C>T	c.(79-81)Cac>Tac	p.H27Y		NM_001042413.1	NP_001035878.1	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	0					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		GCAGGAATGTGATGACCACTG	0.572																																						dbGAP											0													48.0	54.0	52.0					9																	4286347		2033	4182	6215	-	-	-	SO:0001583	missense	0			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000381971.3:c.79C>T	9.37:g.4286347G>A	ENSP00000371398:p.His27Tyr		B1AL19|Q1PHK5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H27Y	ENST00000381971.3	37	c.79	CCDS43784.1	9	.	.	.	.	.	.	.	.	.	.	G	17.02	3.280806	0.59758	.	.	ENSG00000107249	ENST00000381971;ENST00000477901;ENST00000481827	T	0.12569	2.67	5.75	5.75	0.90469	.	.	.	.	.	T	0.18257	0.0438	N	0.19112	0.55	0.26245	N	0.978817	D;P	0.56521	0.976;0.763	P;B	0.54140	0.743;0.167	T	0.08493	-1.0719	9	0.87932	D	0	.	14.1437	0.65336	0.0737:0.0:0.9262:0.0	.	27;27	F8WEV9;Q8NEA6-2	.;.	Y	27	ENSP00000371398:H27Y	ENSP00000371398:H27Y	H	-	1	0	GLIS3	4276347	0.997000	0.39634	0.919000	0.36401	0.500000	0.33767	2.641000	0.46587	2.711000	0.92665	0.655000	0.94253	CAC	GLIS3	-	NULL	ENSG00000107249		0.572	GLIS3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000354776.1	77	0.00	0	G	NM_152629		4286347	4286347	-1	no_errors	ENST00000381971	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.976	A
GLRA1	2741	genome.wustl.edu	37	5	151231107	151231107	+	Silent	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:151231107C>G	ENST00000455880.2	-	7	1042	c.756G>C	c.(754-756)ctG>ctC	p.L252L	GLRA1_ENST00000274576.4_Silent_p.L252L|GLRA1_ENST00000545569.1_Silent_p.L169L|GLRA1_ENST00000471351.2_5'UTR			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	252					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)	p.L252L(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ACATCTGAATCAGGTAGTAAC	0.512																																						dbGAP											1	Substitution - coding silent(1)	urinary_tract(1)											135.0	124.0	127.0					5																	151231107		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.756G>C	5.37:g.151231107C>G			B2R6T3|Q14C77|Q6DJV9	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A1,prints_Neur_channel,tigrfam_Neur_channel	p.L252	ENST00000455880.2	37	c.756	CCDS54942.1	5																																																																																			GLRA1	-	superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000145888		0.512	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA1	HGNC	protein_coding	OTTHUMT00000373959.1	139	0.00	0	C			151231107	151231107	-1	no_errors	ENST00000455880	ensembl	human	known	69_37n	silent	91	18.75	21	SNP	1.000	G
GNAO1	2775	genome.wustl.edu	37	16	56368657	56368657	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:56368657G>A	ENST00000262493.6	+	5	1327	c.481G>A	c.(481-483)Gat>Aat	p.D161N	GNAO1_ENST00000262494.7_Missense_Mutation_p.D161N	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O	161					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				GGACAGCCTGGATCGGATTGG	0.572																																						dbGAP											0													78.0	60.0	66.0					16																	56368657		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.481G>A	16.37:g.56368657G>A	ENSP00000262493:p.Asp161Asn		P29777|Q8TD72|Q9UMV4	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.D161N	ENST00000262493.6	37	c.481	CCDS10756.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.636279	0.96693	.	.	ENSG00000087258	ENST00000262493;ENST00000262494	D;D	0.89415	-2.51;-2.51	5.43	5.43	0.79202	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.93485	0.7921	M	0.86028	2.79	0.80722	D	1	P;P	0.47762	0.816;0.9	P;P	0.51895	0.614;0.683	D	0.94235	0.7480	10	0.72032	D	0.01	.	19.2399	0.93877	0.0:0.0:1.0:0.0	.	161;161	P09471;P09471-2	GNAO_HUMAN;.	N	161	ENSP00000262493:D161N;ENSP00000262494:D161N	ENSP00000262493:D161N	D	+	1	0	GNAO1	54926158	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.947000	0.87758	2.539000	0.85634	0.563000	0.77884	GAT	GNAO1	-	pfam_Gprotein_alpha_su,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000087258		0.572	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAO1	HGNC	protein_coding	OTTHUMT00000256981.2	69	0.00	0	G	NM_020988		56368657	56368657	+1	no_errors	ENST00000262493	ensembl	human	known	69_37n	missense	44	22.41	13	SNP	1.000	A
GOLGA6L17P	642402	genome.wustl.edu	37	15	85053188	85053188	+	RNA	SNP	C	C	G	rs201559925	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr15:85053188C>G	ENST00000414190.2	-	0	264					NR_003246.2																						CCCTGTTCTCCGCAGCCCGAA	0.488																																						dbGAP											0																																										-	-	-			0																															15.37:g.85053188C>G				RNA	SNP	-	NULL	ENST00000414190.2	37	NULL		15																																																																																			GOLGA6L5	-	-	ENSG00000230373		0.488	GOLGA6L5-003	KNOWN	mRNA_end_NF|basic	processed_transcript	GOLGA6L5	HGNC	pseudogene	OTTHUMT00000418579.1	28	0.00	0	C			85053188	85053188	-1	no_errors	ENST00000414190	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	0.002	G
GOLGB1	2804	genome.wustl.edu	37	3	121415752	121415752	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:121415752G>A	ENST00000340645.5	-	13	3728	c.3603C>T	c.(3601-3603)ctC>ctT	p.L1201L	GOLGB1_ENST00000393667.3_Silent_p.L1206L	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1201					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		GCTCCTCCCTGAGATGTCTTT	0.423																																						dbGAP											0													200.0	200.0	200.0					3																	121415752		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.3603C>T	3.37:g.121415752G>A			B2ZZ91|D3DN92|E7EP74|Q14398	Silent	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.L1201	ENST00000340645.5	37	c.3603	CCDS3004.1	3																																																																																			GOLGB1	-	superfamily_Prefoldin	ENSG00000173230		0.423	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	323	0.00	0	G	NM_004487		121415752	121415752	-1	no_errors	ENST00000340645	ensembl	human	known	69_37n	silent	132	14.84	23	SNP	0.907	A
GON4L	54856	genome.wustl.edu	37	1	155721824	155721824	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:155721824C>A	ENST00000368331.1	-	30	6448	c.6400G>T	c.(6400-6402)Gcc>Tcc	p.A2134S	GON4L_ENST00000271883.5_Missense_Mutation_p.A2133S|GON4L_ENST00000437809.1_Missense_Mutation_p.A2133S	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	2134					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GCTTCTGCGGCCTTTGGCTGC	0.552																																						dbGAP											0													99.0	92.0	94.0					1																	155721824		1986	4160	6146	-	-	-	SO:0001583	missense	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.6400G>T	1.37:g.155721824C>A	ENSP00000357315:p.Ala2134Ser		B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.A2134S	ENST00000368331.1	37	c.6400		1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595920	0.66332	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.11063	2.81;2.81;2.81	5.08	2.07	0.26955	Homeodomain-like (1);	0.423150	0.22902	N	0.054254	T	0.08403	0.0209	M	0.62723	1.935	0.21915	N	0.999474	D;D	0.59767	0.976;0.986	P;P	0.56278	0.629;0.795	T	0.12243	-1.0555	10	0.44086	T	0.13	.	4.8489	0.13528	0.1456:0.6051:0.0:0.2493	.	2134;2133	Q3T8J9;Q3T8J9-3	GON4L_HUMAN;.	S	2133;2134;2133	ENSP00000396117:A2133S;ENSP00000357315:A2134S;ENSP00000271883:A2133S	ENSP00000271883:A2133S	A	-	1	0	GON4L	153988448	0.034000	0.19679	0.854000	0.33618	0.952000	0.60782	0.648000	0.24828	0.279000	0.22186	-0.365000	0.07479	GCC	GON4L	-	superfamily_Homeodomain-like	ENSG00000116580		0.552	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		199	0.00	0	C	NM_032292		155721824	155721824	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	missense	75	25.74	26	SNP	0.703	A
GPR31	2853	genome.wustl.edu	37	6	167570935	167570935	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:167570935G>C	ENST00000366834.1	-	1	882	c.385C>G	c.(385-387)Cag>Gag	p.Q129E		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	129					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		AGGGCCGCCTGAGGAGACAGC	0.682																																						dbGAP											0													40.0	48.0	45.0					6																	167570935		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.385C>G	6.37:g.167570935G>C	ENSP00000355799:p.Gln129Glu		B0M0K2|Q4VBL3|Q9NQ20	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q129E	ENST00000366834.1	37	c.385	CCDS5299.1	6	.	.	.	.	.	.	.	.	.	.	G	2.094	-0.407628	0.04832	.	.	ENSG00000120436	ENST00000366834	T	0.37584	1.19	3.51	-0.108	0.13588	GPCR, rhodopsin-like superfamily (1);	0.537322	0.13710	U	0.368160	T	0.07683	0.0193	N	0.14661	0.345	0.09310	N	1	B	0.33345	0.409	B	0.36030	0.216	T	0.23440	-1.0188	10	0.66056	D	0.02	-9.7997	4.2634	0.10752	0.2041:0.0:0.2641:0.5317	.	129	O00270	GPR31_HUMAN	E	129	ENSP00000355799:Q129E	ENSP00000355799:Q129E	Q	-	1	0	GPR31	167490925	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.602000	0.24134	-0.308000	0.08792	-0.683000	0.03753	CAG	GPR31	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000120436		0.682	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR31	HGNC	protein_coding	OTTHUMT00000043111.1	32	0.00	0	G	NM_005299		167570935	167570935	-1	no_errors	ENST00000366834	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	0.000	C
GPR64	10149	genome.wustl.edu	37	X	19028892	19028892	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:19028892G>A	ENST00000379869.3	-	17	1267	c.1104C>T	c.(1102-1104)atC>atT	p.I368I	GPR64_ENST00000357991.3_Silent_p.I365I|GPR64_ENST00000360279.4_Silent_p.I346I|GPR64_ENST00000340581.3_Silent_p.I338I|GPR64_ENST00000379878.3_Silent_p.I352I|GPR64_ENST00000357544.3_Silent_p.I338I|GPR64_ENST00000379873.2_Silent_p.I368I|GPR64_ENST00000356606.4_Silent_p.I354I|GPR64_ENST00000379876.1_Silent_p.I344I|GPR64_ENST00000354791.3_Silent_p.I352I	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	368					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					TGGTGTTGACGATGTCTATAT	0.443													G|||	1	0.000264901	0.0008	0.0	3775	,	,		14867	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													128.0	97.0	107.0					X																	19028892		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1104C>T	X.37:g.19028892G>A			B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.I368	ENST00000379869.3	37	c.1104	CCDS43923.1	X																																																																																			GPR64	-	NULL	ENSG00000173698		0.443	GPR64-003	KNOWN	basic|CCDS	protein_coding	GPR64	HGNC	protein_coding	OTTHUMT00000055970.2	112	0.00	0	G			19028892	19028892	-1	no_errors	ENST00000379869	ensembl	human	known	69_37n	silent	54	12.90	8	SNP	0.013	A
GPR83	10888	genome.wustl.edu	37	11	94129617	94129617	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:94129617G>C	ENST00000243673.2	-	2	632	c.461C>G	c.(460-462)tCa>tGa	p.S154*	GPR83_ENST00000539203.2_Intron	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	154					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GACGTGCAGTGAGCAGTACTG	0.552																																						dbGAP											0													167.0	121.0	136.0					11																	94129617		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.461C>G	11.37:g.94129617G>C	ENSP00000243673:p.Ser154*		B0M0K5|Q6NWR4|Q9P1Y8	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.S154*	ENST00000243673.2	37	c.461	CCDS8297.1	11	.	.	.	.	.	.	.	.	.	.	G	39	7.495839	0.98319	.	.	ENSG00000123901	ENST00000243673	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.245	0.89982	0.0:0.0:1.0:0.0	.	.	.	.	X	154	.	ENSP00000243673:S154X	S	-	2	0	GPR83	93769265	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.666000	0.98612	2.554000	0.86153	0.555000	0.69702	TCA	GPR83	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	ENSG00000123901		0.552	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	HGNC	protein_coding	OTTHUMT00000396232.1	98	0.00	0	G	NM_016540		94129617	94129617	-1	no_errors	ENST00000243673	ensembl	human	known	69_37n	nonsense	64	26.44	23	SNP	1.000	C
GUSBP1	728411	genome.wustl.edu	37	5	21497271	21497271	+	RNA	SNP	T	T	A	rs4701278	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:21497271T>A	ENST00000607545.1	+	0	179					NR_027026.1		Q15486	GUSP1_HUMAN	glucuronidase, beta pseudogene 1						carbohydrate metabolic process (GO:0005975)|nervous system development (GO:0007399)|skeletal system development (GO:0001501)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										ATTCAGAGCGTGTATGGAGTG	0.507													.|||	2890	0.577077	0.5507	0.5692	5008	,	,		39257	0.629		0.5507	False		,,,				2504	0.592					dbGAP											0																																										-	-	-			0			BC064850, X75940		5p14.3	2012-10-04			ENSG00000183666	ENSG00000183666			13670	pseudogene	pseudogene						8565635	Standard	NR_027026		Approved		uc010iub.3	Q15486	OTTHUMG00000162474		5.37:g.21497271T>A			A6NLY8|A8K1B7|Q969T8|Q9BUH2	RNA	SNP	-	NULL	ENST00000607545.1	37	NULL		5																																																																																			RP11-823P9.1	-	-	ENSG00000183666		0.507	GUSBP1-006	KNOWN	basic	processed_transcript	GUSBP1	Clone_based_vega_gene	pseudogene	OTTHUMT00000470546.1	12	0.00	0	T	NG_008324		21497271	21497271	+1	no_errors	ENST00000508260	ensembl	human	known	69_37n	rna	0	100.00	4	SNP	1.000	A
HAP1	9001	genome.wustl.edu	37	17	39887784	39887784	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr17:39887784C>T	ENST00000310778.5	-	6	1039	c.1030G>A	c.(1030-1032)Gag>Aag	p.E344K	HAP1_ENST00000341193.5_Missense_Mutation_p.E352K|HAP1_ENST00000347901.4_Missense_Mutation_p.E344K|HAP1_ENST00000393939.2_Missense_Mutation_p.E344K|JUP_ENST00000540235.1_Intron|RN7SL399P_ENST00000471648.2_RNA			P54257	HAP1_HUMAN	huntingtin-associated protein 1	344	Glu-rich.|HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			ATCTGTTCCTCATCCTCAAGA	0.547																																						dbGAP											0													156.0	126.0	136.0					17																	39887784		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1030G>A	17.37:g.39887784C>T	ENSP00000309392:p.Glu344Lys		A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	pfam_HAP1_N	p.E344K	ENST00000310778.5	37	c.1030		17	.	.	.	.	.	.	.	.	.	.	C	10.92	1.485772	0.26686	.	.	ENSG00000173805	ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	4.14	1.95	0.26073	.	0.216194	0.23409	N	0.048482	T	0.05547	0.0146	N	0.04820	-0.15	0.26327	N	0.977578	P;P;B;B	0.35155	0.487;0.487;0.172;0.316	B;B;B;B	0.40602	0.122;0.203;0.048;0.334	T	0.35798	-0.9774	10	0.06494	T	0.89	-15.7621	5.271	0.15624	0.0:0.6539:0.2268:0.1194	.	344;352;344;344	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	K	344;344;344;352	ENSP00000377513:E344K;ENSP00000309392:E344K;ENSP00000334002:E344K;ENSP00000343170:E352K	ENSP00000309392:E344K	E	-	1	0	HAP1	37141310	0.973000	0.33851	0.957000	0.39632	0.977000	0.68977	1.388000	0.34442	0.922000	0.37019	0.655000	0.94253	GAG	HAP1	-	pfam_HAP1_N	ENSG00000173805		0.547	HAP1-006	KNOWN	basic|appris_principal	protein_coding	HAP1	HGNC	protein_coding	OTTHUMT00000389619.1	184	0.00	0	C	NM_003949		39887784	39887784	-1	no_errors	ENST00000310778	ensembl	human	known	69_37n	missense	93	24.80	31	SNP	0.656	T
HDAC6	10013	genome.wustl.edu	37	X	48681327	48681327	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:48681327G>C	ENST00000334136.5	+	25	2696	c.2518G>C	c.(2518-2520)Gaa>Caa	p.E840Q	HDAC6_ENST00000376619.2_Missense_Mutation_p.E840Q|HDAC6_ENST00000444343.2_Missense_Mutation_p.E854Q			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	840					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	TCCAGAGGTAGAAGACAGAGA	0.567																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0													49.0	42.0	44.0					X																	48681327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.2518G>C	X.37:g.48681327G>C	ENSP00000334061:p.Glu840Gln		O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.E854Q	ENST00000334136.5	37	c.2560	CCDS14306.1	X	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262599	0.23051	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619	T;T;T	0.60548	0.18;0.18;0.18	5.05	4.13	0.48395	.	0.886063	0.09671	N	0.771135	T	0.52273	0.1724	L	0.51422	1.61	0.33786	D	0.624874	P;P;D;P	0.53462	0.454;0.859;0.96;0.651	B;P;B;B	0.46825	0.057;0.528;0.421;0.113	T	0.53995	-0.8359	10	0.17832	T	0.49	-2.5904	5.2843	0.15692	0.111:0.0:0.6941:0.1949	.	830;203;488;840	B4DZN1;B3KY98;B3KVK5;Q9UBN7	.;.;.;HDAC6_HUMAN	Q	854;840;840	ENSP00000398566:E854Q;ENSP00000334061:E840Q;ENSP00000365804:E840Q	ENSP00000334061:E840Q	E	+	1	0	HDAC6	48566271	0.970000	0.33590	0.135000	0.22099	0.934000	0.57294	1.752000	0.38349	1.140000	0.42260	0.600000	0.82982	GAA	HDAC6	-	NULL	ENSG00000094631		0.567	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	86	0.00	0	G	NM_006044		48681327	48681327	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	missense	62	20.51	16	SNP	0.429	C
HECW2	57520	genome.wustl.edu	37	2	197105211	197105211	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:197105211C>G	ENST00000260983.3	-	21	3908	c.3726G>C	c.(3724-3726)caG>caC	p.Q1242H	HECW2_ENST00000409111.1_Missense_Mutation_p.Q886H	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1242	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GCTTATTTCTCTGCAGGTCTT	0.433																																						dbGAP											0													117.0	118.0	118.0					2																	197105211		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3726G>C	2.37:g.197105211C>G	ENSP00000260983:p.Gln1242His		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.Q1242H	ENST00000260983.3	37	c.3726	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930571	0.73327	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.42131	0.98;0.98	4.6	3.72	0.42706	HECT (3);	0.000000	0.85682	D	0.000000	T	0.63153	0.2487	M	0.82323	2.585	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	T	0.64879	-0.6303	10	0.45353	T	0.12	.	10.1424	0.42742	0.0:0.8382:0.0:0.1618	.	1242	Q9P2P5	HECW2_HUMAN	H	886;1242	ENSP00000386775:Q886H;ENSP00000260983:Q1242H	ENSP00000260983:Q1242H	Q	-	3	2	HECW2	196813456	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.936000	0.56568	1.285000	0.44548	0.655000	0.94253	CAG	HECW2	-	smart_HECT,pfscan_HECT	ENSG00000138411		0.433	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3	251	0.00	0	C	NM_020760		197105211	197105211	-1	no_errors	ENST00000260983	ensembl	human	known	69_37n	missense	84	16.00	16	SNP	1.000	G
HEPACAM	220296	genome.wustl.edu	37	11	124805830	124805830	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:124805830G>A	ENST00000298251.4	-	1	478	c.73C>T	c.(73-75)Ctg>Ttg	p.L25L		NM_152722.4	NP_689935.2			hepatic and glial cell adhesion molecule											breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.54e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		GTCTGGATCAGAAGAAGGTAG	0.577																																						dbGAP											0													57.0	60.0	59.0					11																	124805830		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AK098396	CCDS8456.1	11q24.2	2013-01-29	2011-02-11		ENSG00000165478	ENSG00000165478		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26361	protein-coding gene	gene with protein product	"""glial cell adhesion molecule"""	611642	"""hepatocyte cell adhesion molecule"""			15885354, 15917256	Standard	NM_152722		Approved	FLJ25530, hepaCAM, GLIALCAM	uc001qbk.3	Q14CZ8	OTTHUMG00000165938	ENST00000298251.4:c.73C>T	11.37:g.124805830G>A				Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L25	ENST00000298251.4	37	c.73	CCDS8456.1	11																																																																																			HEPACAM	-	NULL	ENSG00000165478		0.577	HEPACAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM	HGNC	protein_coding	OTTHUMT00000387125.1	105	0.00	0	G	NM_152722		124805830	124805830	-1	no_errors	ENST00000298251	ensembl	human	known	69_37n	silent	87	20.91	23	SNP	1.000	A
HIST1H3F	8968	genome.wustl.edu	37	6	26250619	26250619	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:26250619A>G	ENST00000446824.2	-	1	216	c.215T>C	c.(214-216)gTa>gCa	p.V72A	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	72					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			lung(6)|urinary_tract(1)	7						GATCTCACGTACCAGACGCTG	0.602											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													122.0	121.0	122.0					6																	26250619		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.215T>C	6.37:g.26250619A>G	ENSP00000444823:p.Val72Ala	785	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.V72A	ENST00000446824.2	37	c.215	CCDS4600.1	6	.	.	.	.	.	.	.	.	.	.	.	17.07	3.294268	0.60086	.	.	ENSG00000256316	ENST00000446824	T	0.54866	0.55	4.82	4.82	0.62117	.	.	.	.	.	T	0.59183	0.2175	.	.	.	0.42066	D	0.991187	.	.	.	.	.	.	T	0.65792	-0.6082	6	0.87932	D	0	.	14.2481	0.66001	1.0:0.0:0.0:0.0	.	.	.	.	A	72	ENSP00000444823:V72A	ENSP00000444823:V72A	V	-	2	0	HIST1H3F	26358598	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	5.017000	0.64047	2.103000	0.63969	0.459000	0.35465	GTA	HIST1H3F	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000256316		0.602	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3F	HGNC	protein_coding	OTTHUMT00000040098.1	183	0.00	0	A	NM_021018		26250619	26250619	-1	no_errors	ENST00000446824	ensembl	human	known	69_37n	missense	82	24.55	27	SNP	1.000	G
HIST1H2BI	8346	genome.wustl.edu	37	6	26273272	26273272	+	Silent	SNP	G	G	A	rs576204357	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:26273272G>A	ENST00000377733.2	+	1	129	c.69G>A	c.(67-69)caG>caA	p.Q23Q	HIST1H3G_ENST00000305910.3_5'Flank	NM_003525.2	NP_003516.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bi	23					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q23H(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(1)|lung(8)|urinary_tract(1)	16						CCAAGGCACAGAAGAAGGATG	0.582																																						dbGAP											1	Substitution - Missense(1)	lung(1)											176.0	167.0	170.0					6																	26273272		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z80782	CCDS4603.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000168242	ENSG00000278588		"""Histones / Replication-dependent"""	4756	protein-coding gene	gene with protein product		602807	"""H2B histone family, member K"", ""histone 1, H2bi"""	H2BFK		9119399, 12408966	Standard	NM_003525		Approved	H2B/k	uc003nhk.3	P62807	OTTHUMG00000014448	ENST00000377733.2:c.69G>A	6.37:g.26273272G>A			P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.Q23	ENST00000377733.2	37	c.69	CCDS4603.1	6																																																																																			HIST1H2BI	-	superfamily_Histone-fold	ENSG00000168242		0.582	HIST1H2BI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BI	HGNC	protein_coding	OTTHUMT00000040111.1	264	0.00	0	G	NM_003525		26273272	26273272	+1	no_errors	ENST00000377733	ensembl	human	known	69_37n	silent	134	11.76	18	SNP	1.000	A
HMGCLL1	54511	genome.wustl.edu	37	6	55381378	55381378	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:55381378C>T	ENST00000398661.2	-	5	542	c.411G>A	c.(409-411)atG>atA	p.M137I	HMGCLL1_ENST00000308161.4_Intron|HMGCLL1_ENST00000274901.4_Missense_Mutation_p.M107I|HMGCLL1_ENST00000508459.1_Intron|HMGCLL1_ENST00000428842.1_Intron|HMGCLL1_ENST00000370850.2_Intron	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	137					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			GAATGCCTTTCATTACTTCAG	0.348																																					Ovarian(35;840 893 7837 15538 42887)	dbGAP											0													136.0	137.0	136.0					6																	55381378		1863	4108	5971	-	-	-	SO:0001583	missense	0			AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.411G>A	6.37:g.55381378C>T	ENSP00000381654:p.Met137Ile		B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	pfam_PYR_CT,pfscan_PYR_CT	p.M137I	ENST00000398661.2	37	c.411	CCDS43475.1	6	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548257	0.45383	.	.	ENSG00000146151	ENST00000274901;ENST00000398661	D;D	0.97924	-4.61;-4.61	5.51	5.51	0.81932	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.107611	0.64402	D	0.000005	D	0.93552	0.7942	L	0.38531	1.155	0.80722	D	1	B;B	0.12630	0.002;0.006	B;B	0.19666	0.003;0.026	D	0.91111	0.4922	10	0.56958	D	0.05	-28.8264	14.2633	0.66099	0.1489:0.8511:0.0:0.0	.	107;137	Q8TB92-2;Q8TB92	.;HMGC2_HUMAN	I	107;137	ENSP00000274901:M107I;ENSP00000381654:M137I	ENSP00000274901:M107I	M	-	3	0	HMGCLL1	55489337	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.176000	0.50863	2.592000	0.87571	0.591000	0.81541	ATG	HMGCLL1	-	pfam_PYR_CT,pfscan_PYR_CT	ENSG00000146151		0.348	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	HMGCLL1	HGNC	protein_coding	OTTHUMT00000360290.1	219	0.00	0	C	XM_166383		55381378	55381378	-1	no_errors	ENST00000398661	ensembl	human	known	69_37n	missense	129	17.83	28	SNP	1.000	T
HSD17B7	51478	genome.wustl.edu	37	1	162769553	162769553	+	Silent	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:162769553C>G	ENST00000254521.3	+	5	523	c.468C>G	c.(466-468)ctC>ctG	p.L156L	HSD17B7_ENST00000367917.3_Silent_p.L156L|HSD17B7_ENST00000485405.1_3'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	156					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					TGGAGCCTCTCCTCTGTCACA	0.413																																						dbGAP											0													42.0	43.0	43.0					1																	162769553		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.468C>G	1.37:g.162769553C>G			Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	p.L156	ENST00000254521.3	37	c.468	CCDS1242.1	1																																																																																			HSD17B7	-	NULL	ENSG00000132196		0.413	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B7	HGNC	protein_coding	OTTHUMT00000083207.1	106	0.00	0	C	NM_016371		162769553	162769553	+1	no_errors	ENST00000254521	ensembl	human	known	69_37n	silent	74	17.78	16	SNP	0.551	G
HYDIN	54768	genome.wustl.edu	37	16	70884449	70884449	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:70884449C>T	ENST00000393567.2	-	74	12703	c.12553G>A	c.(12553-12555)Gag>Aag	p.E4185K	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4185					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.E4136K(2)|p.E4184K(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GTGTAGCCCTCGGCCTTGACA	0.433																																						dbGAP											4	Substitution - Missense(4)	breast(4)											26.0	24.0	24.0					16																	70884449		1804	4055	5859	-	-	-	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12553G>A	16.37:g.70884449C>T	ENSP00000377197:p.Glu4185Lys		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.E4184K	ENST00000393567.2	37	c.12550	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	17.40	3.380412	0.61845	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01113	5.32	5.56	3.6	0.41247	.	0.647023	0.11835	U	0.524801	T	0.04318	0.0119	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.55673	-0.8104	10	0.26408	T	0.33	.	6.5989	0.22689	0.0:0.6794:0.1694:0.1512	.	4184	F8WD23	.	K	4185;4184	ENSP00000377197:E4185K	ENSP00000313052:E4184K	E	-	1	0	HYDIN	69441950	0.848000	0.29623	0.958000	0.39756	0.559000	0.35586	1.344000	0.33941	1.338000	0.45544	0.511000	0.50034	GAG	HYDIN	-	NULL	ENSG00000157423		0.433	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	176	0.00	0	C			70884449	70884449	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.831	T
HYLS1	219844	genome.wustl.edu	37	11	125769890	125769890	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:125769890G>C	ENST00000425380.2	+	3	1408	c.627G>C	c.(625-627)aaG>aaC	p.K209N	HYLS1_ENST00000526028.1_Missense_Mutation_p.K209N|HYLS1_ENST00000356438.3_Missense_Mutation_p.K209N|PUS3_ENST00000227474.3_Intron	NM_001134793.1	NP_001128265.1	Q96M11	HYLS1_HUMAN	hydrolethalus syndrome 1	209						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|skin(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		ACCGGGGCAAGACAGACCGGG	0.512																																					Esophageal Squamous(172;2590 2636 8884 10471)	dbGAP											0													68.0	67.0	67.0					11																	125769890		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK057477	CCDS8467.1	11q24	2014-06-18				ENSG00000198331			26558	protein-coding gene	gene with protein product		610693				15843405	Standard	NM_145014		Approved	FLJ32915	uc009zbv.3	Q96M11		ENST00000425380.2:c.627G>C	11.37:g.125769890G>C	ENSP00000414884:p.Lys209Asn		B3KXI8|Q96BX9	Missense_Mutation	SNP	NULL	p.K209N	ENST00000425380.2	37	c.627	CCDS8467.1	11	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781521	0.49891	.	.	ENSG00000198331	ENST00000356438;ENST00000425380;ENST00000526028	D;D;D	0.83992	-1.79;-1.79;-1.79	5.49	2.56	0.30785	.	0.000000	0.64402	D	0.000002	D	0.86331	0.5907	L	0.56769	1.78	0.40943	D	0.984485	D	0.89917	1.0	D	0.76575	0.988	D	0.84254	0.0479	10	0.87932	D	0	.	5.5193	0.16923	0.3119:0.1345:0.5536:0.0	.	209	Q96M11	HYLS1_HUMAN	N	209	ENSP00000348815:K209N;ENSP00000414884:K209N;ENSP00000436833:K209N	ENSP00000348815:K209N	K	+	3	2	HYLS1	125275100	0.941000	0.31946	0.867000	0.34043	0.896000	0.52359	1.492000	0.35594	0.405000	0.25532	0.655000	0.94253	AAG	HYLS1	-	NULL	ENSG00000198331		0.512	HYLS1-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYLS1	HGNC	protein_coding	OTTHUMT00000386733.1	124	0.00	0	G	NM_145014		125769890	125769890	+1	no_errors	ENST00000356438	ensembl	human	known	69_37n	missense	73	18.89	17	SNP	0.125	C
ITIH6	347365	genome.wustl.edu	37	X	54785121	54785121	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:54785121C>T	ENST00000218436.6	-	8	1415	c.1386G>A	c.(1384-1386)ctG>ctA	p.L462L		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	462	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										AGAGGCCCTTCAGCTGTAGGG	0.592																																						dbGAP											0													46.0	41.0	43.0					X																	54785121		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1386G>A	X.37:g.54785121C>T			A6NN03	Silent	SNP	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.L462	ENST00000218436.6	37	c.1386	CCDS14361.1	X																																																																																			ITIH6	-	smart_VWF_A,pfscan_VWF_A	ENSG00000102313		0.592	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH6	HGNC	protein_coding	OTTHUMT00000056814.2	78	0.00	0	C	NM_198510		54785121	54785121	-1	no_errors	ENST00000218436	ensembl	human	known	69_37n	silent	52	23.53	16	SNP	1.000	T
KANK3	256949	genome.wustl.edu	37	19	8399284	8399284	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:8399284C>T	ENST00000593649.1	-	4	1412	c.1347G>A	c.(1345-1347)atG>atA	p.M449I	KANK3_ENST00000330915.3_Missense_Mutation_p.M449I			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	449										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CTCTCTTCTTCATGATGGATT	0.627																																						dbGAP											0													55.0	54.0	54.0					19																	8399284		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1347G>A	19.37:g.8399284C>T	ENSP00000470728:p.Met449Ile		Q6NZI1|Q6ZQR3|Q8IUV2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.M449I	ENST00000593649.1	37	c.1347		19	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448290	0.63178	.	.	ENSG00000186994	ENST00000330915	T	0.37584	1.19	4.62	4.62	0.57501	.	.	.	.	.	T	0.49270	0.1547	M	0.78916	2.43	0.47862	D	0.999531	P	0.52316	0.952	P	0.48815	0.591	T	0.58487	-0.7628	9	0.72032	D	0.01	-22.9941	14.9874	0.71359	0.0:1.0:0.0:0.0	.	449	Q6NY19-2	.	I	449	ENSP00000328923:M449I	ENSP00000328923:M449I	M	-	3	0	KANK3	8305284	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.364000	0.79526	2.379000	0.81126	0.313000	0.20887	ATG	KANK3	-	NULL	ENSG00000186994		0.627	KANK3-002	KNOWN	basic	protein_coding	KANK3	HGNC	protein_coding	OTTHUMT00000461379.1	105	0.00	0	C	NM_198471		8399284	8399284	-1	no_errors	ENST00000330915	ensembl	human	known	69_37n	missense	50	16.67	10	SNP	1.000	T
KANK2	25959	genome.wustl.edu	37	19	11283661	11283661	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:11283661C>G	ENST00000586659.1	-	10	2521	c.2207G>C	c.(2206-2208)aGc>aCc	p.S736T	KANK2_ENST00000589359.1_Missense_Mutation_p.S744T|KANK2_ENST00000589894.1_Missense_Mutation_p.S736T|KANK2_ENST00000432929.2_Missense_Mutation_p.S744T|KANK2_ENST00000587317.1_5'Flank|KANK2_ENST00000355150.5_Missense_Mutation_p.S736T			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	736	Interaction with NCOA1.				apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CCATACCTGGCTGGCTTTGGC	0.577																																						dbGAP											0													91.0	90.0	91.0					19																	11283661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.2207G>C	19.37:g.11283661C>G	ENSP00000465650:p.Ser736Thr		B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S744T	ENST00000586659.1	37	c.2231	CCDS12255.1	19	.	.	.	.	.	.	.	.	.	.	C	31	5.073046	0.93950	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.52983	0.64;0.64	5.76	5.76	0.90799	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.52354	0.1729	N	0.11756	0.17	0.54753	D	0.999988	D;P	0.89917	1.0;0.649	D;P	0.87578	0.998;0.465	T	0.52548	-0.8561	10	0.29301	T	0.29	-30.5546	18.713	0.91664	0.0:1.0:0.0:0.0	.	736;744	Q63ZY3;Q63ZY3-2	KANK2_HUMAN;.	T	744;736	ENSP00000395650:S744T;ENSP00000347276:S736T	ENSP00000347276:S736T	S	-	2	0	KANK2	11144661	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.195000	0.51013	2.716000	0.92895	0.655000	0.94253	AGC	KANK2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000197256		0.577	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	91	0.00	0	C	NM_015493		11283661	11283661	-1	no_errors	ENST00000432929	ensembl	human	known	69_37n	missense	55	22.54	16	SNP	1.000	G
KCNH7	90134	genome.wustl.edu	37	2	163241275	163241275	+	Missense_Mutation	SNP	G	G	A	rs183477423		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:163241275G>A	ENST00000332142.5	-	13	2984	c.2885C>T	c.(2884-2886)gCa>gTa	p.A962V		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	962					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.A962E(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GAGCCCAGATGCTTTCCCTAT	0.428																																					GBM(196;1492 2208 17507 24132 45496)	dbGAP											1	Substitution - Missense(1)	lung(1)											203.0	196.0	198.0					2																	163241275		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2885C>T	2.37:g.163241275G>A	ENSP00000331727:p.Ala962Val		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.A962V	ENST00000332142.5	37	c.2885	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	G	9.350	1.065371	0.20067	.	.	ENSG00000184611	ENST00000332142	D	0.98474	-4.95	5.6	3.69	0.42338	.	0.538532	0.21359	N	0.075833	D	0.93465	0.7915	N	0.08118	0	0.46044	D	0.998839	B	0.02656	0.0	B	0.04013	0.001	D	0.90057	0.4153	10	0.29301	T	0.29	.	13.2281	0.59927	0.0685:0.1226:0.8088:0.0	.	962	Q9NS40	KCNH7_HUMAN	V	962	ENSP00000331727:A962V	ENSP00000331727:A962V	A	-	2	0	KCNH7	162949521	1.000000	0.71417	0.993000	0.49108	0.904000	0.53231	2.520000	0.45554	1.382000	0.46385	0.655000	0.94253	GCA	KCNH7	-	NULL	ENSG00000184611		0.428	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	HGNC	protein_coding	OTTHUMT00000255093.1	329	0.00	0	G	NM_033272		163241275	163241275	-1	no_errors	ENST00000332142	ensembl	human	known	69_37n	missense	113	13.64	18	SNP	0.711	A
KDM6B	23135	genome.wustl.edu	37	17	7754985	7754985	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr17:7754985G>A	ENST00000448097.2	+	17	4367	c.4036G>A	c.(4036-4038)Gag>Aag	p.E1346K	KDM6B_ENST00000254846.5_Missense_Mutation_p.E1346K			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1346	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CCAGCTGCAGGAGCTGCTGAA	0.652											OREG0024145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													18.0	18.0	18.0					17																	7754985		2192	4290	6482	-	-	-	SO:0001583	missense	0			AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.4036G>A	17.37:g.7754985G>A	ENSP00000412513:p.Glu1346Lys	644	C9IZ40|Q96G33	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.E1346K	ENST00000448097.2	37	c.4036		17	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546487	0.86022	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	D;D	0.84873	-1.91;-1.91	5.12	5.12	0.69794	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	D	0.93592	0.7954	M	0.88775	2.98	0.80722	D	1	P;D	0.89917	0.566;1.0	P;D	0.85130	0.581;0.997	D	0.94300	0.7536	10	0.87932	D	0	-16.5929	17.8586	0.88773	0.0:0.0:1.0:0.0	.	1346;1346	O15054;O15054-1	KDM6B_HUMAN;.	K	1346	ENSP00000254846:E1346K;ENSP00000412513:E1346K	ENSP00000254846:E1346K	E	+	1	0	KDM6B	7695710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.263000	0.95617	2.834000	0.97654	0.650000	0.86243	GAG	KDM6B	-	smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000132510		0.652	KDM6B-002	KNOWN	basic	protein_coding	KDM6B	HGNC	protein_coding	OTTHUMT00000440248.1	16	0.00	0	G	XM_043272		7754985	7754985	+1	no_errors	ENST00000254846	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	A
KIAA2022	340533	genome.wustl.edu	37	X	73962610	73962610	+	Missense_Mutation	SNP	C	C	G	rs528390672		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:73962610C>G	ENST00000055682.6	-	3	2393	c.1782G>C	c.(1780-1782)caG>caC	p.Q594H		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	594					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TGGTGTTTCTCTGCTTCTTCT	0.463																																						dbGAP											0													130.0	104.0	113.0					X																	73962610		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1782G>C	X.37:g.73962610C>G	ENSP00000055682:p.Gln594His		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.Q594H	ENST00000055682.6	37	c.1782	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	C	6.627	0.484056	0.12581	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.32753	1.44;1.44	5.1	3.18	0.36537	.	0.570696	0.20355	N	0.093962	T	0.17746	0.0426	N	0.22421	0.69	0.27709	N	0.945526	P	0.48503	0.911	B	0.41036	0.346	T	0.10451	-1.0629	10	0.62326	D	0.03	-6.8625	4.1121	0.10063	0.0:0.5978:0.1908:0.2114	.	594	Q5QGS0	K2022_HUMAN	H	594	ENSP00000362567:Q594H;ENSP00000055682:Q594H	ENSP00000055682:Q594H	Q	-	3	2	KIAA2022	73879335	0.997000	0.39634	1.000000	0.80357	0.863000	0.49368	0.119000	0.15626	1.226000	0.43582	-0.192000	0.12808	CAG	KIAA2022	-	NULL	ENSG00000050030		0.463	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	435	0.00	0	C	NM_001008537		73962610	73962610	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	missense	152	16.48	30	SNP	1.000	G
KIF13A	63971	genome.wustl.edu	37	6	17799620	17799620	+	Silent	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:17799620G>C	ENST00000259711.6	-	22	2772	c.2667C>G	c.(2665-2667)gtC>gtG	p.V889V	KIF13A_ENST00000378843.2_Silent_p.V889V|KIF13A_ENST00000378816.5_Silent_p.V889V|KIF13A_ENST00000378814.5_Silent_p.V889V|KIF13A_ENST00000378826.2_Silent_p.V889V	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	889					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			ATTGACAGAAGACAAAATTTG	0.458																																						dbGAP											0													60.0	58.0	59.0					6																	17799620		1862	4101	5963	-	-	-	SO:0001819	synonymous_variant	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.2667C>G	6.37:g.17799620G>C			A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin-like,pfam_KIF1B	p.S283C	ENST00000259711.6	37	c.848	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	G	5.691	0.311993	0.10789	.	.	ENSG00000137177	ENST00000358380	.	.	.	5.62	4.74	0.60224	.	.	.	.	.	T	0.50103	0.1596	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49062	-0.8978	4	.	.	.	.	9.7528	0.40485	0.0718:0.2512:0.677:0.0	.	.	.	.	C	283	.	.	S	-	2	0	KIF13A	17907599	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	3.050000	0.49877	2.653000	0.90120	0.467000	0.42956	TCT	KIF13A	-	NULL	ENSG00000137177		0.458	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	142	0.00	0	G			17799620	17799620	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000358380	ensembl	human	putative	69_37n	missense	86	17.31	18	SNP	1.000	C
KIF5C	3800	genome.wustl.edu	37	2	149835493	149835493	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:149835493G>C	ENST00000435030.1	+	13	1719	c.1351G>C	c.(1351-1353)Gat>Cat	p.D451H	KIF5C_ENST00000397413.1_Missense_Mutation_p.D219H|KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.D356H			O60282	KIF5C_HUMAN	kinesin family member 5C	451					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		ACAGATGTTGGATCAGGATGA	0.348																																						dbGAP											0													78.0	78.0	78.0					2																	149835493		1855	4108	5963	-	-	-	SO:0001583	missense	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.1351G>C	2.37:g.149835493G>C	ENSP00000393379:p.Asp451His		O95079|Q2YDC5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D451H	ENST00000435030.1	37	c.1351		2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.733517	0.89482	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	T;T;T	0.80909	-1.43;-1.43;-1.43	5.65	5.65	0.86999	.	0.049899	0.85682	D	0.000000	D	0.90539	0.7035	.	.	.	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.80764	0.928;0.994	D	0.90488	0.4465	9	0.66056	D	0.02	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	451;17	O60282;Q3LIE3	KIF5C_HUMAN;.	H	451;356;354;219	ENSP00000393379:D451H;ENSP00000410115:D356H;ENSP00000380560:D219H	ENSP00000334176:D354H	D	+	1	0	KIF5C	149543739	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.625000	0.98406	2.941000	0.99782	0.655000	0.94253	GAT	KIF5C	-	NULL	ENSG00000168280		0.348	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	140	0.00	0	G	NM_004522		149835493	149835493	+1	no_errors	ENST00000435030	ensembl	human	known	69_37n	missense	66	17.28	14	SNP	1.000	C
KIFC1	3833	genome.wustl.edu	37	6	33365888	33365888	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:33365888G>T	ENST00000428849.2	+	2	545	c.95G>T	c.(94-96)gGa>gTa	p.G32V		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	32					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						CCTCTCTCAGGAAGCAGACTC	0.557																																						dbGAP											0													55.0	57.0	57.0					6																	33365888		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.95G>T	6.37:g.33365888G>T	ENSP00000393963:p.Gly32Val		O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G32V	ENST00000428849.2	37	c.95	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675678	0.47781	.	.	ENSG00000237649	ENST00000428849;ENST00000450504	T	0.75050	-0.9	4.78	2.92	0.33932	.	1.047520	0.07439	N	0.897007	T	0.40015	0.1100	L	0.27053	0.805	0.20074	N	0.999933	P;P	0.46277	0.79;0.875	B;B	0.38458	0.274;0.274	T	0.24404	-1.0161	10	0.44086	T	0.13	-2.0207	6.1418	0.20263	0.1024:0.1904:0.7072:0.0	.	32;32	B4E063;Q9BW19	.;KIFC1_HUMAN	V	32	ENSP00000393963:G32V	ENSP00000393963:G32V	G	+	2	0	KIFC1	33473866	0.904000	0.30761	0.263000	0.24496	0.902000	0.53008	1.654000	0.37334	0.577000	0.29470	0.455000	0.32223	GGA	KIFC1	-	NULL	ENSG00000237649		0.557	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	174	0.00	0	G	NM_002263		33365888	33365888	+1	no_errors	ENST00000428849	ensembl	human	known	69_37n	missense	142	16.47	28	SNP	0.027	T
KLC2	64837	genome.wustl.edu	37	11	66026285	66026285	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:66026285G>A	ENST00000417856.1	+	2	463	c.220G>A	c.(220-222)Gag>Aag	p.E74K	KLC2_ENST00000316924.5_Missense_Mutation_p.E74K|KLC2_ENST00000394066.2_Missense_Mutation_p.E74K|RP11-755F10.3_ENST00000533576.1_RNA|KLC2_ENST00000421552.1_Missense_Mutation_p.E74K|KLC2_ENST00000394067.2_Missense_Mutation_p.E74K|KLC2_ENST00000394065.2_5'Flank|KLC2_ENST00000394078.1_Missense_Mutation_p.E74K	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	74					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						TGGGCTGGGGGAGGCCCAGGT	0.627											OREG0021097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													22.0	25.0	24.0					11																	66026285		2200	4295	6495	-	-	-	SO:0001583	missense	0			AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.220G>A	11.37:g.66026285G>A	ENSP00000399403:p.Glu74Lys	1088	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.E74K	ENST00000417856.1	37	c.220	CCDS8130.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.718004	0.96839	.	.	ENSG00000174996	ENST00000531240;ENST00000417856;ENST00000526758;ENST00000440228;ENST00000394067;ENST00000316924;ENST00000421552;ENST00000394078;ENST00000461611;ENST00000475757;ENST00000394066	T;T;T;T;T;T;T;T;T;T;T	0.54279	0.8;0.8;0.8;0.8;0.8;0.8;0.58;0.8;0.58;0.8;0.58	3.94	3.94	0.45596	Rabaptin, GTPase-Rab5 binding (1);	0.000000	0.64402	D	0.000002	T	0.75087	0.3802	M	0.87381	2.88	0.31498	N	0.665097	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.97110	1.0;0.989;0.994	T	0.80540	-0.1337	10	0.66056	D	0.02	-29.1762	14.9294	0.70903	0.0:0.0:1.0:0.0	.	74;74;74	A8MX29;A8MXL7;Q9H0B6	.;.;KLC2_HUMAN	K	74	ENSP00000436577:E74K;ENSP00000399403:E74K;ENSP00000437026:E74K;ENSP00000396952:E74K;ENSP00000377631:E74K;ENSP00000314837:E74K;ENSP00000408484:E74K;ENSP00000377641:E74K;ENSP00000434538:E74K;ENSP00000431253:E74K;ENSP00000377630:E74K	ENSP00000314837:E74K	E	+	1	0	KLC2	65782861	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.203000	0.95033	2.030000	0.59900	0.561000	0.74099	GAG	KLC2	-	pfam_Rabaptin_Rab5-bd_dom	ENSG00000174996		0.627	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLC2	HGNC	protein_coding	OTTHUMT00000258200.1	27	0.00	0	G	NM_022822		66026285	66026285	+1	no_errors	ENST00000316924	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	A
KNTC1	9735	genome.wustl.edu	37	12	123069500	123069500	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:123069500G>A	ENST00000333479.7	+	36	3674	c.3497G>A	c.(3496-3498)aGa>aAa	p.R1166K	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1166					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GAGCTTTCCAGACAATGCCAA	0.323																																						dbGAP											0													78.0	74.0	75.0					12																	123069500		1813	4085	5898	-	-	-	SO:0001583	missense	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3497G>A	12.37:g.123069500G>A	ENSP00000328236:p.Arg1166Lys		A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.R1166K	ENST00000333479.7	37	c.3497	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	6.837	0.523690	0.13066	.	.	ENSG00000184445	ENST00000333479	T	0.14022	2.54	5.64	5.64	0.86602	.	0.175901	0.53938	D	0.000041	T	0.13243	0.0321	L	0.47716	1.5	0.80722	D	1	B	0.19817	0.039	B	0.12156	0.007	T	0.06197	-1.0840	10	0.25751	T	0.34	-7.2222	12.0582	0.53548	0.078:0.0:0.922:0.0	.	1166	P50748	KNTC1_HUMAN	K	1166	ENSP00000328236:R1166K	ENSP00000328236:R1166K	R	+	2	0	KNTC1	121635453	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	2.340000	0.43974	2.637000	0.89404	0.563000	0.77884	AGA	KNTC1	-	NULL	ENSG00000184445		0.323	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	213	0.00	0	G			123069500	123069500	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	1.000	A
KRTAP4-2	85291	genome.wustl.edu	37	17	39334385	39334385	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr17:39334385G>C	ENST00000377726.2	-	1	75	c.32C>G	c.(31-33)tCt>tGt	p.S11C		NM_033062.3	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	11	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].					keratin filament (GO:0045095)				kidney(2)|lung(4)|upper_aerodigestive_tract(1)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCCCTGGTCAGAGCACACAGA	0.597																																						dbGAP											0													61.0	61.0	61.0					17																	39334385		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ406934	CCDS11384.1	17q21.2	2013-06-25			ENSG00000244537	ENSG00000244537		"""Keratin associated proteins"""	18900	protein-coding gene	gene with protein product						11279113	Standard	NM_033062		Approved	KAP4.2	uc002hwd.3	Q9BYR5	OTTHUMG00000133437	ENST00000377726.2:c.32C>G	17.37:g.39334385G>C	ENSP00000366955:p.Ser11Cys		A0JP64	Missense_Mutation	SNP	NULL	p.S11C	ENST00000377726.2	37	c.32	CCDS11384.1	17	.	.	.	.	.	.	.	.	.	.	.	0.647	-0.811226	0.02798	.	.	ENSG00000244537	ENST00000377726	T	0.00634	6.07	4.2	3.2	0.36748	.	0.000000	0.31648	U	0.007293	T	0.00356	0.0011	N	0.03903	-0.33	0.27453	N	0.953368	B	0.22146	0.065	B	0.20384	0.029	T	0.41752	-0.9491	10	0.02654	T	1	.	10.132	0.42685	0.0:0.2046:0.7954:0.0	.	11	Q9BYR5	KRA42_HUMAN	C	11	ENSP00000366955:S11C	ENSP00000366955:S11C	S	-	2	0	KRTAP4-2	36587911	0.991000	0.36638	0.905000	0.35620	0.684000	0.39900	1.295000	0.33377	0.847000	0.35167	0.508000	0.49915	TCT	KRTAP4-2	-	NULL	ENSG00000244537		0.597	KRTAP4-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-2	HGNC	protein_coding	OTTHUMT00000257305.1	99	0.00	0	G			39334385	39334385	-1	no_errors	ENST00000377726	ensembl	human	known	69_37n	missense	61	13.89	10	SNP	0.902	C
KYNU	8942	genome.wustl.edu	37	2	143746426	143746426	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:143746426C>G	ENST00000375773.2	+	11	1014	c.915C>G	c.(913-915)ttC>ttG	p.F305L	KYNU_ENST00000409512.1_Intron|KYNU_ENST00000264170.4_Intron	NM_001032998.1	NP_001028170.1			kynureninase									p.F305L(1)		large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		GATCGGAGTTCTTTAATTAGG	0.388																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											147.0	142.0	144.0					2																	143746426		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000375773.2:c.915C>G	2.37:g.143746426C>G	ENSP00000364928:p.Phe305Leu			Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_Kynureninase	p.F305L	ENST00000375773.2	37	c.915	CCDS33299.1	2	.	.	.	.	.	.	.	.	.	.	C	5.652	0.304884	0.10678	.	.	ENSG00000115919	ENST00000375773	T	0.63417	-0.04	2.61	-0.389	0.12455	.	.	.	.	.	T	0.44435	0.1293	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38887	-0.9640	8	0.87932	D	0	.	2.3819	0.04357	0.2372:0.4783:0.0:0.2845	.	305	Q9BVW3	.	L	305	ENSP00000364928:F305L	ENSP00000364928:F305L	F	+	3	2	KYNU	143462896	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.433000	0.21477	-0.111000	0.12001	-0.293000	0.09583	TTC	KYNU	-	NULL	ENSG00000115919		0.388	KYNU-003	KNOWN	basic|CCDS	protein_coding	KYNU	HGNC	protein_coding	OTTHUMT00000332171.1	292	0.34	1	C	NM_001032998		143746426	143746426	+1	no_errors	ENST00000375773	ensembl	human	known	69_37n	missense	79	17.71	17	SNP	0.000	G
LAMB2	3913	genome.wustl.edu	37	3	49160162	49160162	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:49160162G>A	ENST00000418109.1	-	28	4712	c.4548C>T	c.(4546-4548)atC>atT	p.I1516I	LAMB2_ENST00000305544.4_Silent_p.I1516I|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000398888.2_5'Flank|LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000417901.1_5'Flank|USP19_ENST00000434032.2_5'Flank|USP19_ENST00000398892.3_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1516	Domain I.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TCACACTCTGGATAAGTTCTT	0.587																																						dbGAP											0													150.0	144.0	146.0					3																	49160162		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.4548C>T	3.37:g.49160162G>A			Q16321	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.I1516	ENST00000418109.1	37	c.4548	CCDS2789.1	3																																																																																			LAMB2	-	NULL	ENSG00000172037		0.587	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	148	0.00	0	G	NM_002292		49160162	49160162	-1	no_errors	ENST00000305544	ensembl	human	known	69_37n	silent	68	13.75	11	SNP	1.000	A
LEPR	3953	genome.wustl.edu	37	1	66085699	66085699	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:66085699C>T	ENST00000349533.6	+	17	2669	c.2484C>T	c.(2482-2484)ttC>ttT	p.F828F	LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371059.3_Silent_p.F828F|LEPR_ENST00000344610.8_Silent_p.F828F|LEPR_ENST00000371058.1_Silent_p.F828F|LEPR_ENST00000371060.3_Silent_p.F828F	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TTAATAGTTTCACTCAAGGTA	0.318																																						dbGAP											0													53.0	52.0	53.0					1																	66085699		2201	4285	6486	-	-	-	SO:0001819	synonymous_variant	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2484C>T	1.37:g.66085699C>T			Q6FHL5	Silent	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.F828	ENST00000349533.6	37	c.2484	CCDS631.1	1																																																																																			LEPR	-	pfscan_Fibronectin_type3	ENSG00000116678		0.318	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	183	0.00	0	C	NM_002303		66085699	66085699	+1	no_errors	ENST00000349533	ensembl	human	known	69_37n	silent	40	11.11	5	SNP	0.937	T
LRIG3	121227	genome.wustl.edu	37	12	59274492	59274492	+	Missense_Mutation	SNP	C	C	T	rs60376933	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:59274492C>T	ENST00000320743.3	-	13	1958	c.1672G>A	c.(1672-1674)Gag>Aag	p.E558K	LRIG3_ENST00000379141.4_Missense_Mutation_p.E498K	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	558	Ig-like C2-type 1.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			TCCATCACCTCGCCACCTTGG	0.478			T	ROS1	NSCLC								C|||	4	0.000798722	0.0	0.0	5008	,	,		20643	0.004		0.0	False		,,,				2504	0.0					dbGAP		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	0													119.0	101.0	108.0					12																	59274492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1672G>A	12.37:g.59274492C>T	ENSP00000326759:p.Glu558Lys		Q6UXL7|Q8NC72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E558K	ENST00000320743.3	37	c.1672	CCDS8960.1	12	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	31	5.100911	0.94245	.	.	ENSG00000139263	ENST00000379141;ENST00000320743	T;T	0.38560	1.13;1.13	6.04	6.04	0.98038	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37530	N	0.002055	T	0.44787	0.1310	N	0.21617	0.685	0.80722	D	1	P;D	0.89917	0.953;1.0	B;D	0.72338	0.321;0.977	T	0.36237	-0.9756	9	.	.	.	.	20.5792	0.99380	0.0:1.0:0.0:0.0	rs60376933	498;558	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	K	498;558	ENSP00000368436:E498K;ENSP00000326759:E558K	.	E	-	1	0	LRIG3	57560759	0.954000	0.32549	0.998000	0.56505	0.892000	0.51952	5.972000	0.70448	2.873000	0.98535	0.561000	0.74099	GAG	LRIG3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000139263		0.478	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG3	HGNC	protein_coding	OTTHUMT00000406623.1	161	0.00	0	C	NM_153377		59274492	59274492	-1	no_errors	ENST00000320743	ensembl	human	known	69_37n	missense	210	11.76	28	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	170097843	170097843	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:170097843C>T	ENST00000263816.3	-	25	3985	c.3700G>A	c.(3700-3702)Gaa>Aaa	p.E1234K	LRP2_ENST00000443831.1_Missense_Mutation_p.E1097K	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1234	LDL-receptor class A 13. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CACTGAAATTCATCTGAGTGG	0.463																																						dbGAP											0													113.0	116.0	115.0					2																	170097843		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3700G>A	2.37:g.170097843C>T	ENSP00000263816:p.Glu1234Lys		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.E1234K	ENST00000263816.3	37	c.3700	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.191377	0.94923	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.95949	-3.86;-3.86	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.97096	0.9051	L	0.50993	1.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.97158	0.9836	10	0.66056	D	0.02	.	20.3172	0.98658	0.0:1.0:0.0:0.0	.	1097;1234	E9PC35;P98164	.;LRP2_HUMAN	K	1234;1097	ENSP00000263816:E1234K;ENSP00000409813:E1097K	ENSP00000263816:E1234K	E	-	1	0	LRP2	169806089	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.770000	0.85390	2.801000	0.96364	0.650000	0.86243	GAA	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.463	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	60	0.00	0	C	NM_004525		170097843	170097843	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	1.000	T
LRRC15	131578	genome.wustl.edu	37	3	194081543	194081543	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:194081543G>A	ENST00000347624.3	-	2	315	c.230C>T	c.(229-231)tCa>tTa	p.S77L	LRRC15_ENST00000428839.1_Missense_Mutation_p.S83L|LRRC15_ENST00000439944.2_Missense_Mutation_p.S83L	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	77					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)	p.S77L(2)		biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		GATGAGGGCTGAGATATTGAG	0.587																																						dbGAP											2	Substitution - Missense(2)	lung(2)											100.0	77.0	85.0					3																	194081543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.230C>T	3.37:g.194081543G>A	ENSP00000306276:p.Ser77Leu		Q495Q6|Q7RTN7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S83L	ENST00000347624.3	37	c.248	CCDS3306.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307487	0.60305	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	D;T;T	0.90197	-2.63;3.58;3.58	5.04	5.04	0.67666	.	0.103704	0.42964	D	0.000640	D	0.90903	0.7141	L	0.37630	1.12	0.37410	D	0.913216	D;P	0.53312	0.959;0.892	P;P	0.55508	0.777;0.57	D	0.89270	0.3604	10	0.21014	T	0.42	.	19.2769	0.94034	0.0:0.0:1.0:0.0	.	77;83	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	L	77;83;83	ENSP00000306276:S77L;ENSP00000389128:S83L;ENSP00000413707:S83L	ENSP00000306276:S77L	S	-	2	0	LRRC15	195562838	0.999000	0.42202	0.993000	0.49108	0.896000	0.52359	2.549000	0.45803	2.717000	0.92951	0.462000	0.41574	TCA	LRRC15	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000172061		0.587	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC15	HGNC	protein_coding	OTTHUMT00000342858.2	89	0.00	0	G			194081543	194081543	-1	no_errors	ENST00000439944	ensembl	human	known	69_37n	missense	63	20.00	16	SNP	0.991	A
LRRC7	57554	genome.wustl.edu	37	1	70291445	70291445	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:70291445C>G	ENST00000035383.5	+	3	352	c.322C>G	c.(322-324)Cca>Gca	p.P108A	LRRC7_ENST00000310961.5_Missense_Mutation_p.P113A|LRRC7_ENST00000415775.2_5'UTR|LRRC7_ENST00000370958.1_Missense_Mutation_p.P146A	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	108						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						ACAAGAATTTCCAGAAAACAT	0.244																																						dbGAP											0													69.0	69.0	69.0					1																	70291445		2203	4276	6479	-	-	-	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.322C>G	1.37:g.70291445C>G	ENSP00000035383:p.Pro108Ala		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.P108A	ENST00000035383.5	37	c.322	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494920	0.85069	.	.	ENSG00000033122	ENST00000310961;ENST00000370958;ENST00000035383;ENST00000335298	T;T;T	0.60299	1.33;0.2;1.48	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.81833	0.4906	H	0.95712	3.71	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.998	D	0.86944	0.2081	10	0.87932	D	0	.	18.1861	0.89793	0.0:1.0:0.0:0.0	.	108;146	Q96NW7;B1AKT2	LRRC7_HUMAN;.	A	113;146;108;108	ENSP00000309245:P113A;ENSP00000359997:P146A;ENSP00000035383:P108A	ENSP00000035383:P108A	P	+	1	0	LRRC7	70064033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.046000	0.76592	2.616000	0.88540	0.655000	0.94253	CCA	LRRC7	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000033122		0.244	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	249	0.00	0	C	NM_020794		70291445	70291445	+1	no_errors	ENST00000035383	ensembl	human	known	69_37n	missense	81	18.81	19	SNP	1.000	G
LRRN1	57633	genome.wustl.edu	37	3	3888343	3888343	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:3888343C>G	ENST00000319331.3	+	2	2779	c.2018C>G	c.(2017-2019)tCt>tGt	p.S673C	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	673						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		CAAAAAACCTCTTCAATCCCA	0.428																																						dbGAP											0													45.0	48.0	47.0					3																	3888343		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.2018C>G	3.37:g.3888343C>G	ENSP00000314901:p.Ser673Cys		Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S673C	ENST00000319331.3	37	c.2018	CCDS33685.1	3	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405776	0.62288	.	.	ENSG00000175928	ENST00000319331	T	0.52526	0.66	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.64907	0.2641	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	P	0.61800	0.894	T	0.64474	-0.6399	10	0.56958	D	0.05	.	19.8773	0.96884	0.0:1.0:0.0:0.0	.	673	Q6UXK5	LRRN1_HUMAN	C	673	ENSP00000314901:S673C	ENSP00000314901:S673C	S	+	2	0	LRRN1	3863343	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	6.032000	0.70918	2.686000	0.91538	0.650000	0.86243	TCT	LRRN1	-	NULL	ENSG00000175928		0.428	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN1	HGNC	protein_coding	OTTHUMT00000337704.2	89	0.00	0	C	NM_020873		3888343	3888343	+1	no_errors	ENST00000319331	ensembl	human	known	69_37n	missense	40	27.27	15	SNP	1.000	G
MB21D1	115004	genome.wustl.edu	37	6	74135220	74135220	+	Missense_Mutation	SNP	G	G	C	rs141390590	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:74135220G>C	ENST00000370315.3	-	5	1393	c.1299C>G	c.(1297-1299)ttC>ttG	p.F433L	MB21D1_ENST00000370318.1_Missense_Mutation_p.F433L	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	433					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						GATAAGAAGAGAATTTATCCA	0.368																																						dbGAP											0													65.0	62.0	63.0					6																	74135220		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.1299C>G	6.37:g.74135220G>C	ENSP00000359339:p.Phe433Leu		L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Missense_Mutation	SNP	pfam_Mab-21_dom	p.F433L	ENST00000370315.3	37	c.1299	CCDS4978.1	6	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705289	0.68615	.	.	ENSG00000164430	ENST00000370318;ENST00000370315;ENST00000296913	T;T	0.04502	3.61;3.61	5.8	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.05364	0.0142	L	0.58669	1.825	0.38163	D	0.939084	D	0.52996	0.957	P	0.55785	0.784	T	0.41980	-0.9478	10	0.29301	T	0.29	-19.9348	9.9317	0.41525	0.2165:0.0:0.7835:0.0	.	433	Q8N884	M21D1_HUMAN	L	433;433;416	ENSP00000359342:F433L;ENSP00000359339:F433L	ENSP00000296913:F416L	F	-	3	2	MB21D1	74191941	1.000000	0.71417	0.995000	0.50966	0.675000	0.39556	2.500000	0.45381	0.817000	0.34445	0.650000	0.86243	TTC	MB21D1	-	pfam_Mab-21_dom	ENSG00000164430		0.368	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MB21D1	HGNC	protein_coding	OTTHUMT00000041221.5	120	0.00	0	G	NM_138441		74135220	74135220	-1	no_errors	ENST00000370315	ensembl	human	known	69_37n	missense	60	23.75	19	SNP	1.000	C
MAP3K4	4216	genome.wustl.edu	37	6	161507647	161507647	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:161507647C>A	ENST00000392142.4	+	9	2652	c.2504C>A	c.(2503-2505)tCa>tAa	p.S835*	MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.S835*|MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.S835*|MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.S835*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	835					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.S835L(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TTCAGGCTTTCAGCCCCAGTT	0.358																																						dbGAP											2	Substitution - Missense(2)	lung(2)											70.0	68.0	69.0					6																	161507647		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2504C>A	6.37:g.161507647C>A	ENSP00000375986:p.Ser835*		A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S835*	ENST00000392142.4	37	c.2504	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	C	39	7.569995	0.98365	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	5.28	5.28	0.74379	.	0.175509	0.39687	N	0.001291	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0362	19.2757	0.94030	0.0:1.0:0.0:0.0	.	.	.	.	X	835	.	ENSP00000297332:S835X	S	+	2	0	MAP3K4	161427637	0.995000	0.38212	0.065000	0.19835	0.923000	0.55619	6.576000	0.74023	2.624000	0.88883	0.650000	0.86243	TCA	MAP3K4	-	NULL	ENSG00000085511		0.358	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	130	0.00	0	C			161507647	161507647	+1	no_errors	ENST00000392142	ensembl	human	known	69_37n	nonsense	65	16.67	13	SNP	0.134	A
MBD1	4152	genome.wustl.edu	37	18	47799318	47799318	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr18:47799318delT	ENST00000591416.1	-	14	2023	c.1592delA	c.(1591-1593)gacfs	p.D531fs	MBD1_ENST00000588937.1_Frame_Shift_Del_p.D462fs|MBD1_ENST00000585672.1_Frame_Shift_Del_p.D481fs|MBD1_ENST00000590208.1_Frame_Shift_Del_p.D531fs|MBD1_ENST00000269468.5_Frame_Shift_Del_p.D531fs|MBD1_ENST00000591535.1_Frame_Shift_Del_p.D462fs|MBD1_ENST00000349085.2_Frame_Shift_Del_p.D429fs|MBD1_ENST00000382948.5_Frame_Shift_Del_p.D531fs|MBD1_ENST00000587605.1_Frame_Shift_Del_p.D429fs|MBD1_ENST00000339998.6_Frame_Shift_Del_p.D485fs|MBD1_ENST00000398488.1_Frame_Shift_Del_p.D429fs|MBD1_ENST00000398493.1_Frame_Shift_Del_p.D475fs|MBD1_ENST00000347968.3_Frame_Shift_Del_p.D475fs|MBD1_ENST00000424334.2_Frame_Shift_Del_p.D582fs|MBD1_ENST00000353909.3_Frame_Shift_Del_p.D482fs|MBD1_ENST00000585595.1_Frame_Shift_Del_p.D556fs|MBD1_ENST00000398495.2_Frame_Shift_Del_p.D500fs|MBD1_ENST00000436910.1_Frame_Shift_Del_p.D462fs|MBD1_ENST00000269471.5_Frame_Shift_Del_p.D462fs|MBD1_ENST00000457839.2_Frame_Shift_Del_p.D556fs			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	531	TRD.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						CAGGCCTGGGTCTACTGCCTG	0.537																																						dbGAP											0													76.0	73.0	74.0					18																	47799318		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1592delA	18.37:g.47799318delT	ENSP00000467017:p.Asp531fs		A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Frame_Shift_Del	DEL	pfam_Znf_CXXC,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_CXXC	p.D582fs	ENST00000591416.1	37	c.1745	CCDS11943.1	18																																																																																			MBD1	-	NULL	ENSG00000141644		0.537	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MBD1	HGNC	protein_coding	OTTHUMT00000255926.3	96	0.00	0	T	NM_015846		47799318	47799318	-1	no_errors	ENST00000424334	ensembl	human	known	69_37n	frame_shift_del	52	19.40	13	DEL	0.417	-
MDN1	23195	genome.wustl.edu	37	6	90406153	90406153	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:90406153C>T	ENST00000369393.3	-	60	9424	c.9309G>A	c.(9307-9309)gaG>gaA	p.E3103E	MDN1_ENST00000428876.1_Silent_p.E3103E			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3103					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCTGAGTTCTCTCAACCCACT	0.522																																						dbGAP											0													85.0	80.0	82.0					6																	90406153		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.9309G>A	6.37:g.90406153C>T			O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.E3103	ENST00000369393.3	37	c.9309	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.522	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	121	0.00	0	C			90406153	90406153	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	silent	58	23.38	18	SNP	0.991	T
MED12	9968	genome.wustl.edu	37	X	70352039	70352039	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:70352039G>C	ENST00000374080.3	+	30	4268	c.4236G>C	c.(4234-4236)aaG>aaC	p.K1412N	MED12_ENST00000333646.6_Missense_Mutation_p.K1412N|MED12_ENST00000374102.1_Missense_Mutation_p.K1412N			Q93074	MED12_HUMAN	mediator complex subunit 12	1412					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GCAGCAGCAAGACCAAGCCTG	0.517			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													65.0	60.0	62.0					X																	70352039		2142	4227	6369	-	-	-	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4236G>C	X.37:g.70352039G>C	ENSP00000363193:p.Lys1412Asn		O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.K1412N	ENST00000374080.3	37	c.4236	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	G	12.38	1.919746	0.33908	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	4.38	1.63	0.23807	.	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	L	0.58101	1.795	0.44508	D	0.997458	P;D;P;P	0.60575	0.608;0.988;0.928;0.645	B;P;P;B	0.53006	0.175;0.715;0.58;0.196	T	0.60500	-0.7251	10	0.41790	T	0.15	-19.6209	8.7473	0.34594	0.3639:0.0:0.6361:0.0	.	1412;1259;1412;1412	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	N	1412;1412;1412;1412;1380;157	ENSP00000333125:K1412N;ENSP00000363215:K1412N;ENSP00000363193:K1412N;ENSP00000414203:K1380N;ENSP00000408388:K157N	ENSP00000333125:K1412N	K	+	3	2	MED12	70268764	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	1.145000	0.31577	0.436000	0.26393	0.523000	0.50628	AAG	MED12	-	NULL	ENSG00000184634		0.517	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	153	0.00	0	G	NM_005120		70352039	70352039	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	0.945	C
METTL17	64745	genome.wustl.edu	37	14	21460707	21460707	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:21460707G>A	ENST00000339374.6	+	5	687	c.454G>A	c.(454-456)Gag>Aag	p.E152K	METTL17_ENST00000556670.2_Missense_Mutation_p.E152K|METTL17_ENST00000382985.4_Missense_Mutation_p.E152K	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	152					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						CAGCTACACTGAGGGACTGAG	0.433																																						dbGAP											0													98.0	101.0	100.0					14																	21460707		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.454G>A	14.37:g.21460707G>A	ENSP00000343041:p.Glu152Lys		Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	SNP	pfam_Ribosomal_Rsm22_bac-type,pfam_Methyltransf_11	p.E152K	ENST00000339374.6	37	c.454	CCDS9562.1	14	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651383	0.88056	.	.	ENSG00000165792	ENST00000339374;ENST00000382985;ENST00000553564;ENST00000554751;ENST00000555670	T;T;T	0.32515	1.48;1.45;1.98	5.48	5.48	0.80851	.	0.060225	0.64402	D	0.000006	T	0.45895	0.1365	L	0.43152	1.355	0.42605	D	0.993296	D;D;D	0.76494	0.999;0.998;0.998	D;P;D	0.73708	0.981;0.9;0.943	T	0.15809	-1.0424	10	0.28530	T	0.3	.	14.8546	0.70326	0.0:0.0:1.0:0.0	.	152;152;152	Q9H7H0-3;Q9H7H0;Q9H7H0-2	.;MET17_HUMAN;.	K	152;152;70;70;70	ENSP00000343041:E152K;ENSP00000372445:E152K;ENSP00000451478:E70K	ENSP00000343041:E152K	E	+	1	0	METTL17	20530547	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.267000	0.51577	2.592000	0.87571	0.561000	0.74099	GAG	METTL17	-	NULL	ENSG00000165792		0.433	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL17	HGNC	protein_coding	OTTHUMT00000073804.4	298	0.00	0	G	NM_022734		21460707	21460707	+1	no_errors	ENST00000382985	ensembl	human	known	69_37n	missense	100	19.35	24	SNP	1.000	A
MIR513A1	574509	genome.wustl.edu	37	X	146295084	146295084	+	RNA	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:146295084C>T	ENST00000385138.1	-	0	25					NR_030231.1				microRNA 513a-1																		aggcactgtacgctgaatggc	0.433																																						dbGAP											0													124.0	97.0	106.0					X																	146295084		1568	3582	5150	-	-	-			0					Xq27.3	2011-09-12	2008-01-07	2008-12-18	ENSG00000207873	ENSG00000207873		"""ncRNAs / Micro RNAs"""	32141	non-coding RNA	RNA, micro			"""microRNA 513-1"""	MIRN513-1, MIRN513A1			Standard	NR_030231		Approved	hsa-mir-513-1, hsa-mir-513a-1					X.37:g.146295084C>T				RNA	SNP	-	NULL	ENST00000385138.1	37	NULL		X																																																																																			MIR513A1	-	-	ENSG00000207873		0.433	MIR513A1-201	KNOWN	basic	miRNA	MIR513A1	HGNC	miRNA		390	0.00	0	C	NR_030231		146295084	146295084	-1	no_errors	ENST00000385138	ensembl	human	known	69_37n	rna	218	14.45	37	SNP	0.044	T
KMT2A	4297	genome.wustl.edu	37	11	118344572	118344572	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:118344572C>T	ENST00000389506.5	+	3	2698	c.2698C>T	c.(2698-2700)Cag>Tag	p.Q900*	KMT2A_ENST00000534358.1_Nonsense_Mutation_p.Q900*|KMT2A_ENST00000354520.4_Nonsense_Mutation_p.Q900*			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	900					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										aTCAGAAATTCAGAGTAGTTC	0.463																																						dbGAP											0													114.0	110.0	111.0					11																	118344572		2200	4296	6496	-	-	-	SO:0001587	stop_gained	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.2698C>T	11.37:g.118344572C>T	ENSP00000374157:p.Gln900*		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Nonsense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.Q900*	ENST00000389506.5	37	c.2698	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.540122	0.96474	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520	.	.	.	5.56	5.56	0.83823	.	0.347462	0.31760	N	0.007105	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0729	0.89417	0.0:1.0:0.0:0.0	.	.	.	.	X	900;933;900;900	.	ENSP00000346516:Q900X	Q	+	1	0	MLL	117849782	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.705000	0.74644	2.781000	0.95711	0.591000	0.81541	CAG	MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.463	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	192	0.00	0	C	NM_005933		118344572	118344572	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	nonsense	93	16.07	18	SNP	0.998	T
KMT2C	58508	genome.wustl.edu	37	7	151945354	151945354	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:151945354C>T	ENST00000262189.6	-	14	2383	c.2165G>A	c.(2164-2166)gGa>gAa	p.G722E	KMT2C_ENST00000355193.2_Missense_Mutation_p.G722E	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	722					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTCCTTTTCTCCTTGTAGCCT	0.388																																						dbGAP											0													69.0	68.0	68.0					7																	151945354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2165G>A	7.37:g.151945354C>T	ENSP00000262189:p.Gly722Glu		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.G722E	ENST00000262189.6	37	c.2165	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	0.830	-0.745735	0.03065	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.81908	-1.55;-1.55	5.41	0.108	0.14548	.	0.461132	0.18072	N	0.152583	T	0.51534	0.1680	N	0.03608	-0.345	0.32245	N	0.572259	B	0.02656	0.0	B	0.01281	0.0	T	0.50127	-0.8864	10	0.02654	T	1	.	2.3884	0.04372	0.1235:0.1786:0.127:0.5709	.	722	Q8NEZ4	MLL3_HUMAN	E	722	ENSP00000262189:G722E;ENSP00000347325:G722E	ENSP00000262189:G722E	G	-	2	0	MLL3	151576287	0.412000	0.25392	0.075000	0.20258	0.009000	0.06853	0.311000	0.19380	0.036000	0.15547	-1.117000	0.02048	GGA	MLL3	-	NULL	ENSG00000055609		0.388	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	231	0.00	0	C			151945354	151945354	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	missense	119	11.19	15	SNP	0.556	T
MOGS	7841	genome.wustl.edu	37	2	74688908	74688908	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:74688908G>C	ENST00000233616.4	-	4	2170	c.2008C>G	c.(2008-2010)Cag>Gag	p.Q670E	MOGS_ENST00000452063.2_Missense_Mutation_p.Q564E|MOGS_ENST00000462443.1_5'Flank|MOGS_ENST00000409065.1_3'UTR	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	670					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)	p.Q670E(1)		cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						ACGAGCCCCTGAGGGGGCCTG	0.577																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											57.0	66.0	63.0					2																	74688908		1920	4123	6043	-	-	-	SO:0001583	missense	0			X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.2008C>G	2.37:g.74688908G>C	ENSP00000233616:p.Gln670Glu		A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	pfam_Glycoside_hydrolase_63,superfamily_6-hairpin_glycosidase-like	p.Q670E	ENST00000233616.4	37	c.2008	CCDS42700.1	2	.	.	.	.	.	.	.	.	.	.	G	7.885	0.731151	0.15507	.	.	ENSG00000115275	ENST00000233616;ENST00000452063	T;T	0.36878	1.23;1.23	5.01	4.11	0.48088	Six-hairpin glycosidase-like (1);	0.411149	0.26089	N	0.026417	T	0.23133	0.0559	L	0.29908	0.895	0.80722	D	1	B	0.10296	0.003	B	0.15870	0.014	T	0.07046	-1.0793	10	0.02654	T	1	-4.9733	12.9742	0.58529	0.0:0.1639:0.8361:0.0	.	670	Q13724	MOGS_HUMAN	E	670;564	ENSP00000233616:Q670E;ENSP00000388201:Q564E	ENSP00000233616:Q670E	Q	-	1	0	MOGS	74542416	1.000000	0.71417	0.994000	0.49952	0.920000	0.55202	4.383000	0.59600	1.309000	0.44985	0.462000	0.41574	CAG	MOGS	-	pfam_Glycoside_hydrolase_63,superfamily_6-hairpin_glycosidase-like	ENSG00000115275		0.577	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGS	HGNC	protein_coding	OTTHUMT00000328382.1	71	0.00	0	G	NM_006302		74688908	74688908	-1	no_errors	ENST00000233616	ensembl	human	known	69_37n	missense	73	15.12	13	SNP	1.000	C
MRPL53	116540	genome.wustl.edu	37	2	74699718	74699718	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:74699718C>G	ENST00000258105.7	-	1	731	c.70G>C	c.(70-72)Gag>Cag	p.E24Q	MRPL53_ENST00000409710.1_Missense_Mutation_p.E24Q	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	24						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						ACGTTTTTCTCGAAGGGACAG	0.602																																						dbGAP											0													115.0	104.0	107.0					2																	74699718		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.70G>C	2.37:g.74699718C>G	ENSP00000258105:p.Glu24Gln			Missense_Mutation	SNP	pfam_Ribosomal_L53_mit,superfamily_Thioredoxin-like_fold	p.E24Q	ENST00000258105.7	37	c.70	CCDS1944.1	2	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609413	0.46527	.	.	ENSG00000204822	ENST00000258105;ENST00000409710	T;T	0.66280	0.85;-0.2	5.09	5.09	0.68999	.	0.052026	0.85682	D	0.000000	T	0.59169	0.2174	L	0.46157	1.445	0.80722	D	1	P	0.40000	0.698	B	0.42214	0.38	T	0.61667	-0.7016	10	0.49607	T	0.09	-39.2305	13.8456	0.63466	0.0:1.0:0.0:0.0	.	24	Q96EL3	RM53_HUMAN	Q	24	ENSP00000258105:E24Q;ENSP00000386920:E24Q	ENSP00000258105:E24Q	E	-	1	0	MRPL53	74553226	1.000000	0.71417	0.999000	0.59377	0.114000	0.19823	3.745000	0.55119	2.632000	0.89209	0.655000	0.94253	GAG	MRPL53	-	pfam_Ribosomal_L53_mit,superfamily_Thioredoxin-like_fold	ENSG00000204822		0.602	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL53	HGNC	protein_coding	OTTHUMT00000252225.2	160	0.00	0	C	NM_053050		74699718	74699718	-1	no_errors	ENST00000258105	ensembl	human	known	69_37n	missense	72	15.29	13	SNP	1.000	G
MRS2	57380	genome.wustl.edu	37	6	24416704	24416704	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:24416704G>C	ENST00000378386.3	+	7	892	c.799G>C	c.(799-801)Gag>Cag	p.E267Q	MRS2_ENST00000535061.1_Missense_Mutation_p.E217Q|MRS2_ENST00000443868.2_Missense_Mutation_p.E270Q|MRS2_ENST00000378353.1_Missense_Mutation_p.E267Q|MRS2_ENST00000543597.1_5'UTR|MRS2_ENST00000483634.1_3'UTR|MRS2_ENST00000274747.7_3'UTR	NM_020662.2	NP_065713.1	Q9HD23	MRS2_HUMAN	MRS2 magnesium transporter	267						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12						GTTGCTAGAAGAGCTCTGTGT	0.308																																						dbGAP											0													85.0	96.0	92.0					6																	24416704		2203	4294	6497	-	-	-	SO:0001583	missense	0			AF288288	CCDS4552.1, CCDS69055.1, CCDS69056.1, CCDS75408.1	6p22.3-p22.1	2013-05-03	2013-05-03	2008-01-18	ENSG00000124532	ENSG00000124532			13785	protein-coding gene	gene with protein product			"""MRS2-like, magnesium homeostasis factor (S. cerevisiae)"", ""MRS2 magnesium homeostasis factor homolog (S. cerevisiae)"""	MRS2L			Standard	XM_005249242		Approved		uc003neb.3	Q9HD23	OTTHUMG00000014355	ENST00000378386.3:c.799G>C	6.37:g.24416704G>C	ENSP00000367637:p.Glu267Gln		A8K4U3|B3KNN2|B4DQL2|Q5T3Y1|Q6NTG4|Q96KF8|Q9BVP1	Missense_Mutation	SNP	NULL	p.E270Q	ENST00000378386.3	37	c.808	CCDS4552.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.56|19.56	3.850316|3.850316	0.71719|0.71719	.|.	.|.	ENSG00000124532|ENSG00000124532	ENST00000535061;ENST00000378386;ENST00000378353;ENST00000443868|ENST00000446191	T;T;T;T|.	0.47177|.	1.44;1.44;0.85;1.42|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	0.049695|.	0.85682|.	D|.	0.000000|.	T|T	0.63628|0.63628	0.2527|0.2527	L|L	0.52364|0.52364	1.645|1.645	0.80722|0.80722	D|D	1|1	P;D;B;B|.	0.65815|.	0.947;0.995;0.21;0.321|.	P;P;B;B|.	0.62014|.	0.773;0.897;0.334;0.334|.	T|T	0.59434|0.59434	-0.7455|-0.7455	10|5	0.34782|.	T|.	0.22|.	-12.3693|-12.3693	19.3897|19.3897	0.94576|0.94576	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	217;270;267;267|.	F5GWH3;B4DQL2;Q9HD23;Q9HD23-2|.	.;.;MRS2_HUMAN;.|.	Q|N	217;267;267;270|85	ENSP00000441839:E217Q;ENSP00000367637:E267Q;ENSP00000367604:E267Q;ENSP00000399585:E270Q|.	ENSP00000367604:E267Q|.	E|K	+|+	1|3	0|2	MRS2|MRS2	24524683|24524683	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.879000|0.879000	0.50718|0.50718	7.470000|7.470000	0.80973|0.80973	2.652000|2.652000	0.90054|0.90054	0.563000|0.563000	0.77884|0.77884	GAG|AAG	MRS2	-	NULL	ENSG00000124532		0.308	MRS2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	MRS2	HGNC	protein_coding	OTTHUMT00000040002.1	117	0.00	0	G			24416704	24416704	+1	no_errors	ENST00000443868	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	1.000	C
MTFR1	9650	genome.wustl.edu	37	8	66616961	66616961	+	Missense_Mutation	SNP	A	A	G	rs139115659		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr8:66616961A>G	ENST00000262146.4	+	5	440	c.314A>G	c.(313-315)gAt>gGt	p.D105G	MTFR1_ENST00000458689.2_Missense_Mutation_p.D72G|MTFR1_ENST00000517944.1_3'UTR	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	105					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			CCCCTTCAGGATGACCTTCTT	0.512																																						dbGAP											0													73.0	72.0	72.0					8																	66616961		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.314A>G	8.37:g.66616961A>G	ENSP00000262146:p.Asp105Gly		E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	pfam_Mtfr1	p.D105G	ENST00000262146.4	37	c.314	CCDS6182.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	5.942|5.942	0.357774|0.357774	0.11239|0.11239	.|.	.|.	ENSG00000066855|ENSG00000066855	ENST00000518609;ENST00000262146;ENST00000458689|ENST00000518800	T;T|.	0.44083|.	0.93;0.93|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.710623|.	0.14170|.	N|.	0.336783|.	T|T	0.35941|0.35941	0.0949|0.0949	L|L	0.38838|0.38838	1.175|1.175	0.09310|0.09310	N|N	0.999993|0.999993	B;B;B;B|.	0.14012|.	0.004;0.009;0.004;0.004|.	B;B;B;B|.	0.16289|.	0.015;0.012;0.015;0.004|.	T|T	0.27606|0.27606	-1.0069|-1.0069	10|5	0.23302|.	T|.	0.38|.	-11.94|-11.94	6.405|6.405	0.21660|0.21660	0.7547:0.1597:0.0856:0.0|0.7547:0.1597:0.0856:0.0	.|.	105;89;72;105|.	B4E3G8;E5RJS5;E7EP84;Q15390|.	.;.;.;MTFR1_HUMAN|.	G|V	89;105;72|63	ENSP00000262146:D105G;ENSP00000391502:D72G|.	ENSP00000262146:D105G|.	D|M	+|+	2|1	0|0	MTFR1|MTFR1	66779515|66779515	0.998000|0.998000	0.40836|0.40836	0.663000|0.663000	0.29738|0.29738	0.378000|0.378000	0.30076|0.30076	2.955000|2.955000	0.49121|0.49121	2.036000|2.036000	0.60181|0.60181	0.460000|0.460000	0.39030|0.39030	GAT|ATG	MTFR1	-	pfam_Mtfr1	ENSG00000066855		0.512	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFR1	HGNC	protein_coding	OTTHUMT00000378894.1	89	0.00	0	A	NM_014637		66616961	66616961	+1	no_errors	ENST00000262146	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	0.275	G
MUC16	94025	genome.wustl.edu	37	19	9066267	9066267	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:9066267G>C	ENST00000397910.4	-	3	21382	c.21179C>G	c.(21178-21180)tCa>tGa	p.S7060*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7062	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGTCAAAGTTGAATGAGTCTT	0.493																																						dbGAP											0													143.0	138.0	139.0					19																	9066267		1974	4173	6147	-	-	-	SO:0001587	stop_gained	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21179C>G	19.37:g.9066267G>C	ENSP00000381008:p.Ser7060*		Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S7060*	ENST00000397910.4	37	c.21179	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	58	33.287446	0.99981	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.58	-3.26	0.05064	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.5774	0.07940	0.4002:0.196:0.4039:0.0	.	.	.	.	X	7060	.	ENSP00000381008:S7060X	S	-	2	0	MUC16	8927267	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.865000	0.01649	-0.529000	0.06358	-0.481000	0.04817	TCA	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	320	0.00	0	G	NM_024690		9066267	9066267	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	nonsense	208	17.97	46	SNP	0.000	C
MUC4	4585	genome.wustl.edu	37	3	195511634	195511634	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:195511634G>C	ENST00000463781.3	-	2	7276	c.6817C>G	c.(6817-6819)Ctt>Gtt	p.L2273V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L2273V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGAGGTGGCG	0.582																																						dbGAP											0													39.0	36.0	37.0					3																	195511634		676	1585	2261	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6817C>G	3.37:g.195511634G>C	ENSP00000417498:p.Leu2273Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.L2273V	ENST00000463781.3	37	c.6817	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	0.810	-0.752380	0.03041	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39997	1.26;1.05	.	.	.	.	.	.	.	.	T	0.26412	0.0645	N	0.19112	0.55	0.09310	N	1	P	0.34587	0.458	B	0.41691	0.364	T	0.28170	-1.0052	6	.	.	.	.	.	.	.	.	2273	E7ESK3	.	V	2273	ENSP00000417498:L2273V;ENSP00000420243:L2273V	.	L	-	1	0	MUC4	196996029	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-2.869000	0.00721	-0.833000	0.04245	0.064000	0.15345	CTT	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	328	0.00	0	G	NM_018406		195511634	195511634	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	263	10.85	32	SNP	0.033	C
MYH1	4619	genome.wustl.edu	37	17	10404042	10404042	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr17:10404042G>C	ENST00000226207.5	-	28	3860	c.3766C>G	c.(3766-3768)Cta>Gta	p.L1256V	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1256					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TGATCTTCTAGAGCGCGGCAC	0.453																																						dbGAP											0													151.0	133.0	139.0					17																	10404042		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3766C>G	17.37:g.10404042G>C	ENSP00000226207:p.Leu1256Val		Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1256V	ENST00000226207.5	37	c.3766	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	12.27	1.886235	0.33348	.	.	ENSG00000109061	ENST00000226207	T	0.80214	-1.35	5.45	3.46	0.39613	Myosin tail (1);	0.000000	0.33670	U	0.004663	T	0.81399	0.4814	M	0.77406	2.37	0.38231	D	0.941044	B	0.24618	0.107	B	0.33799	0.17	T	0.80130	-0.1511	10	0.52906	T	0.07	.	11.1065	0.48205	0.2071:0.0:0.7929:0.0	.	1256	P12882	MYH1_HUMAN	V	1256	ENSP00000226207:L1256V	ENSP00000226207:L1256V	L	-	1	2	MYH1	10344767	0.632000	0.27172	0.112000	0.21494	0.863000	0.49368	0.911000	0.28584	0.782000	0.33613	0.650000	0.86243	CTA	MYH1	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000109061		0.453	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	358	0.00	0	G	NM_005963		10404042	10404042	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	missense	120	15.38	22	SNP	0.613	C
MYO3B	140469	genome.wustl.edu	37	2	171355142	171355142	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:171355142G>C	ENST00000408978.4	+	26	3198	c.3055G>C	c.(3055-3057)Gct>Cct	p.A1019P	MYO3B_ENST00000334231.6_Missense_Mutation_p.A1028P|MYO3B_ENST00000409044.3_Missense_Mutation_p.A1019P|MYO3B_ENST00000602629.1_Intron	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	1019	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						AACACCTCTTGCTAGCAAAGA	0.383																																						dbGAP											0													143.0	133.0	136.0					2																	171355142		1847	4090	5937	-	-	-	SO:0001583	missense	0				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.3055G>C	2.37:g.171355142G>C	ENSP00000386213:p.Ala1019Pro		B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.A1028P	ENST00000408978.4	37	c.3082	CCDS42773.1	2	.	.	.	.	.	.	.	.	.	.	G	10.80	1.452078	0.26074	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.66	2.74	0.32292	Myosin head, motor domain (2);	0.330325	0.35207	N	0.003377	T	0.52108	0.1714	N	0.13327	0.33	0.32220	N	0.57538	B;B;B	0.09022	0.002;0.002;0.0	B;B;B	0.17979	0.02;0.005;0.008	T	0.50931	-0.8769	10	0.27785	T	0.31	.	12.6177	0.56586	0.0:0.3502:0.529:0.1208	.	1019;1019;1019	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	P	1019;1019;1018;1028;1028	ENSP00000386497:A1019P;ENSP00000386213:A1019P;ENSP00000446237:A1028P;ENSP00000335100:A1028P	ENSP00000314213:A1018P	A	+	1	0	MYO3B	171063388	0.993000	0.37304	0.911000	0.35937	0.969000	0.65631	2.429000	0.44758	0.357000	0.24183	-0.282000	0.10007	GCT	MYO3B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000071909		0.383	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MYO3B	HGNC	protein_coding	OTTHUMT00000333410.1	267	0.00	0	G			171355142	171355142	+1	no_errors	ENST00000334231	ensembl	human	known	69_37n	missense	91	20.18	23	SNP	0.799	C
MYT1	4661	genome.wustl.edu	37	20	62854671	62854671	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr20:62854671G>C	ENST00000328439.1	+	16	2851	c.2487G>C	c.(2485-2487)aaG>aaC	p.K829N	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Missense_Mutation_p.K856N	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TTGCTGACAAGAGCCTCAGAA	0.562																																					GBM(59;481 1041 20555 21139 33705)	dbGAP											0													265.0	273.0	271.0					20																	62854671		2203	4300	6503	-	-	-	SO:0001583	missense	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.2487G>C	20.37:g.62854671G>C	ENSP00000327465:p.Lys829Asn		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.K856N	ENST00000328439.1	37	c.2568	CCDS13558.1	20	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292445	0.59976	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.56611	0.49;0.45	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.73908	0.3647	M	0.83774	2.66	0.80722	D	1	D;D	0.55800	0.973;0.966	P;P	0.61070	0.798;0.883	T	0.78303	-0.2256	10	0.87932	D	0	-29.9197	19.1228	0.93371	0.0:0.0:1.0:0.0	.	856;829	F5H7M8;Q01538	.;MYT1_HUMAN	N	829;856	ENSP00000327465:K829N;ENSP00000442412:K856N	ENSP00000327465:K829N	K	+	3	2	MYT1	62325115	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.250000	0.65432	2.505000	0.84491	0.655000	0.94253	AAG	MYT1	-	NULL	ENSG00000196132		0.562	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1	317	0.00	0	G	NM_004535		62854671	62854671	+1	no_errors	ENST00000536311	ensembl	human	known	69_37n	missense	151	19.25	36	SNP	1.000	C
N4BP2	55728	genome.wustl.edu	37	4	40124825	40124825	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:40124825C>T	ENST00000261435.6	+	10	4693	c.4277C>T	c.(4276-4278)tCt>tTt	p.S1426F		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1426					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						TGGAAAGAATCTGTAATGGTT	0.383																																						dbGAP											0													129.0	133.0	131.0					4																	40124825		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.4277C>T	4.37:g.40124825C>T	ENSP00000261435:p.Ser1426Phe		A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.S1426F	ENST00000261435.6	37	c.4277	CCDS3457.1	4	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016853	0.54576	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.37915	1.17	5.36	5.36	0.76844	.	0.192382	0.43579	D	0.000548	T	0.59252	0.2180	L	0.57536	1.79	0.51767	D	0.999932	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.61559	-0.7038	10	0.87932	D	0	-17.5732	19.0678	0.93119	0.0:1.0:0.0:0.0	.	1426;1426	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	F	1426;1346	ENSP00000261435:S1426F	ENSP00000261435:S1426F	S	+	2	0	N4BP2	39801220	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	6.494000	0.73661	2.494000	0.84150	0.591000	0.81541	TCT	N4BP2	-	NULL	ENSG00000078177		0.383	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	HGNC	protein_coding	OTTHUMT00000250458.2	323	0.00	0	C	NM_018177		40124825	40124825	+1	no_errors	ENST00000261435	ensembl	human	known	69_37n	missense	161	17.01	33	SNP	1.000	T
N6AMT2	221143	genome.wustl.edu	37	13	21331700	21331700	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr13:21331700G>C	ENST00000382758.1	-	2	85	c.38C>G	c.(37-39)tCt>tGt	p.S13C	N6AMT2_ENST00000382754.4_Missense_Mutation_p.S13C|N6AMT2_ENST00000460374.1_5'UTR			Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2 (putative)	13						extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(3)|lung(3)	7		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GGCATGGGCAGAAAGCTGGGG	0.398																																						dbGAP											0													113.0	109.0	110.0					13																	21331700		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055408	CCDS9293.1	13q12.11	2006-12-14			ENSG00000150456	ENSG00000150456			27351	protein-coding gene	gene with protein product						12477932	Standard	NM_174928		Approved		uc001uno.1	Q8WVE0	OTTHUMG00000016519	ENST00000382758.1:c.38C>G	13.37:g.21331700G>C	ENSP00000372206:p.Ser13Cys		B5G4V1	Missense_Mutation	SNP	pfam_N6_adenine_Mtase-rel_euk	p.S13C	ENST00000382758.1	37	c.38	CCDS9293.1	13	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308929	0.60305	.	.	ENSG00000150456	ENST00000382758;ENST00000382754	T;T	0.58060	0.36;0.36	5.5	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.66208	0.2766	M	0.91872	3.25	0.53688	D	0.999974	P	0.46395	0.877	P	0.46362	0.514	T	0.74624	-0.3603	10	0.66056	D	0.02	.	12.3868	0.55336	0.0824:0.0:0.9176:0.0	.	13	Q8WVE0	N6MT2_HUMAN	C	13	ENSP00000372206:S13C;ENSP00000372202:S13C	ENSP00000372202:S13C	S	-	2	0	N6AMT2	20229700	1.000000	0.71417	0.267000	0.24556	0.699000	0.40488	6.019000	0.70818	1.466000	0.48025	0.650000	0.86243	TCT	N6AMT2	-	NULL	ENSG00000150456		0.398	N6AMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	N6AMT2	HGNC	protein_coding	OTTHUMT00000044083.1	321	0.00	0	G	NM_174928		21331700	21331700	-1	no_errors	ENST00000382754	ensembl	human	known	69_37n	missense	126	16.00	24	SNP	0.878	C
NBPF1	55672	genome.wustl.edu	37	1	16892212	16892212	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:16892212C>G	ENST00000430580.2	-	27	3867	c.2980G>C	c.(2980-2982)Gaa>Caa	p.E994Q		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	994	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCAGGCTGTTCAAGACAACTG	0.483																																						dbGAP											0													41.0	36.0	38.0					1																	16892212		1486	2634	4120	-	-	-	SO:0001583	missense	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2980G>C	1.37:g.16892212C>G	ENSP00000474456:p.Glu994Gln		Q8N4E8|Q9C0H0	RNA	SNP	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.483	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	324	0.00	0	C	NM_017940		16892212	16892212	-1	no_errors	ENST00000430580	ensembl	human	known	69_37n	rna	58	10.77	7	SNP	0.000	G
NCF2	4688	genome.wustl.edu	37	1	183559438	183559438	+	Silent	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:183559438G>C	ENST00000367535.3	-	1	278	c.27C>G	c.(25-27)ctC>ctG	p.L9L	NCF2_ENST00000413720.1_Silent_p.L9L|NCF2_ENST00000418089.1_Silent_p.L9L|NCF2_ENST00000367536.1_Silent_p.L9L	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	9					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	CTTCATTCCAGAGGCTGATGG	0.582																																						dbGAP											0													66.0	66.0	66.0					1																	183559438		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.27C>G	1.37:g.183559438G>C			B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_TPR-1,pfam_OPR_PB1,superfamily_SH3_domain,smart_TPR_repeat,smart_SH3_domain,smart_OPR_PB1,pfscan_SH3_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_p67phox,prints_SH3_domain	p.L9	ENST00000367535.3	37	c.27	CCDS1356.1	1																																																																																			NCF2	-	NULL	ENSG00000116701		0.582	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	HGNC	protein_coding	OTTHUMT00000085483.1	72	0.00	0	G	NM_000433		183559438	183559438	-1	no_errors	ENST00000367535	ensembl	human	known	69_37n	silent	44	16.98	9	SNP	0.995	C
NCOA2	10499	genome.wustl.edu	37	8	71068737	71068737	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr8:71068737C>T	ENST00000452400.2	-	11	2044	c.1863G>A	c.(1861-1863)gtG>gtA	p.V621V	NCOA2_ENST00000524223.1_5'UTR	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	621					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			TCTCACTGCTCACGGCCGGGG	0.562			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																	dbGAP		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													86.0	89.0	88.0					8																	71068737		2036	4190	6226	-	-	-	SO:0001819	synonymous_variant	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1863G>A	8.37:g.71068737C>T			Q14CD2	Silent	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.V621	ENST00000452400.2	37	c.1863	CCDS47872.1	8																																																																																			NCOA2	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.562	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	202	0.00	0	C			71068737	71068737	-1	no_errors	ENST00000452400	ensembl	human	known	69_37n	silent	66	22.99	20	SNP	0.014	T
NDFIP2	54602	genome.wustl.edu	37	13	80125187	80125187	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr13:80125187C>G	ENST00000218652.7	+	7	995	c.943C>G	c.(943-945)Cta>Gta	p.L315V		NM_001161407.1|NM_019080.2	NP_001154879.1|NP_061953.2	Q9NV92	NFIP2_HUMAN	Nedd4 family interacting protein 2	315					negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of transporter activity (GO:0032410)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			NS(1)|breast(1)|endometrium(2)|kidney(3)|lung(3)|ovary(2)|prostate(1)|skin(1)	14		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)		TGTTAATTATCTAAAAGTCAG	0.328																																						dbGAP											0													123.0	136.0	132.0					13																	80125187		2203	4295	6498	-	-	-	SO:0001583	missense	0			AB032991	CCDS31998.1	13q22.1	2011-05-18			ENSG00000102471	ENSG00000102471			18537	protein-coding gene	gene with protein product		610041				10574461, 12050153	Standard	NM_019080		Approved	KIAA1165, N4wbp5a	uc001vlf.3	Q9NV92	OTTHUMG00000017136	ENST00000218652.7:c.943C>G	13.37:g.80125187C>G	ENSP00000218652:p.Leu315Val		Q7Z2H3|Q7Z428|Q8TAR3|Q9ULQ5	Missense_Mutation	SNP	pfam_NEDD4/BSD2	p.L315V	ENST00000218652.7	37	c.943	CCDS31998.1	13	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697436	0.48202	.	.	ENSG00000102471	ENST00000218652;ENST00000487865	T;D	0.95171	1.3;-3.63	5.55	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.94588	0.8256	N	0.25647	0.755	0.47659	D	0.99948	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94202	0.7451	10	0.41790	T	0.15	-20.4066	13.918	0.63914	0.0:0.9262:0.0:0.0738	.	201;315	B4DGY6;Q9NV92	.;NFIP2_HUMAN	V	315;212	ENSP00000218652:L315V;ENSP00000419200:L212V	ENSP00000218652:L315V	L	+	1	2	NDFIP2	79023188	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	3.028000	0.49705	1.361000	0.45981	0.460000	0.39030	CTA	NDFIP2	-	pfam_NEDD4/BSD2	ENSG00000102471		0.328	NDFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDFIP2	HGNC	protein_coding	OTTHUMT00000045380.2	168	0.00	0	C			80125187	80125187	+1	no_errors	ENST00000218652	ensembl	human	known	69_37n	missense	44	24.14	14	SNP	0.994	G
NEO1	4756	genome.wustl.edu	37	15	73562365	73562365	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr15:73562365G>A	ENST00000339362.5	+	18	2956	c.2509G>A	c.(2509-2511)Gat>Aat	p.D837N	NEO1_ENST00000261908.6_Missense_Mutation_p.D837N|NEO1_ENST00000560262.1_Missense_Mutation_p.D837N|NEO1_ENST00000558964.1_Missense_Mutation_p.D837N			Q92859	NEO1_HUMAN	neogenin 1	837					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						TTCTGAAGTTGATTTATTTGT	0.378																																						dbGAP											0													173.0	195.0	187.0					15																	73562365		2197	4297	6494	-	-	-	SO:0001583	missense	0			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.2509G>A	15.37:g.73562365G>A	ENSP00000341198:p.Asp837Asn		B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D837N	ENST00000339362.5	37	c.2509	CCDS10247.1	15	.	.	.	.	.	.	.	.	.	.	G	29.7	5.028099	0.93518	.	.	ENSG00000067141	ENST00000339362;ENST00000261908	T;T	0.56611	0.45;0.45	5.54	5.54	0.83059	Fibronectin, type III (1);	0.000000	0.85682	D	0.000000	T	0.62490	0.2432	L	0.29908	0.895	0.80722	D	1	D;P;D	0.89917	1.0;0.879;1.0	D;P;D	0.83275	0.996;0.688;0.991	T	0.54516	-0.8282	10	0.21014	T	0.42	-20.8045	19.8379	0.96666	0.0:0.0:1.0:0.0	.	837;837;837	B7ZKM9;B7ZKN0;Q92859	.;.;NEO1_HUMAN	N	837	ENSP00000341198:D837N;ENSP00000261908:D837N	ENSP00000261908:D837N	D	+	1	0	NEO1	71349418	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.765000	0.95021	0.655000	0.94253	GAT	NEO1	-	superfamily_Fibronectin_type3	ENSG00000067141		0.378	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEO1	HGNC	protein_coding	OTTHUMT00000257472.2	117	0.00	0	G	NM_002499		73562365	73562365	+1	no_errors	ENST00000261908	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	1.000	A
NLRC4	58484	genome.wustl.edu	37	2	32474920	32474920	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:32474920C>G	ENST00000404025.2	-	5	2501	c.2013G>C	c.(2011-2013)aaG>aaC	p.K671N	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000360906.5_Missense_Mutation_p.K671N|NLRC4_ENST00000402280.1_Missense_Mutation_p.K671N			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	671					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GCTTATTCAACTTGCTGAAAT	0.483																																						dbGAP											0													85.0	87.0	86.0					2																	32474920		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.2013G>C	2.37:g.32474920C>G	ENSP00000385090:p.Lys671Asn		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_NACHT_NTPase,pfscan_CARD	p.K671N	ENST00000404025.2	37	c.2013	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	C	12.09	1.834683	0.32421	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.11169	2.8;2.8;2.8	3.3	3.3	0.37823	.	0.234989	0.28257	N	0.016007	T	0.05364	0.0142	L	0.27053	0.805	0.32825	D	0.503200	P	0.37781	0.608	B	0.31869	0.137	T	0.11665	-1.0578	9	0.18710	T	0.47	-9.6481	5.2232	0.15379	0.0:0.7631:0.0:0.2369	.	671	Q9NPP4	NLRC4_HUMAN	N	671	ENSP00000354159:K671N;ENSP00000385428:K671N;ENSP00000385090:K671N	ENSP00000354159:K671N	K	-	3	2	NLRC4	32328424	1.000000	0.71417	0.727000	0.30756	0.517000	0.34286	1.110000	0.31147	2.148000	0.66965	0.543000	0.68304	AAG	NLRC4	-	NULL	ENSG00000091106		0.483	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	94	0.00	0	C	NM_021209		32474920	32474920	-1	no_errors	ENST00000360906	ensembl	human	known	69_37n	missense	42	27.59	16	SNP	0.999	G
NPHS1	4868	genome.wustl.edu	37	19	36336322	36336322	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:36336322G>A	ENST00000378910.5	-	14	1877	c.1878C>T	c.(1876-1878)caC>caT	p.H626H	NPHS1_ENST00000353632.6_Silent_p.H626H	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	626	Ig-like C2-type 6.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTCGGCGCTGTGGGCGCGGC	0.642																																						dbGAP											0													37.0	39.0	38.0					19																	36336322		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.1878C>T	19.37:g.36336322G>A			A6NDH2|C3RX61	Silent	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.H626	ENST00000378910.5	37	c.1878	CCDS32996.1	19																																																																																			NPHS1	-	pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000161270		0.642	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	41	0.00	0	G			36336322	36336322	-1	no_errors	ENST00000378910	ensembl	human	known	69_37n	silent	32	17.95	7	SNP	1.000	A
NRK	203447	genome.wustl.edu	37	X	105193653	105193653	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:105193653C>T	ENST00000243300.9	+	27	4743	c.4440C>T	c.(4438-4440)gcC>gcT	p.A1480A	NRK_ENST00000540278.1_Silent_p.A61A|NRK_ENST00000428173.2_Silent_p.A1481A	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1480	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						ATGCTGAAGCCCTCTCTGTGG	0.373										HNSCC(51;0.14)																												dbGAP											0													92.0	84.0	86.0					X																	105193653		1900	4104	6004	-	-	-	SO:0001819	synonymous_variant	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.4440C>T	X.37:g.105193653C>T			Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.A1481	ENST00000243300.9	37	c.4443		X																																																																																			NRK	-	pfam_Citron,smart_Citron	ENSG00000123572		0.373	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	215	0.00	0	C	NM_198465		105193653	105193653	+1	no_errors	ENST00000428173	ensembl	human	known	69_37n	silent	86	21.10	23	SNP	0.202	T
NRXN3	9369	genome.wustl.edu	37	14	79270156	79270156	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:79270156G>A	ENST00000554719.1	+	6	1610	c.1119G>A	c.(1117-1119)atG>atA	p.M373I	NRXN3_ENST00000335750.5_Missense_Mutation_p.M373I	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	151					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCAAGCTCATGGTTAACTTAG	0.507																																						dbGAP											0													92.0	78.0	83.0					14																	79270156		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1119G>A	14.37:g.79270156G>A	ENSP00000451648:p.Met373Ile		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.M744I	ENST00000554719.1	37	c.2232	CCDS9870.1	14	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866907	0.51588	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.78481	-1.18;-1.18	6.06	6.06	0.98353	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.086287	0.85682	D	0.000000	T	0.69958	0.3169	.	.	.	0.48395	D	0.999647	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.61983	-0.6950	8	.	.	.	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	746;373	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	I	746;744;373;373	ENSP00000451648:M373I;ENSP00000338349:M373I	.	M	+	3	0	NRXN3	78339909	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.809000	0.55606	2.882000	0.98803	0.655000	0.94253	ATG	NRXN3	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000021645		0.507	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413787.1	124	0.00	0	G	NM_001105250		79270156	79270156	+1	no_errors	ENST00000554738	ensembl	human	known	69_37n	missense	116	18.88	27	SNP	1.000	A
NT5E	4907	genome.wustl.edu	37	6	86176793	86176793	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:86176793G>C	ENST00000257770.3	+	2	404	c.355G>C	c.(355-357)Gaa>Caa	p.E119Q	NT5E_ENST00000369651.3_Missense_Mutation_p.E119Q|NT5E_ENST00000369646.3_Missense_Mutation_p.E119Q	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	119					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	GGGAAATCATGAATTTGATAA	0.383																																					Melanoma(140;797 1765 2035 2752 18208)	dbGAP											0													110.0	106.0	107.0					6																	86176793		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.355G>C	6.37:g.86176793G>C	ENSP00000257770:p.Glu119Gln		B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	pfam_5'-Nucleotdase_C,pfam_Metallo_PEstase_dom,superfamily_5'-Nucleotdase_C,prints_5_nucleotidase/apyrase	p.E119Q	ENST00000257770.3	37	c.355	CCDS5002.1	6	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581218	0.86748	.	.	ENSG00000135318	ENST00000257770;ENST00000369646;ENST00000369651	D;D;D	0.91631	-2.88;-2.88;-2.88	5.57	5.57	0.84162	-Nucleotidase, conserved site (1);5&apos (1);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.97993	0.9339	H	0.99026	4.405	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.99537	1.0962	10	0.87932	D	0	-36.9792	18.5186	0.90943	0.0:0.0:1.0:0.0	.	119;119;119	B3KQI8;P21589;Q96B60	.;5NTD_HUMAN;.	Q	119	ENSP00000257770:E119Q;ENSP00000358660:E119Q;ENSP00000358665:E119Q	ENSP00000257770:E119Q	E	+	1	0	NT5E	86233512	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.302000	0.96175	2.613000	0.88420	0.462000	0.41574	GAA	NT5E	-	pfam_Metallo_PEstase_dom	ENSG00000135318		0.383	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5E	HGNC	protein_coding	OTTHUMT00000041388.1	442	0.00	0	G			86176793	86176793	+1	no_errors	ENST00000257770	ensembl	human	known	69_37n	missense	108	14.96	19	SNP	1.000	C
NUP210L	91181	genome.wustl.edu	37	1	154030634	154030634	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:154030634G>A	ENST00000368559.3	-	22	3109	c.3038C>T	c.(3037-3039)cCa>cTa	p.P1013L	NUP210L_ENST00000368553.1_5'Flank|NUP210L_ENST00000271854.3_Missense_Mutation_p.P1013L	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1013					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			ATTTTGGAATGGGCGTTTGGA	0.393																																						dbGAP											0													167.0	156.0	160.0					1																	154030634		1880	4112	5992	-	-	-	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.3038C>T	1.37:g.154030634G>A	ENSP00000357547:p.Pro1013Leu		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.P1013L	ENST00000368559.3	37	c.3038	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203421	0.58234	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.07021	3.46;3.23	4.76	4.76	0.60689	.	0.000000	0.53938	D	0.000060	T	0.14614	0.0353	M	0.75777	2.31	0.58432	D	0.999992	D;D	0.65815	0.986;0.995	P;P	0.57425	0.738;0.82	T	0.01165	-1.1431	10	0.35671	T	0.21	-30.6945	14.62	0.68576	0.0:0.0:1.0:0.0	.	1013;1013	E7EP56;Q5VU65	.;P210L_HUMAN	L	1013	ENSP00000357547:P1013L;ENSP00000271854:P1013L	ENSP00000271854:P1013L	P	-	2	0	NUP210L	152297258	1.000000	0.71417	0.946000	0.38457	0.369000	0.29798	6.596000	0.74113	2.484000	0.83849	0.563000	0.77884	CCA	NUP210L	-	NULL	ENSG00000143552		0.393	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	230	0.00	0	G	NM_207308		154030634	154030634	-1	no_errors	ENST00000368559	ensembl	human	known	69_37n	missense	123	19.48	30	SNP	0.996	A
NUAK2	81788	genome.wustl.edu	37	1	205273335	205273335	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:205273335G>T	ENST00000367157.3	-	7	1256	c.1130C>A	c.(1129-1131)tCc>tAc	p.S377Y		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CTCCTTGCGGGACTTCTTGAG	0.597																																						dbGAP											0													81.0	75.0	77.0					1																	205273335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.1130C>A	1.37:g.205273335G>T	ENSP00000356125:p.Ser377Tyr			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S377Y	ENST00000367157.3	37	c.1130	CCDS1453.1	1	.	.	.	.	.	.	.	.	.	.	g	20.6	4.016247	0.75161	.	.	ENSG00000163545	ENST00000367157	T	0.76578	-1.03	4.96	4.96	0.65561	.	0.000000	0.44285	D	0.000472	D	0.88358	0.6415	M	0.77313	2.365	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	D	0.89894	0.4039	10	0.72032	D	0.01	.	17.8133	0.88623	0.0:0.0:1.0:0.0	.	377	Q9H093	NUAK2_HUMAN	Y	377	ENSP00000356125:S377Y	ENSP00000356125:S377Y	S	-	2	0	NUAK2	203539958	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.458000	0.97634	2.290000	0.77057	0.506000	0.49869	TCC	NUAK2	-	NULL	ENSG00000163545		0.597	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK2	HGNC	protein_coding	OTTHUMT00000090390.1	119	0.00	0	G	NM_030952		205273335	205273335	-1	no_errors	ENST00000367157	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	T
NXF3	56000	genome.wustl.edu	37	X	102338141	102338141	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:102338141C>G	ENST00000395065.3	-	6	702	c.601G>C	c.(601-603)Gaa>Caa	p.E201Q	NXF3_ENST00000425463.2_Missense_Mutation_p.E112Q|NXF3_ENST00000425644.1_5'UTR	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	201					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						TCCACCTTTTCTGACTTCAGC	0.502																																						dbGAP											0													135.0	118.0	124.0					X																	102338141		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.601G>C	X.37:g.102338141C>G	ENSP00000378504:p.Glu201Gln		B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	pfam_Tap_RNA-bd,pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk	p.E201Q	ENST00000395065.3	37	c.601	CCDS14503.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.11|14.11	2.438288|2.438288	0.43326|0.43326	.|.	.|.	ENSG00000147206|ENSG00000147206	ENST00000395065;ENST00000425463|ENST00000427570	T;T|.	0.50548|.	0.74;0.74|.	3.65|3.65	1.88|1.88	0.25563|0.25563	.|.	0.224347|.	0.44483|.	D|.	0.000456|.	T|T	0.45478|0.45478	0.1344|0.1344	M|M	0.70595|0.70595	2.14|2.14	0.09310|0.09310	N|N	1|1	P;P;D|.	0.56968|.	0.93;0.911;0.978|.	P;B;P|.	0.54856|.	0.625;0.376;0.762|.	T|T	0.37056|0.37056	-0.9722|-0.9722	10|5	0.54805|.	T|.	0.06|.	-2.2274|-2.2274	5.0775|5.0775	0.14640|0.14640	0.0:0.7188:0.0:0.2812|0.0:0.7188:0.0:0.2812	.|.	201;97;201|.	B4DYI1;E9PEY7;Q9H4D5|.	.;.;NXF3_HUMAN|.	Q|T	201;112|77	ENSP00000378504:E201Q;ENSP00000404347:E112Q|.	ENSP00000378504:E201Q|.	E|R	-|-	1|2	0|0	NXF3|NXF3	102224797|102224797	0.009000|0.009000	0.17119|0.17119	0.004000|0.004000	0.12327|0.12327	0.022000|0.022000	0.10575|0.10575	1.291000|1.291000	0.33330|0.33330	0.377000|0.377000	0.24735|0.24735	0.513000|0.513000	0.50165|0.50165	GAA|AGA	NXF3	-	NULL	ENSG00000147206		0.502	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF3	HGNC	protein_coding	OTTHUMT00000057684.1	215	0.00	0	C	NM_022052		102338141	102338141	-1	no_errors	ENST00000395065	ensembl	human	known	69_37n	missense	67	19.28	16	SNP	0.068	G
ODF2	4957	genome.wustl.edu	37	9	131262505	131262505	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:131262505C>A	ENST00000434106.3	+	21	2824	c.2461C>A	c.(2461-2463)Ccc>Acc	p.P821T	ODF2_ENST00000351030.3_Missense_Mutation_p.P816T|ODF2_ENST00000604420.1_Missense_Mutation_p.P821T|ODF2_ENST00000444119.2_Missense_Mutation_p.P797T|ODF2_ENST00000372807.5_Missense_Mutation_p.P816T|ODF2_ENST00000393527.3_Missense_Mutation_p.P797T	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	821					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						GACTAGCTCTCCCATCCGCTC	0.557																																						dbGAP											0													212.0	174.0	187.0					9																	131262505		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.2461C>A	9.37:g.131262505C>A	ENSP00000403453:p.Pro821Thr		B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	NULL	p.P821T	ENST00000434106.3	37	c.2461	CCDS56588.1	9	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224055	0.79576	.	.	ENSG00000136811	ENST00000351030;ENST00000372796;ENST00000303890	T;T;T	0.33654	1.47;1.4;1.45	5.5	5.5	0.81552	.	0.146167	0.47093	D	0.000252	T	0.47154	0.1430	L	0.29908	0.895	0.80722	D	1	P;P;B;D	0.64830	0.531;0.952;0.112;0.994	B;P;B;P	0.60173	0.154;0.476;0.031;0.87	T	0.47586	-0.9106	10	0.87932	D	0	-17.391	18.3854	0.90465	0.0:1.0:0.0:0.0	.	816;166;821;797	Q5BJF6-4;Q6PJQ8;Q5BJF6;Q5BJF6-3	.;.;ODFP2_HUMAN;.	T	816;821;797	ENSP00000342581:P816T;ENSP00000361882:P821T;ENSP00000307781:P797T	ENSP00000307781:P797T	P	+	1	0	ODF2	130302326	0.781000	0.28676	1.000000	0.80357	0.879000	0.50718	2.977000	0.49297	2.581000	0.87130	0.561000	0.74099	CCC	ODF2	-	NULL	ENSG00000136811		0.557	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3	189	0.00	0	C			131262505	131262505	+1	no_errors	ENST00000372796	ensembl	human	known	69_37n	missense	78	18.75	18	SNP	1.000	A
OR2B2	81697	genome.wustl.edu	37	6	27879431	27879431	+	Missense_Mutation	SNP	G	G	C	rs201669058		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:27879431G>C	ENST00000303324.2	-	1	743	c.667C>G	c.(667-669)Caa>Gaa	p.Q223E		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						AACACTGCTTGGACAATAAAA	0.418																																						dbGAP											0													127.0	114.0	118.0					6																	27879431		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.667C>G	6.37:g.27879431G>C	ENSP00000304419:p.Gln223Glu		B2RNH2|Q9GZL2|Q9Y299	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q223E	ENST00000303324.2	37	c.667	CCDS4641.1	6	.	.	.	.	.	.	.	.	.	.	G	11.74	1.729766	0.30684	.	.	ENSG00000168131	ENST00000303324	T	0.37752	1.18	4.32	4.32	0.51571	GPCR, rhodopsin-like superfamily (1);	0.202751	0.24094	U	0.041616	T	0.26048	0.0635	M	0.61703	1.905	0.09310	N	1	P	0.44986	0.847	P	0.46510	0.519	T	0.07083	-1.0791	10	0.56958	D	0.05	.	8.8413	0.35144	0.1075:0.0:0.8925:0.0	.	223	Q9GZK3	OR2B2_HUMAN	E	223	ENSP00000304419:Q223E	ENSP00000304419:Q223E	Q	-	1	0	OR2B2	27987410	0.000000	0.05858	0.418000	0.26571	0.356000	0.29392	-0.635000	0.05471	2.311000	0.77944	0.563000	0.77884	CAA	OR2B2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000168131		0.418	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B2	HGNC	protein_coding	OTTHUMT00000040163.1	182	0.00	0	G			27879431	27879431	-1	no_errors	ENST00000303324	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	0.243	C
OR2T34	127068	genome.wustl.edu	37	1	248737567	248737567	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:248737567G>A	ENST00000328782.2	-	1	513	c.492C>T	c.(490-492)ctC>ctT	p.L164L		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TAATGGGGGTGAGCAACAAAC	0.522																																						dbGAP											0													28.0	36.0	33.0					1																	248737567		2153	4279	6432	-	-	-	SO:0001819	synonymous_variant	0			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.492C>T	1.37:g.248737567G>A			B2RNJ8|Q6IEY5|Q96R31	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L164	ENST00000328782.2	37	c.492	CCDS31120.1	1																																																																																			OR2T34	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183310		0.522	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	55	0.00	0	G	NM_001001821		248737567	248737567	-1	no_errors	ENST00000328782	ensembl	human	known	69_37n	silent	27	27.03	10	SNP	0.002	A
OR4E2	26686	genome.wustl.edu	37	14	22133492	22133492	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:22133492C>T	ENST00000408935.1	+	1	196	c.196C>T	c.(196-198)Ctg>Ttg	p.L66L		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		CCTGAGCAATCTGTCCTTTAT	0.423																																						dbGAP											0													285.0	278.0	280.0					14																	22133492		2010	4174	6184	-	-	-	SO:0001819	synonymous_variant	0				CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.196C>T	14.37:g.22133492C>T			Q6IET6|Q96R62	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L66	ENST00000408935.1	37	c.196	CCDS41916.1	14																																																																																			OR4E2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000221977		0.423	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4E2	HGNC	protein_coding	OTTHUMT00000401874.1	316	0.32	1	C			22133492	22133492	+1	no_errors	ENST00000408935	ensembl	human	known	69_37n	silent	99	15.38	18	SNP	0.999	T
OR5W2	390148	genome.wustl.edu	37	11	55681414	55681414	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:55681414G>A	ENST00000344514.1	-	1	644	c.645C>T	c.(643-645)ttC>ttT	p.F215F		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	215			F -> L (in dbSNP:rs17596422).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AATAAGAAATGAAAACTCCTG	0.413																																					Melanoma(48;171 1190 15239 43886 49348)	dbGAP											0													56.0	61.0	60.0					11																	55681414		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.645C>T	11.37:g.55681414G>A				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F215	ENST00000344514.1	37	c.645	CCDS31513.1	11																																																																																			OR5W2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187612		0.413	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	HGNC	protein_coding	OTTHUMT00000391523.1	66	0.00	0	G	NM_001001960		55681414	55681414	-1	no_errors	ENST00000344514	ensembl	human	known	69_37n	silent	54	22.86	16	SNP	0.000	A
SAMD4B	55095	genome.wustl.edu	37	19	39876572	39876572	+	IGR	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:39876572G>A	ENST00000314471.6	+	0	4519				PAF1_ENST00000595564.1_Silent_p.L481L|PAF1_ENST00000221265.3_3'UTR|PAF1_ENST00000221266.7_Silent_p.L458L	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CAGACCACTAGAAAAGTGCTT	0.478																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9			19.37:g.39876572G>A			A5Z0M6|Q6P194	Silent	SNP	pfam_RNA_pol_II-assoc_Paf1	p.L458	ENST00000314471.6	37	c.1372	CCDS33020.1	19																																																																																			PAF1	-	NULL	ENSG00000006712		0.478	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAF1	HGNC	protein_coding	OTTHUMT00000464467.1	17	0.00	0	G	NM_018028		39876572	39876572	-1	no_errors	ENST00000221266	ensembl	human	known	69_37n	silent	12	25.00	4	SNP	0.778	A
PARP9	83666	genome.wustl.edu	37	3	122247483	122247483	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:122247483C>T	ENST00000360356.2	-	11	2520	c.2293G>A	c.(2293-2295)Gaa>Aaa	p.E765K	PARP9_ENST00000471785.1_Missense_Mutation_p.E730K|PARP9_ENST00000477522.2_Missense_Mutation_p.E730K|PARP9_ENST00000492382.1_Missense_Mutation_p.E310K	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	765	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		GTGAGTACTTCAGCCTCAAAC	0.468																																						dbGAP											0													112.0	110.0	110.0					3																	122247483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2293G>A	3.37:g.122247483C>T	ENSP00000353512:p.Glu765Lys		A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	pfam_A1pp,smart_A1pp,pfscan_A1pp,pfscan_Poly(ADP-ribose)pol_cat_dom	p.E765K	ENST00000360356.2	37	c.2293	CCDS3014.1	3	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022444	0.75275	.	.	ENSG00000138496	ENST00000360356;ENST00000492382;ENST00000477522;ENST00000471785;ENST00000452457	T;T;T;T	0.09163	3.34;3.01;3.19;3.19	4.79	4.79	0.61399	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.000000	0.53938	D	0.000046	T	0.22666	0.0547	L	0.45698	1.435	0.80722	D	1	P;D;D	0.71674	0.952;0.998;0.992	P;D;P	0.65233	0.53;0.933;0.856	T	0.00785	-1.1567	10	0.22706	T	0.39	.	15.0445	0.71816	0.0:1.0:0.0:0.0	.	765;310;730	Q8IXQ6;G5E9U8;Q8IXQ6-2	PARP9_HUMAN;.;.	K	765;310;730;730;688	ENSP00000353512:E765K;ENSP00000417664:E310K;ENSP00000419506:E730K;ENSP00000419001:E730K	ENSP00000353512:E765K	E	-	1	0	PARP9	123730173	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	3.147000	0.50639	2.662000	0.90505	0.591000	0.81541	GAA	PARP9	-	pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000138496		0.468	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARP9	HGNC	protein_coding	OTTHUMT00000355957.1	142	0.00	0	C	NM_031458		122247483	122247483	-1	no_errors	ENST00000360356	ensembl	human	known	69_37n	missense	63	19.23	15	SNP	1.000	T
PAX5	5079	genome.wustl.edu	37	9	36923468	36923468	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:36923468G>A	ENST00000358127.4	-	7	868	c.794C>T	c.(793-795)tCa>tTa	p.S265L	PAX5_ENST00000377847.2_Missense_Mutation_p.S265L|PAX5_ENST00000520154.1_Intron|PAX5_ENST00000377852.2_Missense_Mutation_p.S265L|PAX5_ENST00000520281.1_Missense_Mutation_p.S222L|PAX5_ENST00000523241.1_Intron|PAX5_ENST00000523145.1_Missense_Mutation_p.S157L|PAX5_ENST00000377853.2_Missense_Mutation_p.S265L|PAX5_ENST00000522003.1_Missense_Mutation_p.S157L|PAX5_ENST00000446742.1_Missense_Mutation_p.S199L|PAX5_ENST00000414447.1_Missense_Mutation_p.S222L	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	265					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(23)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		GGCCATGGCTGAATACTCTGT	0.582			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																	dbGAP		Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	23	Unknown(23)	haematopoietic_and_lymphoid_tissue(23)											51.0	54.0	53.0					9																	36923468		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.794C>T	9.37:g.36923468G>A	ENSP00000350844:p.Ser265Leu		A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.S265L	ENST00000358127.4	37	c.794	CCDS6607.1	9	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787458	0.70337	.	.	ENSG00000196092	ENST00000358127;ENST00000377849;ENST00000377853;ENST00000377852;ENST00000520281;ENST00000446742;ENST00000522003;ENST00000523145;ENST00000414447;ENST00000377847;ENST00000524340	D;D;D;D;D;D;D;D;D;T	0.97941	-4.18;-4.17;-4.17;-4.61;-3.9;-1.95;-2.48;-4.62;-4.61;1.28	6.03	6.03	0.97812	.	0.169921	0.40469	N	0.001088	D	0.97520	0.9188	L	0.33485	1.01	0.80722	D	1	D;B;B;D;B;D;D;D	0.54601	0.967;0.172;0.349;0.967;0.376;0.967;0.967;0.967	P;B;B;P;B;P;P;P	0.60789	0.879;0.023;0.142;0.879;0.114;0.879;0.879;0.879	D	0.97585	1.0113	10	0.48119	T	0.1	.	19.3283	0.94273	0.0:0.0:1.0:0.0	.	222;222;199;265;92;265;265;265	C0KTF8;C0KTF7;C0KTF9;C0KTF6;C0KTE2;Q6S730;Q6S731;Q02548	.;.;.;.;.;.;.;PAX5_HUMAN	L	265;176;265;265;222;199;157;157;222;265;92	ENSP00000350844:S265L;ENSP00000367084:S265L;ENSP00000367083:S265L;ENSP00000430773:S222L;ENSP00000404687:S199L;ENSP00000429359:S157L;ENSP00000429197:S157L;ENSP00000412188:S222L;ENSP00000367078:S265L;ENSP00000429404:S92L	ENSP00000350844:S265L	S	-	2	0	PAX5	36913468	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.405000	0.90213	2.861000	0.98227	0.655000	0.94253	TCA	PAX5	-	NULL	ENSG00000196092		0.582	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX5	HGNC	protein_coding	OTTHUMT00000052433.1	46	0.00	0	G			36923468	36923468	-1	no_errors	ENST00000358127	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	1.000	A
PBRM1	55193	genome.wustl.edu	37	3	52668737	52668737	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:52668737C>G	ENST00000296302.7	-	11	1183	c.1182G>C	c.(1180-1182)agG>agC	p.R394S	PBRM1_ENST00000337303.4_Missense_Mutation_p.R394S|PBRM1_ENST00000394830.3_Missense_Mutation_p.R394S|PBRM1_ENST00000409057.1_Missense_Mutation_p.R394S|PBRM1_ENST00000409767.1_Missense_Mutation_p.R394S|PBRM1_ENST00000410007.1_Missense_Mutation_p.R394S|PBRM1_ENST00000356770.4_Missense_Mutation_p.R362S|PBRM1_ENST00000409114.3_Missense_Mutation_p.R394S			Q86U86	PB1_HUMAN	polybromo 1	394					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCCGACAACTCCTAACTGTGT	0.393			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	dbGAP		Rec	yes		3	3p21	55193	polybromo 1		E	0													128.0	130.0	129.0					3																	52668737		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1182G>C	3.37:g.52668737C>G	ENSP00000296302:p.Arg394Ser		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_superfamily,superfamily_Bromodomain,superfamily_HMG_superfamily,smart_Bromodomain,smart_BAH_dom,smart_HMG_superfamily,pfscan_BAH_dom,pfscan_HMG_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.R394S	ENST00000296302.7	37	c.1182		3	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294049	0.60086	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17;2.17;2.17;2.17;2.17;2.17	5.68	4.8	0.61643	Bromodomain (3);	0.000000	0.85682	D	0.000000	T	0.45337	0.1337	M	0.79475	2.455	0.53005	D	0.999967	P;D;D;D;D;D;D;D;D	0.89917	0.944;1.0;0.998;0.999;0.998;1.0;0.999;0.999;0.999	P;D;D;D;D;D;D;D;D	0.91635	0.744;0.999;0.99;0.997;0.994;0.999;0.975;0.996;0.996	T	0.44967	-0.9293	10	0.66056	D	0.02	-48.7149	10.242	0.43319	0.0:0.7898:0.0:0.2102	.	394;394;394;394;394;394;394;362;394	Q86U86-9;Q86U86-6;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;PB1_HUMAN;.;.	S	362;394;394;394;394;394;394;394;394;338	ENSP00000349213:R362S;ENSP00000378307:R394S;ENSP00000296302:R394S;ENSP00000338302:R394S;ENSP00000386593:R394S;ENSP00000386529:R394S;ENSP00000386643:R394S;ENSP00000386601:R394S;ENSP00000387775:R394S;ENSP00000397662:R338S	ENSP00000296302:R394S	R	-	3	2	PBRM1	52643777	0.674000	0.27549	1.000000	0.80357	0.994000	0.84299	-0.113000	0.10774	1.384000	0.46424	0.491000	0.48974	AGG	PBRM1	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000163939		0.393	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	200	0.00	0	C	NM_018165		52668737	52668737	-1	no_errors	ENST00000296302	ensembl	human	known	69_37n	missense	85	19.05	20	SNP	1.000	G
PCDHA10	56139	genome.wustl.edu	37	5	140235680	140235680	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:140235680C>G	ENST00000307360.5	+	1	47	c.47C>G	c.(46-48)tCg>tGg	p.S16W	PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.S16W|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	16					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTGCTCTCGCTTCTTCTC	0.577																																						dbGAP											0													77.0	86.0	83.0					5																	140235680		2196	4273	6469	-	-	-	SO:0001583	missense	0			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.47C>G	5.37:g.140235680C>G	ENSP00000304234:p.Ser16Trp		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S16W	ENST00000307360.5	37	c.47	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	C	0.091	-1.166741	0.01660	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.55588	0.51;0.63	4.31	-2.4	0.06583	.	.	.	.	.	T	0.37865	0.1019	L	0.33485	1.01	0.09310	N	1	B;B;B	0.17465	0.022;0.003;0.0	B;B;B	0.24269	0.052;0.005;0.002	T	0.32745	-0.9895	9	0.37606	T	0.19	.	8.1983	0.31409	0.0:0.1408:0.4594:0.3998	.	16;16;16	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	W	16	ENSP00000421030:S16W;ENSP00000304234:S16W	ENSP00000304234:S16W	S	+	2	0	PCDHA10	140215864	0.000000	0.05858	0.020000	0.16555	0.103000	0.19146	-0.986000	0.03747	-0.380000	0.07894	0.561000	0.74099	TCG	PCDHA10	-	NULL	ENSG00000250120		0.577	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	HGNC	protein_coding	OTTHUMT00000372895.2	119	0.00	0	C	NM_018901		140235680	140235680	+1	no_errors	ENST00000307360	ensembl	human	known	69_37n	missense	83	17.65	18	SNP	0.000	G
PCDHB1	29930	genome.wustl.edu	37	5	140432874	140432874	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:140432874C>G	ENST00000306549.3	+	1	1896	c.1819C>G	c.(1819-1821)Cta>Gta	p.L607V		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	607	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCATATCATCTACTTAAGGC	0.463																																						dbGAP											0													96.0	89.0	91.0					5																	140432874		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1819C>G	5.37:g.140432874C>G	ENSP00000307234:p.Leu607Val		Q2M257	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L607V	ENST00000306549.3	37	c.1819	CCDS4243.1	5	.	.	.	.	.	.	.	.	.	.	C	14.53	2.561585	0.45590	.	.	ENSG00000171815	ENST00000306549	T	0.55588	0.51	6.08	6.08	0.98989	Cadherin (4);Cadherin-like (1);	0.000000	0.37857	N	0.001903	T	0.66848	0.2831	L	0.53729	1.69	0.34875	D	0.743988	D	0.71674	0.998	D	0.69824	0.966	T	0.74870	-0.3517	10	0.66056	D	0.02	.	13.4849	0.61359	0.0:0.9283:0.0:0.0717	.	607	Q9Y5F3	PCDB1_HUMAN	V	607	ENSP00000307234:L607V	ENSP00000307234:L607V	L	+	1	2	PCDHB1	140413058	0.259000	0.24043	1.000000	0.80357	0.991000	0.79684	0.692000	0.25482	2.894000	0.99253	0.655000	0.94253	CTA	PCDHB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000171815		0.463	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	179	0.00	0	C	NM_013340		140432874	140432874	+1	no_errors	ENST00000306549	ensembl	human	known	69_37n	missense	98	18.33	22	SNP	1.000	G
PDZD2	23037	genome.wustl.edu	37	5	32091263	32091263	+	Missense_Mutation	SNP	G	G	A	rs550007301	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:32091263G>A	ENST00000438447.1	+	20	8097	c.7709G>A	c.(7708-7710)aGa>aAa	p.R2570K	PDZD2_ENST00000282493.3_Missense_Mutation_p.R2570K			O15018	PDZD2_HUMAN	PDZ domain containing 2	2570					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CTGCCTTTTAGAAGAAGCTGG	0.433																																						dbGAP											0													50.0	52.0	51.0					5																	32091263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7709G>A	5.37:g.32091263G>A	ENSP00000402033:p.Arg2570Lys		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R2570K	ENST00000438447.1	37	c.7709	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	10.66	1.411521	0.25465	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.05925	3.37;3.37	5.22	5.22	0.72569	.	0.128538	0.35838	N	0.002956	T	0.04363	0.0120	N	0.14661	0.345	0.22142	N	0.999336	B	0.29716	0.255	B	0.26614	0.071	T	0.44467	-0.9326	10	0.19590	T	0.45	.	14.2704	0.66149	0.0:0.0:1.0:0.0	.	2570	O15018	PDZD2_HUMAN	K	2570;2371;2570	ENSP00000402033:R2570K;ENSP00000282493:R2570K	ENSP00000282493:R2570K	R	+	2	0	PDZD2	32127020	0.403000	0.25319	0.463000	0.27130	0.003000	0.03518	0.579000	0.23788	2.432000	0.82394	0.561000	0.74099	AGA	PDZD2	-	NULL	ENSG00000133401		0.433	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	71	0.00	0	G			32091263	32091263	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	missense	81	14.74	14	SNP	0.847	A
PCDHB18	54660	genome.wustl.edu	37	5	140616546	140616546	+	RNA	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:140616546C>G	ENST00000526308.1	+	0	2609					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						TAGAATGAGTCTATTTCTTTG	0.373																																						dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140616546C>G			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.373	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	28	0.00	0	C			140616546	140616546	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	26	23.53	8	SNP	0.000	G
PGM3	5238	genome.wustl.edu	37	6	83896771	83896771	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:83896771T>G	ENST00000283977.4	-	3	296	c.170A>C	c.(169-171)cAa>cCa	p.Q57P	PGM3_ENST00000512866.1_Missense_Mutation_p.Q138P|PGM3_ENST00000506587.1_Missense_Mutation_p.Q166P|PGM3_ENST00000513973.1_Missense_Mutation_p.Q138P					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		TATTACAGATTGTGAAAGTTT	0.363																																						dbGAP											0													69.0	65.0	67.0					6																	83896771		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.170A>C	6.37:g.83896771T>G	ENSP00000283977:p.Gln57Pro			Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III,pirsf_PAGM	p.Q138P	ENST00000283977.4	37	c.413		6	.	.	.	.	.	.	.	.	.	.	T	15.28	2.785789	0.49997	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000283977;ENST00000506587;ENST00000510258;ENST00000507554	T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.09	4.97	3.79	0.43588	Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (1);Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.283883	0.40144	N	0.001176	T	0.66528	0.2798	M	0.79926	2.475	0.48395	D	0.999644	P;B;P	0.50066	0.931;0.355;0.931	P;P;P	0.58077	0.832;0.516;0.588	T	0.67829	-0.5569	10	0.37606	T	0.19	-30.742	10.8566	0.46802	0.0:0.0759:0.0:0.9241	.	166;166;138	E9PF86;B4DX94;O95394	.;.;AGM1_HUMAN	P	138;138;57;166;57;138	ENSP00000424874:Q138P;ENSP00000421565:Q138P;ENSP00000283977:Q57P;ENSP00000425809:Q166P;ENSP00000427420:Q57P;ENSP00000425558:Q138P	ENSP00000283977:Q57P	Q	-	2	0	PGM3	83953490	1.000000	0.71417	0.936000	0.37596	0.275000	0.26752	4.708000	0.61859	1.864000	0.54056	0.533000	0.62120	CAA	PGM3	-	pfam_A-D-PHexomutase_a/b/a-I,superfamily_A-D-PHexomutase_a/b/a-I/II/III,pirsf_PAGM	ENSG00000013375		0.363	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	PGM3	HGNC	protein_coding	OTTHUMT00000366385.2	110	0.00	0	T	NM_015599		83896771	83896771	-1	no_errors	ENST00000513973	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	0.933	G
PHC3	80012	genome.wustl.edu	37	3	169847254	169847254	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:169847254G>A	ENST00000494943.1	-	8	1038	c.970C>T	c.(970-972)Cag>Tag	p.Q324*	PHC3_ENST00000467570.1_Nonsense_Mutation_p.Q283*|PHC3_ENST00000495893.2_Nonsense_Mutation_p.Q336*			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	324	Gln-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AATATCAGCTGATGATGGGAA	0.423																																						dbGAP											0													181.0	178.0	179.0					3																	169847254		1965	4154	6119	-	-	-	SO:0001587	stop_gained	0				CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.970C>T	3.37:g.169847254G>A	ENSP00000420271:p.Gln324*		A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Nonsense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.Q336*	ENST00000494943.1	37	c.1006		3	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459261	0.84317	.	.	ENSG00000173889	ENST00000494943;ENST00000495893;ENST00000467570;ENST00000484931	.	.	.	5.35	5.35	0.76521	.	0.179847	0.39687	N	0.001283	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-5.6053	18.6641	0.91483	0.0:0.0:1.0:0.0	.	.	.	.	X	324;336;283;162	.	ENSP00000419089:Q283X	Q	-	1	0	PHC3	171329948	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.001000	0.76297	2.514000	0.84764	0.561000	0.74099	CAG	PHC3	-	NULL	ENSG00000173889		0.423	PHC3-004	KNOWN	basic	protein_coding	PHC3	HGNC	protein_coding	OTTHUMT00000352182.3	443	0.00	0	G	NM_024947		169847254	169847254	-1	no_errors	ENST00000495893	ensembl	human	known	69_37n	nonsense	193	17.09	40	SNP	1.000	A
PIEZO2	63895	genome.wustl.edu	37	18	10770164	10770164	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr18:10770164G>C	ENST00000503781.3	-	19	2852	c.2853C>G	c.(2851-2853)atC>atG	p.I951M	PIEZO2_ENST00000580640.1_Missense_Mutation_p.I976M|PIEZO2_ENST00000302079.6_Missense_Mutation_p.I951M|PIEZO2_ENST00000383408.2_Missense_Mutation_p.I239M	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	951					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										CAGAAACCCAGATAATGTAAG	0.403																																						dbGAP											0													107.0	90.0	96.0					18																	10770164		692	1591	2283	-	-	-	SO:0001583	missense	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.2853C>G	18.37:g.10770164G>C	ENSP00000421377:p.Ile951Met		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	NULL	p.I965M	ENST00000503781.3	37	c.2895		18	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376084	0.24857	.	.	ENSG00000154864	ENST00000302079;ENST00000383408	T;T	0.09073	3.02;3.02	5.87	5.0	0.66597	.	0.058337	0.64402	D	0.000003	T	0.18551	0.0445	L	0.52905	1.665	0.80722	D	1	D	0.57571	0.98	P	0.58331	0.837	T	0.00599	-1.1651	10	0.44086	T	0.13	.	11.221	0.48855	0.1398:0.0:0.8602:0.0	.	976	Q9H5I5-4	.	M	951;239	ENSP00000303316:I951M;ENSP00000372900:I239M	ENSP00000303316:I951M	I	-	3	3	FAM38B	10760164	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.240000	0.51368	1.503000	0.48686	0.644000	0.83932	ATC	PIEZO2	-	NULL	ENSG00000154864		0.403	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	126	0.00	0	G	NM_022068		10770164	10770164	-1	no_errors	ENST00000582913	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	1.000	C
PIM3	415116	genome.wustl.edu	37	22	50356707	50356707	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr22:50356707G>A	ENST00000360612.4	+	6	1348	c.913G>A	c.(913-915)Gac>Aac	p.D305N		NM_001001852.3	NP_001001852.2	Q86V86	PIM3_HUMAN	Pim-3 proto-oncogene, serine/threonine kinase	305					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|histone phosphorylation (GO:0016572)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.D305N(1)					all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		GGAGAGCTGTGACCTGCGGCT	0.682																																						dbGAP											1	Substitution - Missense(1)	lung(1)											18.0	20.0	20.0					22																	50356707		2196	4296	6492	-	-	-	SO:0001583	missense	0			BC052239	CCDS33678.1	22q13	2014-06-25	2014-06-25		ENSG00000198355	ENSG00000198355			19310	protein-coding gene	gene with protein product		610580	"""pim-3 oncogene"""			12477932	Standard	NM_001001852		Approved		uc003bjb.3	Q86V86	OTTHUMG00000150290	ENST00000360612.4:c.913G>A	22.37:g.50356707G>A	ENSP00000353824:p.Asp305Asn		A5D8X8|A8K7J0|B1B0P0|Q68BM2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D305N	ENST00000360612.4	37	c.913	CCDS33678.1	22	.	.	.	.	.	.	.	.	.	.	g	16.86	3.240223	0.58995	.	.	ENSG00000198355	ENST00000360612	T	0.20069	2.1	4.69	4.69	0.59074	Protein kinase-like domain (1);	0.140671	0.46145	U	0.000311	T	0.13415	0.0325	N	0.08118	0	0.40826	D	0.983542	B	0.17268	0.021	B	0.16289	0.015	T	0.08743	-1.0707	10	0.66056	D	0.02	.	16.5917	0.84767	0.0:0.0:1.0:0.0	.	305	Q86V86	PIM3_HUMAN	N	305	ENSP00000353824:D305N	ENSP00000353824:D305N	D	+	1	0	PIM3	48742711	1.000000	0.71417	0.989000	0.46669	0.642000	0.38348	5.935000	0.70145	2.144000	0.66660	0.506000	0.49869	GAC	PIM3	-	superfamily_Kinase-like_dom	ENSG00000198355		0.682	PIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM3	HGNC	protein_coding	OTTHUMT00000317406.1	24	0.00	0	G	NM_001001852		50356707	50356707	+1	no_errors	ENST00000360612	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.980	A
PKD1L1	168507	genome.wustl.edu	37	7	47840422	47840422	+	Missense_Mutation	SNP	G	G	A	rs552515838		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:47840422G>A	ENST00000289672.2	-	54	8068	c.8018C>T	c.(8017-8019)tCt>tTt	p.S2673F	C7orf69_ENST00000418326.2_Intron|C7orf69_ENST00000258776.4_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2673					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AACCCACATAGAGAGCAGAAA	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		16413	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													81.0	81.0	81.0					7																	47840422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.8018C>T	7.37:g.47840422G>A	ENSP00000289672:p.Ser2673Phe		Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.S2673F	ENST00000289672.2	37	c.8018	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	G	1.739	-0.492240	0.04322	.	.	ENSG00000158683	ENST00000289672	T	0.20598	2.06	4.72	-4.72	0.03269	.	728.111000	0.00166	U	0.000002	T	0.08223	0.0205	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.18681	-1.0329	10	0.09590	T	0.72	-0.0294	2.6288	0.04938	0.5148:0.1298:0.2232:0.1321	.	2673	Q8TDX9	PK1L1_HUMAN	F	2673	ENSP00000289672:S2673F	ENSP00000289672:S2673F	S	-	2	0	PKD1L1	47806947	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.174000	0.03105	-1.309000	0.02315	0.563000	0.77884	TCT	PKD1L1	-	NULL	ENSG00000158683		0.557	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	87	0.00	0	G	NM_138295		47840422	47840422	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	52	18.75	12	SNP	0.000	A
GSAP	54103	genome.wustl.edu	37	7	77011930	77011930	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:77011930G>C	ENST00000257626.7	-	7	565	c.487C>G	c.(487-489)Ctt>Gtt	p.L163V		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	163					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										TTCTCTGGAAGAGGATGACTT	0.343																																						dbGAP											0													86.0	82.0	83.0					7																	77011930		1829	4079	5908	-	-	-	SO:0001583	missense	0				CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.487C>G	7.37:g.77011930G>C	ENSP00000257626:p.Leu163Val		A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	NULL	p.L163V	ENST00000257626.7	37	c.487	CCDS34672.2	7	.	.	.	.	.	.	.	.	.	.	G	6.000	0.368327	0.11352	.	.	ENSG00000186088	ENST00000257626	T	0.15834	2.39	5.79	0.982	0.19762	.	2.045590	0.02831	U	0.126793	T	0.11367	0.0277	N	0.19112	0.55	0.09310	N	0.999999	B	0.29301	0.241	B	0.25140	0.058	T	0.27054	-1.0085	10	0.18276	T	0.48	.	7.4336	0.27141	0.656:0.0:0.344:0.0	.	163	A4D1B5	GSAP_HUMAN	V	163	ENSP00000257626:L163V	ENSP00000257626:L163V	L	-	1	0	PION	76849866	0.168000	0.22989	0.001000	0.08648	0.997000	0.91878	0.801000	0.27055	0.247000	0.21414	0.650000	0.86243	CTT	PION	-	NULL	ENSG00000186088		0.343	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PION	HGNC	protein_coding	OTTHUMT00000318672.2	149	0.00	0	G	NM_017439		77011930	77011930	-1	no_errors	ENST00000257626	ensembl	human	known	69_37n	missense	52	24.64	17	SNP	0.005	C
OOSP2	219990	genome.wustl.edu	37	11	59814505	59814505	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:59814505G>A	ENST00000278855.2	+	4	621	c.436G>A	c.(436-438)Gaa>Aaa	p.E146K		NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		146						extracellular region (GO:0005576)				breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						GACAACAGCAGAAGAGTTAGG	0.368																																						dbGAP											0													111.0	112.0	112.0					11																	59814505		2201	4295	6496	-	-	-	SO:0001583	missense	0																														ENST00000278855.2:c.436G>A	11.37:g.59814505G>A	ENSP00000278855:p.Glu146Lys		E9PJA4|Q8N9U6	Missense_Mutation	SNP	NULL	p.E146K	ENST00000278855.2	37	c.436	CCDS7979.1	11	.	.	.	.	.	.	.	.	.	.	G	17.61	3.433076	0.62844	.	.	ENSG00000149507	ENST00000278855	.	.	.	3.28	2.36	0.29203	.	0.245199	0.21340	N	0.076159	T	0.43743	0.1261	L	0.50333	1.59	0.80722	D	1	P	0.36144	0.539	B	0.37091	0.241	T	0.43798	-0.9369	9	0.87932	D	0	-8.2927	6.4559	0.21930	0.1347:0.0:0.8653:0.0	.	146	Q86WS3	PLACL_HUMAN	K	146	.	ENSP00000278855:E146K	E	+	1	0	PLAC1L	59571081	0.899000	0.30636	0.998000	0.56505	0.896000	0.52359	1.138000	0.31491	0.942000	0.37525	0.557000	0.71058	GAA	PLAC1L	-	NULL	ENSG00000149507		0.368	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAC1L	HGNC	protein_coding	OTTHUMT00000394411.1	192	0.00	0	G			59814505	59814505	+1	no_errors	ENST00000278855	ensembl	human	known	69_37n	missense	81	20.39	21	SNP	0.999	A
PLD1	5337	genome.wustl.edu	37	3	171442510	171442510	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:171442510C>T	ENST00000351298.4	-	8	860	c.734G>A	c.(733-735)aGa>aAa	p.R245K	PLD1_ENST00000342215.6_Missense_Mutation_p.R245K|PLD1_ENST00000340989.4_Missense_Mutation_p.R245K|PLD1_ENST00000356327.5_Missense_Mutation_p.R245K	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	245	PH.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GTAGCAGGCTCTTCCCTGACC	0.383																																					NSCLC(149;2174 3517 34058)	dbGAP											0													143.0	138.0	140.0					3																	171442510		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.734G>A	3.37:g.171442510C>T	ENSP00000342793:p.Arg245Lys			Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.R245K	ENST00000351298.4	37	c.734	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	C	16.25	3.070002	0.55539	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	5.67	5.67	0.87782	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.315004	0.37304	N	0.002150	T	0.62282	0.2415	N	0.25647	0.755	0.40740	D	0.982829	B;B	0.16166	0.016;0.009	B;B	0.21360	0.034;0.021	T	0.59043	-0.7528	10	0.05351	T	0.99	-17.5222	19.7221	0.96147	0.0:1.0:0.0:0.0	.	268;245	Q59EA4;Q13393	.;PLD1_HUMAN	K	245	ENSP00000348681:R245K;ENSP00000342793:R245K;ENSP00000339936:R245K;ENSP00000340326:R245K	ENSP00000340326:R245K	R	-	2	0	PLD1	172925204	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.352000	0.44080	2.834000	0.97654	0.650000	0.86243	AGA	PLD1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pirsf_PLipase_D_euk	ENSG00000075651		0.383	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	239	0.00	0	C	NM_002662		171442510	171442510	-1	no_errors	ENST00000351298	ensembl	human	known	69_37n	missense	79	11.24	10	SNP	1.000	T
PLEKHO2	80301	genome.wustl.edu	37	15	65157503	65157503	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr15:65157503G>A	ENST00000323544.4	+	6	1017	c.889G>A	c.(889-891)Gag>Aag	p.E297K	AC069368.3_ENST00000437723.1_Intron	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	297	Pro-rich.									NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						ACCCTGTTCTGAGACTTCTGA	0.617																																						dbGAP											0													47.0	50.0	49.0					15																	65157503		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.889G>A	15.37:g.65157503G>A	ENSP00000326706:p.Glu297Lys		Q7L4H4|Q8WYS8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E297K	ENST00000323544.4	37	c.889	CCDS10196.1	15	.	.	.	.	.	.	.	.	.	.	G	9.274	1.046435	0.19748	.	.	ENSG00000241839	ENST00000323544	T	0.31247	1.5	5.95	4.1	0.47936	.	0.521196	0.20873	N	0.084124	T	0.19208	0.0461	N	0.19112	0.55	0.25604	N	0.986565	B;B	0.17268	0.021;0.012	B;B	0.16722	0.016;0.007	T	0.15925	-1.0420	10	0.52906	T	0.07	.	7.6392	0.28284	0.2619:0.0:0.7381:0.0	.	247;297	Q8TD55-2;Q8TD55	.;PKHO2_HUMAN	K	297	ENSP00000326706:E297K	ENSP00000326706:E297K	E	+	1	0	PLEKHO2	62944556	0.990000	0.36364	0.290000	0.24890	0.037000	0.13140	2.714000	0.47202	0.869000	0.35703	0.655000	0.94253	GAG	PLEKHO2	-	NULL	ENSG00000241839		0.617	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHO2	HGNC	protein_coding	OTTHUMT00000256659.1	39	0.00	0	G	NM_025201		65157503	65157503	+1	no_errors	ENST00000323544	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.406	A
POLR3E	55718	genome.wustl.edu	37	16	22337444	22337444	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:22337444C>T	ENST00000299853.5	+	18	1878	c.1711C>T	c.(1711-1713)Cag>Tag	p.Q571*	POLR3E_ENST00000418581.2_Nonsense_Mutation_p.Q535*|POLR3E_ENST00000564209.1_Nonsense_Mutation_p.Q571*|POLR3E_ENST00000359210.4_Nonsense_Mutation_p.Q571*	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	571					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		GGCCACCTTTCAGAGACAGTT	0.652																																						dbGAP											0													28.0	31.0	30.0					16																	22337444		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.1711C>T	16.37:g.22337444C>T	ENSP00000299853:p.Gln571*		B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Nonsense_Mutation	SNP	pfam_RNA_pol_III_Rpc5	p.Q571*	ENST00000299853.5	37	c.1711	CCDS10605.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.505397	0.97620	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	.	.	.	5.67	4.72	0.59763	.	0.360120	0.31404	N	0.007704	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.0408	8.0805	0.30741	0.2559:0.665:0.0:0.0791	.	.	.	.	X	571;571;535	.	ENSP00000299853:Q571X	Q	+	1	0	POLR3E	22244945	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	2.451000	0.44952	1.401000	0.46761	0.462000	0.41574	CAG	POLR3E	-	NULL	ENSG00000058600		0.652	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3E	HGNC	protein_coding	OTTHUMT00000211590.1	32	0.00	0	C	NM_018119		22337444	22337444	+1	no_errors	ENST00000299853	ensembl	human	known	69_37n	nonsense	21	22.22	6	SNP	0.998	T
POM121L12	285877	genome.wustl.edu	37	7	53104112	53104112	+	Missense_Mutation	SNP	G	G	A	rs200406644		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:53104112G>A	ENST00000408890.4	+	1	764	c.748G>A	c.(748-750)Gat>Aat	p.D250N		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	250										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						TTTTTGTGATGATGCTTGGCC	0.627																																						dbGAP											0													51.0	59.0	56.0					7																	53104112		2012	4169	6181	-	-	-	SO:0001583	missense	0				CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.748G>A	7.37:g.53104112G>A	ENSP00000386133:p.Asp250Asn		Q8NDI9	Missense_Mutation	SNP	NULL	p.D250N	ENST00000408890.4	37	c.748	CCDS43584.1	7	.	.	.	.	.	.	.	.	.	.	G	5.625	0.300077	0.10622	.	.	ENSG00000221900	ENST00000408890	T	0.32023	1.47	1.82	-1.27	0.09347	.	.	.	.	.	T	0.08268	0.0206	N	0.01874	-0.695	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.34775	-0.9815	9	0.02654	T	1	.	5.1366	0.14937	0.5924:0.0:0.4076:0.0	.	250	Q8N7R1	P1L12_HUMAN	N	250	ENSP00000386133:D250N	ENSP00000386133:D250N	D	+	1	0	POM121L12	53071606	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.719000	0.01873	-0.409000	0.07553	-0.254000	0.11334	GAT	POM121L12	-	NULL	ENSG00000221900		0.627	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L12	HGNC	protein_coding	OTTHUMT00000342656.1	62	0.00	0	G	NM_182595		53104112	53104112	+1	no_errors	ENST00000408890	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	0.000	A
POTEC	388468	genome.wustl.edu	37	18	14538183	14538183	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr18:14538183C>T	ENST00000358970.5	-	2	586	c.587G>A	c.(586-588)cGa>cAa	p.R196Q	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	196										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AAGTTGACATCGTCTGTCCAG	0.408																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.587G>A	18.37:g.14538183C>T	ENSP00000351856:p.Arg196Gln			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R196Q	ENST00000358970.5	37	c.587	CCDS45835.1	18	.	.	.	.	.	.	.	.	.	.	C	6.845	0.525062	0.13066	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.52057	0.68	1.4	0.191	0.15130	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.29355	0.0731	L	0.31926	0.97	0.20074	N	0.999936	B	0.23377	0.084	B	0.17979	0.02	T	0.18023	-1.0350	9	0.27082	T	0.32	.	3.1145	0.06370	0.0:0.2761:0.0:0.7239	.	196	B2RU33	POTEC_HUMAN	Q	196	ENSP00000351856:R196Q	ENSP00000351856:R196Q	R	-	2	0	POTEC	14528183	0.981000	0.34729	0.001000	0.08648	0.161000	0.22273	1.129000	0.31381	0.050000	0.15949	0.194000	0.17425	CGA	POTEC	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000183206		0.408	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	49	0.00	0	C	XM_496269		14538183	14538183	-1	no_errors	ENST00000358970	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	0.907	T
PPEF2	5470	genome.wustl.edu	37	4	76811237	76811237	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:76811237G>C	ENST00000286719.7	-	5	646	c.290C>G	c.(289-291)tCc>tGc	p.S97C	PPEF2_ENST00000510607.1_5'Flank	NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	97					detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CTTCATCTCGGAGTCCTGGGC	0.522																																					NSCLC(105;1359 1603 15961 44567 47947)	dbGAP											0													210.0	188.0	195.0					4																	76811237		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.290C>G	4.37:g.76811237G>C	ENSP00000286719:p.Ser97Cys		O14831	Missense_Mutation	SNP	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,pfam_PPP_dom,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,prints_Ser/Thr-sp_prot-phosphatase,pfscan_EF_HAND_2	p.S97C	ENST00000286719.7	37	c.290	CCDS34013.1	4	.	.	.	.	.	.	.	.	.	.	G	11.57	1.676758	0.29783	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.57273	0.41	5.07	1.34	0.21922	Serine/threonine phosphatase, PPP5 (1);	1.965940	0.02794	U	0.122454	T	0.64148	0.2572	M	0.62723	1.935	0.09310	N	1	P;P	0.50710	0.938;0.936	P;P	0.54499	0.716;0.754	T	0.44003	-0.9356	10	0.66056	D	0.02	-2.7301	7.5034	0.27530	0.3836:0.0:0.6164:0.0	.	97;97	O14830-2;O14830	.;PPE2_HUMAN	C	97	ENSP00000286719:S97C	ENSP00000286719:S97C	S	-	2	0	PPEF2	77030261	0.047000	0.20315	0.001000	0.08648	0.006000	0.05464	2.326000	0.43849	0.172000	0.19760	0.313000	0.20887	TCC	PPEF2	-	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_PPP_dom	ENSG00000156194		0.522	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	HGNC	protein_coding	OTTHUMT00000362929.1	369	0.00	0	G	NM_006239		76811237	76811237	-1	no_errors	ENST00000286719	ensembl	human	known	69_37n	missense	146	14.62	25	SNP	0.004	C
PPP2R3C	55012	genome.wustl.edu	37	14	35554936	35554936	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:35554936G>C	ENST00000261475.5	-	13	1575	c.1222C>G	c.(1222-1224)Ctt>Gtt	p.L408V		NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	408					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		AAATCCTGAAGAGAGATTTTC	0.358																																						dbGAP											0													95.0	90.0	92.0					14																	35554936		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.1222C>G	14.37:g.35554936G>C	ENSP00000261475:p.Leu408Val		B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	NULL	p.L408V	ENST00000261475.5	37	c.1222	CCDS9654.1	14	.	.	.	.	.	.	.	.	.	.	g	19.96	3.923196	0.73213	.	.	ENSG00000092020	ENST00000261475;ENST00000555219	T;T	0.70164	-0.44;-0.46	5.72	5.72	0.89469	EF-hand-like domain (1);	0.058613	0.64402	D	0.000003	D	0.82715	0.5097	M	0.83223	2.63	0.80722	D	1	D	0.69078	0.997	P	0.61874	0.895	D	0.83988	0.0336	10	0.59425	D	0.04	-8.5786	19.8858	0.96911	0.0:0.0:1.0:0.0	.	408	Q969Q6	P2R3C_HUMAN	V	408;83	ENSP00000261475:L408V;ENSP00000452173:L83V	ENSP00000261475:L408V	L	-	1	0	PPP2R3C	34624687	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.603000	0.67619	2.714000	0.92807	0.579000	0.79373	CTT	PPP2R3C	-	NULL	ENSG00000092020		0.358	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3C	HGNC	protein_coding	OTTHUMT00000276687.1	199	0.00	0	G	NM_017917		35554936	35554936	-1	no_errors	ENST00000261475	ensembl	human	known	69_37n	missense	118	16.20	23	SNP	1.000	C
PPP2R3C	55012	genome.wustl.edu	37	14	35568480	35568480	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:35568480G>C	ENST00000261475.5	-	7	1037	c.684C>G	c.(682-684)ttC>ttG	p.F228L		NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	228	Poly-Phe.				activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		GATCTAAAAAGAAGAAGAACT	0.299																																						dbGAP											0													43.0	43.0	43.0					14																	35568480		2201	4292	6493	-	-	-	SO:0001583	missense	0			AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.684C>G	14.37:g.35568480G>C	ENSP00000261475:p.Phe228Leu		B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	NULL	p.F228L	ENST00000261475.5	37	c.684	CCDS9654.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.399253|4.399253	0.83120|0.83120	.|.	.|.	ENSG00000092020|ENSG00000092020	ENST00000261475;ENST00000554361|ENST00000555614	T;T|.	0.28255|.	1.62;1.62|.	5.26|5.26	4.36|4.36	0.52297|0.52297	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75975|0.75975	0.3923|0.3923	M|M	0.86268|0.86268	2.805|2.805	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.974;1.0|.	D;D|.	0.97110|.	0.969;1.0|.	T|T	0.78170|0.78170	-0.2308|-0.2308	10|5	0.62326|.	D|.	0.03|.	-7.9479|-7.9479	11.0782|11.0782	0.48045|0.48045	0.1499:0.0:0.8501:0.0|0.1499:0.0:0.8501:0.0	.|.	200;228|.	G3V2K1;Q969Q6|.	.;P2R3C_HUMAN|.	L|V	228;200|157	ENSP00000261475:F228L;ENSP00000450716:F200L|.	ENSP00000261475:F228L|.	F|L	-|-	3|1	2|0	PPP2R3C|PPP2R3C	34638231|34638231	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.086000|5.086000	0.64474|0.64474	1.341000|1.341000	0.45600|0.45600	0.650000|0.650000	0.86243|0.86243	TTC|CTT	PPP2R3C	-	NULL	ENSG00000092020		0.299	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3C	HGNC	protein_coding	OTTHUMT00000276687.1	103	0.00	0	G	NM_017917		35568480	35568480	-1	no_errors	ENST00000261475	ensembl	human	known	69_37n	missense	54	23.94	17	SNP	1.000	C
PRSS57	400668	genome.wustl.edu	37	19	694935	694935	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:694935C>G	ENST00000329267.7	-	2	144	c.115G>C	c.(115-117)Gag>Cag	p.E39Q		NM_214710.3	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine, 57	39	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.E39Q(2)		central_nervous_system(1)|lung(5)	6						GGGGTCACCTCGTGGCCCCCG	0.706																																						dbGAP											2	Substitution - Missense(2)	lung(2)											12.0	13.0	12.0					19																	694935		2191	4291	6482	-	-	-	SO:0001583	missense	0			AY358594	CCDS12041.1	19p13.3	2012-03-26	2011-03-07	2011-03-07		ENSG00000185198		"""Serine peptidases / Serine peptidases"""	31397	protein-coding gene	gene with protein product			"""protease, serine-like 1"""	PRSSL1		12975309	Standard	NM_214710		Approved	UNQ782	uc002lpl.1	Q6UWY2		ENST00000329267.7:c.115G>C	19.37:g.694935C>G	ENSP00000327386:p.Glu39Gln		B2RNW8	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.E39Q	ENST00000329267.7	37	c.115	CCDS12041.1	19	.	.	.	.	.	.	.	.	.	.	C	19.18	3.776870	0.70107	.	.	ENSG00000185198	ENST00000329267	D	0.89485	-2.52	5.17	4.12	0.48240	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.41194	D	0.000923	D	0.92987	0.7768	M	0.74467	2.265	0.24037	N	0.996099	D;D	0.61697	0.99;0.99	P;D	0.68943	0.896;0.961	D	0.86463	0.1780	10	0.72032	D	0.01	.	11.1604	0.48512	0.0:0.9117:0.0:0.0883	.	38;39	B7ZMF6;Q6UWY2	.;PRS57_HUMAN	Q	39	ENSP00000327386:E39Q	ENSP00000327386:E39Q	E	-	1	0	PRSS57	645935	0.981000	0.34729	0.100000	0.21137	0.138000	0.21146	2.889000	0.48601	1.184000	0.42957	0.485000	0.47835	GAG	PRSS57	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000185198		0.706	PRSS57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS57	HGNC	protein_coding	OTTHUMT00000452480.2	10	0.00	0	C	NM_214710		694935	694935	-1	no_errors	ENST00000329267	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	0.306	G
PTCHD2	57540	genome.wustl.edu	37	1	11584097	11584097	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:11584097G>A	ENST00000294484.6	+	11	2599	c.2461G>A	c.(2461-2463)Gag>Aag	p.E821K	PTCHD2_ENST00000389575.3_Missense_Mutation_p.E821K	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	821					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TAGCCGGCCTGAGGCCACCCT	0.612																																						dbGAP											0													27.0	33.0	31.0					1																	11584097		1902	4111	6013	-	-	-	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2461G>A	1.37:g.11584097G>A	ENSP00000294484:p.Glu821Lys		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.E821K	ENST00000294484.6	37	c.2461	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	G	11.30	1.597028	0.28445	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.89939	-2.59;-2.59	5.25	5.25	0.73442	.	0.390052	0.27754	N	0.017995	T	0.80412	0.4618	N	0.24115	0.695	0.33763	D	0.622043	B	0.30406	0.278	B	0.22386	0.039	T	0.81197	-0.1042	10	0.18710	T	0.47	-25.7809	15.6037	0.76646	0.0:0.0:1.0:0.0	.	821	Q9P2K9	PTHD2_HUMAN	K	821	ENSP00000294484:E821K;ENSP00000374226:E821K	ENSP00000294484:E821K	E	+	1	0	PTCHD2	11506684	0.978000	0.34361	0.460000	0.27093	0.087000	0.18053	1.882000	0.39648	2.455000	0.83008	0.561000	0.74099	GAG	PTCHD2	-	NULL	ENSG00000204624		0.612	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	40	0.00	0	G	XM_052561		11584097	11584097	+1	no_errors	ENST00000294484	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	0.779	A
PTPN22	26191	genome.wustl.edu	37	1	114380586	114380586	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:114380586G>C	ENST00000359785.5	-	13	1571	c.1436C>G	c.(1435-1437)tCt>tGt	p.S479C	PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000528414.1_Missense_Mutation_p.S424C|PTPN22_ENST00000525799.1_Missense_Mutation_p.S352C|PTPN22_ENST00000420377.2_Missense_Mutation_p.S479C|PTPN22_ENST00000538253.1_Missense_Mutation_p.S235C	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	479					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACAAAACAAGAATCATGTGG	0.388																																						dbGAP											0													113.0	108.0	110.0					1																	114380586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1436C>G	1.37:g.114380586G>C	ENSP00000352833:p.Ser479Cys		A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S479C	ENST00000359785.5	37	c.1436	CCDS863.1	1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461841	0.26248	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	5.82	3.9	0.45041	.	0.630262	0.14080	N	0.342818	T	0.59321	0.2185	M	0.65975	2.015	0.09310	N	1	D;D;D;D;D;D	0.76494	0.996;0.999;0.993;0.991;0.991;0.993	P;P;P;P;P;P	0.59703	0.799;0.862;0.711;0.751;0.788;0.789	T	0.53143	-0.8480	10	0.56958	D	0.05	.	8.3742	0.32434	0.0797:0.0:0.762:0.1583	.	235;352;479;424;479;479	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	C	479;424;235;479;352;479	ENSP00000352833:S479C;ENSP00000435176:S424C;ENSP00000439372:S235C;ENSP00000388229:S479C;ENSP00000432674:S352C	ENSP00000346621:S479C	S	-	2	0	PTPN22	114182109	0.008000	0.16893	0.004000	0.12327	0.039000	0.13416	0.473000	0.22132	0.752000	0.32923	0.655000	0.94253	TCT	PTPN22	-	pirsf_Non-rcpt_Tyr_Pase_8/22	ENSG00000134242		0.388	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	132	0.00	0	G	NM_015967		114380586	114380586	-1	no_errors	ENST00000359785	ensembl	human	known	69_37n	missense	51	27.14	19	SNP	0.057	C
PTPN22	26191	genome.wustl.edu	37	1	114380881	114380881	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:114380881G>C	ENST00000359785.5	-	13	1276	c.1141C>G	c.(1141-1143)Ctg>Gtg	p.L381V	PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000528414.1_Missense_Mutation_p.L326V|PTPN22_ENST00000525799.1_Missense_Mutation_p.L254V|PTPN22_ENST00000420377.2_Missense_Mutation_p.L381V|PTPN22_ENST00000538253.1_Missense_Mutation_p.L137V	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	381					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTAGCTCCAGAAAGTCAAAA	0.383																																						dbGAP											0													99.0	92.0	94.0					1																	114380881		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1141C>G	1.37:g.114380881G>C	ENSP00000352833:p.Leu381Val		A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L381V	ENST00000359785.5	37	c.1141	CCDS863.1	1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093502	0.36952	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.36520	3.55;3.18;1.25;3.42;2.9	5.82	-0.732	0.11147	.	0.452778	0.19234	N	0.119338	T	0.31136	0.0787	M	0.69823	2.125	0.39746	D	0.971824	D;P;P;P;P;B	0.89917	1.0;0.952;0.568;0.939;0.575;0.236	D;P;B;P;B;B	0.83275	0.996;0.607;0.195;0.775;0.108;0.11	T	0.49808	-0.8900	10	0.09338	T	0.73	.	6.3052	0.21135	0.4666:0.1406:0.3928:0.0	.	137;254;381;326;381;381	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	V	381;326;137;381;254;381	ENSP00000352833:L381V;ENSP00000435176:L326V;ENSP00000439372:L137V;ENSP00000388229:L381V;ENSP00000432674:L254V	ENSP00000346621:L381V	L	-	1	2	PTPN22	114182404	0.745000	0.28261	0.822000	0.32727	0.943000	0.58893	1.040000	0.30278	-0.382000	0.07870	-0.768000	0.03414	CTG	PTPN22	-	pirsf_Non-rcpt_Tyr_Pase_8/22	ENSG00000134242		0.383	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	233	0.00	0	G	NM_015967		114380881	114380881	-1	no_errors	ENST00000359785	ensembl	human	known	69_37n	missense	71	30.10	31	SNP	0.484	C
PTPRD	5789	genome.wustl.edu	37	9	8485307	8485307	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:8485307G>C	ENST00000381196.4	-	26	3616	c.3073C>G	c.(3073-3075)Cat>Gat	p.H1025D	PTPRD_ENST00000397606.3_Missense_Mutation_p.H604D|PTPRD_ENST00000471274.1_5'Flank|PTPRD_ENST00000397611.3_Missense_Mutation_p.H611D|PTPRD_ENST00000537002.1_Missense_Mutation_p.H611D|PTPRD_ENST00000360074.4_Missense_Mutation_p.H1012D|PTPRD_ENST00000358503.5_Missense_Mutation_p.H1003D|PTPRD_ENST00000355233.5_Missense_Mutation_p.H614D|PTPRD_ENST00000486161.1_Missense_Mutation_p.H614D|PTPRD_ENST00000397617.3_Missense_Mutation_p.H604D|PTPRD_ENST00000540109.1_Missense_Mutation_p.H1025D|PTPRD_ENST00000356435.5_Missense_Mutation_p.H1025D	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1025	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GCTTTGACATGAAAATTTTTT	0.378										TSP Lung(15;0.13)																												dbGAP											0													63.0	63.0	63.0					9																	8485307		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3073C>G	9.37:g.8485307G>C	ENSP00000370593:p.His1025Asp		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.H1025D	ENST00000381196.4	37	c.3073	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339731	0.41398	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6	5.55	4.64	0.57946	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.048006	0.85682	D	0.000000	T	0.42223	0.1193	L	0.36672	1.1	0.80722	D	1	B;B;B;B;B;B;B;P;B	0.40794	0.03;0.013;0.004;0.027;0.021;0.023;0.235;0.729;0.151	B;B;B;B;B;B;B;B;B	0.36030	0.057;0.009;0.014;0.005;0.185;0.085;0.216;0.179;0.107	T	0.25745	-1.0123	9	.	.	.	.	15.6416	0.77009	0.0:0.0:0.8614:0.1386	.	604;609;614;614;611;611;1012;1025;1025	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	D	1025;1025;1012;1003;614;604;611;611;1025;614;604	ENSP00000370593:H1025D;ENSP00000348812:H1025D;ENSP00000353187:H1012D;ENSP00000351293:H1003D;ENSP00000347373:H614D;ENSP00000380741:H604D;ENSP00000380735:H611D;ENSP00000440515:H611D;ENSP00000438164:H1025D;ENSP00000417093:H614D;ENSP00000380731:H604D	.	H	-	1	0	PTPRD	8475307	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	1.308000	0.44962	0.655000	0.94253	CAT	PTPRD	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000153707		0.378	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	176	0.00	0	G			8485307	8485307	-1	no_errors	ENST00000356435	ensembl	human	known	69_37n	missense	70	18.60	16	SNP	1.000	C
RAB23	51715	genome.wustl.edu	37	6	57061379	57061379	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:57061379G>A	ENST00000317483.3	-	4	886	c.267C>T	c.(265-267)ttC>ttT	p.F89F	RAB23_ENST00000468148.1_Silent_p.F89F	NM_016277.3	NP_057361.3	Q9ULC3	RAB23_HUMAN	RAB23, member RAS oncogene family	89					autophagic vacuole assembly (GO:0000045)|cellular defense response (GO:0006968)|cilium assembly (GO:0042384)|craniofacial suture morphogenesis (GO:0097094)|embryonic digit morphogenesis (GO:0042733)|GTP catabolic process (GO:0006184)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription factor import into nucleus (GO:0042992)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|small GTPase mediated signal transduction (GO:0007264)|spinal cord dorsal/ventral patterning (GO:0021513)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	8	Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CTGTGGTAGAGAACACGAGCA	0.378																																						dbGAP											0													89.0	77.0	81.0					6																	57061379		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB034244	CCDS4962.1	6p12.1	2008-05-15			ENSG00000112210	ENSG00000112210		"""RAB, member RAS oncogene"""	14263	protein-coding gene	gene with protein product		606144					Standard	NM_016277		Approved		uc003pdt.3	Q9ULC3	OTTHUMG00000014918	ENST00000317483.3:c.267C>T	6.37:g.57061379G>A			B2R9I5|Q68DJ6|Q8NI06|Q9P023	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Ras,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F89	ENST00000317483.3	37	c.267	CCDS4962.1	6																																																																																			RAB23	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Ras,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000112210		0.378	RAB23-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB23	HGNC	protein_coding	OTTHUMT00000041042.1	248	0.00	0	G			57061379	57061379	-1	no_errors	ENST00000317483	ensembl	human	known	69_37n	silent	73	23.16	22	SNP	1.000	A
RAB40AL	282808	genome.wustl.edu	37	X	102192645	102192645	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:102192645G>C	ENST00000218249.5	+	1	446	c.399G>C	c.(397-399)aaG>aaC	p.K133N	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	133					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						TGGCATTCAAGAGGCAGGTGC	0.547																																						dbGAP											0													18.0	25.0	22.0					X																	102192645		2181	4271	6452	-	-	-	SO:0001583	missense	0			BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	ENST00000218249.5:c.399G>C	X.37:g.102192645G>C	ENSP00000218249:p.Lys133Asn		Q495H3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_SOCS_C,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,smart_SOCS_C,pfscan_SOCS_C,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.K133N	ENST00000218249.5	37	c.399	CCDS35353.1	X	.	.	.	.	.	.	.	.	.	.	.	17.82	3.482251	0.63962	.	.	ENSG00000102128	ENST00000218249	T	0.78246	-1.16	0.779	0.779	0.18550	Small GTP-binding protein domain (1);	0.000000	0.48767	U	0.000168	T	0.69949	0.3168	N	0.11870	0.19	0.53005	D	0.999969	D	0.63046	0.992	D	0.70016	0.967	T	0.67373	-0.5687	10	0.51188	T	0.08	.	3.0396	0.06134	0.3382:0.0:0.6618:0.0	.	133	P0C0E4	RB40L_HUMAN	N	133	ENSP00000218249:K133N	ENSP00000218249:K133N	K	+	3	2	RAB40AL	102079301	1.000000	0.71417	0.973000	0.42090	0.972000	0.66771	2.937000	0.48979	0.678000	0.31325	0.458000	0.33432	AAG	RAB40AL	-	pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000102128		0.547	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40AL	HGNC	protein_coding	OTTHUMT00000057679.1	51	0.00	0	G	NM_001031834		102192645	102192645	+1	no_errors	ENST00000218249	ensembl	human	known	69_37n	missense	53	25.35	18	SNP	1.000	C
RABEP2	79874	genome.wustl.edu	37	16	28931193	28931193	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:28931193C>G	ENST00000358201.4	-	3	934	c.346G>C	c.(346-348)Gag>Cag	p.E116Q	RABEP2_ENST00000544477.1_Missense_Mutation_p.E45Q|RABEP2_ENST00000561803.1_5'UTR|RABEP2_ENST00000357573.6_Missense_Mutation_p.E116Q	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	116					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						TCCTTCTCCTCACAGTCCTGC	0.627																																					Pancreas(66;639 1284 10093 31061 49099)	dbGAP											0													41.0	45.0	44.0					16																	28931193		1978	4161	6139	-	-	-	SO:0001583	missense	0			AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.346G>C	16.37:g.28931193C>G	ENSP00000350934:p.Glu116Gln			Missense_Mutation	SNP	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.E116Q	ENST00000358201.4	37	c.346	CCDS42140.1	16	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915186	0.92178	.	.	ENSG00000177548	ENST00000358201;ENST00000357573;ENST00000544477	T;T;T	0.57907	0.68;0.7;0.37	4.75	4.75	0.60458	Rabaptin coiled-coil domain (1);	0.616620	0.16470	N	0.213032	T	0.69504	0.3118	L	0.55990	1.75	0.42380	D	0.992484	D;D;D;D	0.89917	0.999;0.986;1.0;0.989	D;P;D;P	0.83275	0.996;0.844;0.989;0.904	T	0.72187	-0.4366	10	0.87932	D	0	-24.669	17.0026	0.86384	0.0:1.0:0.0:0.0	.	45;116;116;116	B4DHR0;Q9H5N1-2;Q49AT6;Q9H5N1	.;.;.;RABE2_HUMAN	Q	116;116;45	ENSP00000350934:E116Q;ENSP00000350186:E116Q;ENSP00000442798:E45Q	ENSP00000350186:E116Q	E	-	1	0	RABEP2	28838694	0.994000	0.37717	0.943000	0.38184	0.982000	0.71751	3.353000	0.52247	2.395000	0.81488	0.650000	0.86243	GAG	RABEP2	-	pfam_Rabaptin_coiled-coil	ENSG00000177548		0.627	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RABEP2	HGNC	protein_coding	OTTHUMT00000432691.1	84	0.00	0	C	NM_024816		28931193	28931193	-1	no_errors	ENST00000358201	ensembl	human	known	69_37n	missense	55	19.12	13	SNP	0.999	G
RANBP2	5903	genome.wustl.edu	37	2	109380099	109380099	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:109380099C>G	ENST00000283195.6	+	20	3230	c.3104C>G	c.(3103-3105)tCa>tGa	p.S1035*		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1035					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AAATTTAACTCAAATTTCAAA	0.438																																						dbGAP											0													104.0	104.0	104.0					2																	109380099		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3104C>G	2.37:g.109380099C>G	ENSP00000283195:p.Ser1035*		Q13074|Q15280|Q53TE2|Q59FH7	Nonsense_Mutation	SNP	pfam_Ran_bind_dom,pfam_Znf_RanBP2,pfam_IR1-M,pfam_Cyclophilin-like_PPIase_dom,pfam_TPR-1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,smart_Ran_bind_dom,smart_Znf_RanBP2,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RanBP2,pfscan_Cyclophilin-like_PPIase_dom,pfscan_Ran_bind_dom,prints_Cyclophilin-like_PPIase_dom	p.S1035*	ENST00000283195.6	37	c.3104	CCDS2079.1	2	.	.	.	.	.	.	.	.	.	.	C	41	8.740062	0.98935	.	.	ENSG00000153201	ENST00000283195	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-14.0885	19.8051	0.96529	0.0:1.0:0.0:0.0	.	.	.	.	X	1035	.	ENSP00000283195:S1035X	S	+	2	0	RANBP2	108746531	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	3.919000	0.56439	2.672000	0.90937	0.557000	0.71058	TCA	RANBP2	-	NULL	ENSG00000153201		0.438	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	HGNC	protein_coding	OTTHUMT00000253594.1	126	0.00	0	C	NM_006267		109380099	109380099	+1	no_errors	ENST00000283195	ensembl	human	known	69_37n	nonsense	52	21.21	14	SNP	1.000	G
RAPGEF2	9693	genome.wustl.edu	37	4	160264511	160264511	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:160264511G>A	ENST00000264431.4	+	16	3145	c.2726G>A	c.(2725-2727)cGa>cAa	p.R909Q		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	909	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CACGTTGGCCGAATGGCTTCA	0.448																																						dbGAP											0													113.0	111.0	112.0					4																	160264511		1946	4147	6093	-	-	-	SO:0001583	missense	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2726G>A	4.37:g.160264511G>A	ENSP00000264431:p.Arg909Gln		D3DP27	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,pfam_PDZ,pfam_cNMP-bd_dom,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R909Q	ENST00000264431.4	37	c.2726	CCDS43277.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.584776	0.96578	.	.	ENSG00000109756	ENST00000264431	T	0.29142	1.58	5.73	5.73	0.89815	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.36220	0.0959	L	0.46741	1.465	0.80722	D	1	P	0.52061	0.95	P	0.44673	0.457	T	0.09465	-1.0673	10	0.54805	T	0.06	.	19.8852	0.96909	0.0:0.0:1.0:0.0	.	909	Q9Y4G8	RPGF2_HUMAN	Q	909	ENSP00000264431:R909Q	ENSP00000264431:R909Q	R	+	2	0	RAPGEF2	160483961	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	9.864000	0.99589	2.697000	0.92050	0.491000	0.48974	CGA	RAPGEF2	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000109756		0.448	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	HGNC	protein_coding	OTTHUMT00000364980.2	143	0.00	0	G	NM_014247		160264511	160264511	+1	no_errors	ENST00000264431	ensembl	human	known	69_37n	missense	89	15.24	16	SNP	1.000	A
RDH5	5959	genome.wustl.edu	37	12	56118164	56118164	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:56118164G>A	ENST00000257895.5	+	5	944	c.792G>A	c.(790-792)gtG>gtA	p.V264V	RDH5_ENST00000548082.1_Silent_p.V264V|RDH5_ENST00000547072.1_Silent_p.V167V|RP11-644F5.10_ENST00000550412.1_3'UTR	NM_001199771.1|NM_002905.3	NP_001186700.1|NP_002896.2	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis/9-cis)	264			V -> G (in RPA; decreased stability).		phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)	12					Vitamin A(DB00162)	TAACCAAGGTGAGCCGATGCC	0.592											OREG0021908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													149.0	125.0	133.0					12																	56118164		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89717	CCDS31829.1	12q13-q14	2013-06-03	2006-05-09			ENSG00000135437	1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	9940	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 5"""	601617	"""retinol dehydrogenase 5 (11-cis and 9-cis)"""	RDH1		9115228, 8884265, 19027726	Standard	NM_002905		Approved	HSD17B9, SDR9C5	uc001shl.3	Q92781	OTTHUMG00000170126	ENST00000257895.5:c.792G>A	12.37:g.56118164G>A		1013	O00179|Q8TAI2	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.V264	ENST00000257895.5	37	c.792	CCDS31829.1	12																																																																																			RDH5	-	NULL	ENSG00000135437		0.592	RDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH5	HGNC	protein_coding	OTTHUMT00000407493.1	105	0.00	0	G	NM_002905		56118164	56118164	+1	no_errors	ENST00000257895	ensembl	human	known	69_37n	silent	99	18.85	23	SNP	1.000	A
RDX	5962	genome.wustl.edu	37	11	110104054	110104054	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:110104054C>G	ENST00000343115.4	-	13	1814	c.1495G>C	c.(1495-1497)Gaa>Caa	p.E499Q	RDX_ENST00000405097.1_Missense_Mutation_p.E499Q|RDX_ENST00000528900.1_Missense_Mutation_p.E152Q|RDX_ENST00000544551.1_Missense_Mutation_p.E363Q|RDX_ENST00000530301.1_Intron|RDX_ENST00000528498.1_Missense_Mutation_p.E499Q	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	499	Glu-rich.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		TTTGATAATTCAGCACTAGCT	0.438																																					Esophageal Squamous(55;25 1062 11040 28755 44273)	dbGAP											0													252.0	229.0	237.0					11																	110104054		2201	4298	6499	-	-	-	SO:0001583	missense	0			BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.1495G>C	11.37:g.110104054C>G	ENSP00000342830:p.Glu499Gln		A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Band_41_domain,prints_Ez/rad/moesin,prints_Band_41_fam,pfscan_FERM_domain	p.E499Q	ENST00000343115.4	37	c.1495	CCDS8343.1	11	.	.	.	.	.	.	.	.	.	.	C	24.3	4.517409	0.85495	.	.	ENSG00000137710	ENST00000528498;ENST00000405097;ENST00000528900;ENST00000343115;ENST00000544551;ENST00000530085	D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	6.01	5.09	0.68999	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92018	0.7471	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.69078	0.997;0.994;0.989;0.995	D;D;D;D	0.66497	0.944;0.932;0.925;0.932	D	0.92198	0.5765	10	0.56958	D	0.05	.	15.6824	0.77381	0.0:0.9336:0.0:0.0664	.	363;499;499;152	F5H1A7;A7YIJ8;P35241;A7YIK3	.;.;RADI_HUMAN;.	Q	499;499;152;499;363;169	ENSP00000432112:E499Q;ENSP00000384136:E499Q;ENSP00000433580:E152Q;ENSP00000342830:E499Q;ENSP00000445826:E363Q;ENSP00000434788:E169Q	ENSP00000342830:E499Q	E	-	1	0	RDX	109609264	1.000000	0.71417	0.941000	0.38009	0.805000	0.45488	7.445000	0.80570	2.861000	0.98227	0.650000	0.86243	GAA	RDX	-	pirsf_ERM,pfam_ERM_C,superfamily_Moesin	ENSG00000137710		0.438	RDX-001	KNOWN	basic|CCDS	protein_coding	RDX	HGNC	protein_coding	OTTHUMT00000390535.2	460	0.00	0	C	NM_002906		110104054	110104054	-1	no_errors	ENST00000530749	ensembl	human	known	69_37n	missense	102	17.74	22	SNP	1.000	G
RGS14	10636	genome.wustl.edu	37	5	176799049	176799049	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:176799049G>C	ENST00000408923.3	+	15	1862	c.1674G>C	c.(1672-1674)ttG>ttC	p.L558F	RGS14_ENST00000506944.1_3'UTR	NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	558					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGGATCCTTGAACTCCACCA	0.637																																					NSCLC(47;353 1896 28036)	dbGAP											0													89.0	109.0	102.0					5																	176799049		2100	4204	6304	-	-	-	SO:0001583	missense	0			AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.1674G>C	5.37:g.176799049G>C	ENSP00000386229:p.Leu558Phe		O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_Regulat_G_prot_signal,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.L558F	ENST00000408923.3	37	c.1674	CCDS43405.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.050|0.050	-1.253159|-1.253159	0.01457|0.01457	.|.	.|.	ENSG00000169220|ENSG00000169220	ENST00000408923;ENST00000336477|ENST00000511890	T|.	0.39787|.	1.06|.	4.75|4.75	-7.39|-7.39	0.01402|0.01402	.|.	.|.	.|.	.|.	.|.	T|.	0.15869|.	0.0382|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	P;P;B|.	0.36438|.	0.553;0.545;0.214|.	B;B;B|.	0.32533|.	0.146;0.147;0.07|.	T|.	0.33879|.	-0.9851|.	9|.	0.51188|.	T|.	0.08|.	0.1382|0.1382	11.1148|11.1148	0.48254|0.48254	0.6999:0.1846:0.1155:0.0|0.6999:0.1846:0.1155:0.0	.|.	329;406;558|.	B3KUX0;O43566-5;O43566|.	.;.;RGS14_HUMAN|.	F|S	558;339|429	ENSP00000386229:L558F|.	ENSP00000336864:L339F|.	L|X	+|+	3|2	2|2	RGS14|RGS14	176731655|176731655	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.052000|0.052000	0.14988|0.14988	-1.519000|-1.519000	0.02243|0.02243	-1.613000|-1.613000	0.01577|0.01577	-0.300000|-0.300000	0.09419|0.09419	TTG|TGA	RGS14	-	NULL	ENSG00000169220		0.637	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS14	HGNC	protein_coding	OTTHUMT00000372676.1	58	0.00	0	G	NM_006480		176799049	176799049	+1	no_errors	ENST00000408923	ensembl	human	known	69_37n	missense	55	12.70	8	SNP	0.000	C
RIC8A	60626	genome.wustl.edu	37	11	209437	209437	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:209437G>T	ENST00000526104.1	+	3	1507	c.163G>T	c.(163-165)Gaa>Taa	p.E55*	BET1L_ENST00000529614.2_5'Flank|BET1L_ENST00000382762.3_5'Flank|BET1L_ENST00000486280.1_5'Flank|RIC8A_ENST00000527696.1_Nonsense_Mutation_p.E49*|BET1L_ENST00000410108.1_5'Flank|RIC8A_ENST00000325207.5_Nonsense_Mutation_p.E55*|BET1L_ENST00000332865.6_5'Flank|BET1L_ENST00000325147.9_5'Flank			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	55					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTCCGTCCTGGAACAGGGCTT	0.667																																						dbGAP											0													68.0	69.0	69.0					11																	209437		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.163G>T	11.37:g.209437G>T	ENSP00000432008:p.Glu55*		Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Nonsense_Mutation	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn	p.E55*	ENST00000526104.1	37	c.163		11	.	.	.	.	.	.	.	.	.	.	G	38	6.669008	0.97747	.	.	ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000531209;ENST00000530889;ENST00000527696	.	.	.	4.12	4.12	0.48240	.	0.302125	0.36482	N	0.002571	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-27.0267	10.0232	0.42055	0.0961:0.0:0.9039:0.0	.	.	.	.	X	55;55;55;59;49	.	ENSP00000325941:E55X	E	+	1	0	RIC8A	199437	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.321000	0.59209	2.244000	0.73946	0.561000	0.74099	GAA	RIC8A	-	superfamily_ARM-type_fold	ENSG00000177963		0.667	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	RIC8A	HGNC	protein_coding	OTTHUMT00000384761.1	67	0.00	0	G	NM_021932		209437	209437	+1	no_errors	ENST00000325207	ensembl	human	known	69_37n	nonsense	41	24.07	13	SNP	1.000	T
RIPK1	8737	genome.wustl.edu	37	6	3077012	3077012	+	5'UTR	DEL	G	G	-	rs202096237	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:3077012delG	ENST00000259808.4	+	0	253				RIPK1_ENST00000541791.1_5'Flank|RIPK1_ENST00000380409.2_5'Flank|RIPK1_ENST00000479389.1_Intron			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				CAGCTCTGCCGGGGGGGGAAA	0.388																																						dbGAP											0													28.0	28.0	28.0					6																	3077012		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.-46G>-	6.37:g.3077012delG			A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	RNA	DEL	-	NULL	ENST00000259808.4	37	NULL	CCDS4482.1	6																																																																																			RIPK1	-	-	ENSG00000137275		0.388	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	HGNC	protein_coding	OTTHUMT00000039659.2	50	0.00	0	G	NM_003804		3077012	3077012	+1	no_errors	ENST00000490396	ensembl	human	known	69_37n	rna	31	11.43	4	DEL	0.000	-
ROCK2	9475	genome.wustl.edu	37	2	11332346	11332346	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:11332346C>G	ENST00000315872.6	-	32	4539	c.4091G>C	c.(4090-4092)aGa>aCa	p.R1364T	ROCK2_ENST00000401753.1_Missense_Mutation_p.R1121T	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	1364					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CATTGAAGTTCTAGGAGATGA	0.438																																						dbGAP											0													149.0	142.0	144.0					2																	11332346		1820	4070	5890	-	-	-	SO:0001583	missense	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.4091G>C	2.37:g.11332346C>G	ENSP00000317985:p.Arg1364Thr		Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.R1364T	ENST00000315872.6	37	c.4091	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767093	0.69878	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.63913	-0.07;0.98	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	N	0.08118	0	0.54753	D	0.999989	B	0.29590	0.25	B	0.22753	0.041	T	0.46624	-0.9178	10	0.54805	T	0.06	.	19.6691	0.95903	0.0:1.0:0.0:0.0	.	1364	O75116	ROCK2_HUMAN	T	1364;1121;722	ENSP00000317985:R1364T;ENSP00000385509:R1121T	ENSP00000317985:R1364T	R	-	2	0	ROCK2	11249797	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.772000	0.85439	2.721000	0.93114	0.591000	0.81541	AGA	ROCK2	-	pirsf_Rho-assoc_coiled-coil_kinase	ENSG00000134318		0.438	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	245	0.00	0	C			11332346	11332346	-1	no_errors	ENST00000315872	ensembl	human	known	69_37n	missense	137	16.46	27	SNP	1.000	G
ROR1	4919	genome.wustl.edu	37	1	64624667	64624667	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:64624667C>G	ENST00000371079.1	+	8	1553	c.1178C>G	c.(1177-1179)tCa>tGa	p.S393*	ROR1_ENST00000545203.1_5'UTR|RP11-24J23.2_ENST00000424995.1_RNA	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	393					peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						CACCCAGATTCAAAGGATTCC	0.363																																						dbGAP											0													67.0	67.0	67.0					1																	64624667		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1178C>G	1.37:g.64624667C>G	ENSP00000360120:p.Ser393*		Q5VVX6|Q66K77|Q92776	Nonsense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.S393*	ENST00000371079.1	37	c.1178	CCDS626.1	1	.	.	.	.	.	.	.	.	.	.	C	41	8.751488	0.98939	.	.	ENSG00000185483	ENST00000371079;ENST00000544776	.	.	.	5.77	4.85	0.62838	.	0.197519	0.24937	N	0.034411	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	9.2925	0.37795	0.1524:0.7722:0.0:0.0754	.	.	.	.	X	393;396	.	ENSP00000360120:S393X	S	+	2	0	ROR1	64397255	0.855000	0.29742	0.978000	0.43139	0.895000	0.52256	1.566000	0.36396	1.572000	0.49736	0.650000	0.86243	TCA	ROR1	-	pirsf_Tyr_kinase_rcpt_ROR,superfamily_Kringle-like,smart_Kringle	ENSG00000185483		0.363	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR1	HGNC	protein_coding	OTTHUMT00000025002.1	95	0.00	0	C	NM_005012		64624667	64624667	+1	no_errors	ENST00000371079	ensembl	human	known	69_37n	nonsense	53	22.06	15	SNP	0.990	G
RTN3	10313	genome.wustl.edu	37	11	63486546	63486546	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:63486546C>A	ENST00000377819.5	+	3	726	c.572C>A	c.(571-573)tCa>tAa	p.S191*	RTN3_ENST00000537981.1_Intron|RTN3_ENST00000356000.3_Intron|RTN3_ENST00000339997.4_Nonsense_Mutation_p.S172*|RTN3_ENST00000354497.4_Intron|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000540798.1_Nonsense_Mutation_p.S79*	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	191					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						AATGGGGTATCAAGTAGGGAG	0.433																																						dbGAP											0													75.0	77.0	76.0					11																	63486546		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.572C>A	11.37:g.63486546C>A	ENSP00000367050:p.Ser191*		B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Nonsense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.S191*	ENST00000377819.5	37	c.572	CCDS58141.1	11	.	.	.	.	.	.	.	.	.	.	C	5.371	0.253680	0.10185	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798;ENST00000545432;ENST00000543552	.	.	.	5.56	3.7	0.42460	.	1.527500	0.03924	N	0.284074	.	.	.	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	0.0308	8.5715	0.33572	0.0:0.8228:0.0:0.1772	.	.	.	.	X	191;172;79;98;90	.	ENSP00000344106:S172X	S	+	2	0	RTN3	63243122	0.002000	0.14202	0.001000	0.08648	0.035000	0.12851	1.009000	0.29886	0.837000	0.34925	0.591000	0.81541	TCA	RTN3	-	NULL	ENSG00000133318		0.433	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	HGNC	protein_coding	OTTHUMT00000397846.1	92	0.00	0	C	NM_006054		63486546	63486546	+1	no_errors	ENST00000377819	ensembl	human	known	69_37n	nonsense	68	15.00	12	SNP	0.002	A
S1PR3	1903	genome.wustl.edu	37	9	91616385	91616385	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:91616385C>G	ENST00000375846.3	+	1	4965	c.270C>G	c.(268-270)atC>atG	p.I90M	S1PR3_ENST00000358157.2_Missense_Mutation_p.I90M			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	90					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						TGGCCGGCATCGCTTACAAGG	0.512											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													80.0	80.0	80.0					9																	91616385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.270C>G	9.37:g.91616385C>G	ENSP00000365006:p.Ile90Met	1283	Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_EDG3_rcpt,prints_S1P_rcpt,prints_7TM_GPCR_Rhodpsn,prints_EDG1_rcpt,prints_Cnbnoid_rcpt	p.I90M	ENST00000375846.3	37	c.270	CCDS6680.1	9	.	.	.	.	.	.	.	.	.	.	C	11.18	1.562702	0.27915	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	T;T	0.23147	1.92;1.92	5.04	-7.03	0.01584	GPCR, rhodopsin-like superfamily (1);	0.201592	0.43747	D	0.000529	T	0.20861	0.0502	L	0.37630	1.12	0.22601	N	0.998948	D	0.53312	0.959	P	0.56398	0.797	T	0.09997	-1.0649	10	0.62326	D	0.03	.	2.3308	0.04235	0.5257:0.1033:0.1346:0.2365	.	90	Q99500	S1PR3_HUMAN	M	90	ENSP00000350878:I90M;ENSP00000365006:I90M	ENSP00000350878:I90M	I	+	3	3	S1PR3	90806205	0.001000	0.12720	0.001000	0.08648	0.913000	0.54294	-2.025000	0.01435	-1.036000	0.03287	0.561000	0.74099	ATC	S1PR3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000213694		0.512	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR3	HGNC	protein_coding	OTTHUMT00000052979.2	40	0.00	0	C	NM_005226		91616385	91616385	+1	no_errors	ENST00000358157	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.014	G
SALL2	6297	genome.wustl.edu	37	14	21991732	21991732	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:21991732G>A	ENST00000327430.3	-	2	2424	c.2130C>T	c.(2128-2130)gtC>gtT	p.V710V	SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000450879.2_Silent_p.V573V	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	710					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GGTGCATCCGGACATGCTGCT	0.597																																						dbGAP											0													67.0	63.0	65.0					14																	21991732		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2130C>T	14.37:g.21991732G>A			B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S569F	ENST00000327430.3	37	c.1706	CCDS32045.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.581|0.581	-0.837201|-0.837201	0.02692|0.02692	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000541876|ENST00000546363	.|.	.|.	.|.	4.76|4.76	-2.1|-2.1	0.07210|0.07210	.|.	.|.	.|.	.|.	.|.	T|T	0.50667|0.50667	0.1629|0.1629	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.44251|0.44251	-0.9340|-0.9340	5|4	0.36615|.	T|.	0.2|.	-0.3654|-0.3654	6.6213|6.6213	0.22804|0.22804	0.2841:0.0:0.5583:0.1575|0.2841:0.0:0.5583:0.1575	.|.	.|.	.|.	.|.	S|F	593|569	.|.	ENSP00000443331:P593S|.	P|S	-|-	1|2	0|0	SALL2|SALL2	21061572|21061572	0.961000|0.961000	0.32948|0.32948	0.992000|0.992000	0.48379|0.48379	0.432000|0.432000	0.31715|0.31715	0.101000|0.101000	0.15251|0.15251	-0.224000|-0.224000	0.09928|0.09928	-0.440000|-0.440000	0.05779|0.05779	CCG|TCC	SALL2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000165821		0.597	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL2	HGNC	protein_coding	OTTHUMT00000401242.1	84	0.00	0	G	NM_005407		21991732	21991732	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000546363	ensembl	human	putative	69_37n	missense	60	25.93	21	SNP	0.997	A
SAMD9L	219285	genome.wustl.edu	37	7	92763064	92763064	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr7:92763064G>A	ENST00000318238.4	-	5	3437	c.2221C>T	c.(2221-2223)Cat>Tat	p.H741Y	SAMD9L_ENST00000411955.1_Missense_Mutation_p.H741Y|SAMD9L_ENST00000437805.1_Missense_Mutation_p.H741Y	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	741					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CCTGGATGATGATAAAGATTG	0.363																																						dbGAP											0													107.0	105.0	106.0					7																	92763064		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2221C>T	7.37:g.92763064G>A	ENSP00000326247:p.His741Tyr		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,pfscan_SAM	p.H741Y	ENST00000318238.4	37	c.2221	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093078	0.76756	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.80994	-1.44;-1.44;-1.44	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.89107	0.6621	M	0.71036	2.16	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.90370	0.4380	10	0.87932	D	0	-17.3528	17.5752	0.87946	0.0:0.0:1.0:0.0	.	741	Q8IVG5	SAM9L_HUMAN	Y	741	ENSP00000326247:H741Y;ENSP00000405760:H741Y;ENSP00000408796:H741Y	ENSP00000326247:H741Y	H	-	1	0	SAMD9L	92601000	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.396000	0.66297	2.490000	0.84030	0.467000	0.42956	CAT	SAMD9L	-	NULL	ENSG00000177409		0.363	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1	101	0.98	1	G	NM_152703		92763064	92763064	-1	no_errors	ENST00000318238	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	A
SETD2	29072	genome.wustl.edu	37	3	47165587	47165587	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:47165587G>C	ENST00000409792.3	-	3	581	c.539C>G	c.(538-540)tCa>tGa	p.S180*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	180	Pro-rich.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TACAGTTGTTGATTCTGCTAT	0.552			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													656.0	589.0	609.0					3																	47165587		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.539C>G	3.37:g.47165587G>C	ENSP00000386759:p.Ser180*		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.S180*	ENST00000409792.3	37	c.539	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981402	0.74474	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.6751	0.56889	0.0:0.0:0.8356:0.1644	.	.	.	.	X	180;180;180;136	.	ENSP00000386759:S180X	S	-	2	0	SETD2	47140591	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.499000	0.66937	2.621000	0.88768	0.563000	0.77884	TCA	SETD2	-	NULL	ENSG00000181555		0.552	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	583	0.00	0	G	NM_014159		47165587	47165587	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	nonsense	365	16.67	73	SNP	0.856	C
SHISA7	729956	genome.wustl.edu	37	19	55948979	55948979	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:55948979C>T	ENST00000376325.4	-	3	968	c.969G>A	c.(967-969)aaG>aaA	p.K323K		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	323						integral component of membrane (GO:0016021)				skin(1)	1						CACCCAGCCTCTTGAGGGAAG	0.662																																						dbGAP											0													31.0	34.0	33.0					19																	55948979		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.969G>A	19.37:g.55948979C>T				Silent	SNP	NULL	p.K323	ENST00000376325.4	37	c.969	CCDS46193.1	19																																																																																			SHISA7	-	NULL	ENSG00000187902		0.662	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA7	HGNC	protein_coding	OTTHUMT00000334533.2	69	0.00	0	C	NM_001145176		55948979	55948979	-1	no_errors	ENST00000376325	ensembl	human	known	69_37n	silent	38	26.42	14	SNP	0.963	T
SIRPB2	284759	genome.wustl.edu	37	20	1460486	1460486	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr20:1460486C>T	ENST00000359801.3	-	2	346	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	SIRPB2_ENST00000537284.1_Intron|SIRPB2_ENST00000608747.1_Intron|SIRPB2_ENST00000444444.2_Intron	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	97	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.E203*(1)|p.E104*(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TTCAGTGGTTCTGATGTCCGT	0.453																																						dbGAP											2	Substitution - Nonsense(2)	large_intestine(2)											142.0	126.0	131.0					20																	1460486		1568	3582	5150	-	-	-	SO:0001583	missense	0			AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.310G>A	20.37:g.1460486C>T	ENSP00000352849:p.Glu104Lys		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E104K	ENST00000359801.3	37	c.310	CCDS42849.1	20	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747815	0.30955	.	.	ENSG00000196209	ENST00000359801	T	0.42131	0.98	4.13	4.13	0.48395	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.952302	0.08635	N	0.916503	T	0.38161	0.1030	N	0.17474	0.49	0.44214	D	0.997042	P	0.51449	0.945	P	0.54460	0.753	T	0.03684	-1.1013	10	0.07482	T	0.82	-24.4079	12.0631	0.53574	0.0:1.0:0.0:0.0	.	104	Q5JXA9	SIRB2_HUMAN	K	104	ENSP00000352849:E104K	ENSP00000352849:E104K	E	-	1	0	SIRPB2	1408486	0.001000	0.12720	0.020000	0.16555	0.853000	0.48598	0.747000	0.26290	2.312000	0.78011	0.655000	0.94253	GAA	SIRPB2	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000196209		0.453	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPB2	HGNC	protein_coding	OTTHUMT00000077544.1	159	0.00	0	C	NM_178459		1460486	1460486	-1	no_errors	ENST00000359801	ensembl	human	known	69_37n	missense	78	13.33	12	SNP	0.013	T
SLC8B1	80024	genome.wustl.edu	37	12	113754439	113754439	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:113754439G>A	ENST00000552014.1	-	11	1400	c.885C>T	c.(883-885)ttC>ttT	p.F295F	SLC8B1_ENST00000553238.1_5'UTR|SLC8B1_ENST00000546737.1_Silent_p.F239F|SLC8B1_ENST00000202831.3_Silent_p.F295F			Q6J4K2	NCKX6_HUMAN	solute carrier family 8 (sodium/lithium/calcium exchanger), member B1	295					cytosolic calcium ion homeostasis (GO:0051480)|glucose homeostasis (GO:0042593)|ion transport (GO:0006811)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of insulin secretion (GO:0050796)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial crista (GO:0030061)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)|calcium:sodium antiporter activity involved in regulation of cardiac muscle cell membrane potential (GO:0086038)|protein homodimerization activity (GO:0042803)										CCTGGTAGAAGAACAGCGGCC	0.592																																						dbGAP											0													152.0	153.0	153.0					12																	113754439		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025886	CCDS31909.1	12q24.13	2013-07-19	2013-07-19	2013-07-19	ENSG00000089060	ENSG00000089060		"""Solute carriers"""	26175	protein-coding gene	gene with protein product		609841	"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 6"", ""solute carrier family 24 (sodium/lithium/calcium exchanger), member 6"""	SLC24A6		14625281, 23506867	Standard	NM_024959		Approved	FLJ22233, NCKX6, NCLX	uc001tvc.3	Q6J4K2	OTTHUMG00000169566	ENST00000552014.1:c.885C>T	12.37:g.113754439G>A			A6NP50|Q4KMS9|Q6J4K1|Q9H6I8	Missense_Mutation	SNP	pfam_NaCa_Exmemb	p.S165F	ENST00000552014.1	37	c.494	CCDS31909.1	12																																																																																			SLC24A6	-	NULL	ENSG00000089060		0.592	SLC8B1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SLC24A6	HGNC	protein_coding	OTTHUMT00000404830.3	121	0.00	0	G	NM_024959		113754439	113754439	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000550672	ensembl	human	known	69_37n	missense	44	22.81	13	SNP	0.004	A
KHSRP	8570	genome.wustl.edu	37	19	6427163	6427163	+	5'Flank	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:6427163C>G	ENST00000398148.3	-	0	0				SLC25A41_ENST00000321510.6_Missense_Mutation_p.Q297H	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein						gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						AGCTGGCCATCTGGCCACAGG	0.647																																					Colon(55;593 1006 2067 9135 22980)	dbGAP											0													20.0	24.0	23.0					19																	6427163		2114	4224	6338	-	-	-	SO:0001631	upstream_gene_variant	0			U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945			19.37:g.6427163C>G	Exception_encountered		O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.Q297H	ENST00000398148.3	37	c.891	CCDS45936.1	19	.	.	.	.	.	.	.	.	.	.	C	18.41	3.617092	0.66672	.	.	ENSG00000181240	ENST00000321510	T	0.78707	-1.2	4.22	3.19	0.36642	Mitochondrial carrier domain (2);	.	.	.	.	D	0.85026	0.5603	M	0.66297	2.02	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85418	0.1141	9	0.87932	D	0	-28.1273	10.8578	0.46808	0.0:0.905:0.0:0.095	.	297	Q8N5S1	S2541_HUMAN	H	297	ENSP00000322649:Q297H	ENSP00000322649:Q297H	Q	-	3	2	SLC25A41	6378163	0.998000	0.40836	1.000000	0.80357	0.962000	0.63368	1.771000	0.38542	0.975000	0.38392	0.462000	0.41574	CAG	SLC25A41	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000181240		0.647	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A41	HGNC	protein_coding	OTTHUMT00000453305.1	23	0.00	0	C			6427163	6427163	-1	no_errors	ENST00000321510	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	G
SLC39A13	91252	genome.wustl.edu	37	11	47434989	47434989	+	Silent	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:47434989C>G	ENST00000362021.4	+	5	618	c.576C>G	c.(574-576)ctC>ctG	p.L192L	SLC39A13_ENST00000529740.1_3'UTR|SLC39A13_ENST00000533076.1_Silent_p.L192L|SLC39A13_ENST00000354884.4_Silent_p.L192L|SLC39A13_ENST00000524928.1_Silent_p.L192L	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	192					cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		CCGCCGCGCTCAATGGAGGCC	0.677																																						dbGAP											0													29.0	32.0	31.0					11																	47434989		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0				CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.576C>G	11.37:g.47434989C>G			D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Silent	SNP	pfam_ZIP	p.L192	ENST00000362021.4	37	c.576	CCDS44592.1	11																																																																																			SLC39A13	-	pfam_ZIP	ENSG00000165915		0.677	SLC39A13-012	KNOWN	basic|CCDS	protein_coding	SLC39A13	HGNC	protein_coding	OTTHUMT00000395652.1	73	0.00	0	C	NM_152264		47434989	47434989	+1	no_errors	ENST00000362021	ensembl	human	known	69_37n	silent	32	21.95	9	SNP	0.957	G
SLC6A7	6534	genome.wustl.edu	37	5	149576681	149576681	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:149576681C>G	ENST00000230671.2	+	4	797	c.426C>G	c.(424-426)ttC>ttG	p.F142L	SLC6A7_ENST00000524041.1_Missense_Mutation_p.F142L	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	142					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	ACGTGCTCTTCTACCTCTTCG	0.612																																						dbGAP											0													140.0	124.0	129.0					5																	149576681		2203	4300	6503	-	-	-	SO:0001583	missense	0			S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.426C>G	5.37:g.149576681C>G	ENSP00000230671:p.Phe142Leu		Q0VG81|Q52LU6	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.F142L	ENST00000230671.2	37	c.426	CCDS4305.1	5	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635138	0.87760	.	.	ENSG00000011083	ENST00000230671;ENST00000524041	T;T	0.76578	-1.03;-1.03	5.39	3.58	0.41010	.	0.050266	0.85682	D	0.000000	T	0.69557	0.3124	L	0.33093	0.98	0.54753	D	0.999987	B	0.24317	0.101	B	0.32533	0.147	T	0.69239	-0.5197	10	0.72032	D	0.01	.	10.6755	0.45783	0.1306:0.8002:0.0:0.0692	.	142	Q99884	SC6A7_HUMAN	L	142	ENSP00000230671:F142L;ENSP00000428200:F142L	ENSP00000230671:F142L	F	+	3	2	SLC6A7	149556874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.028000	0.57246	1.269000	0.44280	0.655000	0.94253	TTC	SLC6A7	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000011083		0.612	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A7	HGNC	protein_coding	OTTHUMT00000252325.1	126	0.00	0	C	NM_014228		149576681	149576681	+1	no_errors	ENST00000230671	ensembl	human	known	69_37n	missense	55	32.93	27	SNP	1.000	G
SLC8A1	6546	genome.wustl.edu	37	2	40655984	40655984	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:40655984G>C	ENST00000403092.1	-	2	1470	c.1437C>G	c.(1435-1437)atC>atG	p.I479M	SLC8A1_ENST00000405269.1_Missense_Mutation_p.I479M|SLC8A1_ENST00000402441.1_Missense_Mutation_p.I479M|SLC8A1_ENST00000406785.2_Missense_Mutation_p.I479M|SLC8A1_ENST00000408028.2_Missense_Mutation_p.I479M|SLC8A1_ENST00000332839.4_Missense_Mutation_p.I479M|SLC8A1_ENST00000406391.2_Missense_Mutation_p.I479M|SLC8A1_ENST00000542024.1_Missense_Mutation_p.I479M|SLC8A1_ENST00000542756.1_Missense_Mutation_p.I479M|SLC8A1_ENST00000405901.3_Missense_Mutation_p.I479M			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	479	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CATCATCTATGATACCCACTC	0.423																																						dbGAP											0													75.0	70.0	72.0					2																	40655984		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1437C>G	2.37:g.40655984G>C	ENSP00000384763:p.Ile479Met		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,pfscan_DnaJ_N,prints_Na_Ca_Ex,prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	p.I479M	ENST00000403092.1	37	c.1437	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	G	11.18	1.561950	0.27915	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02	6.17	4.29	0.51040	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.76278	0.3965	H	0.99286	4.5	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.988;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.97;0.996;0.999;0.998	T	0.81837	-0.0749	10	0.87932	D	0	.	8.3551	0.32324	0.2532:0.0:0.7468:0.0	.	479;479;479;479;479	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	M	479	ENSP00000383886:I479M;ENSP00000440727:I479M;ENSP00000384763:I479M;ENSP00000385678:I479M;ENSP00000385188:I479M;ENSP00000385535:I479M;ENSP00000332931:I479M;ENSP00000384908:I479M;ENSP00000385811:I479M;ENSP00000443515:I479M	ENSP00000332931:I479M	I	-	3	3	SLC8A1	40509488	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	1.265000	0.33027	1.534000	0.49203	-0.345000	0.07892	ATC	SLC8A1	-	pfam_Calx_beta,smart_Calx_beta,tigrfam_Na_Ca_Ex	ENSG00000183023		0.423	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	HGNC	protein_coding	OTTHUMT00000326065.1	68	0.00	0	G	NM_021097		40655984	40655984	-1	no_errors	ENST00000332839	ensembl	human	known	69_37n	missense	64	20.00	16	SNP	1.000	C
SLFN11	91607	genome.wustl.edu	37	17	33690742	33690742	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr17:33690742C>G	ENST00000394566.1	-	4	357	c.85G>C	c.(85-87)Gaa>Caa	p.E29Q	SLFN11_ENST00000308377.4_Missense_Mutation_p.E29Q	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	29					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTTCTGTTTTCTTCTCCAAGA	0.468																																						dbGAP											0													80.0	86.0	84.0					17																	33690742		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.85G>C	17.37:g.33690742C>G	ENSP00000378067:p.Glu29Gln		E1P643|Q8N3S8|Q8N762|Q8TEE0	Missense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.E29Q	ENST00000394566.1	37	c.85	CCDS11294.1	17	.	.	.	.	.	.	.	.	.	.	C	9.321	1.058120	0.19987	.	.	ENSG00000172716	ENST00000308377;ENST00000394566;ENST00000430814;ENST00000441608;ENST00000427966	T;T;T;T;T	0.24350	4.46;4.46;1.86;2.21;1.86	4.0	-3.53	0.04667	.	2.187460	0.02718	N	0.113667	T	0.19046	0.0457	L	0.46741	1.465	0.09310	N	1	P	0.35656	0.514	B	0.29716	0.106	T	0.19877	-1.0292	10	0.31617	T	0.26	.	5.6134	0.17418	0.0:0.1875:0.1654:0.6472	.	29	Q7Z7L1	SLN11_HUMAN	Q	29	ENSP00000312402:E29Q;ENSP00000378067:E29Q;ENSP00000397454:E29Q;ENSP00000393615:E29Q;ENSP00000395140:E29Q	ENSP00000312402:E29Q	E	-	1	0	SLFN11	30714855	0.000000	0.05858	0.020000	0.16555	0.003000	0.03518	-1.069000	0.03444	-0.447000	0.07138	-0.176000	0.13171	GAA	SLFN11	-	NULL	ENSG00000172716		0.468	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN11	HGNC	protein_coding	OTTHUMT00000256480.1	156	0.00	0	C	NM_152270		33690742	33690742	-1	no_errors	ENST00000308377	ensembl	human	known	69_37n	missense	46	23.33	14	SNP	0.191	G
SMCHD1	23347	genome.wustl.edu	37	18	2700630	2700630	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr18:2700630G>A	ENST00000320876.6	+	11	1774	c.1436G>A	c.(1435-1437)cGa>cAa	p.R479Q	SMCHD1_ENST00000261598.8_Missense_Mutation_p.R479Q|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	479			R -> P (in FSHD2; decreased protein level in fibroblasts as compared to wild type protein). {ECO:0000269|PubMed:23143600}.		chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TGGAATGGACGATTAATACCA	0.294																																						dbGAP											0													130.0	119.0	122.0					18																	2700630		1833	4090	5923	-	-	-	SO:0001583	missense	0			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.1436G>A	18.37:g.2700630G>A	ENSP00000326603:p.Arg479Gln		O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_ATPase-like_ATP-bd,smart_SMC_hinge	p.R479Q	ENST00000320876.6	37	c.1436	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	G	33	5.248351	0.95305	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.63255	-0.03;0.01	5.5	5.5	0.81552	.	.	.	.	.	T	0.78984	0.4370	M	0.68593	2.085	0.40354	D	0.97916	D	0.89917	1.0	D	0.79108	0.992	T	0.81118	-0.1078	9	0.87932	D	0	.	19.4004	0.94627	0.0:0.0:1.0:0.0	.	479	A6NHR9	SMHD1_HUMAN	Q	479	ENSP00000326603:R479Q;ENSP00000261598:R479Q	ENSP00000261598:R479Q	R	+	2	0	SMCHD1	2690630	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.054000	0.93866	2.577000	0.86979	0.655000	0.94253	CGA	SMCHD1	-	NULL	ENSG00000101596		0.294	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	467	0.00	0	G			2700630	2700630	+1	no_errors	ENST00000320876	ensembl	human	known	69_37n	missense	69	21.59	19	SNP	1.000	A
SMEK2	57223	genome.wustl.edu	37	2	55791554	55791554	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:55791554C>T	ENST00000345102.5	-	15	2456	c.2155G>A	c.(2155-2157)Gaa>Aaa	p.E719K	SNORA12_ENST00000390873.1_RNA|SMEK2_ENST00000272313.5_Missense_Mutation_p.E634K|SMEK2_ENST00000407823.3_Missense_Mutation_p.E687K	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	719	Poly-Glu.				positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCTTCATCTTCATTAAACCAC	0.363																																						dbGAP											0													163.0	147.0	152.0					2																	55791554		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.2155G>A	2.37:g.55791554C>T	ENSP00000339769:p.Glu719Lys		Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.E634K	ENST00000345102.5	37	c.1900	CCDS46289.1	2	.	.	.	.	.	.	.	.	.	.	C	17.13	3.310376	0.60414	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.47528	0.84;0.84;0.84	5.98	5.98	0.97165	.	0.194563	0.53938	D	0.000056	T	0.43456	0.1248	L	0.38953	1.18	0.58432	D	0.999999	B;B;B;B;B	0.33807	0.426;0.009;0.002;0.049;0.036	B;B;B;B;B	0.35727	0.209;0.013;0.012;0.024;0.063	T	0.14980	-1.0453	10	0.20046	T	0.44	-7.5749	20.4434	0.99119	0.0:1.0:0.0:0.0	.	687;719;634;719;146	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3;B4DKA9;Q5MIZ7-5	.;P4R3B_HUMAN;.;.;.	K	634;687;719	ENSP00000272313:E634K;ENSP00000385912:E687K;ENSP00000339769:E719K	ENSP00000272313:E634K	E	-	1	0	SMEK2	55645058	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	4.904000	0.63279	2.838000	0.97847	0.655000	0.94253	GAA	SMEK2	-	NULL	ENSG00000138041		0.363	SMEK2-002	NOVEL	basic|CCDS	protein_coding	SMEK2	HGNC	protein_coding	OTTHUMT00000251483.1	483	0.00	0	C	NM_020463		55791554	55791554	-1	no_errors	ENST00000272313	ensembl	human	known	69_37n	missense	180	13.40	28	SNP	1.000	T
SNCAIP	9627	genome.wustl.edu	37	5	121785558	121785558	+	Silent	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:121785558C>G	ENST00000261368.8	+	9	1873	c.1611C>G	c.(1609-1611)gtC>gtG	p.V537V	CTC-210G5.1_ENST00000506053.1_RNA|SNCAIP_ENST00000261367.7_Silent_p.V584V|SNCAIP_ENST00000414317.2_Silent_p.V139V|CTC-210G5.1_ENST00000503529.1_RNA|CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000542191.1_Silent_p.V95V|CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000379536.2_Silent_p.V477V|SNCAIP_ENST00000503116.2_3'UTR|CTC-210G5.1_ENST00000509993.1_RNA|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000379533.2_Silent_p.V584V|SNCAIP_ENST00000379538.3_Silent_p.V171V	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	537					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TAGAACGTGTCACGCTGCAGA	0.413																																						dbGAP											0													173.0	174.0	174.0					5																	121785558		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1611C>G	5.37:g.121785558C>G			D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V584	ENST00000261368.8	37	c.1752	CCDS4131.1	5																																																																																			SNCAIP	-	NULL	ENSG00000064692		0.413	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	222	0.00	0	C			121785558	121785558	+1	no_errors	ENST00000379533	ensembl	human	known	69_37n	silent	86	22.52	25	SNP	1.000	G
SOS1	6654	genome.wustl.edu	37	2	39214691	39214691	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:39214691C>T	ENST00000426016.1	-	23	3519	c.3433G>A	c.(3433-3435)Gat>Aat	p.D1145N	SOS1_ENST00000402219.2_Missense_Mutation_p.D1145N|SOS1_ENST00000395038.2_Missense_Mutation_p.D1130N			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	1145					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				GGCACTTCATCAGTGCCTTTG	0.398									Noonan syndrome																													dbGAP											0													53.0	53.0	53.0					2																	39214691		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.3433G>A	2.37:g.39214691C>T	ENSP00000387784:p.Asp1145Asn		A8K2G3|B4DXG2	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.D1145N	ENST00000426016.1	37	c.3433	CCDS1802.1	2	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573359	0.65765	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038	T;T;T	0.76578	-0.96;-0.96;-1.03	5.72	5.72	0.89469	.	0.156383	0.56097	D	0.000032	T	0.75228	0.3821	L	0.50333	1.59	0.80722	D	1	B	0.20780	0.048	B	0.24394	0.053	T	0.67941	-0.5540	10	0.25751	T	0.34	.	19.8607	0.96783	0.0:1.0:0.0:0.0	.	1145	Q07889	SOS1_HUMAN	N	1145;1145;862;1130	ENSP00000387784:D1145N;ENSP00000384675:D1145N;ENSP00000378479:D1130N	ENSP00000378479:D1130N	D	-	1	0	SOS1	39068195	1.000000	0.71417	0.896000	0.35187	0.697000	0.40408	6.714000	0.74692	2.850000	0.98022	0.650000	0.86243	GAT	SOS1	-	NULL	ENSG00000115904		0.398	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SOS1	HGNC	protein_coding	OTTHUMT00000219948.3	175	0.00	0	C	NM_005633		39214691	39214691	-1	no_errors	ENST00000402219	ensembl	human	known	69_37n	missense	80	11.11	10	SNP	1.000	T
SOX3	6658	genome.wustl.edu	37	X	139586809	139586809	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:139586809C>T	ENST00000370536.2	-	1	416	c.417G>A	c.(415-417)gtG>gtA	p.V139V		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	139					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					TGGGCCGTTTCACACGGTCCT	0.652																																						dbGAP											0													34.0	34.0	34.0					X																	139586809		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.417G>A	X.37:g.139586809C>T			P35714|Q5JWI3|Q9NP49	Silent	SNP	pfam_HMG_superfamily,pfam_TF_SOX,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.V139	ENST00000370536.2	37	c.417	CCDS14669.1	X																																																																																			SOX3	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000134595		0.652	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	HGNC	protein_coding	OTTHUMT00000058577.1	56	0.00	0	C			139586809	139586809	-1	no_errors	ENST00000370536	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	0.994	T
SOX9	6662	genome.wustl.edu	37	17	70120527	70120527	+	Nonstop_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr17:70120527G>C	ENST00000245479.2	+	3	1901	c.1529G>C	c.(1528-1530)tGa>tCa	p.*510S		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	0					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			ACTCGACCTTGAGGAGGCCTC	0.552																																					Pancreas(42;83 1041 2320 35205 39456)	dbGAP											0													44.0	45.0	45.0					17																	70120527		2203	4298	6501	-	-	-	SO:0001578	stop_lost	0			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.1529G>C	17.37:g.70120527G>C	ENSP00000245479:p.*510Serext*49		Q53Y80	Nonstop_Mutation	SNP	pfam_Sox_N,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.*510S	ENST00000245479.2	37	c.1529	CCDS11689.1	17	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455294	0.26161	.	.	ENSG00000125398	ENST00000245479;ENST00000455872	.	.	.	4.59	2.16	0.27623	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.7543	0.23505	0.322:0.0:0.678:0.0	.	.	.	.	S	510;446	.	.	X	+	2	2	SOX9	67632122	1.000000	0.71417	0.995000	0.50966	0.783000	0.44284	1.987000	0.40687	1.070000	0.40811	0.462000	0.41574	TGA	SOX9	-	NULL	ENSG00000125398		0.552	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX9	HGNC	protein_coding	OTTHUMT00000389032.1	44	0.00	0	G	NM_000346		70120527	70120527	+1	no_errors	ENST00000245479	ensembl	human	known	69_37n	nonstop	35	32.69	17	SNP	1.000	C
SPEN	23013	genome.wustl.edu	37	1	16260482	16260482	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:16260482G>T	ENST00000375759.3	+	11	7951	c.7747G>T	c.(7747-7749)Gaa>Taa	p.E2583*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2583	RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAAGCCTTTAGAAGAAAAAAC	0.537																																						dbGAP											0													67.0	76.0	73.0					1																	16260482		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7747G>T	1.37:g.16260482G>T	ENSP00000364912:p.Glu2583*		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.E2583*	ENST00000375759.3	37	c.7747	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	45	12.059961	0.99632	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.38	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-23.1448	15.1613	0.72788	0.0:0.0:0.8479:0.1521	.	.	.	.	X	2583	.	ENSP00000364912:E2583X	E	+	1	0	SPEN	16133069	1.000000	0.71417	0.135000	0.22099	0.018000	0.09664	6.888000	0.75622	1.231000	0.43661	-0.397000	0.06425	GAA	SPEN	-	NULL	ENSG00000065526		0.537	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	43	0.00	0	G	NM_015001		16260482	16260482	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	nonsense	32	20.00	8	SNP	0.915	T
SPHK2	56848	genome.wustl.edu	37	19	49132338	49132338	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:49132338C>T	ENST00000245222.4	+	7	1639	c.1273C>T	c.(1273-1275)Ctt>Ttt	p.L425F	SPHK2_ENST00000340932.3_Missense_Mutation_p.L387F|SPHK2_ENST00000599748.1_Missense_Mutation_p.L389F|SPHK2_ENST00000600537.1_Missense_Mutation_p.L366F|SPHK2_ENST00000443164.1_Missense_Mutation_p.L487F|SPHK2_ENST00000599029.1_Missense_Mutation_p.L389F|SPHK2_ENST00000598088.1_Missense_Mutation_p.L425F	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	425					blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)	p.L425V(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		tgacctgcctcttcccctgcc	0.687																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											22.0	24.0	23.0					19																	49132338		2201	4293	6494	-	-	-	SO:0001583	missense	0			AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.1273C>T	19.37:g.49132338C>T	ENSP00000245222:p.Leu425Phe		A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.L487F	ENST00000245222.4	37	c.1459	CCDS12727.1	19	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913881	0.52439	.	.	ENSG00000063176	ENST00000245222;ENST00000406269;ENST00000340932;ENST00000443164	T;T;T	0.27557	2.03;1.78;1.66	4.37	3.33	0.38152	.	0.454339	0.19384	N	0.115595	T	0.26774	0.0655	N	0.08118	0	0.37330	D	0.909929	D;D;D	0.65815	0.995;0.985;0.985	P;P;P	0.59221	0.854;0.767;0.767	T	0.20739	-1.0266	10	0.49607	T	0.09	-34.5853	8.3428	0.32254	0.0:0.8905:0.0:0.1095	.	366;487;425	B4DU87;A0T4C8;Q9NRA0	.;.;SPHK2_HUMAN	F	425;398;387;487	ENSP00000245222:L425F;ENSP00000341091:L387F;ENSP00000413369:L487F	ENSP00000245222:L425F	L	+	1	0	SPHK2	53824150	0.983000	0.35010	0.993000	0.49108	0.382000	0.30200	3.078000	0.50096	1.199000	0.43173	0.655000	0.94253	CTT	SPHK2	-	NULL	ENSG00000063176		0.687	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHK2	HGNC	protein_coding	OTTHUMT00000466153.1	48	0.00	0	C			49132338	49132338	+1	no_errors	ENST00000443164	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.998	T
SPIN1	10927	genome.wustl.edu	37	9	91090081	91090081	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:91090081G>A	ENST00000375859.3	+	6	956	c.678G>A	c.(676-678)tcG>tcA	p.S226S	SPIN1_ENST00000541629.1_Silent_p.S226S|SPIN1_ENST00000469017.2_3'UTR	NM_006717.2	NP_006708.2	Q9Y657	SPIN1_HUMAN	spindlin 1	226	Tudor-like domain 3.				chromatin modification (GO:0016568)|gamete generation (GO:0007276)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of Wnt signaling pathway (GO:0030177)|rRNA transcription (GO:0009303)|Wnt signaling pathway (GO:0016055)	nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle (GO:0005819)	methylated histone binding (GO:0035064)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						AAGATGGCTCGAAAAGGACTG	0.418																																						dbGAP											0													87.0	90.0	89.0					9																	91090081		2184	4298	6482	-	-	-	SO:0001819	synonymous_variant	0			AF317228	CCDS43843.1	9q22.1	2008-02-05	2007-01-03	2007-01-03	ENSG00000106723	ENSG00000106723			11243	protein-coding gene	gene with protein product		609936	"""spindlin"""	SPIN		16098913	Standard	NM_006717		Approved		uc004apy.3	Q9Y657	OTTHUMG00000020168	ENST00000375859.3:c.678G>A	9.37:g.91090081G>A			A8K0X6|B3KRQ4|Q7KZJ8|Q9GZT2|Q9H0N7	Silent	SNP	pfam_Spin_Ssty	p.S226	ENST00000375859.3	37	c.678	CCDS43843.1	9																																																																																			SPIN1	-	pfam_Spin_Ssty	ENSG00000106723		0.418	SPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN1	HGNC	protein_coding	OTTHUMT00000052967.1	99	0.00	0	G	NM_006717		91090081	91090081	+1	no_errors	ENST00000375859	ensembl	human	known	69_37n	silent	57	12.31	8	SNP	0.006	A
SSTR3	6753	genome.wustl.edu	37	22	37602828	37602828	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr22:37602828C>T	ENST00000328544.3	-	2	1548	c.1015G>A	c.(1015-1017)Gag>Aag	p.E339K	SSTR3_ENST00000402501.1_Missense_Mutation_p.E339K	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	339					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	ACAGTGGGCTCCTGGCTGCGC	0.662																																						dbGAP											0													28.0	34.0	32.0					22																	37602828		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.1015G>A	22.37:g.37602828C>T	ENSP00000330138:p.Glu339Lys		A8K550|Q53ZR7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_Somatstn_rcpt_3,prints_7TM_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Somatstn_rcpt_5,prints_Neuropept_W_rcpt	p.E339K	ENST00000328544.3	37	c.1015	CCDS13944.1	22	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123619	0.56613	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.37915	1.17;1.17	5.42	4.41	0.53225	.	1.018690	0.07817	N	0.959190	T	0.49406	0.1555	M	0.68952	2.095	0.49051	D	0.999749	D	0.58620	0.983	P	0.53401	0.725	T	0.28396	-1.0045	10	0.15499	T	0.54	.	12.5013	0.55957	0.0:0.9225:0.0:0.0775	.	339	P32745	SSR3_HUMAN	K	339	ENSP00000330138:E339K;ENSP00000384904:E339K	ENSP00000330138:E339K	E	-	1	0	SSTR3	35932774	1.000000	0.71417	1.000000	0.80357	0.041000	0.13682	5.779000	0.68948	1.281000	0.44480	-0.140000	0.14226	GAG	SSTR3	-	prints_Somatstn_rcpt_3	ENSG00000183473		0.662	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR3	HGNC	protein_coding	OTTHUMT00000318802.1	36	0.00	0	C			37602828	37602828	-1	no_errors	ENST00000328544	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	1.000	T
STK17B	9262	genome.wustl.edu	37	2	197010664	197010664	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:197010664G>A	ENST00000263955.4	-	4	737	c.451C>T	c.(451-453)Cag>Tag	p.Q151*	STK17B_ENST00000409228.1_Nonsense_Mutation_p.Q151*	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	151	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			ATGTTATTCTGATGTAGATAA	0.333																																						dbGAP											0													86.0	78.0	81.0					2																	197010664		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.451C>T	2.37:g.197010664G>A	ENSP00000263955:p.Gln151*			Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q151*	ENST00000263955.4	37	c.451	CCDS2315.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.348958	0.97494	.	.	ENSG00000081320	ENST00000263955;ENST00000409228	.	.	.	4.99	4.99	0.66335	.	0.143217	0.32028	N	0.006693	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	15.5103	0.75776	0.0:0.1481:0.8519:0.0	.	.	.	.	X	151	.	ENSP00000263955:Q151X	Q	-	1	0	STK17B	196718909	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.547000	0.67249	2.767000	0.95098	0.655000	0.94253	CAG	STK17B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000081320		0.333	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17B	HGNC	protein_coding	OTTHUMT00000256092.2	156	0.00	0	G			197010664	197010664	-1	no_errors	ENST00000263955	ensembl	human	known	69_37n	nonsense	77	13.48	12	SNP	1.000	A
STX3	6809	genome.wustl.edu	37	11	59554516	59554516	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:59554516G>A	ENST00000337979.4	+	3	668	c.121G>A	c.(121-123)Gaa>Aaa	p.E41K	STX3_ENST00000529177.1_Missense_Mutation_p.E41K|STX3_ENST00000300150.7_Missense_Mutation_p.E10K|STX3_ENST00000437946.2_Intron|STX3_ENST00000535361.1_Missense_Mutation_p.E41K	NM_001178040.1|NM_004177.4	NP_001171511.1|NP_004168.1	Q13277	STX3_HUMAN	syntaxin 3	41					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|long-term synaptic potentiation (GO:0060291)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|neurotransmitter transport (GO:0006836)	apical plasma membrane (GO:0016324)|azurophil granule (GO:0042582)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|vacuole (GO:0005773)	arachidonic acid binding (GO:0050544)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|skin(1)	13						ATAGATTGAGGAAACTCGGCT	0.438																																						dbGAP											0													140.0	125.0	130.0					11																	59554516		2201	4295	6496	-	-	-	SO:0001583	missense	0			AJ002076	CCDS7975.1, CCDS53637.1	11q12.1	2008-02-05	2006-04-25	2006-04-25	ENSG00000166900	ENSG00000166900			11438	protein-coding gene	gene with protein product		600876	"""syntaxin 3A"""	STX3A		16598260, 16339081	Standard	NM_004177		Approved		uc001nog.3	Q13277	OTTHUMG00000167353	ENST00000337979.4:c.121G>A	11.37:g.59554516G>A	ENSP00000338562:p.Glu41Lys		B4DME0|O43750|O43751|Q15360	Missense_Mutation	SNP	pfam_Syntaxin_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.E41K	ENST00000337979.4	37	c.121	CCDS7975.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.414987	0.96092	.	.	ENSG00000166900	ENST00000300150;ENST00000337979;ENST00000535361;ENST00000529177	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.01	5.01	0.66863	t-SNARE (1);Syntaxin, N-terminal (2);	0.147702	0.64402	D	0.000012	T	0.48447	0.1500	M	0.78049	2.395	0.80722	D	1	P;P	0.52316	0.917;0.952	P;P	0.57204	0.655;0.815	T	0.53337	-0.8453	10	0.62326	D	0.03	-24.2273	16.9086	0.86134	0.0:0.0:1.0:0.0	.	41;41	B4DME0;Q13277	.;STX3_HUMAN	K	10;41;41;41	ENSP00000300150:E10K;ENSP00000338562:E41K;ENSP00000441649:E41K;ENSP00000433248:E41K	ENSP00000300150:E10K	E	+	1	0	STX3	59311092	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.619000	0.90938	2.312000	0.78011	0.650000	0.86243	GAA	STX3	-	pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N	ENSG00000166900		0.438	STX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX3	HGNC	protein_coding	OTTHUMT00000394264.1	211	0.00	0	G	NM_004177		59554516	59554516	+1	no_errors	ENST00000337979	ensembl	human	known	69_37n	missense	55	14.06	9	SNP	1.000	A
STX3	6809	genome.wustl.edu	37	11	59554572	59554572	+	Silent	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:59554572C>G	ENST00000337979.4	+	3	724	c.177C>G	c.(175-177)ctC>ctG	p.L59L	STX3_ENST00000529177.1_Silent_p.L59L|STX3_ENST00000300150.7_Silent_p.L28L|STX3_ENST00000437946.2_Intron|STX3_ENST00000535361.1_Silent_p.L59L	NM_001178040.1|NM_004177.4	NP_001171511.1|NP_004168.1	Q13277	STX3_HUMAN	syntaxin 3	59					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|long-term synaptic potentiation (GO:0060291)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|neurotransmitter transport (GO:0006836)	apical plasma membrane (GO:0016324)|azurophil granule (GO:0042582)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|vacuole (GO:0005773)	arachidonic acid binding (GO:0050544)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|skin(1)	13						CTAAGAAACTCTACAGTATCA	0.423																																						dbGAP											0													160.0	142.0	148.0					11																	59554572		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AJ002076	CCDS7975.1, CCDS53637.1	11q12.1	2008-02-05	2006-04-25	2006-04-25	ENSG00000166900	ENSG00000166900			11438	protein-coding gene	gene with protein product		600876	"""syntaxin 3A"""	STX3A		16598260, 16339081	Standard	NM_004177		Approved		uc001nog.3	Q13277	OTTHUMG00000167353	ENST00000337979.4:c.177C>G	11.37:g.59554572C>G			B4DME0|O43750|O43751|Q15360	Silent	SNP	pfam_Syntaxin_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.L59	ENST00000337979.4	37	c.177	CCDS7975.1	11																																																																																			STX3	-	pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N	ENSG00000166900		0.423	STX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX3	HGNC	protein_coding	OTTHUMT00000394264.1	221	0.00	0	C	NM_004177		59554572	59554572	+1	no_errors	ENST00000337979	ensembl	human	known	69_37n	silent	61	25.61	21	SNP	0.953	G
SYCP2	10388	genome.wustl.edu	37	20	58441426	58441426	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr20:58441426G>C	ENST00000357552.3	-	41	4467	c.4242C>G	c.(4240-4242)ttC>ttG	p.F1414L	SYCP2_ENST00000371001.2_Missense_Mutation_p.F1414L			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1414					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TAATGAATTGGAATTTATCAA	0.249																																						dbGAP											0													32.0	36.0	35.0					20																	58441426		2134	4240	6374	-	-	-	SO:0001583	missense	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.4242C>G	20.37:g.58441426G>C	ENSP00000350162:p.Phe1414Leu		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.F1414L	ENST00000357552.3	37	c.4242	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106182	0.37145	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000412613	T;T	0.21191	2.02;2.02	5.3	2.26	0.28386	.	0.179859	0.39759	N	0.001280	T	0.21186	0.0510	M	0.64997	1.995	0.32076	N	0.593746	B	0.19073	0.033	B	0.19946	0.027	T	0.16630	-1.0396	10	0.72032	D	0.01	-5.0612	8.4962	0.33130	0.319:0.0:0.681:0.0	.	1414	Q9BX26	SYCP2_HUMAN	L	1414;1414;100	ENSP00000360040:F1414L;ENSP00000350162:F1414L	ENSP00000350162:F1414L	F	-	3	2	SYCP2	57874821	1.000000	0.71417	0.945000	0.38365	0.969000	0.65631	2.585000	0.46111	0.725000	0.32318	0.557000	0.71058	TTC	SYCP2	-	NULL	ENSG00000196074		0.249	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	84	0.00	0	G	NM_014258		58441426	58441426	-1	no_errors	ENST00000357552	ensembl	human	known	69_37n	missense	84	10.53	10	SNP	0.981	C
SYNE2	23224	genome.wustl.edu	37	14	64496655	64496655	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:64496655T>A	ENST00000344113.4	+	44	6969	c.6757T>A	c.(6757-6759)Tca>Aca	p.S2253T	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.S2253T|SYNE2_ENST00000358025.3_Missense_Mutation_p.S2253T	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2253					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGAACATGATTCATACCAGGT	0.383																																						dbGAP											0													88.0	84.0	85.0					14																	64496655		1830	4092	5922	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6757T>A	14.37:g.64496655T>A	ENSP00000341781:p.Ser2253Thr		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S2253T	ENST00000344113.4	37	c.6757	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	T	4.341	0.062657	0.08388	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.34859	1.34;1.34;1.34	5.24	1.41	0.22369	.	0.732164	0.11988	N	0.510132	T	0.19725	0.0474	L	0.27053	0.805	0.18873	N	0.999989	B;B	0.09022	0.001;0.002	B;B	0.12156	0.003;0.007	T	0.27226	-1.0080	10	0.16896	T	0.51	.	3.0379	0.06128	0.3873:0.1387:0.0:0.474	.	2253;2253	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	T	2253	ENSP00000350719:S2253T;ENSP00000341781:S2253T;ENSP00000452570:S2253T	ENSP00000261678:S2253T	S	+	1	0	SYNE2	63566408	0.000000	0.05858	0.180000	0.23079	0.208000	0.24298	0.210000	0.17455	0.330000	0.23485	0.533000	0.62120	TCA	SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.383	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	273	0.36	1	T	NM_182914		64496655	64496655	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	110	19.12	26	SNP	0.082	A
SYNE2	23224	genome.wustl.edu	37	14	64630264	64630264	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr14:64630264G>A	ENST00000344113.4	+	89	16656	c.16444G>A	c.(16444-16446)Gaa>Aaa	p.E5482K	SYNE2_ENST00000357395.3_Missense_Mutation_p.E1867K|SYNE2_ENST00000554584.1_Missense_Mutation_p.E5399K|SYNE2_ENST00000358025.3_Missense_Mutation_p.E5482K|SYNE2_ENST00000555002.1_Missense_Mutation_p.E2116K|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000394768.2_Missense_Mutation_p.E1867K	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5482					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGCTTATTTGGAAAAGATGCT	0.478																																						dbGAP											0													58.0	58.0	58.0					14																	64630264		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16444G>A	14.37:g.64630264G>A	ENSP00000341781:p.Glu5482Lys		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E5482K	ENST00000344113.4	37	c.16444	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	31	5.085573	0.94100	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.60040	0.64;3.93;0.63;0.22;3.98;3.93	6.08	5.16	0.70880	.	0.103746	0.41823	D	0.000813	T	0.70159	0.3192	M	0.76328	2.33	0.80722	D	1	P;D;B;P	0.57571	0.712;0.98;0.201;0.903	P;P;B;P	0.55391	0.621;0.762;0.056;0.775	T	0.70249	-0.4924	10	0.44086	T	0.13	.	15.8815	0.79207	0.0:0.1338:0.8662:0.0	.	1867;5399;5482;5482	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	K	5482;1867;5482;5399;5405;2116;1867	ENSP00000350719:E5482K;ENSP00000349969:E1867K;ENSP00000341781:E5482K;ENSP00000452570:E5399K;ENSP00000450831:E2116K;ENSP00000378249:E1867K	ENSP00000261678:E5405K	E	+	1	0	SYNE2	63700017	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.268000	0.58883	2.890000	0.99128	0.655000	0.94253	GAA	SYNE2	-	NULL	ENSG00000054654		0.478	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	142	0.00	0	G	NM_182914		64630264	64630264	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	76	26.21	27	SNP	1.000	A
TBC1D15	64786	genome.wustl.edu	37	12	72307641	72307641	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:72307641C>G	ENST00000550746.1	+	13	1451	c.1387C>G	c.(1387-1389)Ctt>Gtt	p.L463V	TBC1D15_ENST00000393309.3_Missense_Mutation_p.L217V|TBC1D15_ENST00000485960.2_Missense_Mutation_p.L446V|TBC1D15_ENST00000319106.8_Missense_Mutation_p.L454V|TBC1D15_ENST00000548679.1_3'UTR	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	463	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACTTTCCCCTCTTTTATATGT	0.353																																						dbGAP											0													134.0	139.0	137.0					12																	72307641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.1387C>G	12.37:g.72307641C>G	ENSP00000448182:p.Leu463Val		B4DMT9|B9A6L6|J3KNI9|Q9HA83	Missense_Mutation	SNP	pfam_DUF3548,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.L463V	ENST00000550746.1	37	c.1387	CCDS31858.1	12	.	.	.	.	.	.	.	.	.	.	C	9.727	1.161297	0.21538	.	.	ENSG00000121749	ENST00000550746;ENST00000319106;ENST00000485960;ENST00000393309	T;T;T;T	0.10573	2.86;2.86;2.86;2.86	5.77	3.83	0.44106	Rab-GAP/TBC domain (4);	0.131818	0.52532	D	0.000068	T	0.12263	0.0298	L	0.58583	1.82	0.40497	D	0.980603	B;B;B	0.11235	0.004;0.0;0.001	B;B;B	0.12156	0.007;0.001;0.002	T	0.04593	-1.0940	10	0.38643	T	0.18	-10.8191	10.7552	0.46232	0.1203:0.4279:0.4518:0.0	.	454;446;463	E9PH93;Q8TC07-2;Q8TC07	.;.;TBC15_HUMAN	V	463;454;446;217	ENSP00000448182:L463V;ENSP00000318262:L454V;ENSP00000420678:L446V;ENSP00000376986:L217V	ENSP00000318262:L454V	L	+	1	0	TBC1D15	70593908	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.186000	0.42593	1.425000	0.47237	0.557000	0.71058	CTT	TBC1D15	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000121749		0.353	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	TBC1D15	HGNC	protein_coding	OTTHUMT00000351266.2	290	0.00	0	C	NM_022771		72307641	72307641	+1	no_errors	ENST00000550746	ensembl	human	known	69_37n	missense	116	10.00	13	SNP	1.000	G
TBCC	6903	genome.wustl.edu	37	6	42713653	42713653	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:42713653C>G	ENST00000372876.1	-	1	181	c.159G>C	c.(157-159)gaG>gaC	p.E53D	TBCC_ENST00000244625.2_Missense_Mutation_p.E53D	NM_003192.2	NP_003183	Q15814	TBCC_HUMAN	tubulin folding cofactor C	53					'de novo' posttranslational protein folding (GO:0051084)|cell morphogenesis (GO:0000902)|cellular protein metabolic process (GO:0044267)|GTP catabolic process (GO:0006184)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)	chaperone binding (GO:0051087)|GTPase activity (GO:0003924)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(3)	14	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			TGTTCTCCTTCTCTACCTCCT	0.612																																						dbGAP											0													86.0	78.0	81.0					6																	42713653		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61234	CCDS4872.1	6p21.1	2008-02-05	2006-11-21		ENSG00000124659	ENSG00000124659			11580	protein-coding gene	gene with protein product		602971	"""tubulin-specific chaperone c"""			8706133, 11847227	Standard	NM_003192		Approved	CFC	uc003osl.3	Q15814	OTTHUMG00000014704	ENST00000372876.1:c.159G>C	6.37:g.42713653C>G	ENSP00000361967:p.Glu53Asp		Q53Y43|Q5T787	Missense_Mutation	SNP	pfam_Tubulin-bd_cofactor_C,smart_CARP_motif	p.E53D	ENST00000372876.1	37	c.159	CCDS4872.1	6	.	.	.	.	.	.	.	.	.	.	C	5.120	0.207696	0.09704	.	.	ENSG00000124659	ENST00000372876;ENST00000244625	T;T	0.15952	2.38;2.38	5.03	1.85	0.25348	.	0.808768	0.11587	N	0.549108	T	0.07683	0.0193	M	0.72894	2.215	0.35260	D	0.779517	B	0.24675	0.109	B	0.24155	0.051	T	0.18713	-1.0328	10	0.17369	T	0.5	-0.6701	10.1796	0.42959	0.0:0.7846:0.0:0.2154	.	53	Q15814	TBCC_HUMAN	D	53	ENSP00000361967:E53D;ENSP00000244625:E53D	ENSP00000244625:E53D	E	-	3	2	TBCC	42821631	0.695000	0.27747	0.998000	0.56505	0.044000	0.14063	0.019000	0.13444	0.086000	0.17137	0.557000	0.71058	GAG	TBCC	-	NULL	ENSG00000124659		0.612	TBCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCC	HGNC	protein_coding	OTTHUMT00000040559.1	84	0.00	0	C	NM_003192		42713653	42713653	-1	no_errors	ENST00000244625	ensembl	human	known	69_37n	missense	72	17.24	15	SNP	0.993	G
TCF21	6943	genome.wustl.edu	37	6	134212887	134212887	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:134212887G>A	ENST00000367882.4	+	2	747	c.487G>A	c.(487-489)Gac>Aac	p.D163N	RP3-323P13.2_ENST00000607033.1_RNA|RP3-323P13.2_ENST00000607573.1_RNA|RP3-323P13.2_ENST00000607641.1_RNA|TCF21_ENST00000237316.3_Missense_Mutation_p.D163N|RP3-323P13.2_ENST00000606544.1_RNA	NM_003206.3	NP_003197.2	O43680	TCF21_HUMAN	transcription factor 21	163					branching involved in ureteric bud morphogenesis (GO:0001658)|branchiomeric skeletal muscle development (GO:0014707)|bronchiole development (GO:0060435)|diaphragm development (GO:0060539)|embryonic digestive tract morphogenesis (GO:0048557)|epithelial cell differentiation (GO:0030855)|gland development (GO:0048732)|glomerulus development (GO:0032835)|kidney development (GO:0001822)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|metanephric glomerular capillary formation (GO:0072277)|metanephric mesenchymal cell differentiation (GO:0072162)|morphogenesis of a branching structure (GO:0001763)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reproductive structure development (GO:0048608)|respiratory system development (GO:0060541)|Sertoli cell differentiation (GO:0060008)|sex determination (GO:0007530)|spleen development (GO:0048536)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	13	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		ACCCGAGAGTGACCTGAAAGA	0.662																																						dbGAP											0													49.0	51.0	50.0					6																	134212887		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047419	CCDS5167.1	6q23.2	2014-09-17			ENSG00000118526	ENSG00000118526		"""Basic helix-loop-helix proteins"""	11632	protein-coding gene	gene with protein product		603306				9507058	Standard	NM_198392		Approved	POD1, bHLHa23	uc003qei.4	O43680	OTTHUMG00000015608	ENST00000367882.4:c.487G>A	6.37:g.134212887G>A	ENSP00000356857:p.Asp163Asn		E1P581|O43545|Q6ICV0|Q9BZ14	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D163N	ENST00000367882.4	37	c.487	CCDS5167.1	6	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447376	0.84101	.	.	ENSG00000118526	ENST00000367882;ENST00000237316	D;D	0.96992	-4.2;-4.2	5.63	5.63	0.86233	.	0.050332	0.85682	D	0.000000	D	0.91270	0.7248	L	0.29908	0.895	0.80722	D	1	B	0.25235	0.121	B	0.23419	0.046	D	0.87665	0.2537	10	0.40728	T	0.16	-13.7431	19.6736	0.95921	0.0:0.0:1.0:0.0	.	163	O43680	TCF21_HUMAN	N	163	ENSP00000356857:D163N;ENSP00000237316:D163N	ENSP00000237316:D163N	D	+	1	0	TCF21	134254580	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	2.660000	0.90430	0.650000	0.86243	GAC	TCF21	-	NULL	ENSG00000118526		0.662	TCF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF21	HGNC	protein_coding	OTTHUMT00000042292.1	94	0.00	0	G	NM_198392		134212887	134212887	+1	no_errors	ENST00000237316	ensembl	human	known	69_37n	missense	62	19.48	15	SNP	1.000	A
TET2	54790	genome.wustl.edu	37	4	106196474	106196474	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:106196474C>T	ENST00000540549.1	+	11	5667	c.4807C>T	c.(4807-4809)Caa>Taa	p.Q1603*	TET2_ENST00000380013.4_Nonsense_Mutation_p.Q1603*|TET2_ENST00000513237.1_Nonsense_Mutation_p.Q1624*|TET2_ENST00000545826.1_3'UTR			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1603					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.Q1603*(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CACCTCATCTCAAGCTGCAGG	0.418			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)											93.0	72.0	78.0					4																	106196474		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.4807C>T	4.37:g.106196474C>T	ENSP00000442788:p.Gln1603*		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	NULL	p.Q1603*	ENST00000540549.1	37	c.4807	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	C	49	15.523164	0.99836	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-5.1932	17.1586	0.86798	0.0:1.0:0.0:0.0	.	.	.	.	X	1603;1624;1603	.	ENSP00000369351:Q1603X	Q	+	1	0	TET2	106415923	1.000000	0.71417	0.664000	0.29753	0.832000	0.47134	5.140000	0.64807	2.469000	0.83416	0.491000	0.48974	CAA	TET2	-	NULL	ENSG00000168769		0.418	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	140	0.00	0	C	NM_017628		106196474	106196474	+1	no_errors	ENST00000380013	ensembl	human	known	69_37n	nonsense	71	20.22	18	SNP	0.997	T
TGS1	96764	genome.wustl.edu	37	8	56699009	56699010	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr8:56699009_56699010insCA	ENST00000260129.5	+	4	1029_1030	c.552_553insCA	c.(553-555)gaafs	p.E185fs		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	185					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			ATCCTCCAGTTGAAAACACATT	0.356																																					Esophageal Squamous(34;275 823 4842 34837 48447)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	Exception_encountered	8.37:g.56699009_56699010insCA	ENSP00000260129:p.Glu185fs		A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Frame_Shift_Ins	INS	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.E184fs	ENST00000260129.5	37	c.552_553	CCDS34894.1	8																																																																																			TGS1	-	NULL	ENSG00000137574		0.356	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	119	0.00	0	-	NM_024831		56699009	56699010	+1	no_errors	ENST00000260129	ensembl	human	known	69_37n	frame_shift_ins	69	16.87	14	INS	0.131:0.995	CA
TLE6	79816	genome.wustl.edu	37	19	2987056	2987056	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:2987056G>C	ENST00000246112.4	+	7	562	c.361G>C	c.(361-363)Gag>Cag	p.E121Q	TLE6_ENST00000452088.1_5'UTR|TLE6_ENST00000478073.2_3'UTR	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	121					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCGAGCTTTGAGGACATCAT	0.637																																						dbGAP											0													54.0	55.0	55.0					19																	2987056		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.361G>C	19.37:g.2987056G>C	ENSP00000246112:p.Glu121Gln		J3KMZ1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.E121Q	ENST00000246112.4	37	c.361	CCDS45910.1	19	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511504	0.44660	.	.	ENSG00000104953	ENST00000447920;ENST00000453329;ENST00000246112	T	0.19394	2.15	2.7	-3.54	0.04653	.	.	.	.	.	T	0.07593	0.0191	N	0.08118	0	0.09310	N	0.999999	P	0.38020	0.615	B	0.37144	0.242	T	0.28713	-1.0035	9	0.20046	T	0.44	.	3.4248	0.07406	0.5678:0.0:0.2387:0.1934	.	121	C9JGZ7	.	Q	121	ENSP00000246112:E121Q	ENSP00000246112:E121Q	E	+	1	0	TLE6	2938056	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.540000	0.06106	-0.695000	0.05105	-0.300000	0.09419	GAG	TLE6	-	NULL	ENSG00000104953		0.637	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE6	HGNC	protein_coding	OTTHUMT00000345996.3	47	0.00	0	G	NM_024760		2987056	2987056	+1	no_errors	ENST00000246112	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	0.000	C
TMEM145	284339	genome.wustl.edu	37	19	42818951	42818951	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:42818951C>T	ENST00000301204.3	+	5	409	c.368C>T	c.(367-369)tCa>tTa	p.S123L	TMEM145_ENST00000598766.1_Missense_Mutation_p.S133L|TMEM145_ENST00000601020.1_3'UTR	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	123					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				CAGGTGGTATCAGAGGAGGGA	0.612																																						dbGAP											0													73.0	74.0	74.0					19																	42818951		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.368C>T	19.37:g.42818951C>T	ENSP00000301204:p.Ser123Leu			Missense_Mutation	SNP	pfam_Rhodopsin-like_GPCR_TM_domain	p.S123L	ENST00000301204.3	37	c.368	CCDS12603.1	19	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586564	0.46110	.	.	ENSG00000167619	ENST00000301204	T	0.47528	0.84	5.0	5.0	0.66597	.	0.568065	0.17239	N	0.181631	T	0.36220	0.0959	L	0.43152	1.355	0.36890	D	0.889855	B	0.29432	0.244	B	0.21151	0.033	T	0.30765	-0.9967	10	0.19147	T	0.46	-8.0802	11.2928	0.49261	0.1823:0.8177:0.0:0.0	.	123	Q8NBT3	TM145_HUMAN	L	123	ENSP00000301204:S123L	ENSP00000301204:S123L	S	+	2	0	TMEM145	47510791	0.997000	0.39634	1.000000	0.80357	0.939000	0.58152	1.792000	0.38754	2.488000	0.83962	0.557000	0.71058	TCA	TMEM145	-	NULL	ENSG00000167619		0.612	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM145	HGNC	protein_coding	OTTHUMT00000463737.1	68	0.00	0	C	NM_173633		42818951	42818951	+1	no_errors	ENST00000301204	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.998	T
TP53	7157	genome.wustl.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr17:7578235T>C	ENST00000269305.4	-	6	803	c.614A>G	c.(613-615)tAt>tGt	p.Y205C	TP53_ENST00000455263.2_Missense_Mutation_p.Y205C|TP53_ENST00000413465.2_Missense_Mutation_p.Y205C|TP53_ENST00000359597.4_Missense_Mutation_p.Y205C|TP53_ENST00000445888.2_Missense_Mutation_p.Y205C|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.Y205C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)											136.0	121.0	126.0					17																	7578235		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>G	17.37:g.7578235T>C	ENSP00000269305:p.Tyr205Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y205C	ENST00000269305.4	37	c.614	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490024	0.64074	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.998;0.995;0.997;0.999;0.997;0.996	D	0.97320	0.9943	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205C;ENSP00000352610:Y205C;ENSP00000269305:Y205C;ENSP00000398846:Y205C;ENSP00000391127:Y205C;ENSP00000391478:Y205C;ENSP00000425104:Y73C;ENSP00000423862:Y112C	ENSP00000269305:Y205C	Y	-	2	0	TP53	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	275	0.00	0	T	NM_000546		7578235	7578235	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	97	21.14	26	SNP	0.989	C
TRIM49B	283116	genome.wustl.edu	37	11	49055873	49055873	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:49055873G>A	ENST00000332682.7	+	4	711	c.683G>A	c.(682-684)gGa>gAa	p.G228E		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	228						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						ATTTTAAGAGGAATGTATGAG	0.378																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.683G>A	11.37:g.49055873G>A	ENSP00000330216:p.Gly228Glu			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.G228E	ENST00000332682.7	37	c.683	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.052874	0.00394	.	.	ENSG00000182053	ENST00000332682	T	0.04119	3.7	0.689	-1.38	0.09027	.	.	.	.	.	T	0.03095	0.0091	L	0.44542	1.39	0.09310	N	1	.	.	.	.	.	.	T	0.48352	-0.9043	6	0.02654	T	1	.	.	.	.	.	.	.	.	E	228	ENSP00000330216:G228E	ENSP00000330216:G228E	G	+	2	0	AC084851.1	49012449	0.001000	0.12720	0.001000	0.08648	0.033000	0.12548	-0.164000	0.09983	-1.109000	0.02996	0.184000	0.17185	GGA	TRIM49B	-	NULL	ENSG00000182053		0.378	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		565	0.00	0	G			49055873	49055873	+1	no_errors	ENST00000332682	ensembl	human	known	69_37n	missense	146	20.22	37	SNP	0.001	A
TRIM59	286827	genome.wustl.edu	37	3	160155837	160155837	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:160155837G>A	ENST00000309784.4	-	3	1320	c.1135C>T	c.(1135-1137)Ctg>Ttg	p.L379L	TRIM59_ENST00000543469.1_Intron|RP11-432B6.3_ENST00000483754.1_Intron	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	379					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ACCTTATGCAGACTGTTAGAT	0.308																																						dbGAP											0													54.0	57.0	56.0					3																	160155837		2199	4294	6493	-	-	-	SO:0001819	synonymous_variant	0			AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.1135C>T	3.37:g.160155837G>A			A8K5G9|D3DNL9	Silent	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,smart_Znf_RING,pfscan_Znf_B-box,pfscan_Znf_RING	p.L379	ENST00000309784.4	37	c.1135	CCDS3190.1	3																																																																																			TRIM59	-	NULL	ENSG00000213186		0.308	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM59	HGNC	protein_coding	OTTHUMT00000352963.1	123	0.00	0	G	NM_173084		160155837	160155837	-1	no_errors	ENST00000309784	ensembl	human	known	69_37n	silent	87	22.81	26	SNP	0.000	A
TSTA3	7264	genome.wustl.edu	37	8	144696575	144696575	+	Silent	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr8:144696575G>C	ENST00000425753.2	-	6	616	c.513C>G	c.(511-513)acC>acG	p.T171T	TSTA3_ENST00000529064.1_Silent_p.T171T	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	171					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CGAAGACGTTGGTGGGGATGA	0.652																																						dbGAP											0													136.0	122.0	126.0					8																	144696575		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.513C>G	8.37:g.144696575G>C			B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Silent	SNP	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct	p.T171	ENST00000425753.2	37	c.513	CCDS6408.1	8																																																																																			TSTA3	-	pfam_Epimerase_deHydtase	ENSG00000104522		0.652	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSTA3	HGNC	protein_coding	OTTHUMT00000382263.1	145	0.00	0	G	NM_003313		144696575	144696575	-1	no_errors	ENST00000425753	ensembl	human	known	69_37n	silent	102	15.00	18	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179429698	179429698	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:179429698C>G	ENST00000591111.1	-	276	76462	c.76238G>C	c.(76237-76239)gGa>gCa	p.G25413A	TTN_ENST00000342175.6_Missense_Mutation_p.G18181A|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G24486A|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G18114A|TTN_ENST00000460472.2_Missense_Mutation_p.G17989A|TTN_ENST00000589042.1_Missense_Mutation_p.G27054A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25413	Fibronectin type-III 84. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCACTTTTTCCATACCTGTT	0.383																																						dbGAP											0													131.0	128.0	129.0					2																	179429698		1856	4093	5949	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76238G>C	2.37:g.179429698C>G	ENSP00000465570:p.Gly25413Ala		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.G24486A	ENST00000591111.1	37	c.73457		2	.	.	.	.	.	.	.	.	.	.	C	10.89	1.477471	0.26511	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	6.02	6.02	0.97574	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89550	0.6747	H	0.99487	4.59	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.93307	0.6681	9	0.87932	D	0	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	17989;18114;18181;25413	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	24486;17989;18181;18114;17987	ENSP00000343764:G24486A;ENSP00000434586:G17989A;ENSP00000340554:G18181A;ENSP00000352154:G18114A	ENSP00000340554:G18181A	G	-	2	0	TTN	179137944	1.000000	0.71417	0.957000	0.39632	0.406000	0.30931	7.797000	0.85911	2.857000	0.98124	0.650000	0.86243	GGA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	157	0.00	0	C	NM_133378		179429698	179429698	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	73	18.89	17	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179456070	179456070	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:179456070C>T	ENST00000591111.1	-	254	55683	c.55459G>A	c.(55459-55461)Gaa>Aaa	p.E18487K	TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E11255K|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E17560K|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E11188K|TTN_ENST00000460472.2_Missense_Mutation_p.E11063K|TTN_ENST00000589042.1_Missense_Mutation_p.E20128K|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18487	Ig-like 106.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGTCTGTTTCAACTGTGTAG	0.438																																						dbGAP											0													351.0	344.0	346.0					2																	179456070		1922	4137	6059	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55459G>A	2.37:g.179456070C>T	ENSP00000465570:p.Glu18487Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E17560K	ENST00000591111.1	37	c.52678		2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168477	0.78339	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	6.11	6.11	0.99139	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64349	0.2590	L	0.41710	1.295	0.58432	D	0.999997	P;P;P;P	0.47484	0.896;0.896;0.896;0.896	P;P;P;P	0.46510	0.519;0.519;0.519;0.519	T	0.66131	-0.6000	9	0.87932	D	0	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	11063;11188;11255;18487	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	17560;11063;11255;11188;11061	ENSP00000343764:E17560K;ENSP00000434586:E11063K;ENSP00000340554:E11255K;ENSP00000352154:E11188K	ENSP00000340554:E11255K	E	-	1	0	TTN	179164316	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	6.093000	0.71422	2.906000	0.99361	0.655000	0.94253	GAA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	163	0.61	1	C	NM_133378		179456070	179456070	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	94	13.76	15	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179650716	179650716	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:179650716G>A	ENST00000591111.1	-	14	2453	c.2229C>T	c.(2227-2229)gcC>gcT	p.A743A	TTN_ENST00000342175.6_Silent_p.A697A|TTN_ENST00000360870.5_Silent_p.A743A|TTN_ENST00000342992.6_Silent_p.A743A|TTN_ENST00000359218.5_Silent_p.A697A|TTN_ENST00000460472.2_Silent_p.A697A|TTN_ENST00000589042.1_Silent_p.A743A			Q8WZ42	TITIN_HUMAN	titin	33584			A -> V (in CMD1G; affects interaction with TCAP/telethonin). {ECO:0000269|PubMed:11846417}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTACCTTTGCGGCGGAAATGC	0.542																																						dbGAP											0													97.0	88.0	91.0					2																	179650716		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2229C>T	2.37:g.179650716G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A743	ENST00000591111.1	37	c.2229		2																																																																																			TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.542	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	125	0.00	0	G	NM_133378		179650716	179650716	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	52	23.53	16	SNP	0.001	A
TUBB3	10381	genome.wustl.edu	37	16	90001832	90001832	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:90001832G>C	ENST00000315491.7	+	4	1096	c.973G>C	c.(973-975)Gag>Cag	p.E325Q	TUBB3_ENST00000554444.1_Missense_Mutation_p.E253Q|TUBB3_ENST00000556922.1_Missense_Mutation_p.E672Q|TUBB3_ENST00000555576.1_Intron|TUBB3_ENST00000304984.5_Missense_Mutation_p.E253Q	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	325					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	GTCCATGAAGGAGGTGGACGA	0.627																																						dbGAP											0													141.0	124.0	130.0					16																	90001832		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.973G>C	16.37:g.90001832G>C	ENSP00000320295:p.Glu325Gln		A8K854|Q9BTZ0|Q9BW10	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.E325Q	ENST00000315491.7	37	c.973	CCDS10988.1	16	.	.	.	.	.	.	.	.	.	.	G	14.81	2.646699	0.47258	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000198211;ENSG00000198211	ENST00000556922;ENST00000555399;ENST00000304984;ENST00000554444;ENST00000315491	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	4.6	4.6	0.57074	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.56097	D	0.000022	D	0.89114	0.6623	H	0.94658	3.565	0.53688	D	0.999973	B;P	0.37141	0.091;0.584	B;B	0.40228	0.323;0.323	D	0.91295	0.5062	9	.	.	.	.	17.3629	0.87356	0.0:0.0:1.0:0.0	.	325;325	Q13509;B2RBD5	TBB3_HUMAN;.	Q	672;325;253;253;325	ENSP00000451560:E672Q;ENSP00000302777:E253Q;ENSP00000451617:E253Q;ENSP00000320295:E325Q	.	E	+	1	0	RP11-566K11.2;TUBB3	88529333	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.554000	0.98121	2.278000	0.76064	0.511000	0.50034	GAG	TUBB3	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Alpha_tubulin	ENSG00000258947		0.627	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB3	Clone_based_vega_gene	protein_coding	OTTHUMT00000272874.1	136	0.00	0	G	NM_006086		90001832	90001832	+1	no_errors	ENST00000315491	ensembl	human	known	69_37n	missense	74	13.95	12	SNP	1.000	C
TUBGCP6	85378	genome.wustl.edu	37	22	50658734	50658734	+	Missense_Mutation	SNP	G	G	C	rs146117828		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr22:50658734G>C	ENST00000248846.5	-	16	4158	c.4054C>G	c.(4054-4056)Ccc>Gcc	p.P1352A	TUBGCP6_ENST00000491449.1_5'UTR|TUBGCP6_ENST00000439308.2_Missense_Mutation_p.P1352A			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1352					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GGTTGGGTGGGAGCCACGTCT	0.647																																						dbGAP											0													45.0	44.0	44.0					22																	50658734		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.4054C>G	22.37:g.50658734G>C	ENSP00000248846:p.Pro1352Ala		Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.P1352A	ENST00000248846.5	37	c.4054	CCDS14087.1	22	.	.	.	.	.	.	.	.	.	.	G	11.15	1.555286	0.27739	.	.	ENSG00000128159	ENST00000248846;ENST00000425018;ENST00000439308	T;T;T	0.56611	3.13;0.45;1.68	4.29	-4.43	0.03568	.	85.072400	0.00166	N	0.000000	T	0.35941	0.0949	L	0.43152	1.355	0.09310	N	1	B;B;B	0.31153	0.139;0.31;0.264	B;B;B	0.27380	0.056;0.079;0.047	T	0.06899	-1.0801	10	0.15066	T	0.55	.	1.8892	0.03244	0.4289:0.2766:0.1762:0.1183	.	1344;1352;1352	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	A	1352;38;1352	ENSP00000248846:P1352A;ENSP00000405979:P38A;ENSP00000397387:P1352A	ENSP00000248846:P1352A	P	-	1	0	TUBGCP6	49000861	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.326000	0.19646	-0.878000	0.04007	0.561000	0.74099	CCC	TUBGCP6	-	pfam_Spc97_Spc98	ENSG00000128159		0.647	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP6	HGNC	protein_coding	OTTHUMT00000075004.3	40	0.00	0	G	NM_020461		50658734	50658734	-1	no_errors	ENST00000248846	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	0.000	C
UBA1	7317	genome.wustl.edu	37	X	47070624	47070624	+	Splice_Site	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chrX:47070624G>A	ENST00000335972.6	+	20	2647	c.2464G>A	c.(2464-2466)Gat>Aat	p.D822N	UBA1_ENST00000377351.4_Splice_Site_p.D822N|UBA1_ENST00000377269.3_Splice_Site_p.D270N	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	822					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGCCTCTGTTGGTGAGGGTGT	0.597																																						dbGAP											0													75.0	55.0	62.0					X																	47070624		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.2464+1G>A	X.37:g.47070624G>A			Q5JRR8|Q96E13	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.D822N	ENST00000335972.6	37	c.2464	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158125	0.78114	.	.	ENSG00000130985	ENST00000377351;ENST00000335972;ENST00000377269	T;T;T	0.41065	1.01;1.01;1.01	4.66	4.66	0.58398	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.101796	0.64402	D	0.000003	T	0.50701	0.1631	M	0.86651	2.83	0.80722	D	1	B;B	0.27264	0.173;0.062	B;B	0.25884	0.064;0.046	T	0.57808	-0.7747	10	0.52906	T	0.07	-10.2272	15.6561	0.77136	0.0:0.0:1.0:0.0	.	270;822	Q5JRR6;P22314	.;UBA1_HUMAN	N	822;822;270	ENSP00000366568:D822N;ENSP00000338413:D822N;ENSP00000366481:D270N	ENSP00000338413:D822N	D	+	1	0	UBA1	46955568	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.252000	0.58785	2.296000	0.77279	0.529000	0.55759	GAT	UBA1	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.597	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	53	0.00	0	G	NM_003334	Missense_Mutation	47070624	47070624	+1	no_errors	ENST00000335972	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	A
UBA6	55236	genome.wustl.edu	37	4	68539460	68539460	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:68539460C>G	ENST00000322244.5	-	7	560	c.501G>C	c.(499-501)caG>caC	p.Q167H	UBA6_ENST00000420827.2_Missense_Mutation_p.Q167H	NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	167					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TGATCTTCTTCTGCAATGGAA	0.308																																						dbGAP											0													138.0	131.0	134.0					4																	68539460		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.501G>C	4.37:g.68539460C>G	ENSP00000313454:p.Gln167His		A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.Q167H	ENST00000322244.5	37	c.501	CCDS3516.1	4	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244304	0.59103	.	.	ENSG00000033178	ENST00000322244;ENST00000420827	T;T	0.43294	0.95;0.95	5.1	-0.856	0.10697	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.187167	0.47852	D	0.000204	T	0.62183	0.2407	M	0.88704	2.975	0.41573	D	0.988695	D;D;D	0.71674	0.972;0.99;0.998	P;P;D	0.67900	0.86;0.81;0.954	T	0.61173	-0.7116	10	0.48119	T	0.1	-3.2341	9.9459	0.41609	0.0:0.4695:0.0:0.5305	.	167;167;167	A0AVT1-4;A0AVT1-3;A0AVT1	.;.;UBA6_HUMAN	H	167	ENSP00000313454:Q167H;ENSP00000399234:Q167H	ENSP00000313454:Q167H	Q	-	3	2	UBA6	68222055	0.998000	0.40836	0.944000	0.38274	0.954000	0.61252	0.524000	0.22940	-0.608000	0.05731	-0.163000	0.13421	CAG	UBA6	-	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000033178		0.308	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6	HGNC	protein_coding	OTTHUMT00000251429.2	186	0.00	0	C	NM_018227		68539460	68539460	-1	no_errors	ENST00000322244	ensembl	human	known	69_37n	missense	71	17.44	15	SNP	0.998	G
UBR4	23352	genome.wustl.edu	37	1	19464532	19464532	+	Missense_Mutation	SNP	C	C	T	rs530578440	byFrequency	TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:19464532C>T	ENST00000375254.3	-	60	8902	c.8875G>A	c.(8875-8877)Gaa>Aaa	p.E2959K	UBR4_ENST00000375226.2_Missense_Mutation_p.E2935K|UBR4_ENST00000375267.2_Missense_Mutation_p.E2959K|UBR4_ENST00000375217.2_Missense_Mutation_p.E2952K	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2959					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E2959Q(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ccttcagtttctccttctcct	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	95.0	95.0					1																	19464532		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8875G>A	1.37:g.19464532C>T	ENSP00000364403:p.Glu2959Lys		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E2959K	ENST00000375254.3	37	c.8875	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.448972	0.96205	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.26518	1.77;1.77;1.73;1.75	5.65	5.65	0.86999	.	0.119957	0.56097	D	0.000038	T	0.34106	0.0886	N	0.14661	0.345	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.19549	-1.0302	10	0.56958	D	0.05	.	18.5036	0.90890	0.0:1.0:0.0:0.0	.	2959	Q5T4S7	UBR4_HUMAN	K	2959;2959;2952;2935;567;1645	ENSP00000364403:E2959K;ENSP00000364416:E2959K;ENSP00000364365:E2952K;ENSP00000364374:E2935K	ENSP00000364365:E2952K	E	-	1	0	UBR4	19337119	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.909000	0.75735	2.668000	0.90789	0.655000	0.94253	GAA	UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.532	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	114	0.00	0	C	NM_020765		19464532	19464532	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	72	20.65	19	SNP	1.000	T
UNC119B	84747	genome.wustl.edu	37	12	121151105	121151105	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:121151105C>G	ENST00000344651.4	+	2	313	c.273C>G	c.(271-273)atC>atG	p.I91M	UNC119B_ENST00000539658.1_3'UTR	NM_001080533.1	NP_001074002.1	A6NIH7	U119B_HUMAN	unc-119 homolog B (C. elegans)	91					cilium morphogenesis (GO:0060271)|lipoprotein transport (GO:0042953)	ciliary transition zone (GO:0035869)	lipid binding (GO:0008289)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AAGACAACATCTACAGTATTG	0.368																																						dbGAP											0													118.0	115.0	116.0					12																	121151105		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31914.1	12q24	2014-06-16	2001-11-28		ENSG00000175970	ENSG00000175970			16488	protein-coding gene	gene with protein product	"""POC7 centriolar protein homolog B (Chlamydomonas)"""		"""unc119 (C.elegans) homolog B"""				Standard	NM_001080533		Approved	MGC5139, POC7B	uc001tyz.4	A6NIH7	OTTHUMG00000169201	ENST00000344651.4:c.273C>G	12.37:g.121151105C>G	ENSP00000344942:p.Ile91Met			Missense_Mutation	SNP	pfam_GMP_PDE_delta,superfamily_Ig_E-set	p.I91M	ENST00000344651.4	37	c.273	CCDS31914.1	12	.	.	.	.	.	.	.	.	.	.	C	17.76	3.469817	0.63625	.	.	ENSG00000175970	ENST00000344651;ENST00000537794	.	.	.	5.25	4.36	0.52297	Immunoglobulin E-set (1);	0.276051	0.39274	N	0.001409	D	0.85457	0.5701	M	0.89214	3.015	0.47476	D	0.999432	B	0.28512	0.214	P	0.54460	0.753	D	0.85970	0.1476	9	0.72032	D	0.01	-14.718	10.4734	0.44650	0.0:0.8334:0.0:0.1666	.	91	A6NIH7	U119B_HUMAN	M	91	.	ENSP00000344942:I91M	I	+	3	3	UNC119B	119635488	0.999000	0.42202	0.995000	0.50966	0.989000	0.77384	0.745000	0.26259	1.444000	0.47605	0.563000	0.77884	ATC	UNC119B	-	pfam_GMP_PDE_delta,superfamily_Ig_E-set	ENSG00000175970		0.368	UNC119B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC119B	HGNC	protein_coding	OTTHUMT00000402857.1	220	0.00	0	C	NM_001080533		121151105	121151105	+1	no_errors	ENST00000344651	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	1.000	G
USH1C	10083	genome.wustl.edu	37	11	17531162	17531162	+	Intron	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr11:17531162G>A	ENST00000318024.4	-	16	1393				USH1C_ENST00000527020.1_Intron|USH1C_ENST00000005226.7_Missense_Mutation_p.S585F|USH1C_ENST00000527720.1_Intron|USH1C_ENST00000529563.1_Intron	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CACATGGCCAGATAAGGGAAG	0.652																																						dbGAP											0													10.0	13.0	12.0					11																	17531162		2191	4274	6465	-	-	-	SO:0001627	intron_variant	0			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1285-7635C>T	11.37:g.17531162G>A			A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S585F	ENST00000318024.4	37	c.1754	CCDS31438.1	11	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504821	0.26949	.	.	ENSG00000006611	ENST00000005226	T	0.38240	1.15	5.74	5.74	0.90152	.	0.947125	0.08806	N	0.891070	T	0.36826	0.0981	.	.	.	0.09310	N	1	B	0.26876	0.162	B	0.27887	0.084	T	0.33854	-0.9852	9	0.56958	D	0.05	.	16.8303	0.85942	0.0:0.0:1.0:0.0	.	585	Q7RTU8	.	F	585	ENSP00000005226:S585F	ENSP00000005226:S585F	S	-	2	0	USH1C	17487738	0.347000	0.24853	0.012000	0.15200	0.085000	0.17905	4.161000	0.58170	2.711000	0.92665	0.591000	0.81541	TCT	USH1C	-	NULL	ENSG00000006611		0.652	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	HGNC	protein_coding	OTTHUMT00000389146.1	18	0.00	0	G	NM_005709		17531162	17531162	-1	no_errors	ENST00000005226	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.084	A
USP34	9736	genome.wustl.edu	37	2	61468708	61468708	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:61468708G>A	ENST00000398571.2	-	53	6840	c.6764C>T	c.(6763-6765)tCa>tTa	p.S2255L		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2255					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TAGTAACTCTGACGAAACATC	0.333																																						dbGAP											0													159.0	137.0	143.0					2																	61468708		1817	4081	5898	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6764C>T	2.37:g.61468708G>A	ENSP00000381577:p.Ser2255Leu		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.S2255L	ENST00000398571.2	37	c.6764	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703159	0.68501	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.05025	3.51;3.51	5.51	5.51	0.81932	Armadillo-type fold (1);	0.062459	0.64402	D	0.000003	T	0.06096	0.0158	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44221	-0.9342	10	0.46703	T	0.11	.	19.7747	0.96386	0.0:0.0:1.0:0.0	.	2255	Q70CQ2	UBP34_HUMAN	L	2103;2103;2255;533	ENSP00000381577:S2255L;ENSP00000410559:S533L	ENSP00000263989:S2103L	S	-	2	0	USP34	61322212	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.813000	0.99286	2.750000	0.94351	0.585000	0.79938	TCA	USP34	-	superfamily_ARM-type_fold	ENSG00000115464		0.333	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	480	0.00	0	G			61468708	61468708	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	134	30.93	60	SNP	1.000	A
USP38	84640	genome.wustl.edu	37	4	144119005	144119005	+	Silent	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:144119005G>A	ENST00000307017.4	+	4	1484	c.978G>A	c.(976-978)gtG>gtA	p.V326V	USP38_ENST00000510377.1_Silent_p.V326V	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	326					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					TTCCTCTTGTGAGACCTGGTG	0.383																																						dbGAP											0													179.0	163.0	168.0					4																	144119005		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.978G>A	4.37:g.144119005G>A			B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.V326	ENST00000307017.4	37	c.978	CCDS3758.1	4																																																																																			USP38	-	NULL	ENSG00000170185		0.383	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP38	HGNC	protein_coding	OTTHUMT00000364869.1	425	0.00	0	G	NM_032557		144119005	144119005	+1	no_errors	ENST00000307017	ensembl	human	known	69_37n	silent	101	18.55	23	SNP	1.000	A
USP4	7375	genome.wustl.edu	37	3	49348063	49348063	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr3:49348063G>C	ENST00000265560.4	-	8	990	c.944C>G	c.(943-945)tCc>tGc	p.S315C	USP4_ENST00000351842.4_Missense_Mutation_p.S268C|USP4_ENST00000488520.1_5'UTR	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	315	USP.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		CTGCAAAGCGGAGTTCATGAA	0.498																																						dbGAP											0													185.0	164.0	171.0					3																	49348063		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.944C>G	3.37:g.49348063G>C	ENSP00000265560:p.Ser315Cys		A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.S315C	ENST00000265560.4	37	c.944	CCDS2793.1	3	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263533	0.80358	.	.	ENSG00000114316	ENST00000351842;ENST00000265560	T;T	0.06294	3.32;3.32	5.43	5.43	0.79202	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	M	0.72479	2.2	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.00330	-1.1812	10	0.87932	D	0	-16.8018	17.8034	0.88595	0.0:0.0:1.0:0.0	.	268;315;315	Q13107-2;Q13107;Q08AK7	.;UBP4_HUMAN;.	C	268;315	ENSP00000341028:S268C;ENSP00000265560:S315C	ENSP00000265560:S315C	S	-	2	0	USP4	49323067	1.000000	0.71417	0.957000	0.39632	0.673000	0.39480	9.614000	0.98353	2.547000	0.85894	0.491000	0.48974	TCC	USP4	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000114316		0.498	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP4	HGNC	protein_coding	OTTHUMT00000346069.1	347	0.00	0	G	NM_199443		49348063	49348063	-1	no_errors	ENST00000265560	ensembl	human	known	69_37n	missense	96	22.83	29	SNP	1.000	C
USP53	54532	genome.wustl.edu	37	4	120190905	120190905	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:120190905C>G	ENST00000274030.6	+	15	2527	c.1348C>G	c.(1348-1350)Ctg>Gtg	p.L450V	USP53_ENST00000450251.1_Missense_Mutation_p.L450V	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						AGAATGTGCTCTGAAAGCTAT	0.318																																						dbGAP											0													96.0	96.0	96.0					4																	120190905		1805	4058	5863	-	-	-	SO:0001583	missense	0			BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.1348C>G	4.37:g.120190905C>G	ENSP00000274030:p.Leu450Val			Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L450V	ENST00000274030.6	37	c.1348	CCDS43265.1	4	.	.	.	.	.	.	.	.	.	.	C	12.49	1.954629	0.34471	.	.	ENSG00000145390	ENST00000274030;ENST00000450251	T;T	0.21543	2.0;2.0	5.61	1.77	0.24775	.	0.270973	0.29417	N	0.012205	T	0.17916	0.0430	L	0.57536	1.79	0.26644	N	0.972223	B	0.23442	0.085	B	0.22386	0.039	T	0.17623	-1.0363	10	0.33940	T	0.23	-4.7214	6.1033	0.20059	0.282:0.5771:0.0:0.1409	.	450	Q70EK8	UBP53_HUMAN	V	450	ENSP00000274030:L450V;ENSP00000409906:L450V	ENSP00000274030:L450V	L	+	1	2	USP53	120410353	0.949000	0.32298	0.957000	0.39632	0.996000	0.88848	1.409000	0.34680	0.004000	0.14682	0.561000	0.74099	CTG	USP53	-	NULL	ENSG00000145390		0.318	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP53	HGNC	protein_coding	OTTHUMT00000364564.2	97	0.00	0	C	XM_052597		120190905	120190905	+1	no_errors	ENST00000274030	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.942	G
UTRN	7402	genome.wustl.edu	37	6	144780060	144780060	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:144780060C>T	ENST00000367545.3	+	19	2439	c.2439C>T	c.(2437-2439)gtC>gtT	p.V813V		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	813	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTGAAAAGGTCATCAAGACAA	0.418																																						dbGAP											0													52.0	54.0	53.0					6																	144780060		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2439C>T	6.37:g.144780060C>T			Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.V813	ENST00000367545.3	37	c.2439	CCDS34547.1	6																																																																																			UTRN	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000152818		0.418	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	57	0.00	0	C			144780060	144780060	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	0.005	T
VCAN	1462	genome.wustl.edu	37	5	82817735	82817735	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:82817735C>G	ENST00000265077.3	+	7	4175	c.3610C>G	c.(3610-3612)Cca>Gca	p.P1204A	VCAN_ENST00000343200.5_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.P1156A|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.P1204A	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1204	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGTCACAGTTCCAAGTGATAT	0.408																																						dbGAP											0													141.0	139.0	140.0					5																	82817735		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3610C>G	5.37:g.82817735C>G	ENSP00000265077:p.Pro1204Ala		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.P1204A	ENST00000265077.3	37	c.3610	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	C	9.636	1.137801	0.21123	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	D;D;D	0.85955	-1.94;-2.02;-2.05	5.65	3.83	0.44106	.	0.121540	0.37955	N	0.001877	T	0.78842	0.4347	M	0.72894	2.215	0.33980	D	0.647898	B;P	0.45126	0.4;0.851	B;B	0.34418	0.121;0.182	T	0.83355	-0.0001	10	0.54805	T	0.06	.	5.8642	0.18765	0.2467:0.565:0.1198:0.0685	.	1204;1204	P13611-3;P13611	.;CSPG2_HUMAN	A	1204;1204;1156	ENSP00000265077:P1204A;ENSP00000342768:P1204A;ENSP00000425959:P1156A	ENSP00000265077:P1204A	P	+	1	0	VCAN	82853491	0.944000	0.32072	0.973000	0.42090	0.081000	0.17604	1.536000	0.36072	1.348000	0.45733	0.585000	0.79938	CCA	VCAN	-	NULL	ENSG00000038427		0.408	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	171	0.00	0	C	NM_004385		82817735	82817735	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	72	17.05	15	SNP	0.645	G
VCP	7415	genome.wustl.edu	37	9	35059573	35059573	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:35059573G>A	ENST00000358901.6	-	14	2816	c.1921C>T	c.(1921-1923)Cag>Tag	p.Q641*		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	641					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TAGATGAGCTGATCAAGACGG	0.512																																						dbGAP											0													168.0	133.0	145.0					9																	35059573		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1921C>T	9.37:g.35059573G>A	ENSP00000351777:p.Gln641*		B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Nonsense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase,tigrfam_ATPase_AAA_CDC48	p.Q641*	ENST00000358901.6	37	c.1921	CCDS6573.1	9	.	.	.	.	.	.	.	.	.	.	G	47	13.441023	0.99742	.	.	ENSG00000165280	ENST00000358901	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-32.0411	20.6439	0.99570	0.0:0.0:1.0:0.0	.	.	.	.	X	641	.	ENSP00000351777:Q641X	Q	-	1	0	VCP	35049573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	CAG	VCP	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase,tigrfam_ATPase_AAA_CDC48	ENSG00000165280		0.512	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	HGNC	protein_coding	OTTHUMT00000052290.1	199	0.00	0	G	NM_007126		35059573	35059573	-1	no_errors	ENST00000358901	ensembl	human	known	69_37n	nonsense	63	20.25	16	SNP	1.000	A
WASF1	8936	genome.wustl.edu	37	6	110434565	110434565	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr6:110434565C>G	ENST00000392589.1	-	5	1068	c.232G>C	c.(232-234)Gtt>Ctt	p.V78L	WASF1_ENST00000359451.2_Missense_Mutation_p.V78L|WASF1_ENST00000392586.1_Missense_Mutation_p.V78L|WASF1_ENST00000392587.2_Missense_Mutation_p.V78L|WASF1_ENST00000392588.1_Missense_Mutation_p.V78L	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	78					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		GTAACACTAACAGATAAACGG	0.313																																						dbGAP											0													92.0	90.0	90.0					6																	110434565		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.232G>C	6.37:g.110434565C>G	ENSP00000376368:p.Val78Leu		E1P5F2|Q5SZK7	Missense_Mutation	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.V78L	ENST00000392589.1	37	c.232	CCDS5080.1	6	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670324	0.67814	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451;ENST00000444391;ENST00000265601;ENST00000368938;ENST00000419252;ENST00000447287	T;T;T;T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.66	5.66	0.87406	.	0.054072	0.85682	D	0.000000	T	0.49881	0.1583	M	0.78049	2.395	0.46241	D	0.998944	B	0.02656	0.0	B	0.06405	0.002	T	0.49634	-0.8919	10	0.28530	T	0.3	.	13.9634	0.64194	0.0:0.9275:0.0:0.0725	.	78	Q92558	WASF1_HUMAN	L	78	ENSP00000376365:V78L;ENSP00000376366:V78L;ENSP00000376368:V78L;ENSP00000376367:V78L;ENSP00000352425:V78L;ENSP00000407041:V78L;ENSP00000265601:V78L;ENSP00000357934:V78L;ENSP00000404142:V78L;ENSP00000402663:V78L	ENSP00000265601:V78L	V	-	1	0	WASF1	110541258	1.000000	0.71417	0.990000	0.47175	0.982000	0.71751	3.455000	0.52993	2.669000	0.90835	0.591000	0.81541	GTT	WASF1	-	NULL	ENSG00000112290		0.313	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF1	HGNC	protein_coding	OTTHUMT00000041784.3	203	0.00	0	C	NM_003931		110434565	110434565	-1	no_errors	ENST00000359451	ensembl	human	known	69_37n	missense	87	21.24	24	SNP	1.000	G
WDFY3	23001	genome.wustl.edu	37	4	85674919	85674919	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr4:85674919C>T	ENST00000295888.4	-	35	6077	c.5670G>A	c.(5668-5670)atG>atA	p.M1890I	WDFY3_ENST00000322366.6_Missense_Mutation_p.M1890I	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1890					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AGTCAGGGCTCATCCACATGG	0.498																																						dbGAP											0													132.0	115.0	121.0					4																	85674919		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5670G>A	4.37:g.85674919C>T	ENSP00000295888:p.Met1890Ile		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M1890I	ENST00000295888.4	37	c.5670	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452856	0.43531	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.64438	-0.1;-0.1	5.82	5.82	0.92795	.	0.182483	0.64402	D	0.000007	T	0.51822	0.1697	L	0.36672	1.1	0.38727	D	0.953582	B	0.06786	0.001	B	0.08055	0.003	T	0.47983	-0.9074	10	0.21014	T	0.42	.	14.8846	0.70557	0.1433:0.8567:0.0:0.0	.	1890	Q8IZQ1	WDFY3_HUMAN	I	1890	ENSP00000318466:M1890I;ENSP00000295888:M1890I	ENSP00000295888:M1890I	M	-	3	0	WDFY3	85893943	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.301000	0.59086	2.752000	0.94435	0.655000	0.94253	ATG	WDFY3	-	NULL	ENSG00000163625		0.498	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	168	0.00	0	C	NM_014991		85674919	85674919	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	missense	101	17.21	21	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	50030439	50030439	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr10:50030439C>A	ENST00000325239.5	+	34	5866	c.5839C>A	c.(5839-5841)Cag>Aag	p.Q1947K	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1947						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CAAAGAGCCTCAGCCAAGTGC	0.552																																						dbGAP											0													71.0	72.0	71.0					10																	50030439		692	1591	2283	-	-	-	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.5839C>A	10.37:g.50030439C>A	ENSP00000320563:p.Gln1947Lys		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1037*	ENST00000325239.5	37	c.3110	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.587|5.587	0.293034|0.293034	0.10567|0.10567	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002;ENST00000374161	T|.	0.55588|.	0.51|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.382752|.	0.27710|.	N|.	0.018163|.	T|.	0.73110|.	0.3545|.	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	P;B|.	0.50272|.	0.933;0.007|.	P;B|.	0.47251|.	0.542;0.004|.	T|.	0.69562|.	-0.5112|.	9|.	.|.	.|.	.|.	.|.	17.3632|17.3632	0.87357|0.87357	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	475;1947|.	F2Z372;Q6ZS81|.	.;WDFY4_HUMAN|.	K|X	1947|1037;493	ENSP00000320563:Q1947K|.	.|.	Q|S	+|+	1|2	0|0	WDFY4|WDFY4	49700445|49700445	0.990000|0.990000	0.36364|0.36364	0.998000|0.998000	0.56505|0.56505	0.082000|0.082000	0.17680|0.17680	1.854000|1.854000	0.39368|0.39368	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	CAG|TCA	WDFY4	-	NULL	ENSG00000128815		0.552	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		119	0.00	0	C	XM_033379		50030439	50030439	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000312002	ensembl	human	known	69_37n	nonsense	56	13.85	9	SNP	1.000	A
WDR7	23335	genome.wustl.edu	37	18	54424178	54424178	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr18:54424178C>G	ENST00000254442.3	+	15	2565	c.2354C>G	c.(2353-2355)tCa>tGa	p.S785*	WDR7_ENST00000357574.3_Nonsense_Mutation_p.S785*|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	785					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		TCCAGCAAATCAAAGCCATTG	0.428																																						dbGAP											0													99.0	93.0	95.0					18																	54424178		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2354C>G	18.37:g.54424178C>G	ENSP00000254442:p.Ser785*		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S785*	ENST00000254442.3	37	c.2354	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	C	40	8.060680	0.98635	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	19.5942	0.95527	0.0:1.0:0.0:0.0	.	.	.	.	X	785;785;110;785	.	ENSP00000254442:S785X	S	+	2	0	WDR7	52575176	1.000000	0.71417	0.898000	0.35279	0.275000	0.26752	7.687000	0.84139	2.724000	0.93272	0.655000	0.94253	TCA	WDR7	-	NULL	ENSG00000091157		0.428	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	153	0.00	0	C			54424178	54424178	+1	no_errors	ENST00000254442	ensembl	human	known	69_37n	nonsense	97	11.82	13	SNP	1.000	G
WFDC6	140870	genome.wustl.edu	37	20	44163071	44163071	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr20:44163071G>A	ENST00000600168.1	-	4	556	c.469C>T	c.(469-471)Cca>Tca	p.P157S	WFDC6_ENST00000372670.3_3'UTR			Q9BQY6	WFDC6_HUMAN	WAP four-disulfide core domain 6	0						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|kidney(1)|large_intestine(2)|lung(2)	6		Myeloproliferative disorder(115;0.0122)				GGCACACGTGGAGAGAGGCCT	0.483																																					Ovarian(123;591 1661 9833 14622 45877)	dbGAP											0													129.0	120.0	123.0					20																	44163071		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031663	CCDS13358.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000243543	ENSG00000243543		"""WAP four-disulfide core domain containing"""	16164	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 171"""	C20orf171		12206714	Standard	NM_080827		Approved	dJ461P17.11, WAP6		Q9BQY6	OTTHUMG00000046354	ENST00000600168.1:c.469C>T	20.37:g.44163071G>A	ENSP00000470076:p.Pro157Ser		Q3MJ23|Q5JYQ4|Q8NFV6	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Whey_acidic_protein_4-diS_core,superfamily_Prot_inh_Kunz-m,superfamily_Whey_acidic_protein_4-diS_core,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.P157S	ENST00000600168.1	37	c.469		20	.	.	.	.	.	.	.	.	.	.	G	12.62	1.992945	0.35131	.	.	ENSG00000243543	ENST00000372665	.	.	.	3.11	-0.115	0.13560	.	.	.	.	.	T	0.34454	0.0898	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35599	-0.9782	5	0.59425	D	0.04	.	2.9834	0.05961	0.2918:0.2389:0.4693:0.0	.	.	.	.	S	157	.	ENSP00000361750:P157S	P	-	1	0	WFDC6	43596485	0.025000	0.19082	0.001000	0.08648	0.089000	0.18198	0.624000	0.24462	-0.002000	0.14469	0.563000	0.77884	CCA	WFDC6	-	NULL	ENSG00000243543		0.483	WFDC6-201	KNOWN	basic	protein_coding	WFDC6	HGNC	protein_coding		97	0.00	0	G			44163071	44163071	-1	no_errors	ENST00000372665	ensembl	human	novel	69_37n	missense	102	17.07	21	SNP	0.001	A
XRCC4	7518	genome.wustl.edu	37	5	82554427	82554427	+	Missense_Mutation	SNP	G	G	A	rs527506822		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:82554427G>A	ENST00000511817.1	+	7	904	c.824G>A	c.(823-825)cGa>cAa	p.R275Q	XRCC4_ENST00000338635.6_Missense_Mutation_p.R275Q|XRCC4_ENST00000509268.1_3'UTR|XRCC4_ENST00000396027.4_Missense_Mutation_p.R275Q|XRCC4_ENST00000282268.3_Missense_Mutation_p.R275Q			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	275					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		AGGAGACAGCGAATGCAAAGA	0.363								Non-homologous end-joining																														dbGAP											0													116.0	117.0	117.0					5																	82554427		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.824G>A	5.37:g.82554427G>A	ENSP00000421491:p.Arg275Gln		A8K3X4|Q9BS72|Q9UP94	Missense_Mutation	SNP	pfam_DNA_ds_break_repair_XRCC4,superfamily_XRCC4_N	p.R275Q	ENST00000511817.1	37	c.824	CCDS4059.1	5	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062684	0.76187	.	.	ENSG00000152422	ENST00000282268;ENST00000338635;ENST00000396027;ENST00000511817	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	4.99	3.18	0.36537	.	0.069863	0.56097	D	0.000039	T	0.41119	0.1145	M	0.71581	2.175	0.45747	D	0.998646	D;D;D	0.65815	0.973;0.99;0.995	P;P;P	0.60117	0.712;0.869;0.793	T	0.18398	-1.0338	10	0.56958	D	0.05	-53.6721	7.5104	0.27571	0.0866:0.0:0.749:0.1644	.	275;275;275	Q13426-2;Q13426;Q13426-3	.;XRCC4_HUMAN;.	Q	275	ENSP00000282268:R275Q;ENSP00000342011:R275Q;ENSP00000379344:R275Q;ENSP00000421491:R275Q	ENSP00000282268:R275Q	R	+	2	0	XRCC4	82590183	0.949000	0.32298	0.989000	0.46669	0.789000	0.44602	1.528000	0.35985	0.609000	0.30018	0.650000	0.86243	CGA	XRCC4	-	pfam_DNA_ds_break_repair_XRCC4	ENSG00000152422		0.363	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	XRCC4	HGNC	protein_coding	OTTHUMT00000369624.1	230	0.00	0	G	NM_022550		82554427	82554427	+1	no_errors	ENST00000338635	ensembl	human	known	69_37n	missense	75	27.18	28	SNP	0.983	A
YME1L1	10730	genome.wustl.edu	37	10	27412521	27412521	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr10:27412521C>G	ENST00000326799.3	-	11	1376	c.1228G>C	c.(1228-1230)Gag>Cag	p.E410Q	YME1L1_ENST00000375972.3_Missense_Mutation_p.E320Q|YME1L1_ENST00000463270.1_5'UTR|YME1L1_ENST00000376016.3_Missense_Mutation_p.E353Q	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	410					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						ACAAACATCTCATCAAATTCG	0.443																																						dbGAP											0													131.0	135.0	134.0					10																	27412521		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.1228G>C	10.37:g.27412521C>G	ENSP00000318480:p.Glu410Gln		B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,smart_AAA+_ATPase,tigrfam_FtsH	p.E410Q	ENST00000326799.3	37	c.1228	CCDS7152.1	10	.	.	.	.	.	.	.	.	.	.	C	36	5.650580	0.96714	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000546122	T;T;T	0.79454	-1.27;-1.27;-1.27	6.01	6.01	0.97437	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);Peptidase M41, FtsH (2);	0.000000	0.85682	D	0.000000	D	0.83308	0.5226	L	0.28115	0.83	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.996;0.996;0.998	D	0.84478	0.0603	10	0.87932	D	0	-14.7415	20.5211	0.99222	0.0:1.0:0.0:0.0	.	320;353;410	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	Q	353;410;410;320;156	ENSP00000365184:E353Q;ENSP00000318480:E410Q;ENSP00000365139:E320Q	ENSP00000318480:E410Q	E	-	1	0	YME1L1	27452527	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.802000	0.85969	2.861000	0.98227	0.650000	0.86243	GAG	YME1L1	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase,tigrfam_FtsH	ENSG00000136758		0.443	YME1L1-005	KNOWN	basic|CCDS	protein_coding	YME1L1	HGNC	protein_coding	OTTHUMT00000047306.1	187	0.00	0	C	NM_139312		27412521	27412521	-1	no_errors	ENST00000326799	ensembl	human	known	69_37n	missense	109	16.15	21	SNP	1.000	G
ZDHHC11	79844	genome.wustl.edu	37	5	837564	837564	+	Silent	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr5:837564G>C	ENST00000283441.8	-	6	1199	c.816C>G	c.(814-816)ctC>ctG	p.L272L	ZDHHC11_ENST00000503758.2_5'UTR|ZDHHC11_ENST00000424784.2_Silent_p.L272L	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	272						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GGTTATTAATGAGATACTCAA	0.493																																						dbGAP											0													171.0	199.0	189.0					5																	837564		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.816C>G	5.37:g.837564G>C			Q6UWR9	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.L272	ENST00000283441.8	37	c.816	CCDS3857.1	5																																																																																			ZDHHC11	-	NULL	ENSG00000188818		0.493	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11	HGNC	protein_coding	OTTHUMT00000206681.3	307	0.00	0	G	NM_024786		837564	837564	-1	no_errors	ENST00000283441	ensembl	human	known	69_37n	silent	156	15.59	29	SNP	0.000	C
ZDHHC12	84885	genome.wustl.edu	37	9	131484019	131484019	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr9:131484019C>T	ENST00000372663.4	-	4	405	c.393G>A	c.(391-393)gaG>gaA	p.E131E	ZDHHC12_ENST00000372672.2_Silent_p.E131E|RP11-545E17.3_ENST00000443631.1_RNA|ZDHHC12_ENST00000467312.1_5'UTR|ZDHHC12_ENST00000372667.5_Silent_p.E145E	NM_032799.4	NP_116188	Q96GR4	ZDH12_HUMAN	zinc finger, DHHC-type containing 12	131					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|ovary(2)|upper_aerodigestive_tract(1)	4						CCACACAGTTCTCCATCCAGG	0.657																																						dbGAP											0													149.0	132.0	138.0					9																	131484019		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027430	CCDS6909.1	9q34.11	2008-02-05			ENSG00000160446	ENSG00000160446		"""Zinc fingers, DHHC-type"""	19159	protein-coding gene	gene with protein product							Standard	NM_032799		Approved	ZNF400, FLJ14524	uc004bvy.3	Q96GR4	OTTHUMG00000020756	ENST00000372663.4:c.393G>A	9.37:g.131484019C>T			A6NH95|B2RE03|Q5T265|Q5T267|Q5T268|Q86VT5|Q96T09	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.E145	ENST00000372663.4	37	c.435	CCDS6909.1	9																																																																																			ZDHHC12	-	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	ENSG00000160446		0.657	ZDHHC12-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC12	HGNC	protein_coding	OTTHUMT00000054484.1	116	0.00	0	C	NM_032799		131484019	131484019	-1	no_errors	ENST00000372667	ensembl	human	known	69_37n	silent	88	11.88	12	SNP	1.000	T
ZFAND4	93550	genome.wustl.edu	37	10	46143787	46143787	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr10:46143787T>C	ENST00000344646.5	-	5	739	c.524A>G	c.(523-525)gAt>gGt	p.D175G	ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374371.2_Missense_Mutation_p.D175G|ZFAND4_ENST00000374366.3_Missense_Mutation_p.D101G	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	175							zinc ion binding (GO:0008270)										CAAATGAAAATCTATTTTCTT	0.338																																						dbGAP											0													111.0	104.0	107.0					10																	46143787		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.524A>G	10.37:g.46143787T>C	ENSP00000339484:p.Asp175Gly		A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_Znf_AN1,smart_Ubiquitin,smart_Znf_AN1,prints_Ubiquitin_subgr,pfscan_Znf_AN1,pfscan_Ubiquitin_supergroup	p.D175G	ENST00000344646.5	37	c.524	CCDS7214.1	10	.	.	.	.	.	.	.	.	.	.	T	2.820	-0.245052	0.05906	.	.	ENSG00000172671	ENST00000344646;ENST00000374371;ENST00000374366;ENST00000374376;ENST00000374370	T;T;T	0.48522	1.95;0.81;1.95	5.2	1.27	0.21489	.	12.184500	0.00520	N	0.000187	T	0.24736	0.0600	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20306	-1.0279	10	0.22706	T	0.39	-2.9471	9.1395	0.36894	0.0:0.7067:0.0:0.2933	.	175;175	Q5VVY4;Q86XD8	.;ANUB1_HUMAN	G	175;175;101;175;57	ENSP00000339484:D175G;ENSP00000363491:D175G;ENSP00000363486:D101G	ENSP00000339484:D175G	D	-	2	0	ANUBL1	45463793	0.000000	0.05858	0.737000	0.30932	0.276000	0.26787	0.252000	0.18278	0.038000	0.15604	-0.354000	0.07668	GAT	ZFAND4	-	NULL	ENSG00000172671		0.338	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND4	HGNC	protein_coding	OTTHUMT00000047790.1	142	0.00	0	T	NM_174890		46143787	46143787	-1	no_errors	ENST00000344646	ensembl	human	known	69_37n	missense	57	25.00	19	SNP	0.004	C
ZFC3H1	196441	genome.wustl.edu	37	12	72026676	72026676	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr12:72026676T>C	ENST00000378743.3	-	14	3165	c.2807A>G	c.(2806-2808)gAt>gGt	p.D936G		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	936					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						CCCAAAGCGATCTTGTTCCAG	0.343																																						dbGAP											0													139.0	132.0	134.0					12																	72026676		1812	4072	5884	-	-	-	SO:0001583	missense	0			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.2807A>G	12.37:g.72026676T>C	ENSP00000368017:p.Asp936Gly		Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	pfam_Putative_zinc-finger_domain,smart_HAT,pfscan_TPR-contain_dom	p.D936G	ENST00000378743.3	37	c.2807	CCDS41813.1	12	.	.	.	.	.	.	.	.	.	.	T	10.79	1.448976	0.26074	.	.	ENSG00000133858	ENST00000378743	T	0.30448	1.53	5.29	5.29	0.74685	.	0.351800	0.28847	N	0.013954	T	0.16981	0.0408	N	0.12182	0.205	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.09314	-1.0680	10	0.24483	T	0.36	.	10.4461	0.44495	0.0:0.0761:0.0:0.9239	.	936	O60293	ZC3H1_HUMAN	G	936	ENSP00000368017:D936G	ENSP00000368017:D936G	D	-	2	0	ZFC3H1	70312943	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	3.519000	0.53458	2.015000	0.59207	0.397000	0.26171	GAT	ZFC3H1	-	NULL	ENSG00000133858		0.343	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	HGNC	protein_coding	OTTHUMT00000404751.1	284	0.00	0	T	NM_144982		72026676	72026676	-1	no_errors	ENST00000378743	ensembl	human	known	69_37n	missense	141	35.62	78	SNP	1.000	C
ZMYM4	9202	genome.wustl.edu	37	1	35835996	35835996	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr1:35835996C>G	ENST00000314607.6	+	7	1029	c.949C>G	c.(949-951)Cag>Gag	p.Q317E	ZMYM4_ENST00000482131.1_3'UTR|ZMYM4_ENST00000373297.2_Missense_Mutation_p.Q317E	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	317					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TACTGGCTTTCAGCCCTCACT	0.333																																						dbGAP											0													27.0	28.0	28.0					1																	35835996		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.949C>G	1.37:g.35835996C>G	ENSP00000322915:p.Gln317Glu		A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Nonsense_Mutation	SNP	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH	p.S65*	ENST00000314607.6	37	c.194	CCDS389.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.2|23.2	4.387769|4.387769	0.82902|0.82902	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	T;T|.	0.25414|.	1.89;1.8|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.160446|.	0.44902|.	D|.	0.000414|.	T|.	0.58366|.	0.2117|.	L|L	0.55990|0.55990	1.75|1.75	0.25271|0.25271	N|N	0.989513|0.989513	B|.	0.32051|.	0.354|.	B|.	0.30716|.	0.119|.	T|.	0.52771|.	-0.8531|.	10|.	0.46703|.	T|.	0.11|.	-6.3357|-6.3357	19.1563|19.1563	0.93511|0.93511	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	317|.	Q5VZL5|.	ZMYM4_HUMAN|.	E|X	317|65	ENSP00000322915:Q317E;ENSP00000362394:Q317E|.	ENSP00000322915:Q317E|.	Q|S	+|+	1|2	0|0	ZMYM4|ZMYM4	35608583|35608583	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.682000|5.682000	0.68182|0.68182	2.525000|2.525000	0.85131|0.85131	0.591000|0.591000	0.81541|0.81541	CAG|TCA	ZMYM4	-	NULL	ENSG00000146463		0.333	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3	31	0.00	0	C	NM_005095		35835996	35835996	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000457946	ensembl	human	known	69_37n	nonsense	20	28.57	8	SNP	1.000	G
ZNF236	7776	genome.wustl.edu	37	18	74611135	74611135	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr18:74611135C>T	ENST00000253159.8	+	11	2043	c.1845C>T	c.(1843-1845)gtC>gtT	p.V615V	ZNF236_ENST00000320610.9_Silent_p.V617V	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	615					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		ATATTCCAGTCCCTGATATTC	0.398																																						dbGAP											0													65.0	63.0	63.0					18																	74611135		1898	4104	6002	-	-	-	SO:0001819	synonymous_variant	0			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.1845C>T	18.37:g.74611135C>T			B2RTX9|Q9UL37	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V615	ENST00000253159.8	37	c.1845	CCDS42447.1	18																																																																																			ZNF236	-	NULL	ENSG00000130856		0.398	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	88	0.00	0	C			74611135	74611135	+1	no_errors	ENST00000253159	ensembl	human	known	69_37n	silent	43	24.56	14	SNP	1.000	T
ZNF556	80032	genome.wustl.edu	37	19	2877800	2877800	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:2877800G>A	ENST00000307635.2	+	4	931	c.844G>A	c.(844-846)Gcc>Acc	p.A282T	ZNF556_ENST00000586426.1_Missense_Mutation_p.A281T	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GATCATGCACGCCGGAGGGAG	0.527																																						dbGAP											0													59.0	54.0	56.0					19																	2877800		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.844G>A	19.37:g.2877800G>A	ENSP00000302603:p.Ala282Thr		Q96GM3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A282T	ENST00000307635.2	37	c.844	CCDS12097.1	19	.	.	.	.	.	.	.	.	.	.	G	6.149	0.395682	0.11638	.	.	ENSG00000172000	ENST00000307635	T	0.04275	3.66	2.3	0.0419	0.14215	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00967	0.0032	N	0.00201	-1.865	0.22446	N	0.999093	B	0.02656	0.0	B	0.01281	0.0	T	0.46162	-0.9211	9	0.02654	T	1	.	5.692	0.17835	0.8381:0.0:0.1619:0.0	.	282	Q9HAH1	ZN556_HUMAN	T	282	ENSP00000302603:A282T	ENSP00000302603:A282T	A	+	1	0	ZNF556	2828800	0.893000	0.30496	0.014000	0.15608	0.011000	0.07611	1.876000	0.39588	-0.054000	0.13266	-1.176000	0.01726	GCC	ZNF556	-	pfscan_Znf_C2H2	ENSG00000172000		0.527	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF556	HGNC	protein_coding	OTTHUMT00000451638.2	45	0.00	0	G	NM_024967		2877800	2877800	+1	no_errors	ENST00000307635	ensembl	human	known	69_37n	missense	61	12.68	9	SNP	0.995	A
ZNF585B	92285	genome.wustl.edu	37	19	37676240	37676240	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:37676240C>G	ENST00000532828.2	-	5	2450	c.2199G>C	c.(2197-2199)ttG>ttC	p.L733F	ZNF585B_ENST00000527838.1_3'UTR|ZNF585B_ENST00000312908.5_Missense_Mutation_p.L321F|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000531805.1_Missense_Mutation_p.L678F	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	733					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GATGTTTATTCAAATTGGACC	0.458																																					Melanoma(93;882 1454 18863 28917 48427)	dbGAP											0													195.0	161.0	173.0					19																	37676240		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.2199G>C	19.37:g.37676240C>G	ENSP00000433773:p.Leu733Phe		Q8IZD3|Q96JW6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L733F	ENST00000532828.2	37	c.2199	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	C	7.319	0.616586	0.14129	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.52057	0.68;0.68;0.68	2.42	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.283721	0.19174	N	0.120855	T	0.50531	0.1621	L	0.55834	1.745	0.09310	N	1	P;D	0.65815	0.683;0.995	B;P	0.60345	0.291;0.873	T	0.31420	-0.9944	10	0.56958	D	0.05	.	2.9627	0.05897	0.3806:0.4561:0.0:0.1633	.	678;733	E9PQH3;Q52M93	.;Z585B_HUMAN	F	678;733;321	ENSP00000436774:L678F;ENSP00000433773:L733F;ENSP00000442139:L321F	ENSP00000442139:L321F	L	-	3	2	ZNF585B	42368080	0.000000	0.05858	0.996000	0.52242	0.322000	0.28314	-4.327000	0.00252	1.331000	0.45412	0.305000	0.20034	TTG	ZNF585B	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000245680		0.458	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2	348	0.00	0	C	NM_152279		37676240	37676240	-1	no_errors	ENST00000532828	ensembl	human	known	69_37n	missense	181	19.56	44	SNP	0.058	G
ZNF446	55663	genome.wustl.edu	37	19	58991184	58991184	+	Intron	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:58991184C>T	ENST00000594369.1	+	5	1093				ZNF446_ENST00000335841.4_Intron|ZNF446_ENST00000596341.1_Intron	NM_017908.2	NP_060378.1	Q9NWS9	ZN446_HUMAN	zinc finger protein 446						regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		TCTGTGCTACCAGCCCTACCC	0.672																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS12982.1	19q13.43	2013-01-09				ENSG00000083838		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21036	protein-coding gene	gene with protein product							Standard	NM_017908		Approved	ZKSCAN20, FLJ20626, ZSCAN52	uc002qsz.3	Q9NWS9		ENST00000594369.1:c.712+90C>T	19.37:g.58991184C>T				Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T97	ENST00000594369.1	37	c.291	CCDS12982.1	19																																																																																			ZNF446	-	NULL	ENSG00000083838		0.672	ZNF446-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF446	HGNC	protein_coding	OTTHUMT00000467052.1	26	0.00	0	C	NM_017908		58991184	58991184	+1	no_errors	ENST00000391694	ensembl	human	known	69_37n	silent	21	36.36	12	SNP	0.000	T
ZNF638	27332	genome.wustl.edu	37	2	71591252	71591252	+	Silent	SNP	C	C	T	rs201676031		TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr2:71591252C>T	ENST00000409544.1	+	5	2217	c.1587C>T	c.(1585-1587)ttC>ttT	p.F529F	ZNF638_ENST00000264447.4_Silent_p.F529F|ZNF638_ENST00000355812.3_Silent_p.F529F|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000377802.2_Silent_p.F529F	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	529	Arg-rich.				regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						GCCATCGTTTCATTTCTAGAT	0.433																																						dbGAP											0													113.0	104.0	107.0					2																	71591252		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1587C>T	2.37:g.71591252C>T			B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	pfam_RRM_dom,smart_Znf_U1,smart_Znf_C2H2-like,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.F529	ENST00000409544.1	37	c.1587	CCDS1917.1	2																																																																																			ZNF638	-	NULL	ENSG00000075292		0.433	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	189	0.53	1	C	NM_014497		71591252	71591252	+1	no_errors	ENST00000264447	ensembl	human	known	69_37n	silent	89	32.84	44	SNP	0.358	T
ZNF671	79891	genome.wustl.edu	37	19	58232983	58232983	+	Silent	SNP	G	G	C			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr19:58232983G>C	ENST00000317398.6	-	4	566	c.471C>G	c.(469-471)ctC>ctG	p.L157L	AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000335820.3_Silent_p.L59L|ZNF671_ENST00000594803.1_5'Flank	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCTCTGCCATGAGAGTCCTGA	0.478																																						dbGAP											0													124.0	120.0	122.0					19																	58232983		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.471C>G	19.37:g.58232983G>C			A6NF07|Q9H5E9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L157	ENST00000317398.6	37	c.471	CCDS12961.1	19																																																																																			ZNF671	-	NULL	ENSG00000083814		0.478	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	HGNC	protein_coding	OTTHUMT00000466817.1	152	0.00	0	G	NM_024833		58232983	58232983	-1	no_errors	ENST00000317398	ensembl	human	known	69_37n	silent	56	31.71	26	SNP	0.000	C
ZNF821	55565	genome.wustl.edu	37	16	71894091	71894091	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:71894091C>G	ENST00000565601.1	-	7	1476	c.1069G>C	c.(1069-1071)Gag>Cag	p.E357Q	ZNF821_ENST00000564134.1_3'UTR|ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000446827.2_Missense_Mutation_p.E315Q|ZNF821_ENST00000313565.6_Missense_Mutation_p.E315Q|ZNF821_ENST00000425432.1_Missense_Mutation_p.E357Q	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						TCCATTTTCTCCAGCCTCCTC	0.587																																						dbGAP											0													78.0	70.0	72.0					16																	71894091		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.1069G>C	16.37:g.71894091C>G	ENSP00000455648:p.Glu357Gln		A6NK48|B4DKK4|D3DWS3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E357Q	ENST00000565601.1	37	c.1069	CCDS56006.1	16	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473083	0.84640	.	.	ENSG00000102984	ENST00000425432;ENST00000313565;ENST00000446827	T;T;T	0.01495	6.43;4.83;4.83	6.1	6.1	0.99115	.	0.000000	0.85682	D	0.000000	T	0.07279	0.0184	L	0.34521	1.04	0.80722	D	1	D;D;D	0.69078	0.997;0.996;0.997	D;D;D	0.75484	0.986;0.986;0.986	T	0.21861	-1.0233	10	0.72032	D	0.01	-16.1422	20.7146	0.99709	0.0:1.0:0.0:0.0	.	357;315;357	B4DKK4;O75541-2;O75541	.;.;ZN821_HUMAN	Q	357;315;315	ENSP00000398089:E357Q;ENSP00000313822:E315Q;ENSP00000405908:E315Q	ENSP00000313822:E315Q	E	-	1	0	ZNF821	70451592	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.487000	0.81328	2.902000	0.99343	0.650000	0.86243	GAG	ZNF821	-	NULL	ENSG00000102984		0.587	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF821	HGNC	protein_coding	OTTHUMT00000434180.1	51	0.00	0	C	NM_017530		71894091	71894091	-1	no_errors	ENST00000425432	ensembl	human	known	69_37n	missense	34	16.67	7	SNP	1.000	G
ZNF821	55565	genome.wustl.edu	37	16	71895828	71895828	+	Silent	SNP	C	C	T			TCGA-AR-A0TX-01A-11D-A099-09	TCGA-AR-A0TX-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	63d635fa-d136-4e8a-a534-966ee678bb66	3c3cfe65-4e86-4c42-85d0-9daaeff2fc26	g.chr16:71895828C>T	ENST00000565601.1	-	6	842	c.435G>A	c.(433-435)gtG>gtA	p.V145V	ZNF821_ENST00000564134.1_Intron|ATXN1L_ENST00000569119.1_Intron|ZNF821_ENST00000446827.2_Silent_p.V103V|ZNF821_ENST00000313565.6_Silent_p.V103V|ZNF821_ENST00000564943.1_5'Flank|ZNF821_ENST00000425432.1_Silent_p.V145V	NM_001201553.1	NP_001188482.1	O75541	ZN821_HUMAN	zinc finger protein 821	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(2)	13						TCTTGGCGCTCACCACTGCTG	0.547																																						dbGAP											0													80.0	68.0	72.0					16																	71895828		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF070588	CCDS32481.1, CCDS56006.1, CCDS73911.1	16q22.3	2008-05-02				ENSG00000102984		"""Zinc fingers, C2H2-type"""	28043	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_017530		Approved		uc021tlb.1	O75541		ENST00000565601.1:c.435G>A	16.37:g.71895828C>T			A6NK48|B4DKK4|D3DWS3	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V145	ENST00000565601.1	37	c.435	CCDS56006.1	16																																																																																			ZNF821	-	NULL	ENSG00000102984		0.547	ZNF821-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF821	HGNC	protein_coding	OTTHUMT00000434180.1	123	0.00	0	C	NM_017530		71895828	71895828	-1	no_errors	ENST00000425432	ensembl	human	known	69_37n	silent	65	16.46	13	SNP	1.000	T
