#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADCY9	115	genome.wustl.edu	37	16	4042255	4042255	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr16:4042255C>A	ENST00000294016.3	-	5	2637	c.2099G>T	c.(2098-2100)gGa>gTa	p.G700V	ADCY9_ENST00000571889.1_5'UTR	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	700					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.G700V(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TGCCCACCTTCCCTTCTCCTG	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	87.0	90.0					16																	4042255		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2099G>T	16.37:g.4042255C>A	ENSP00000294016:p.Gly700Val		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.G700V	ENST00000294016.3	37	c.2099	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077297	0.76415	.	.	ENSG00000162104	ENST00000294016	D	0.83335	-1.71	5.28	5.28	0.74379	.	0.111312	0.64402	D	0.000009	T	0.75882	0.3910	L	0.44542	1.39	0.80722	D	1	P	0.44734	0.842	B	0.37047	0.24	T	0.74472	-0.3654	10	0.11182	T	0.66	.	18.9204	0.92523	0.0:1.0:0.0:0.0	.	700	O60503	ADCY9_HUMAN	V	700	ENSP00000294016:G700V	ENSP00000294016:G700V	G	-	2	0	ADCY9	3982256	1.000000	0.71417	0.985000	0.45067	0.945000	0.59286	3.596000	0.54024	2.463000	0.83235	0.643000	0.83706	GGA	ADCY9	-	NULL	ENSG00000162104		0.557	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	HGNC	protein_coding	OTTHUMT00000438076.1	52	0.00	0	C			4042255	4042255	-1	no_errors	ENST00000294016	ensembl	human	known	69_37n	missense	45	37.50	27	SNP	1.000	A
ALKBH7	84266	genome.wustl.edu	37	19	6374526	6374526	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr19:6374526G>A	ENST00000245812.3	+	3	817	c.429G>A	c.(427-429)atG>atA	p.M143I	ALKBH7_ENST00000596657.1_Start_Codon_SNP_p.M1I|ALKBH7_ENST00000599849.1_Missense_Mutation_p.M82I	NM_032306.3	NP_115682.1	Q9BT30	ALKB7_HUMAN	alkB, alkylation repair homolog 7 (E. coli)	143					cellular response to DNA damage stimulus (GO:0006974)|fatty acid metabolic process (GO:0006631)|regulation of lipid storage (GO:0010883)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)	mitochondrial matrix (GO:0005759)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.M143I(1)		breast(2)|kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						CCAGCGTTATGCGGCTGGTGC	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	57.0	54.0					19																	6374526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY427650	CCDS12163.1	19p13.3	2008-02-05	2006-02-09	2006-02-09		ENSG00000125652		"""Alkylation repair homologs"""	21306	protein-coding gene	gene with protein product		613305	"""spermatogenesis associated 11"""	SPATA11		12477932	Standard	NM_032306		Approved	MGC10974	uc002meo.2	Q9BT30		ENST00000245812.3:c.429G>A	19.37:g.6374526G>A	ENSP00000245812:p.Met143Ile		B2R4U9|Q53FF3	Missense_Mutation	SNP	NULL	p.M143I	ENST00000245812.3	37	c.429	CCDS12163.1	19	.	.	.	.	.	.	.	.	.	.	G	28.8	4.952289	0.92660	.	.	ENSG00000125652	ENST00000245812	T	0.15603	2.41	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.47488	0.1448	M	0.86573	2.825	0.58432	D	0.999999	D	0.69078	0.997	D	0.70716	0.97	T	0.53408	-0.8443	10	0.66056	D	0.02	-14.8766	16.1613	0.81712	0.0:0.0:1.0:0.0	.	143	Q9BT30	ALKB7_HUMAN	I	143	ENSP00000245812:M143I	ENSP00000245812:M143I	M	+	3	0	ALKBH7	6325526	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	6.811000	0.75221	2.634000	0.89283	0.555000	0.69702	ATG	ALKBH7	-	NULL	ENSG00000125652		0.647	ALKBH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH7	HGNC	protein_coding	OTTHUMT00000453036.1	52	0.00	0	G	NM_032306		6374526	6374526	+1	no_errors	ENST00000245812	ensembl	human	known	69_37n	missense	96	17.95	21	SNP	1.000	A
BCL9	607	genome.wustl.edu	37	1	147095879	147095879	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr1:147095879C>T	ENST00000234739.3	+	10	4140	c.3400C>T	c.(3400-3402)Cgg>Tgg	p.R1134W		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1134	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.R1134W(1)		breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					ACCTCAAGGACGGATGGGCTT	0.617			T	"""IGH@, IGL@"""	B-ALL																																	dbGAP		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	1	Substitution - Missense(1)	breast(1)											98.0	100.0	99.0					1																	147095879		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.3400C>T	1.37:g.147095879C>T	ENSP00000234739:p.Arg1134Trp		Q5T489	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.R1134W	ENST00000234739.3	37	c.3400	CCDS30833.1	1	.	.	.	.	.	.	.	.	.	.	C	16.40	3.113668	0.56398	.	.	ENSG00000116128	ENST00000234739	T	0.57907	0.37	4.64	2.77	0.32553	.	0.000000	0.85682	D	0.000000	T	0.25606	0.0623	L	0.36672	1.1	0.50813	D	0.999898	B;B	0.15473	0.013;0.013	B;B	0.10450	0.005;0.005	T	0.18116	-1.0347	10	0.72032	D	0.01	-13.5517	10.9269	0.47195	0.0:0.8472:0.0:0.1528	.	1134;1134	Q1JQ81;O00512	.;BCL9_HUMAN	W	1134	ENSP00000234739:R1134W	ENSP00000234739:R1134W	R	+	1	2	BCL9	145562503	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.278000	0.78587	0.687000	0.31509	0.655000	0.94253	CGG	BCL9	-	NULL	ENSG00000116128		0.617	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	44	0.00	0	C	NM_004326		147095879	147095879	+1	no_errors	ENST00000234739	ensembl	human	known	69_37n	missense	36	44.78	30	SNP	1.000	T
C17orf104	284071	genome.wustl.edu	37	17	42745436	42745436	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr17:42745436C>G	ENST00000409122.2	+	5	2299	c.2157C>G	c.(2155-2157)taC>taG	p.Y719*	C17orf104_ENST00000359945.3_Nonsense_Mutation_p.Y719*|C17orf104_ENST00000409464.1_Nonsense_Mutation_p.Y553*	NM_001145080.2	NP_001138552.2	A2RUB1	CQ104_HUMAN	chromosome 17 open reading frame 104	719								p.Y719*(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|skin(1)	24						GCCATTTGTACCCTTATTTTA	0.398																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											76.0	67.0	70.0					17																	42745436		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS45703.1, CCDS45703.2	17q21.31	2009-09-08			ENSG00000180336	ENSG00000180336			26670	protein-coding gene	gene with protein product							Standard	NM_001145080		Approved	FLJ35848	uc002iha.3	A2RUB1	OTTHUMG00000153039	ENST00000409122.2:c.2157C>G	17.37:g.42745436C>G	ENSP00000386452:p.Tyr719*		B4DXJ2|B5MD93|B9EGQ6|C4AM97|Q4G0Y1|Q8IVZ7|Q8NA45	Nonsense_Mutation	SNP	NULL	p.Y719*	ENST00000409122.2	37	c.2157	CCDS45703.2	17	.	.	.	.	.	.	.	.	.	.	C	38	6.883834	0.97908	.	.	ENSG00000180336	ENST00000359945;ENST00000409122;ENST00000409464	.	.	.	5.62	-0.577	0.11727	.	0.343290	0.26265	N	0.025378	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-21.9096	10.8149	0.46569	0.0:0.4446:0.0:0.5554	.	.	.	.	X	719;719;553	.	ENSP00000353028:Y719X	Y	+	3	2	C17orf104	40100962	0.984000	0.35163	0.998000	0.56505	0.988000	0.76386	0.074000	0.14662	0.020000	0.15106	0.591000	0.81541	TAC	C17orf104	-	NULL	ENSG00000180336		0.398	C17orf104-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf104	HGNC	protein_coding	OTTHUMT00000329171.2	149	0.00	0	C	NM_001145080		42745436	42745436	+1	no_errors	ENST00000409122	ensembl	human	known	69_37n	nonsense	51	61.76	84	SNP	0.992	G
CALML6	163688	genome.wustl.edu	37	1	1848267	1848267	+	Silent	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr1:1848267C>T	ENST00000307786.3	+	4	784	c.330C>T	c.(328-330)agC>agT	p.S110S	CALML6_ENST00000462293.1_3'UTR	NM_138705.2	NP_619650.2	Q8TD86	CALL6_HUMAN	calmodulin-like 6	110	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.S110S(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.94e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.83e-23)|GBM - Glioblastoma multiforme(42;3.23e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		ACCAGGAGAGCGAGCTGAGGG	0.587																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											105.0	116.0	112.0					1																	1848267		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF490905	CCDS30566.1	1p36.33	2013-01-10			ENSG00000169885	ENSG00000169885		"""EF-hand domain containing"""	24193	protein-coding gene	gene with protein product		610171					Standard	NM_138705		Approved	CAGLP	uc001aih.1	Q8TD86	OTTHUMG00000000943	ENST00000307786.3:c.330C>T	1.37:g.1848267C>T			A2A2M3|Q6Q2C4	Silent	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S110	ENST00000307786.3	37	c.330	CCDS30566.1	1																																																																																			CALML6	-	pfscan_EF_HAND_2	ENSG00000169885		0.587	CALML6-004	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	CALML6	HGNC	protein_coding	OTTHUMT00000276929.1	61	0.00	0	C	NM_138705		1848267	1848267	+1	no_errors	ENST00000307786	ensembl	human	known	69_37n	silent	19	59.57	28	SNP	0.213	T
DAO	1610	genome.wustl.edu	37	12	109288102	109288102	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr12:109288102C>T	ENST00000228476.3	+	7	775	c.571C>T	c.(571-573)Cga>Tga	p.R191*	DAO_ENST00000551281.1_Nonsense_Mutation_p.R125*	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	191					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)	p.R191*(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	GGCGCTACAACGAGACCCCCT	0.557																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											67.0	53.0	58.0					12																	109288102		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.571C>T	12.37:g.109288102C>T	ENSP00000228476:p.Arg191*		B2R7I5|Q16758|Q8N6R2	Nonsense_Mutation	SNP	pfam_FAD-dep_OxRdtase	p.R191*	ENST00000228476.3	37	c.571	CCDS9122.1	12	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631187	0.46944	.	.	ENSG00000110887	ENST00000551281;ENST00000228476;ENST00000547768;ENST00000547166	.	.	.	5.51	3.51	0.40186	.	0.095984	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-20.3253	16.2953	0.82767	0.0:0.7247:0.2753:0.0	.	.	.	.	X	125;191;68;191	.	ENSP00000228476:R191X	R	+	1	2	DAO	107812231	1.000000	0.71417	0.930000	0.37139	0.366000	0.29705	3.867000	0.56047	1.301000	0.44836	0.499000	0.49734	CGA	DAO	-	pfam_FAD-dep_OxRdtase	ENSG00000110887		0.557	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAO	HGNC	protein_coding	OTTHUMT00000403682.1	45	0.00	0	C			109288102	109288102	+1	no_errors	ENST00000228476	ensembl	human	known	69_37n	nonsense	31	41.51	22	SNP	1.000	T
DNAH5	1767	genome.wustl.edu	37	5	13737575	13737575	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr5:13737575C>T	ENST00000265104.4	-	66	11345	c.11241G>A	c.(11239-11241)atG>atA	p.M3747I		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3747	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.M3747I(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTACATCTTCCATCAGATGAG	0.368									Kartagener syndrome																													dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	124.0	130.0					5																	13737575		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11241G>A	5.37:g.13737575C>T	ENSP00000265104:p.Met3747Ile		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.M3747I	ENST00000265104.4	37	c.11241	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292599	0.23564	.	.	ENSG00000039139	ENST00000265104	T	0.20881	2.04	5.68	4.82	0.62117	.	0.192926	0.56097	D	0.000033	T	0.07052	0.0179	N	0.02685	-0.53	0.29681	N	0.84168	B	0.02656	0.0	B	0.12837	0.008	T	0.30851	-0.9964	10	0.06236	T	0.91	.	7.3773	0.26835	0.1364:0.7234:0.0:0.1402	.	3747	Q8TE73	DYH5_HUMAN	I	3747	ENSP00000265104:M3747I	ENSP00000265104:M3747I	M	-	3	0	DNAH5	13790575	1.000000	0.71417	0.990000	0.47175	0.967000	0.64934	0.864000	0.27926	1.410000	0.46936	0.655000	0.94253	ATG	DNAH5	-	NULL	ENSG00000039139		0.368	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	222	0.00	0	C	NM_001369		13737575	13737575	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	missense	190	31.65	88	SNP	0.999	T
DPY19L2P1	554236	genome.wustl.edu	37	7	35131356	35131357	+	RNA	DEL	TG	TG	-	rs182353742|rs376288775	byFrequency	TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr7:35131356_35131357delTG	ENST00000436258.1	-	0	2012_2013							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										AGGATGAGTTtgtgtgtgtgtg	0.406																																						dbGAP											0																																										-	-	-			0			BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35131366_35131367delTG			B4E2E3	RNA	DEL	-	NULL	ENST00000436258.1	37	NULL		7																																																																																			DPY19L2P1	-	-	ENSG00000189212		0.406	DPY19L2P1-002	KNOWN	basic	processed_transcript	DPY19L2P1	HGNC	pseudogene	OTTHUMT00000338113.1	24	0.00	0	TG			35131356	35131357	-1	no_errors	ENST00000436258	ensembl	human	known	69_37n	rna	47	16.07	9	DEL	0.000:0.000	-
FCGBP	8857	genome.wustl.edu	37	19	40383820	40383820	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr19:40383820C>T	ENST00000221347.6	-	21	9797	c.9790G>A	c.(9790-9792)Ggc>Agc	p.G3264S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3264			G -> S (in dbSNP:rs6508919).			extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGCTGGCAGCCGTGCTGGCCG	0.662																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.9790G>A	19.37:g.40383820C>T	ENSP00000221347:p.Gly3264Ser		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.G3264S	ENST00000221347.6	37	c.9790	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	17.89	3.500296	0.64298	.	.	ENSG00000090920	ENST00000221347	T	0.05025	3.51	3.01	3.01	0.34805	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.17066	0.0410	M	0.77103	2.36	0.21445	N	0.99968	D	0.71674	0.998	D	0.68192	0.956	T	0.15636	-1.0430	9	0.11182	T	0.66	.	5.4472	0.16541	0.0:0.7348:0.0:0.2652	.	3264	Q9Y6R7	FCGBP_HUMAN	S	3264	ENSP00000221347:G3264S	ENSP00000221347:G3264S	G	-	1	0	FCGBP	45075660	0.004000	0.15560	0.859000	0.33776	0.956000	0.61745	0.708000	0.25719	1.388000	0.46506	0.400000	0.26472	GGC	FCGBP	-	smart_VWC_out,smart_VWF_type-D	ENSG00000090920		0.662	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	19	0.00	0	C	NM_003890		40383820	40383820	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	33	34.00	17	SNP	0.796	T
FEZF2	55079	genome.wustl.edu	37	3	62356989	62356989	+	Silent	SNP	C	C	A	rs367795548		TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr3:62356989C>A	ENST00000283268.3	-	4	1317	c.1023G>T	c.(1021-1023)gcG>gcT	p.A341A	PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|FEZF2_ENST00000486811.1_Silent_p.A341A|FEZF2_ENST00000475839.1_Silent_p.A341A	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	341					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.A341A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		TGCGGTTGAACGCTTTGCCGC	0.557																																					NSCLC(170;1772 2053 12525 15604 23984)	dbGAP											1	Substitution - coding silent(1)	breast(1)											151.0	132.0	139.0					3																	62356989		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1023G>T	3.37:g.62356989C>A			A8K349|Q9BZ91|Q9NWB9	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A341	ENST00000283268.3	37	c.1023	CCDS2897.1	3																																																																																			FEZF2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000153266		0.557	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF2	HGNC	protein_coding	OTTHUMT00000351813.1	103	0.00	0	C	NM_018008		62356989	62356989	-1	no_errors	ENST00000283268	ensembl	human	known	69_37n	silent	75	37.70	46	SNP	0.989	A
IQUB	154865	genome.wustl.edu	37	7	123150002	123150003	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr7:123150002_123150003insA	ENST00000466202.1	-	3	1060_1061	c.484_485insT	c.(484-486)tcafs	p.S162fs	IQUB_ENST00000324698.6_Frame_Shift_Ins_p.S162fs|IQUB_ENST00000488987.1_Intron|IQUB_ENST00000434450.1_Frame_Shift_Ins_p.S162fs	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	162	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						TAATAAGTGTGAAAAATGGTCC	0.312																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.485dupT	7.37:g.123150007_123150007dupA	ENSP00000417769:p.Ser162fs		A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Frame_Shift_Ins	INS	pfam_Ubiquitin,pfscan_Ubiquitin_supergroup	p.S162fs	ENST00000466202.1	37	c.485_484	CCDS5787.1	7																																																																																			IQUB	-	pfam_Ubiquitin,pfscan_Ubiquitin_supergroup	ENSG00000164675		0.312	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IQUB	HGNC	protein_coding	OTTHUMT00000348529.1	137	0.00	0	-	NM_178827		123150002	123150003	-1	no_errors	ENST00000324698	ensembl	human	known	69_37n	frame_shift_ins	107	35.93	60	INS	0.996:0.998	A
KLF17	128209	genome.wustl.edu	37	1	44595388	44595388	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr1:44595388G>A	ENST00000372299.3	+	2	503	c.445G>A	c.(445-447)Ggg>Agg	p.G149R	KLF17_ENST00000476802.1_Intron	NM_173484.3	NP_775755.3	Q5JT82	KLF17_HUMAN	Kruppel-like factor 17	149					gamete generation (GO:0007276)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G149R(2)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(1)|lung(6)|ovary(3)|prostate(1)|skin(2)|stomach(1)	18	Acute lymphoblastic leukemia(166;0.155)					GCCCTTCGGTGGGAATCTAAG	0.567																																						dbGAP											2	Substitution - Missense(2)	breast(2)											37.0	40.0	39.0					1																	44595388		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC049844	CCDS508.1	1p34.1	2011-11-15	2006-02-17	2006-02-17	ENSG00000171872	ENSG00000171872		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	18830	protein-coding gene	gene with protein product		609602	"""zinc finger protein 393"""	ZNF393		16460907	Standard	NM_173484		Approved	Zfp393, FLJ40160	uc001clp.3	Q5JT82	OTTHUMG00000009664	ENST00000372299.3:c.445G>A	1.37:g.44595388G>A	ENSP00000361373:p.Gly149Arg		Q86VQ7|Q8N805	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G149R	ENST00000372299.3	37	c.445	CCDS508.1	1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626312	0.28978	.	.	ENSG00000171872	ENST00000372299	T	0.10192	2.9	4.78	2.85	0.33270	.	0.255939	0.27768	N	0.017931	T	0.04497	0.0123	N	0.12746	0.255	0.09310	N	1	P	0.34780	0.468	B	0.27170	0.077	T	0.40289	-0.9571	10	0.24483	T	0.36	.	6.853	0.24024	0.2142:0.0:0.7858:0.0	.	149	Q5JT82	KLF17_HUMAN	R	149	ENSP00000361373:G149R	ENSP00000361373:G149R	G	+	1	0	KLF17	44367975	0.745000	0.28261	0.004000	0.12327	0.002000	0.02628	1.085000	0.30840	0.881000	0.35993	0.650000	0.86243	GGG	KLF17	-	NULL	ENSG00000171872		0.567	KLF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF17	HGNC	protein_coding	OTTHUMT00000026646.1	60	0.00	0	G	NM_173484		44595388	44595388	+1	no_errors	ENST00000372299	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	0.004	A
KIF2C	11004	genome.wustl.edu	37	1	45213334	45213334	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr1:45213334G>A	ENST00000372224.4	+	4	391	c.278G>A	c.(277-279)cGg>cAg	p.R93Q	KIF2C_ENST00000372217.1_Missense_Mutation_p.R39Q|KIF2C_ENST00000372222.3_5'UTR|KIF2C_ENST00000372218.4_Missense_Mutation_p.R93Q|KIF2C_ENST00000493027.1_3'UTR	NM_006845.3	NP_006836.2	Q99661	KIF2C_HUMAN	kinesin family member 2C	93	Globular. {ECO:0000255}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|microtubule motor activity (GO:0003777)|microtubule plus-end binding (GO:0051010)	p.R93Q(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(1)|skin(1)|urinary_tract(1)	34	Acute lymphoblastic leukemia(166;0.155)					AAACAAAAACGGAGATCCGTC	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	66.0	66.0					1																	45213334		2203	4300	6503	-	-	-	SO:0001583	missense	0			U63743	CCDS512.1, CCDS72774.1	1p34.1	2014-01-21	2003-01-13	2003-01-17	ENSG00000142945	ENSG00000142945		"""Kinesins"""	6393	protein-coding gene	gene with protein product		604538	"""kinesin-like 6 (mitotic centromere-associated kinesin)"""	KNSL6		9434124	Standard	NM_006845		Approved	MCAK, CT139	uc001cmg.4	Q99661	OTTHUMG00000008416	ENST00000372224.4:c.278G>A	1.37:g.45213334G>A	ENSP00000361298:p.Arg93Gln		B3ITR9|Q5JR88|Q6ICU1|Q96C18|Q96HB8|Q9BWV8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R93Q	ENST00000372224.4	37	c.278	CCDS512.1	1	.	.	.	.	.	.	.	.	.	.	g	17.92	3.507443	0.64410	.	.	ENSG00000142945	ENST00000452259;ENST00000372224;ENST00000372218;ENST00000455186;ENST00000372217	T;T;T;T;T	0.75477	1.08;-0.94;-0.76;0.77;-0.94	5.86	4.95	0.65309	.	0.483448	0.23906	N	0.043391	T	0.66528	0.2798	L	0.44542	1.39	0.80722	D	1	B;P;B	0.46277	0.425;0.875;0.067	B;B;B	0.41646	0.029;0.362;0.011	T	0.68808	-0.5311	10	0.59425	D	0.04	.	9.7577	0.40513	0.0733:0.1398:0.7869:0.0	.	93;39;93	B7Z6Q6;Q99661-2;Q99661	.;.;KIF2C_HUMAN	Q	93;93;93;84;39	ENSP00000410346:R93Q;ENSP00000361298:R93Q;ENSP00000361292:R93Q;ENSP00000395050:R84Q;ENSP00000361291:R39Q	ENSP00000361291:R39Q	R	+	2	0	KIF2C	44985921	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	3.559000	0.53756	1.493000	0.48517	-0.136000	0.14681	CGG	KIF2C	-	NULL	ENSG00000142945		0.383	KIF2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2C	HGNC	protein_coding	OTTHUMT00000023180.1	120	0.00	0	G	NM_006845		45213334	45213334	+1	no_errors	ENST00000372224	ensembl	human	known	69_37n	missense	37	58.43	52	SNP	1.000	A
MAPKBP1	23005	genome.wustl.edu	37	15	42104263	42104263	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr15:42104263G>A	ENST00000456763.2	+	6	632	c.436G>A	c.(436-438)Gcc>Acc	p.A146T	MAPKBP1_ENST00000221214.6_Missense_Mutation_p.A146T|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.A34T|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.A146T|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.A146T	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	146								p.A146T(1)		breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CTCTCCTAGCGCCAAGTACAT	0.617											OREG0023077	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	breast(1)											159.0	125.0	136.0					15																	42104263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.436G>A	15.37:g.42104263G>A	ENSP00000393099:p.Ala146Thr	906	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A146T	ENST00000456763.2	37	c.436	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	g	14.13	2.443371	0.43429	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566;ENST00000510535	T;T;T;T;T;T	0.56611	5.05;0.45;0.58;5.05;5.05;2.31	5.39	4.44	0.53790	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.528795	0.22594	N	0.058045	T	0.32585	0.0834	L	0.28115	0.83	0.25458	N	0.987943	P;B;B;P	0.47841	0.901;0.33;0.251;0.588	B;B;B;B	0.37601	0.254;0.048;0.104;0.145	T	0.25950	-1.0117	10	0.07175	T	0.84	-17.063	13.1112	0.59275	0.0:0.0:0.6492:0.3508	.	34;146;146;146	F8WC21;O60336-2;O60336;O60336-6	.;.;MABP1_HUMAN;.	T	146;146;34;146;146;146	ENSP00000397570:A146T;ENSP00000221214:A146T;ENSP00000260357:A34T;ENSP00000393099:A146T;ENSP00000426154:A146T;ENSP00000422132:A146T	ENSP00000221214:A146T	A	+	1	0	MAPKBP1	39891555	0.989000	0.36119	0.955000	0.39395	0.964000	0.63967	1.918000	0.40006	2.549000	0.85964	0.639000	0.83563	GCC	MAPKBP1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000137802		0.617	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	71	0.00	0	G	NM_014994		42104263	42104263	+1	no_errors	ENST00000456763	ensembl	human	known	69_37n	missense	43	41.33	31	SNP	0.953	A
MGAM	8972	genome.wustl.edu	37	7	141765159	141765159	+	Silent	SNP	G	G	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr7:141765159G>A	ENST00000549489.2	+	38	4604	c.4509G>A	c.(4507-4509)caG>caA	p.Q1503Q	MGAM_ENST00000475668.2_Silent_p.Q1503Q	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1503	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.Q1503Q(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGACGGGACAGCGAGGGGTCG	0.602																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											41.0	45.0	44.0					7																	141765159		2032	4176	6208	-	-	-	SO:0001819	synonymous_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4509G>A	7.37:g.141765159G>A			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.Q1503	ENST00000549489.2	37	c.4509	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.602	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	58	0.00	0	G			141765159	141765159	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	silent	84	12.50	12	SNP	1.000	A
NMT1	4836	genome.wustl.edu	37	17	43183002	43183002	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr17:43183002C>T	ENST00000592782.1	+	13	1617	c.1486C>T	c.(1486-1488)Caa>Taa	p.Q496*	NMT1_ENST00000258960.2_Nonsense_Mutation_p.Q496*			P30419	NMT1_HUMAN	N-myristoyltransferase 1	496					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)	p.Q496*(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				ACTGGTGCTACAATAACCAGT	0.507																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											165.0	114.0	131.0					17																	43183002		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.1486C>T	17.37:g.43183002C>T	ENSP00000468424:p.Gln496*		A8K7C1|Q9UE09	Nonsense_Mutation	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.Q496*	ENST00000592782.1	37	c.1486	CCDS11494.1	17	.	.	.	.	.	.	.	.	.	.	C	27.7	4.855122	0.91355	.	.	ENSG00000136448	ENST00000258960	.	.	.	6.03	6.03	0.97812	.	0.173902	0.51477	D	0.000081	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.1098	18.3299	0.90264	0.0:1.0:0.0:0.0	.	.	.	.	X	496	.	ENSP00000258960:Q496X	Q	+	1	0	NMT1	40538528	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	5.451000	0.66632	2.861000	0.98227	0.655000	0.94253	CAA	NMT1	-	pirsf_MyristoylCoA_TrFase	ENSG00000136448		0.507	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT1	HGNC	protein_coding	OTTHUMT00000449239.1	102	0.00	0	C	NM_021079		43183002	43183002	+1	no_errors	ENST00000258960	ensembl	human	known	69_37n	nonsense	31	60.76	48	SNP	1.000	T
NPAP1	23742	genome.wustl.edu	37	15	24923646	24923646	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr15:24923646delC	ENST00000329468.2	+	1	3106	c.2632delC	c.(2632-2634)cagfs	p.Q878fs		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	878					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Q878fs*14(1)									TTTTCCTGCACAGGCAGATAG	0.507																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											107.0	106.0	106.0					15																	24923646		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2632delC	15.37:g.24923646delC	ENSP00000333735:p.Gln878fs			Frame_Shift_Del	DEL	NULL	p.Q878fs	ENST00000329468.2	37	c.2632	CCDS10015.1	15																																																																																			NPAP1	-	NULL	ENSG00000185823		0.507	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	108	0.00	0	C	NM_018958		24923646	24923646	+1	no_errors	ENST00000329468	ensembl	human	known	69_37n	frame_shift_del	82	30.47	39	DEL	0.001	-
OR6C76	390326	genome.wustl.edu	37	12	55820959	55820959	+	Frame_Shift_Del	DEL	A	A	-	rs397719965|rs57387180		TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr12:55820959delA	ENST00000328314.3	+	1	922	c.922delA	c.(922-924)aaafs	p.K311fs		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GATTTCCCACAAAAAAAAAAA	0.338																																						dbGAP											0													19.0	20.0	19.0					12																	55820959		2110	4120	6230	-	-	-	SO:0001589	frameshift_variant	0				CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.922delA	12.37:g.55820959delA	ENSP00000328402:p.Lys311fs			Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K311fs	ENST00000328314.3	37	c.922	CCDS31823.1	12																																																																																			OR6C76	-	NULL	ENSG00000185821		0.338	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C76	HGNC	protein_coding	OTTHUMT00000406675.1	34	0.00	0	A	NM_001005183		55820959	55820959	+1	no_errors	ENST00000328314	ensembl	human	known	69_37n	frame_shift_del	25	16.67	5	DEL	0.016	-
PABPC4L	132430	genome.wustl.edu	37	4	135121651	135121651	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr4:135121651C>T	ENST00000421491.3	-	2	780	c.524G>A	c.(523-525)cGa>cAa	p.R175Q	PABPC4L_ENST00000529122.2_Missense_Mutation_p.R233Q			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	175							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R233Q(2)		breast(1)|endometrium(2)	3						ACGATCTTTTCGGTTTTTGAA	0.438																																						dbGAP											2	Substitution - Missense(2)	breast(2)											183.0	146.0	157.0					4																	135121651		692	1591	2283	-	-	-	SO:0001583	missense	0			AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.524G>A	4.37:g.135121651C>T	ENSP00000463233:p.Arg175Gln			Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_PABP_1234	p.R233Q	ENST00000421491.3	37	c.698		4																																																																																			PABPC4L	-	tigrfam_PABP_1234	ENSG00000254535		0.438	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	PABPC4L	HGNC	protein_coding	OTTHUMT00000364399.2	223	0.00	0	C	NM_001114734		135121651	135121651	-1	no_errors	ENST00000529122	ensembl	human	known	69_37n	missense	97	15.65	18	SNP	1.000	T
PCDHGB6	56100	genome.wustl.edu	37	5	140788351	140788351	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr5:140788351A>T	ENST00000520790.1	+	1	582	c.582A>T	c.(580-582)ttA>ttT	p.L194F	PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	194	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L194F(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCAGAGTTATCTCTGGAGA	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											26.0	27.0	27.0					5																	140788351		1836	4088	5924	-	-	-	SO:0001583	missense	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.582A>T	5.37:g.140788351A>T	ENSP00000428603:p.Leu194Phe		Q9Y5C5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L194F	ENST00000520790.1	37	c.582	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	a	15.71	2.913116	0.52439	.	.	ENSG00000253305	ENST00000520790	T	0.62364	0.03	5.34	-3.21	0.05140	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.82912	0.5140	H	0.95470	3.675	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.978	T	0.77019	-0.2743	9	0.87932	D	0	.	14.1794	0.65564	0.3164:0.0:0.6836:0.0	.	194;194	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	F	194	ENSP00000428603:L194F	ENSP00000428603:L194F	L	+	3	2	PCDHGB6	140768535	0.354000	0.24912	0.800000	0.32199	0.966000	0.64601	0.388000	0.20735	-0.458000	0.07023	-0.456000	0.05471	TTA	PCDHGB6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253305		0.398	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1	87	0.00	0	A	NM_018926		140788351	140788351	+1	no_errors	ENST00000520790	ensembl	human	known	69_37n	missense	58	36.26	33	SNP	0.046	T
PKD1L2	114780	genome.wustl.edu	37	16	81242149	81242150	+	RNA	DEL	TT	TT	-	rs55980345|rs75398810|rs532218091|rs548490632|rs386792900	byFrequency	TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr16:81242149_81242150delTT	ENST00000525539.1	-	0	705_706				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.N236fs*26(6)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CGGACACAGGTTTCCAAAGTAG	0.554																																						dbGAP											6	Deletion - Frameshift(6)	breast(4)|lung(2)																																								-	-	-			0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81242149_81242150delTT			Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Frame_Shift_Del	DEL	pfam_Lectin_gal-bd_dom,pfam_C-type_lectin,pfam_PKD/REJ-like,superfamily_C-type_lectin_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_PKD_dom,smart_C-type_lectin,pfscan_C-type_lectin,pfscan_Lectin_gal-bd_dom,pfscan_REJ-like	p.N236fs	ENST00000525539.1	37	c.707_706		16																																																																																			PKD1L2	-	pfam_Lectin_gal-bd_dom,pfscan_Lectin_gal-bd_dom	ENSG00000166473		0.554	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387972.2	40	0.00	0	TT			81242149	81242150	-1	no_errors	ENST00000337114	ensembl	human	known	69_37n	frame_shift_del	32	11.11	4	DEL	0.998:0.999	-
PLD5	200150	genome.wustl.edu	37	1	242253180	242253180	+	Silent	SNP	G	G	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr1:242253180G>A	ENST00000536534.2	-	10	1828	c.1587C>T	c.(1585-1587)ggC>ggT	p.G529G	PLD5_ENST00000427495.1_Silent_p.G467G|PLD5_ENST00000442594.2_Silent_p.G437G			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	529						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.G437G(1)|p.G529G(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			GATCCTTTCCGCCTGTGTCGT	0.448																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											224.0	218.0	220.0					1																	242253180		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1587C>T	1.37:g.242253180G>A			A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	smart_PLipase_D/transphosphatidylase	p.G529	ENST00000536534.2	37	c.1587	CCDS1621.2	1																																																																																			PLD5	-	NULL	ENSG00000180287		0.448	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	287	0.00	0	G	NM_152666		242253180	242253180	-1	no_errors	ENST00000536534	ensembl	human	known	69_37n	silent	312	27.27	117	SNP	0.000	A
PVRL3	25945	genome.wustl.edu	37	3	110837787	110837787	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr3:110837787T>G	ENST00000485303.1	+	3	1062	c.787T>G	c.(787-789)Tta>Gta	p.L263V	PVRL3_ENST00000493615.1_Missense_Mutation_p.L240V|PVRL3_ENST00000319792.3_Missense_Mutation_p.L263V	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	263					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)	p.L263V(1)|p.L240V(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						CTCTTTCATATTAGACATACA	0.318																																						dbGAP											2	Substitution - Missense(2)	breast(2)											51.0	52.0	52.0					3																	110837787		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.787T>G	3.37:g.110837787T>G	ENSP00000418070:p.Leu263Val		E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.L263V	ENST00000485303.1	37	c.787	CCDS2957.1	3	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387575	0.61956	.	.	ENSG00000177707	ENST00000485303;ENST00000319792;ENST00000493615	T;T;T	0.28895	1.59;1.64;1.86	5.42	-0.0716	0.13742	.	0.080163	0.51477	D	0.000087	T	0.48390	0.1497	M	0.85299	2.745	0.39743	D	0.971771	D;D	0.67145	0.994;0.996	P;P	0.59546	0.859;0.817	T	0.51156	-0.8741	9	.	.	.	.	8.4724	0.32993	0.0:0.4311:0.0:0.5689	.	240;263	E9PFR0;Q9NQS3	.;PVRL3_HUMAN	V	263;263;240	ENSP00000418070:L263V;ENSP00000321514:L263V;ENSP00000420579:L240V	.	L	+	1	2	PVRL3	112320477	0.608000	0.26966	0.990000	0.47175	0.991000	0.79684	0.426000	0.21363	-0.016000	0.14127	0.528000	0.53228	TTA	PVRL3	-	NULL	ENSG00000177707		0.318	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL3	HGNC	protein_coding	OTTHUMT00000354045.1	67	0.00	0	T	NM_015480		110837787	110837787	+1	no_errors	ENST00000485303	ensembl	human	known	69_37n	missense	46	41.77	33	SNP	0.998	G
RFX4	5992	genome.wustl.edu	37	12	107078653	107078653	+	Intron	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr12:107078653C>T	ENST00000392842.1	+	6	791				RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000229387.5_Missense_Mutation_p.S21L|RP11-482D24.2_ENST00000547531.1_RNA|RFX4_ENST00000357881.4_Intron	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)						cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S21L(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						cagatagattcgagatgccca	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											72.0	60.0	64.0					12																	107078653		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.378-2009C>T	12.37:g.107078653C>T			A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Missense_Mutation	SNP	NULL	p.S21L	ENST00000392842.1	37	c.62	CCDS9106.1	12	.	.	.	.	.	.	.	.	.	.	C	1.339	-0.594727	0.03771	.	.	ENSG00000111783	ENST00000552866;ENST00000229387	T;T	0.78246	-1.16;0.92	4.44	2.57	0.30868	.	.	.	.	.	T	0.59390	0.2190	N	0.08118	0	0.09310	N	1	B	0.17268	0.021	B	0.19148	0.024	T	0.54583	-0.8272	9	0.87932	D	0	.	9.6254	0.39748	0.3807:0.6193:0.0:0.0	.	21	B2RDW4	.	L	21	ENSP00000447904:S21L;ENSP00000229387:S21L	ENSP00000229387:S21L	S	+	2	0	RFX4	105602783	0.001000	0.12720	0.002000	0.10522	0.011000	0.07611	0.912000	0.28597	0.771000	0.33359	0.655000	0.94253	TCG	RFX4	-	NULL	ENSG00000111783		0.478	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX4	HGNC	protein_coding	OTTHUMT00000402707.1	94	0.00	0	C	NM_032491		107078653	107078653	+1	no_errors	ENST00000229387	ensembl	human	known	69_37n	missense	59	32.18	28	SNP	0.003	T
RFXANK	8625	genome.wustl.edu	37	19	19304795	19304795	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr19:19304795C>T	ENST00000303088.4	+	3	514	c.40C>T	c.(40-42)Cag>Tag	p.Q14*	RFXANK_ENST00000456252.3_Nonsense_Mutation_p.Q14*|MEF2BNB_ENST00000477565.3_5'Flank|RFXANK_ENST00000407360.3_Nonsense_Mutation_p.Q14*|MEF2BNB_ENST00000585679.1_5'Flank|MEF2B_ENST00000162023.5_5'Flank|RFXANK_ENST00000392324.4_Nonsense_Mutation_p.Q14*|RFXANK_ENST00000353145.1_Nonsense_Mutation_p.Q14*|MEF2BNB_ENST00000494489.2_5'Flank|MEF2BNB_ENST00000462790.3_5'Flank|MEF2BNB-MEF2B_ENST00000444486.3_5'Flank|MEF2B_ENST00000602424.2_5'Flank|MEF2BNB-MEF2B_ENST00000514819.3_5'Flank	NM_003721.2	NP_003712.1	O14593	RFXK_HUMAN	regulatory factor X-associated ankyrin-containing protein	14					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.Q14*(1)		NS(1)|breast(1)|endometrium(1)|lung(8)|ovary(2)|prostate(1)	14			Epithelial(12;0.00228)			CATCCAGACCCAGCAGACCCC	0.557																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											163.0	176.0	171.0					19																	19304795		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF094760	CCDS12395.1, CCDS12396.1, CCDS62611.1	19p12	2014-09-17			ENSG00000064490	ENSG00000064490		"""Ankyrin repeat domain containing"""	9987	protein-coding gene	gene with protein product	"""ankyrin repeat-containing regulatory factor X-associated protein"", ""regulatory factor X subunit B"", ""RFX-Bdelta4"", ""DNA-binding protein RFXANK"""	603200				9806546, 10072068	Standard	NM_003721		Approved	BLS, RFX-B, ANKRA1, F14150_1, MGC138628	uc002nls.3	O14593	OTTHUMG00000169224	ENST00000303088.4:c.40C>T	19.37:g.19304795C>T	ENSP00000305071:p.Gln14*		O95839|Q24JQ1|Q6FGA8	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_DNA-bd_RFXANK,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q14*	ENST00000303088.4	37	c.40	CCDS12395.1	19	.	.	.	.	.	.	.	.	.	.	C	26.6	4.748718	0.89753	.	.	ENSG00000064490	ENST00000353145;ENST00000421262;ENST00000456252;ENST00000303088;ENST00000407360;ENST00000543652;ENST00000540981;ENST00000541873;ENST00000392324	.	.	.	4.43	3.37	0.38596	.	0.499081	0.19094	N	0.122874	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-12.8592	10.3219	0.43771	0.0:0.7991:0.2008:0.0	.	.	.	.	X	14	.	ENSP00000305071:Q14X	Q	+	1	0	RFXANK	19165795	0.993000	0.37304	0.103000	0.21229	0.013000	0.08279	3.426000	0.52778	0.845000	0.35118	-0.502000	0.04539	CAG	RFXANK	-	pirsf_DNA-bd_RFXANK	ENSG00000064490		0.557	RFXANK-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	RFXANK	HGNC	protein_coding	OTTHUMT00000402923.2	88	0.00	0	C	NM_003721		19304795	19304795	+1	no_errors	ENST00000303088	ensembl	human	known	69_37n	nonsense	63	33.68	32	SNP	0.635	T
RGPD3	653489	genome.wustl.edu	37	2	107040513	107040516	+	Frame_Shift_Del	DEL	TAGA	TAGA	-			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	TAGA	TAGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr2:107040513_107040516delTAGA	ENST00000409886.3	-	20	3994_3997	c.3907_3910delTCTA	c.(3907-3912)tctaagfs	p.SK1303fs	RGPD3_ENST00000304514.7_Frame_Shift_Del_p.SK1303fs	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1303					protein targeting to Golgi (GO:0000042)			p.K1304fs*5(2)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						GCAGGAGACTTAGATAGACTCAAA	0.407																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)								6,2980		3,0,1490						2.3	1.0			7	14,6270		7,0,3135	no	frameshift	RGPD3	NM_001144013.1		10,0,4625	A1A1,A1R,RR		0.2228,0.2009,0.2157				20,9250				-	-	-	SO:0001589	frameshift_variant	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.3907_3910delTCTA	2.37:g.107040517_107040520delTAGA	ENSP00000386588:p.Ser1303fs		B8ZZM4	Frame_Shift_Del	DEL	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.K1304fs	ENST00000409886.3	37	c.3910_3907	CCDS46379.1	2																																																																																			RGPD3	-	NULL	ENSG00000153165		0.407	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	170	0.00	0	TAGA	XM_929931		107040513	107040516	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	frame_shift_del	142	24.06	45	DEL	1.000:0.998:1.000:1.000	-
RGS5	8490	genome.wustl.edu	37	1	163117185	163117185	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr1:163117185C>T	ENST00000313961.5	-	5	770	c.493G>A	c.(493-495)Gat>Aat	p.D165N	RGS5_ENST00000527988.1_Missense_Mutation_p.D57N|RGS5_ENST00000530507.1_Missense_Mutation_p.D169N|RGS5_ENST00000367903.3_Missense_Mutation_p.D185N	NM_001254749.1|NM_003617.3	NP_001241678.1|NP_003608.1	O15539	RGS5_HUMAN	regulator of G-protein signaling 5	165	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.D165N(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20			LUSC - Lung squamous cell carcinoma(543;0.187)			GGCAGAGAATCCTTTTCCATC	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											143.0	128.0	133.0					1																	163117185		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF030108	CCDS1244.1, CCDS55652.1, CCDS58041.1	1q23.1	2008-02-05	2007-08-14		ENSG00000143248	ENSG00000143248		"""Regulators of G-protein signaling"""	10001	protein-coding gene	gene with protein product		603276	"""regulator of G-protein signalling 5"""			9747037	Standard	NM_003617		Approved		uc021pdt.1	O15539	OTTHUMG00000034441	ENST00000313961.5:c.493G>A	1.37:g.163117185C>T	ENSP00000319308:p.Asp165Asn		E9PMP5|Q53XA9|Q599J0	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.D165N	ENST00000313961.5	37	c.493	CCDS1244.1	1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.993117	0.93167	.	.	ENSG00000143248	ENST00000313961;ENST00000367903;ENST00000530507;ENST00000527988	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.21	5.21	0.72293	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.80276	0.4593	M	0.85777	2.775	0.46061	D	0.998844	D	0.69078	0.997	D	0.78314	0.991	T	0.81801	-0.0766	9	0.48119	T	0.1	.	16.2836	0.82708	0.0:1.0:0.0:0.0	.	165	O15539	RGS5_HUMAN	N	165;185;169;57	ENSP00000319308:D165N;ENSP00000356879:D185N;ENSP00000433001:D169N;ENSP00000432313:D57N	ENSP00000319308:D165N	D	-	1	0	RGS5	161383809	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.976000	0.70484	2.435000	0.82474	0.655000	0.94253	GAT	RGS5	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	ENSG00000143248		0.443	RGS5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGS5	HGNC	protein_coding	OTTHUMT00000083264.1	133	0.00	0	C	NM_003617		163117185	163117185	-1	no_errors	ENST00000313961	ensembl	human	known	69_37n	missense	112	32.12	53	SNP	1.000	T
SLX4	84464	genome.wustl.edu	37	16	3640194	3640194	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr16:3640194C>A	ENST00000294008.3	-	12	4085	c.3445G>T	c.(3445-3447)Gat>Tat	p.D1149Y		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1149	Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.D1149Y(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						ATGACCTCATCTTCTTCGTTC	0.438								Direct reversal of damage																														dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	103.0	105.0					16																	3640194		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.3445G>T	16.37:g.3640194C>A	ENSP00000294008:p.Asp1149Tyr		Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.D1149Y	ENST00000294008.3	37	c.3445	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902093	0.52227	.	.	ENSG00000188827	ENST00000294008	T	0.19250	2.16	5.62	0.397	0.16314	.	1.452040	0.03874	N	0.276121	T	0.28863	0.0716	L	0.52573	1.65	0.09310	N	1	D	0.56287	0.975	P	0.48901	0.594	T	0.31586	-0.9938	10	0.62326	D	0.03	.	8.5624	0.33518	0.0:0.636:0.0:0.364	.	1149	Q8IY92	SLX4_HUMAN	Y	1149	ENSP00000294008:D1149Y	ENSP00000294008:D1149Y	D	-	1	0	SLX4	3580195	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.061000	0.14366	-0.128000	0.11641	-0.123000	0.14984	GAT	SLX4	-	NULL	ENSG00000188827		0.438	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	119	0.00	0	C	NM_032444		3640194	3640194	-1	no_errors	ENST00000294008	ensembl	human	known	69_37n	missense	97	37.97	60	SNP	0.000	A
SMCHD1	23347	genome.wustl.edu	37	18	2743899	2743899	+	Silent	SNP	C	C	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr18:2743899C>T	ENST00000320876.6	+	29	4112	c.3774C>T	c.(3772-3774)ctC>ctT	p.L1258L	SMCHD1_ENST00000261598.8_Silent_p.L1258L|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1258					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)	p.L1258L(2)|p.L706L(1)		NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						CTAAACTTCTCCTTATAGACT	0.383																																						dbGAP											3	Substitution - coding silent(3)	breast(3)											79.0	71.0	73.0					18																	2743899		1829	4084	5913	-	-	-	SO:0001819	synonymous_variant	0			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3774C>T	18.37:g.2743899C>T			O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_ATPase-like_ATP-bd,smart_SMC_hinge	p.L1258	ENST00000320876.6	37	c.3774	CCDS45822.1	18																																																																																			SMCHD1	-	NULL	ENSG00000101596		0.383	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	160	0.00	0	C			2743899	2743899	+1	no_errors	ENST00000320876	ensembl	human	known	69_37n	silent	138	38.12	85	SNP	0.575	T
TEK	7010	genome.wustl.edu	37	9	27169494	27169494	+	Silent	SNP	G	G	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr9:27169494G>A	ENST00000380036.4	+	4	937	c.495G>A	c.(493-495)gtG>gtA	p.V165V	TEK_ENST00000406359.4_Silent_p.V165V|TEK_ENST00000519097.1_Silent_p.V61V	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	165					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V165V(1)		breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	TCCATTCAGTGCCCCGGCATG	0.488																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											160.0	159.0	159.0					9																	27169494		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.495G>A	9.37:g.27169494G>A			A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V165	ENST00000380036.4	37	c.495	CCDS6519.1	9																																																																																			TEK	-	NULL	ENSG00000120156		0.488	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	76	0.00	0	G			27169494	27169494	+1	no_errors	ENST00000380036	ensembl	human	known	69_37n	silent	13	62.86	22	SNP	1.000	A
TMEM9B	56674	genome.wustl.edu	37	11	8969901	8969901	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr11:8969901T>A	ENST00000534025.1	-	5	1022	c.563A>T	c.(562-564)aAg>aTg	p.K188M	TMEM9B_ENST00000309134.5_Missense_Mutation_p.K114M|TMEM9B_ENST00000525069.1_Missense_Mutation_p.K114M	NM_020644.1	NP_065695.1	Q9NQ34	TMM9B_HUMAN	TMEM9 domain family, member B	188					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)	p.K188M(1)		breast(1)|lung(1)|prostate(1)	3				Epithelial(150;4.39e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0237)		AAAGACAGACTTTCGCTGCTC	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											139.0	130.0	133.0					11																	8969901		2201	4296	6497	-	-	-	SO:0001583	missense	0			AJ400877	CCDS7796.1, CCDS66021.1	11p15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000175348	ENSG00000175348			1168	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 15"""	C11orf15		11528127	Standard	NM_001286095		Approved		uc001mhe.1	Q9NQ34	OTTHUMG00000165676	ENST00000534025.1:c.563A>T	11.37:g.8969901T>A	ENSP00000433361:p.Lys188Met		Q7Z649	Missense_Mutation	SNP	pfam_TMEM9	p.K188M	ENST00000534025.1	37	c.563	CCDS7796.1	11	.	.	.	.	.	.	.	.	.	.	T	21.0	4.089046	0.76756	.	.	ENSG00000175348	ENST00000309134;ENST00000534025;ENST00000525069	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.78622	0.4312	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.81136	-0.1070	9	0.87932	D	0	.	14.9988	0.71455	0.0:0.0:0.0:1.0	.	188	Q9NQ34	TMM9B_HUMAN	M	114;188;114	.	ENSP00000311842:K114M	K	-	2	0	TMEM9B	8926477	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.987000	0.70571	2.279000	0.76181	0.533000	0.62120	AAG	TMEM9B	-	pfam_TMEM9	ENSG00000175348		0.502	TMEM9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM9B	HGNC	protein_coding	OTTHUMT00000385722.1	48	0.00	0	T			8969901	8969901	-1	no_errors	ENST00000534025	ensembl	human	known	69_37n	missense	49	38.27	31	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578429	7578429	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr17:7578429delC	ENST00000269305.4	-	5	690	c.501delG	c.(499-501)cagfs	p.Q167fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.Q167fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.Q167fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.Q167fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.Q167fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.Q167fs|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	167	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HD (in a sporadic cancer; somatic mutation).|QH -> YL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Q167H(3)|p.Q167fs*3(3)|p.Q167Q(3)|p.Q167fs*14(2)|p.V157_C176del20(1)|p.Q167_H168>YL(1)|p.Q167del(1)|p.A159_Q167delAMAIYKQSQ(1)|p.Q167fs*4(1)|p.Y163fs*1(1)|p.Q35fs*3(1)|p.Q167fs*12(1)|p.P151_V173del23(1)|p.Q165_M169delQSQHM(1)|p.S149fs*72(1)|p.Q167_H168>HD(1)|p.Q74fs*3(1)|p.H168fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGTCATGTGCTGTGACTGCT	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Deletion - Frameshift(8)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(4)|Substitution - Missense(3)|Substitution - coding silent(3)|Complex - compound substitution(2)	breast(7)|lung(6)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(2)|central_nervous_system(2)|oesophagus(2)|prostate(2)|upper_aerodigestive_tract(1)|biliary_tract(1)|salivary_gland(1)|ovary(1)											54.0	54.0	54.0					17																	7578429		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.501delG	17.37:g.7578429delC	ENSP00000269305:p.Gln167fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Q167fs	ENST00000269305.4	37	c.501	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	64	0.00	0	C	NM_000546		7578429	7578429	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	9	72.50	29	DEL	0.986	-
UHRF1BP1L	23074	genome.wustl.edu	37	12	100482727	100482727	+	Silent	SNP	T	T	C			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr12:100482727T>C	ENST00000279907.7	-	8	1199	c.987A>G	c.(985-987)ctA>ctG	p.L329L	UHRF1BP1L_ENST00000545232.2_5'UTR|UHRF1BP1L_ENST00000356828.3_Silent_p.L329L	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	329								p.L329L(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						CACATATGTGTAGATCTAGAT	0.303																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											76.0	73.0	74.0					12																	100482727		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.987A>G	12.37:g.100482727T>C			A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Silent	SNP	NULL	p.L329	ENST00000279907.7	37	c.987	CCDS31882.1	12																																																																																			UHRF1BP1L	-	NULL	ENSG00000111647		0.303	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	120	0.00	0	T	NM_001006947		100482727	100482727	-1	no_errors	ENST00000279907	ensembl	human	known	69_37n	silent	92	44.91	75	SNP	1.000	C
UNC45A	55898	genome.wustl.edu	37	15	91496180	91496180	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr15:91496180G>T	ENST00000418476.2	+	18	2365	c.2325G>T	c.(2323-2325)aaG>aaT	p.K775N	RCCD1_ENST00000394258.2_5'Flank|RCCD1_ENST00000556618.1_5'Flank|UNC45A_ENST00000394275.2_Missense_Mutation_p.K760N|AC068831.6_ENST00000553321.1_RNA|RCCD1_ENST00000555155.1_5'Flank	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	775					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.K775N(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TGAAGGAGAAGGCTGTGCCCA	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	57.0	64.0					15																	91496180		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.2325G>T	15.37:g.91496180G>T	ENSP00000407487:p.Lys775Asn		A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K775N	ENST00000418476.2	37	c.2325	CCDS10367.1	15	.	.	.	.	.	.	.	.	.	.	g	14.24	2.477115	0.44044	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.48522	0.81;0.81	4.88	2.01	0.26516	Armadillo-like helical (1);Armadillo-type fold (1);	0.396202	0.30492	N	0.009507	T	0.38665	0.1049	L	0.46670	1.46	0.50313	D	0.999863	B;B	0.29301	0.241;0.151	B;B	0.33454	0.164;0.073	T	0.09422	-1.0675	10	0.26408	T	0.33	-29.0073	9.3824	0.38322	0.2252:0.0:0.7748:0.0	.	775;760	Q9H3U1;A8K6F7	UN45A_HUMAN;.	N	760;775	ENSP00000377816:K760N;ENSP00000407487:K775N	ENSP00000377816:K760N	K	+	3	2	UNC45A	89297184	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	1.258000	0.32944	0.281000	0.22233	0.645000	0.84053	AAG	UNC45A	-	superfamily_ARM-type_fold	ENSG00000140553		0.527	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45A	HGNC	protein_coding	OTTHUMT00000280406.2	24	0.00	0	G	NM_018671		91496180	91496180	+1	no_errors	ENST00000418476	ensembl	human	known	69_37n	missense	20	39.39	13	SNP	1.000	T
VPS53	55275	genome.wustl.edu	37	17	489514	489514	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr17:489514C>A	ENST00000571805.1	-	13	1445	c.1309G>T	c.(1309-1311)Gac>Tac	p.D437Y	VPS53_ENST00000401468.3_Missense_Mutation_p.D160Y|VPS53_ENST00000446250.2_Missense_Mutation_p.D239Y|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000576149.1_5'UTR|VPS53_ENST00000291074.5_Missense_Mutation_p.D408Y|VPS53_ENST00000437048.2_Missense_Mutation_p.D437Y			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	437					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)		p.D437Y(1)|p.D408Y(1)		breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		ACTCACTTGTCTTGGGATTCG	0.488																																						dbGAP											2	Substitution - Missense(2)	breast(2)											150.0	136.0	141.0					17																	489514		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.1309G>T	17.37:g.489514C>A	ENSP00000459312:p.Asp437Tyr		A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	pfam_Vps53_N,pfam_Vacuolar_sorting-assoc_54	p.D437Y	ENST00000571805.1	37	c.1309		17	.	.	.	.	.	.	.	.	.	.	C	31	5.058359	0.93846	.	.	ENSG00000141252	ENST00000437048;ENST00000446250;ENST00000291074;ENST00000401468;ENST00000389040	T;T;T;T;T	0.46451	1.35;1.35;1.35;1.35;0.87	6.07	6.07	0.98685	Vps53-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73768	0.3629	M	0.91406	3.205	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.998;0.999;0.997	T	0.78440	-0.2203	10	0.87932	D	0	.	19.2077	0.93739	0.0:1.0:0.0:0.0	.	160;437;239;437;408	E7EVT8;Q5VIR6-4;G3V0H8;Q5VIR6;Q5VIR6-2	.;.;.;VPS53_HUMAN;.	Y	437;239;408;160;389	ENSP00000401435:D437Y;ENSP00000394386:D239Y;ENSP00000291074:D408Y;ENSP00000384294:D160Y;ENSP00000373692:D389Y	ENSP00000291074:D408Y	D	-	1	0	VPS53	436264	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.137000	0.77295	2.884000	0.98904	0.655000	0.94253	GAC	VPS53	-	pfam_Vps53_N	ENSG00000141252		0.488	VPS53-006	KNOWN	basic	protein_coding	VPS53	HGNC	protein_coding	OTTHUMT00000436940.2	138	0.00	0	C	NM_018289		489514	489514	-1	no_errors	ENST00000437048	ensembl	human	known	69_37n	missense	36	66.04	70	SNP	1.000	A
WSB2	55884	genome.wustl.edu	37	12	118472017	118472017	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr12:118472017G>T	ENST00000315436.3	-	9	1340	c.1199C>A	c.(1198-1200)aCa>aAa	p.T400K	WSB2_ENST00000536738.1_5'Flank|WSB2_ENST00000542304.1_Missense_Mutation_p.T175K|WSB2_ENST00000441406.2_Missense_Mutation_p.T417K|WSB2_ENST00000544233.1_Missense_Mutation_p.T190K|WSB2_ENST00000535496.1_Missense_Mutation_p.T402K	NM_001278557.1|NM_018639.3	NP_001265486.1|NP_061109.1	Q9NYS7	WSB2_HUMAN	WD repeat and SOCS box containing 2	400	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.T400K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGTCCTGTATGTGAGGAACTC	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											242.0	203.0	216.0					12																	118472017		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038187	CCDS9186.1, CCDS61251.1, CCDS61252.1	12q24.23	2013-01-09	2011-01-25		ENSG00000176871	ENSG00000176871		"""WD repeat domain containing"""	19222	protein-coding gene	gene with protein product			"""WD repeat and SOCS box-containing 2"""			12076535	Standard	NM_018639		Approved	SBA2, MGC10210	uc001twr.2	Q9NYS7	OTTHUMG00000168885	ENST00000315436.3:c.1199C>A	12.37:g.118472017G>T	ENSP00000319474:p.Thr400Lys		B4DIE6|B4DPV6|Q9NRX9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SOCS_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,smart_SOCS_C,prints_G-protein_beta_WD-40_rep,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T400K	ENST00000315436.3	37	c.1199	CCDS9186.1	12	.	.	.	.	.	.	.	.	.	.	G	25.7	4.660923	0.88154	.	.	ENSG00000176871	ENST00000315436;ENST00000542304;ENST00000441406;ENST00000544233;ENST00000535496	T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1	5.9	5.9	0.94986	SOCS protein, C-terminal (4);	0.043083	0.85682	D	0.000000	T	0.38026	0.1025	N	0.20483	0.58	0.80722	D	1	P	0.51537	0.946	P	0.45856	0.495	T	0.17319	-1.0373	10	0.49607	T	0.09	-21.5342	19.874	0.96863	0.0:0.0:1.0:0.0	.	400	Q9NYS7	WSB2_HUMAN	K	400;175;417;190;402	ENSP00000319474:T400K;ENSP00000445941:T175K;ENSP00000409131:T417K;ENSP00000444431:T190K;ENSP00000439450:T402K	ENSP00000319474:T400K	T	-	2	0	WSB2	116956400	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	9.467000	0.97671	2.788000	0.95919	0.650000	0.86243	ACA	WSB2	-	pfam_SOCS_C,smart_SOCS_C,pfscan_SOCS_C	ENSG00000176871		0.453	WSB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSB2	HGNC	protein_coding	OTTHUMT00000401515.1	154	0.00	0	G	NM_018639		118472017	118472017	-1	no_errors	ENST00000315436	ensembl	human	known	69_37n	missense	135	30.05	58	SNP	1.000	T
ZNF729	100287226	genome.wustl.edu	37	19	22496524	22496524	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A0U3-01A-11D-A10G-09	TCGA-AR-A0U3-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c8251555-77d3-4a20-9cc0-f7df0fda5955	264507ec-fd44-4bf0-94aa-abbe52c03810	g.chr19:22496524A>G	ENST00000601693.1	+	4	423	c.305A>G	c.(304-306)gAt>gGt	p.D102G	ZNF729_ENST00000357491.6_Missense_Mutation_p.D102G			A6NN14	ZN729_HUMAN	zinc finger protein 729	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D102G(1)		breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						AGCACAAAAGATTCTTTCCAA	0.343																																						dbGAP											1	Substitution - Missense(1)	breast(1)																																								-	-	-	SO:0001583	missense	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.305A>G	19.37:g.22496524A>G	ENSP00000469582:p.Asp102Gly		M0QY45	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D102G	ENST00000601693.1	37	c.305	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	9.102	1.004472	0.19199	.	.	ENSG00000196350	ENST00000357491	T	0.07114	3.22	1.55	-3.1	0.05315	.	.	.	.	.	T	0.07638	0.0192	L	0.48986	1.54	.	.	.	.	.	.	.	.	.	T	0.32322	-0.9911	6	0.39692	T	0.17	.	0.5382	0.00640	0.4454:0.205:0.1478:0.2018	.	.	.	.	G	102	ENSP00000350085:D102G	ENSP00000350085:D102G	D	+	2	0	ZNF729	22288364	0.011000	0.17503	0.000000	0.03702	0.002000	0.02628	1.086000	0.30853	-1.208000	0.02634	-0.686000	0.03744	GAT	ZNF729	-	NULL	ENSG00000196350		0.343	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	116	0.00	0	A	XM_496301		22496524	22496524	+1	no_stop_codon	ENST00000357491	ensembl	human	known	69_37n	missense	92	44.24	73	SNP	0.000	G
