#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ZNF721	170960	genome.wustl.edu	37	4	467894	467894	+	Intron	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr4:467894G>A	ENST00000338977.5	-	1	47				ZNF721_ENST00000507078.1_5'Flank|ZNF721_ENST00000511833.2_Intron|ZNF721_ENST00000506646.1_5'UTR|ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						TGTGGAAGCAGGGAAGTGAGG	0.607																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1+24950C>T	4.37:g.467894G>A			Q69YG7	RNA	SNP	-	NULL	ENST00000338977.5	37	NULL		4																																																																																			ABCA11P	-	-	ENSG00000251595		0.607	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	ABCA11P	HGNC	protein_coding	OTTHUMT00000357939.1	61	0.00	0	G	NM_133474		467894	467894	-1	no_errors	ENST00000451020	ensembl	human	known	69_37n	rna	42	25.00	14	SNP	0.001	A
AIM1	202	genome.wustl.edu	37	6	106991455	106991455	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr6:106991455G>C	ENST00000369066.3	+	9	4285	c.3798G>C	c.(3796-3798)atG>atC	p.M1266I	AIM1_ENST00000535438.1_Missense_Mutation_p.M85I	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TGGGGTCTATGAAAGTTCTAA	0.408																																						dbGAP											0													261.0	253.0	255.0					6																	106991455		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.3798G>C	6.37:g.106991455G>C	ENSP00000358062:p.Met1266Ile		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.M1266I	ENST00000369066.3	37	c.3798	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	8.329	0.825962	0.16749	.	.	ENSG00000112297	ENST00000369066;ENST00000457437;ENST00000535438	T;T;T	0.70164	-0.46;-0.46;-0.46	5.82	4.84	0.62591	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.251264	0.48286	D	0.000184	T	0.13798	0.0334	N	0.01817	-0.705	0.26403	N	0.976391	B;B	0.11235	0.0;0.004	B;B	0.17098	0.004;0.017	T	0.25676	-1.0125	10	0.02654	T	1	.	8.2952	0.31982	0.1335:0.1605:0.7059:0.0	.	85;1266	B4DU04;Q9Y4K1	.;AIM1_HUMAN	I	1266;85;85	ENSP00000358062:M1266I;ENSP00000391419:M85I;ENSP00000439183:M85I	ENSP00000358062:M1266I	M	+	3	0	AIM1	107098148	1.000000	0.71417	0.998000	0.56505	0.287000	0.27160	1.554000	0.36266	2.758000	0.94735	0.650000	0.86243	ATG	AIM1	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000112297		0.408	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	540	0.18	1	G			106991455	106991455	+1	no_errors	ENST00000369066	ensembl	human	known	69_37n	missense	395	20.36	101	SNP	1.000	C
AKR1C1	1645	genome.wustl.edu	37	10	5010513	5010513	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr10:5010513G>A	ENST00000380872.4	+	4	574	c.382G>A	c.(382-384)Gtg>Atg	p.V128M	AKR1C1_ENST00000380859.1_Missense_Mutation_p.V130M|AKR1C1_ENST00000434459.2_Missense_Mutation_p.V128M|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	128					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	AGGTGAGGAAGTGATCCCAAA	0.428																																					Colon(130;2054 2316 13360 15380)	dbGAP											0													24.0	20.0	21.0					10																	5010513		2183	4240	6423	-	-	-	SO:0001583	missense	0			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.382G>A	10.37:g.5010513G>A	ENSP00000370254:p.Val128Met		P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.V128M	ENST00000380872.4	37	c.382	CCDS7061.1	10	.	.	.	.	.	.	.	.	.	.	g	1.191	-0.635265	0.03584	.	.	ENSG00000187134	ENST00000434459;ENST00000380872;ENST00000380859	T;T;T	0.51574	0.7;0.7;0.7	2.63	-5.26	0.02772	NADP-dependent oxidoreductase domain (3);	1.444650	0.04991	N	0.467237	T	0.22859	0.0552	N	0.05124	-0.11	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.18023	-1.0350	10	0.59425	D	0.04	.	3.1136	0.06367	0.2077:0.516:0.1153:0.161	.	128	Q04828	AK1C1_HUMAN	M	128;128;130	ENSP00000412248:V128M;ENSP00000370254:V128M;ENSP00000370240:V130M	ENSP00000370240:V130M	V	+	1	0	AKR1C1	5000513	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.866000	0.00176	-3.552000	0.00142	-2.179000	0.00317	GTG	AKR1C1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000187134		0.428	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C1	HGNC	protein_coding	OTTHUMT00000046523.2	208	0.00	0	G	NM_001353		5010513	5010513	+1	no_errors	ENST00000380872	ensembl	human	known	69_37n	missense	162	23.58	50	SNP	0.000	A
ARHGEF4	50649	genome.wustl.edu	37	2	131704164	131704164	+	Missense_Mutation	SNP	C	C	T	rs201813341		TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr2:131704164C>T	ENST00000326016.5	+	4	902	c.383C>T	c.(382-384)aCg>aTg	p.T128M	ARHGEF4_ENST00000525839.1_Missense_Mutation_p.T128M|ARHGEF4_ENST00000428230.2_Missense_Mutation_p.T128M|ARHGEF4_ENST00000409359.1_Missense_Mutation_p.T984M|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.T128M|ARHGEF4_ENST00000409303.1_Missense_Mutation_p.T128M	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	128					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		AGTGCTCCAACGGGACTGAAC	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		19890	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													115.0	113.0	114.0					2																	131704164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.383C>T	2.37:g.131704164C>T	ENSP00000316845:p.Thr128Met		Q9HDC6|Q9UPP0	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.T128M	ENST00000326016.5	37	c.383	CCDS2165.1	2	.	.	.	.	.	.	.	.	.	.	C	1.489	-0.555129	0.03967	.	.	ENSG00000136002	ENST00000409359;ENST00000326016;ENST00000392953;ENST00000438985;ENST00000428230;ENST00000525839;ENST00000409303	T;T;T;T;T;T;T	0.70399	0.91;-0.2;-0.31;0.9;0.92;-0.31;-0.48	4.48	-2.19	0.07015	.	0.734995	0.10189	N	0.704935	T	0.44746	0.1308	N	0.12746	0.255	0.09310	N	1	B;B;B;B	0.34181	0.133;0.44;0.028;0.012	B;B;B;B	0.21917	0.009;0.037;0.006;0.009	T	0.16129	-1.0413	10	0.41790	T	0.15	.	9.0652	0.36458	0.0:0.3949:0.0:0.6051	.	128;984;128;128	E9PEM0;E7EV07;Q9NR80-4;Q9NR80	.;.;.;ARHG4_HUMAN	M	984;128;128;308;128;128;128	ENSP00000386794:T984M;ENSP00000316845:T128M;ENSP00000376680:T128M;ENSP00000389661:T308M;ENSP00000398455:T128M;ENSP00000432267:T128M;ENSP00000387285:T128M	ENSP00000316845:T128M	T	+	2	0	ARHGEF4	131420634	0.000000	0.05858	0.001000	0.08648	0.041000	0.13682	-1.012000	0.03649	-0.474000	0.06862	-0.142000	0.14014	ACG	ARHGEF4	-	NULL	ENSG00000136002		0.527	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	HGNC	protein_coding	OTTHUMT00000254554.4	183	0.00	0	C			131704164	131704164	+1	no_errors	ENST00000326016	ensembl	human	known	69_37n	missense	158	22.93	47	SNP	0.000	T
C10orf12	26148	genome.wustl.edu	37	10	98744191	98744191	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr10:98744191G>A	ENST00000286067.2	+	1	3151	c.3044G>A	c.(3043-3045)cGt>cAt	p.R1015H		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	1015										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		GCCCAGCAACGTTTAATCAAG	0.473																																						dbGAP											0													68.0	71.0	70.0					10																	98744191		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.3044G>A	10.37:g.98744191G>A	ENSP00000286067:p.Arg1015His		Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.R1015H	ENST00000286067.2	37	c.3044	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	G	11.55	1.673393	0.29693	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.10763	2.84	5.34	5.34	0.76211	.	0.000000	0.44097	U	0.000490	T	0.18923	0.0454	L	0.36672	1.1	0.09310	N	1	D	0.89917	1.0	P	0.61003	0.882	T	0.04991	-1.0913	10	0.44086	T	0.13	-6.3657	11.6734	0.51415	0.0815:0.0:0.9185:0.0	.	1015	Q8N655	CJ012_HUMAN	H	1015;849	ENSP00000286067:R1015H	ENSP00000286067:R1015H	R	+	2	0	C10orf12	98734181	0.014000	0.17966	0.299000	0.25016	0.169000	0.22640	1.994000	0.40757	2.521000	0.84997	0.655000	0.94253	CGT	C10orf12	-	NULL	ENSG00000155640		0.473	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	66	0.00	0	G	NM_015652		98744191	98744191	+1	no_errors	ENST00000286067	ensembl	human	known	69_37n	missense	85	17.48	18	SNP	0.106	A
C9orf163	158055	genome.wustl.edu	37	9	139379395	139379395	+	Silent	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr9:139379395C>T	ENST00000354376.1	+	1	1449	c.495C>T	c.(493-495)ctC>ctT	p.L165L		NM_152571.2	NP_689784.1	Q8N9P6	CI163_HUMAN	chromosome 9 open reading frame 163	165										kidney(1)|lung(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.36e-06)|Epithelial(140;5.65e-06)		TGCTGCCTCTCAGGCGTGGGG	0.627											OREG0019617	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													58.0	61.0	60.0					9																	139379395		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055336	CCDS7001.1	9q34.3	2006-03-21			ENSG00000196366	ENSG00000196366			26718	protein-coding gene	gene with protein product							Standard	NM_152571		Approved	FLJ36779	uc004chy.3	Q8N9P6	OTTHUMG00000131725	ENST00000354376.1:c.495C>T	9.37:g.139379395C>T		1648		Silent	SNP	NULL	p.L165	ENST00000354376.1	37	c.495	CCDS7001.1	9																																																																																			C9orf163	-	NULL	ENSG00000196366		0.627	C9orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf163	HGNC	protein_coding	OTTHUMT00000254644.1	60	0.00	0	C	NM_152571		139379395	139379395	+1	no_errors	ENST00000354376	ensembl	human	known	69_37n	silent	48	28.36	19	SNP	0.000	T
CCDC138	165055	genome.wustl.edu	37	2	109473397	109473397	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr2:109473397A>T	ENST00000295124.4	+	13	1724	c.1664A>T	c.(1663-1665)gAt>gTt	p.D555V	CCDC138_ENST00000412964.2_Missense_Mutation_p.D555V	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	555										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						AATGTTATTGATAGTTTGCTC	0.343																																						dbGAP											0													85.0	90.0	89.0					2																	109473397		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.1664A>T	2.37:g.109473397A>T	ENSP00000295124:p.Asp555Val		Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	NULL	p.D555V	ENST00000295124.4	37	c.1664	CCDS2080.1	2	.	.	.	.	.	.	.	.	.	.	a	15.40	2.821793	0.50633	.	.	ENSG00000163006	ENST00000412964;ENST00000295124	T;T	0.64991	-0.13;-0.0	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.78136	0.4236	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.80975	-0.1142	10	0.87932	D	0	-24.1488	15.0364	0.71751	1.0:0.0:0.0:0.0	.	555;555	Q96M89-2;Q96M89	.;CC138_HUMAN	V	555	ENSP00000411800:D555V;ENSP00000295124:D555V	ENSP00000295124:D555V	D	+	2	0	CCDC138	108839829	1.000000	0.71417	0.976000	0.42696	0.255000	0.26057	4.829000	0.62737	2.039000	0.60335	0.477000	0.44152	GAT	CCDC138	-	NULL	ENSG00000163006		0.343	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC138	HGNC	protein_coding	OTTHUMT00000253593.1	280	0.00	0	A	NM_144978		109473397	109473397	+1	no_errors	ENST00000295124	ensembl	human	known	69_37n	missense	196	19.01	46	SNP	1.000	T
CFHR2	3080	genome.wustl.edu	37	1	196871653	196871653	+	Intron	SNP	A	A	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr1:196871653A>G	ENST00000367421.3	+	2	135				CFHR4_ENST00000367418.2_Intron|CFHR4_ENST00000367416.2_Missense_Mutation_p.Y54C|CFHR4_ENST00000251424.4_Missense_Mutation_p.Y55C|CFHR4_ENST00000608469.1_Intron			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TATTCCTATTACTGTGATCAA	0.393																																						dbGAP											0													131.0	138.0	136.0					1																	196871653		2132	4279	6411	-	-	-	SO:0001627	intron_variant	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-46932A>G	1.37:g.196871653A>G			Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Y54C	ENST00000367421.3	37	c.161		1	.	.	.	.	.	.	.	.	.	.	.	11.27	1.588697	0.28357	.	.	ENSG00000134365	ENST00000367416;ENST00000251424	T;T	0.64803	-0.12;-0.12	3.7	-4.31	0.03698	Complement control module (2);Sushi/SCR/CCP (2);	.	.	.	.	T	0.69151	0.3079	M	0.76574	2.34	0.09310	N	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.961;0.984	T	0.59794	-0.7387	9	0.54805	T	0.06	.	0.8815	0.01235	0.2579:0.3433:0.2305:0.1682	.	54;55;55	C9J7J7;Q5DVJ7;Q92496	.;.;FHR4_HUMAN	C	54;55	ENSP00000356386:Y54C;ENSP00000251424:Y55C	ENSP00000251424:Y55C	Y	+	2	0	CFHR4	195138276	0.000000	0.05858	0.005000	0.12908	0.010000	0.07245	-1.000000	0.03693	-0.338000	0.08413	0.358000	0.22013	TAC	CFHR4	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP	ENSG00000134365		0.393	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	HGNC	protein_coding		364	0.00	0	A	NM_005666		196871653	196871653	+1	no_errors	ENST00000367416	ensembl	human	known	69_37n	missense	281	43.60	218	SNP	0.000	G
COL5A3	50509	genome.wustl.edu	37	19	10114309	10114309	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr19:10114309C>T	ENST00000264828.3	-	6	866	c.781G>A	c.(781-783)Ggg>Agg	p.G261R		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	261	Nonhelical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTGCCCTTCCCCTTGCGACCT	0.577																																						dbGAP											0													267.0	196.0	220.0					19																	10114309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.781G>A	19.37:g.10114309C>T	ENSP00000264828:p.Gly261Arg		Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.G261R	ENST00000264828.3	37	c.781	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720000	0.30503	.	.	ENSG00000080573	ENST00000264828	D	0.89123	-2.47	4.08	4.08	0.47627	.	1.020640	0.07820	U	0.959701	D	0.90086	0.6903	N	0.25647	0.755	0.33419	D	0.579577	D	0.89917	1.0	D	0.87578	0.998	D	0.84319	0.0515	10	0.18276	T	0.48	.	12.0324	0.53406	0.0:1.0:0.0:0.0	.	261	P25940	CO5A3_HUMAN	R	261	ENSP00000264828:G261R	ENSP00000264828:G261R	G	-	1	0	COL5A3	9975309	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	2.211000	0.42825	2.272000	0.75746	0.456000	0.33151	GGG	COL5A3	-	NULL	ENSG00000080573		0.577	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	408	0.00	0	C	NM_015719		10114309	10114309	-1	no_errors	ENST00000264828	ensembl	human	known	69_37n	missense	404	19.20	96	SNP	1.000	T
COQ10A	93058	genome.wustl.edu	37	12	56663001	56663001	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr12:56663001C>T	ENST00000308197.5	+	3	701	c.440C>T	c.(439-441)tCt>tTt	p.S147F	COQ10A_ENST00000546544.1_Missense_Mutation_p.S130F|RP11-977G19.14_ENST00000546464.1_RNA|COQ10A_ENST00000433805.2_Missense_Mutation_p.S115F	NM_144576.3	NP_653177.3	Q96MF6	CQ10A_HUMAN	coenzyme Q10 homolog A (S. cerevisiae)	147						mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	8						CGTTACACCTCTGCAGTTTCC	0.473																																						dbGAP											0													106.0	102.0	103.0					12																	56663001		1917	4120	6037	-	-	-	SO:0001583	missense	0			AK057003	CCDS41796.1, CCDS44921.1	12q13.3	2011-09-16	2006-04-04		ENSG00000135469	ENSG00000135469			26515	protein-coding gene	gene with protein product			"""coenzyme Q10 homolog A (yeast)"""				Standard	NM_144576		Approved	FLJ32452	uc001sko.4	Q96MF6	OTTHUMG00000170283	ENST00000308197.5:c.440C>T	12.37:g.56663001C>T	ENSP00000312587:p.Ser147Phe		Q6GMR6|Q6UWB9|Q86X16|Q8TAL2|Q96MF1|Q9BUP4	Missense_Mutation	SNP	pfam_Polyket_cyc	p.S147F	ENST00000308197.5	37	c.440	CCDS41796.1	12	.	.	.	.	.	.	.	.	.	.	C	27.9	4.869011	0.91587	.	.	ENSG00000135469	ENST00000308197;ENST00000433805;ENST00000546544	T;T;T	0.48201	0.82;1.0;0.93	5.05	5.05	0.67936	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79275	0.4418	H	0.96175	3.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.86301	0.1680	10	0.87932	D	0	.	17.589	0.87989	0.0:1.0:0.0:0.0	.	130;152;147	Q96MF6-2;Q8TAL2;Q96MF6	.;.;CQ10A_HUMAN	F	147;115;130	ENSP00000312587:S147F;ENSP00000407843:S115F;ENSP00000446723:S130F	ENSP00000312587:S147F	S	+	2	0	COQ10A	54949268	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.532000	0.81985	2.524000	0.85096	0.561000	0.74099	TCT	COQ10A	-	pfam_Polyket_cyc	ENSG00000135469		0.473	COQ10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ10A	HGNC	protein_coding	OTTHUMT00000408332.1	127	0.00	0	C	NM_144576		56663001	56663001	+1	no_errors	ENST00000308197	ensembl	human	known	69_37n	missense	146	22.34	42	SNP	1.000	T
CPAMD8	27151	genome.wustl.edu	37	19	17017901	17017901	+	Silent	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr19:17017901C>T	ENST00000443236.1	-	30	4060	c.4029G>A	c.(4027-4029)gcG>gcA	p.A1343A	RN7SL835P_ENST00000579920.1_RNA	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1296						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GGAAGTGCCTCGCTTTGTCAG	0.657																																						dbGAP											0													28.0	36.0	34.0					19																	17017901		2136	4241	6377	-	-	-	SO:0001819	synonymous_variant	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.4029G>A	19.37:g.17017901C>T			Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.R1354Q	ENST00000443236.1	37	c.4061	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	C	0.960	-0.703553	0.03255	.	.	ENSG00000160111	ENST00000443236	.	.	.	3.07	-6.14	0.02111	.	.	.	.	.	T	0.47801	0.1465	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50329	-0.8841	4	.	.	.	.	7.4511	0.27240	0.0:0.2132:0.4543:0.3325	.	.	.	.	Q	1354	.	.	R	-	2	0	CPAMD8	16878901	0.089000	0.21612	0.230000	0.23976	0.121000	0.20230	-1.184000	0.03076	-0.997000	0.03450	-0.293000	0.09583	CGA	CPAMD8	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000160111		0.657	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	35	0.00	0	C	NM_015692		17017901	17017901	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443236	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.625	T
CTH	1491	genome.wustl.edu	37	1	70897810	70897810	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr1:70897810C>T	ENST00000370938.3	+	8	913	c.769C>T	c.(769-771)Cga>Tga	p.R257*	CTH_ENST00000411986.2_Nonsense_Mutation_p.R225*|CTH_ENST00000346806.2_Nonsense_Mutation_p.R213*	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase	0						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						CCTCTGCAATCGAGGTCTGAA	0.428																																						dbGAP											0													127.0	122.0	123.0					1																	70897810		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.769C>T	1.37:g.70897810C>T	ENSP00000359976:p.Arg257*		O95791|Q9NX42	Nonsense_Mutation	SNP	pfam_Cys/Met-Metab_PyrdxlP-dep_enz,pfam_Aminotransferase_I/II,pfam_Aminotrans_V/Cys_dSase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cys/Met-Metab_PyrdxlP-dep_enz	p.R257*	ENST00000370938.3	37	c.769	CCDS650.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.621618	0.96660	.	.	ENSG00000116761	ENST00000411986;ENST00000370938;ENST00000346806	.	.	.	5.47	3.52	0.40303	.	0.061993	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.0728	14.3837	0.66929	0.4058:0.5942:0.0:0.0	.	.	.	.	X	225;257;213	.	ENSP00000311554:R213X	R	+	1	2	CTH	70670398	1.000000	0.71417	0.873000	0.34254	0.556000	0.35491	2.354000	0.44098	0.725000	0.32318	0.650000	0.86243	CGA	CTH	-	pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cys/Met-Metab_PyrdxlP-dep_enz	ENSG00000116761		0.428	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTH	HGNC	protein_coding	OTTHUMT00000025918.1	329	0.00	0	C	NM_001902		70897810	70897810	+1	no_errors	ENST00000370938	ensembl	human	known	69_37n	nonsense	245	20.97	65	SNP	1.000	T
CTNNA1	1495	genome.wustl.edu	37	5	138117646	138117646	+	Silent	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr5:138117646C>T	ENST00000302763.7	+	2	123	c.33C>T	c.(31-33)ttC>ttT	p.F11F	CTNNA1_ENST00000355078.5_5'UTR|CTNNA1_ENST00000518825.1_Silent_p.F11F	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	11	Involved in homodimerization.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACATAAACTTCAAGTGGGATC	0.378																																						dbGAP											0													82.0	76.0	78.0					5																	138117646		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.33C>T	5.37:g.138117646C>T			Q12795|Q8N1C0	Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.F11	ENST00000302763.7	37	c.33	CCDS34243.1	5																																																																																			CTNNA1	-	NULL	ENSG00000044115		0.378	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	137	0.00	0	C	NM_001903		138117646	138117646	+1	no_errors	ENST00000302763	ensembl	human	known	69_37n	silent	168	20.28	43	SNP	1.000	T
DLX3	1747	genome.wustl.edu	37	17	48070938	48070938	+	Silent	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr17:48070938C>T	ENST00000434704.2	-	2	567	c.342G>A	c.(340-342)gaG>gaA	p.E114E	DLX3_ENST00000512495.2_5'UTR	NM_005220.2	NP_005211.1	O60479	DLX3_HUMAN	distal-less homeobox 3	114					blood vessel development (GO:0001568)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|placenta development (GO:0001890)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						CTGCTTCCGGCTCCTCCTTCA	0.692																																						dbGAP											0													72.0	59.0	63.0					17																	48070938		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11556.1	17q21.33	2011-06-20	2005-12-22			ENSG00000064195		"""Homeoboxes / ANTP class : NKL subclass"""	2916	protein-coding gene	gene with protein product		600525	"""distal-less homeo box 3"""			7613049	Standard	NM_005220		Approved		uc002ipy.3	O60479		ENST00000434704.2:c.342G>A	17.37:g.48070938C>T			B3KQL6	Silent	SNP	pfam_Distal-less_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.E114	ENST00000434704.2	37	c.342	CCDS11556.1	17																																																																																			DLX3	-	superfamily_Homeodomain-like	ENSG00000064195		0.692	DLX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX3	HGNC	protein_coding	OTTHUMT00000366307.1	56	0.00	0	C			48070938	48070938	-1	no_errors	ENST00000434704	ensembl	human	known	69_37n	silent	35	46.97	31	SNP	1.000	T
DNHD1	144132	genome.wustl.edu	37	11	6519529	6519529	+	Silent	SNP	C	C	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr11:6519529C>G	ENST00000527990.2	+	1	84	c.84C>G	c.(82-84)gtC>gtG	p.V28V	DNHD1_ENST00000354685.3_Silent_p.V28V|DNHD1_ENST00000477562.1_Intron|DNHD1_ENST00000254579.6_Silent_p.V28V			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	28					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CCATATGTGTCTTGGACAGCA	0.537																																						dbGAP											0													196.0	193.0	194.0					11																	6519529		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.84C>G	11.37:g.6519529C>G			Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Silent	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.V28	ENST00000527990.2	37	c.84	CCDS44532.1	11																																																																																			DNHD1	-	NULL	ENSG00000179532		0.537	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	34	0.00	0	C	NM_144666		6519529	6519529	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	silent	21	19.23	5	SNP	0.003	G
ELAC2	60528	genome.wustl.edu	37	17	12903496	12903496	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr17:12903496G>A	ENST00000338034.4	-	15	1639	c.1400C>T	c.(1399-1401)gCg>gTg	p.A467V	ELAC2_ENST00000395962.2_Missense_Mutation_p.A448V|ELAC2_ENST00000426905.3_Missense_Mutation_p.A427V	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	467					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						GCCGTCCTGCGCACTCCTCCT	0.567																																						dbGAP											0													53.0	51.0	52.0					17																	12903496		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1400C>T	17.37:g.12903496G>A	ENSP00000337445:p.Ala467Val		B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	pfam_Beta-lactamas-like	p.A467V	ENST00000338034.4	37	c.1400	CCDS11164.1	17	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537678	0.27475	.	.	ENSG00000006744	ENST00000426905;ENST00000338034;ENST00000395962;ENST00000457438	T;T;T	0.64618	0.29;-0.11;-0.11	5.0	-2.19	0.07015	.	1.307490	0.04695	N	0.414906	T	0.36908	0.0984	N	0.05230	-0.09	0.09310	N	1	B;B;B;B;B;B;B;B	0.10296	0.003;0.0;0.001;0.002;0.003;0.002;0.001;0.002	B;B;B;B;B;B;B;B	0.06405	0.001;0.001;0.002;0.002;0.001;0.0;0.001;0.002	T	0.25916	-1.0118	10	0.09084	T	0.74	-0.8698	9.9441	0.41598	0.4499:0.0:0.5501:0.0	.	427;450;448;265;467;227;452;95	B4DPL9;E9PGJ0;G5E9D5;E7ES68;Q9BQ52;B3KSU9;B4DT15;Q9BQ52-3	.;.;.;.;RNZ2_HUMAN;.;.;.	V	427;467;448;145	ENSP00000405223:A427V;ENSP00000337445:A467V;ENSP00000379291:A448V	ENSP00000337445:A467V	A	-	2	0	ELAC2	12844221	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.146000	0.03191	-0.586000	0.05898	-0.142000	0.14014	GCG	ELAC2	-	NULL	ENSG00000006744		0.567	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAC2	HGNC	protein_coding	OTTHUMT00000129934.5	30	0.00	0	G			12903496	12903496	-1	no_errors	ENST00000338034	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	0.000	A
FAP	2191	genome.wustl.edu	37	2	163044844	163044844	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr2:163044844C>G	ENST00000188790.4	-	20	1856	c.1649G>C	c.(1648-1650)aGg>aCg	p.R550T	FAP_ENST00000443424.1_Missense_Mutation_p.R525T	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						AAATACAGACCTTACACTCTG	0.413																																						dbGAP											0													98.0	90.0	93.0					2																	163044844		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.1649G>C	2.37:g.163044844C>G	ENSP00000188790:p.Arg550Thr			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.R550T	ENST00000188790.4	37	c.1649	CCDS33311.1	2	.	.	.	.	.	.	.	.	.	.	C	8.637	0.895145	0.17613	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	T;T	0.39592	1.07;1.07	6.07	2.32	0.28847	.	0.498050	0.26510	N	0.023969	T	0.16171	0.0389	N	0.04090	-0.28	0.09310	N	1	B;B;B	0.11235	0.0;0.004;0.002	B;B;B	0.15870	0.001;0.014;0.006	T	0.33111	-0.9881	10	0.02654	T	1	-16.8631	9.0407	0.36316	0.0:0.5704:0.0:0.4296	.	525;29;550	B4DLR2;Q12884-2;Q12884	.;.;SEPR_HUMAN	T	550;525	ENSP00000188790:R550T;ENSP00000411391:R525T	ENSP00000188790:R550T	R	-	2	0	FAP	162753090	0.019000	0.18553	0.981000	0.43875	0.998000	0.95712	0.672000	0.25187	0.155000	0.19261	0.655000	0.94253	AGG	FAP	-	NULL	ENSG00000078098		0.413	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAP	HGNC	protein_coding	OTTHUMT00000332852.2	160	0.00	0	C			163044844	163044844	-1	no_errors	ENST00000188790	ensembl	human	known	69_37n	missense	128	22.89	38	SNP	0.005	G
FHDC1	85462	genome.wustl.edu	37	4	153889196	153889196	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr4:153889196G>C	ENST00000511601.1	+	10	1353	c.1165G>C	c.(1165-1167)Gaa>Caa	p.E389Q	FHDC1_ENST00000260008.3_Missense_Mutation_p.E389Q			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	389	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.								ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					ATCACTAAAAGAAAACATCCA	0.453																																						dbGAP											0													129.0	127.0	128.0					4																	153889196		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.1165G>C	4.37:g.153889196G>C	ENSP00000427567:p.Glu389Gln			Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.E389Q	ENST00000511601.1	37	c.1165	CCDS34081.1	4	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989947	0.74589	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.17691	2.26;2.26	5.87	5.87	0.94306	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.427722	0.29342	N	0.012422	T	0.24044	0.0582	L	0.44542	1.39	0.45822	D	0.998692	P	0.45240	0.854	P	0.46144	0.505	T	0.00249	-1.1879	10	0.26408	T	0.33	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	389	Q9C0D6	FHDC1_HUMAN	Q	389	ENSP00000427567:E389Q;ENSP00000260008:E389Q	ENSP00000260008:E389Q	E	+	1	0	FHDC1	154108646	1.000000	0.71417	0.747000	0.31113	0.640000	0.38277	4.399000	0.59703	2.941000	0.99782	0.655000	0.94253	GAA	FHDC1	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000137460		0.453	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	207	0.00	0	G	NM_033393		153889196	153889196	+1	no_errors	ENST00000260008	ensembl	human	known	69_37n	missense	166	19.71	41	SNP	0.987	C
GCM2	9247	genome.wustl.edu	37	6	10876743	10876743	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr6:10876743G>A	ENST00000379491.4	-	3	538	c.391C>T	c.(391-393)Cga>Tga	p.R131*	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	131					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CTGTGCCCTCGACAAGGAATC	0.493																																						dbGAP											0													102.0	87.0	92.0					6																	10876743		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.391C>T	6.37:g.10876743G>A	ENSP00000368805:p.Arg131*		D3GDV6|Q5THN5	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.R131*	ENST00000379491.4	37	c.391	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	G	38	6.748059	0.97809	.	.	ENSG00000124827	ENST00000379491	.	.	.	5.41	3.49	0.39957	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0622	13.8981	0.63785	0.0:0.0:0.7227:0.2773	.	.	.	.	X	131	.	ENSP00000368805:R131X	R	-	1	2	GCM2	10984729	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.271000	0.58902	1.248000	0.43934	0.650000	0.86243	CGA	GCM2	-	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	ENSG00000124827		0.493	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1	80	0.00	0	G			10876743	10876743	-1	no_errors	ENST00000379491	ensembl	human	known	69_37n	nonsense	64	22.89	19	SNP	1.000	A
GPR37	2861	genome.wustl.edu	37	7	124404936	124404936	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr7:124404936delG	ENST00000303921.2	-	1	745	c.95delC	c.(94-96)cctfs	p.P32fs		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	32					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TCTGGACGCAGGGGCGACCCC	0.647																																						dbGAP											0													20.0	21.0	21.0					7																	124404936		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.95delC	7.37:g.124404936delG	ENSP00000306449:p.Pro32fs		A4D0Y6|O00348|O14768|Q8TD39	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,prints_GPR37_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P32fs	ENST00000303921.2	37	c.95	CCDS5792.1	7																																																																																			GPR37	-	NULL	ENSG00000170775		0.647	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	HGNC	protein_coding	OTTHUMT00000347873.1	18	0.00	0	G	NM_005302		124404936	124404936	-1	no_errors	ENST00000303921	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.006	-
GREB1L	80000	genome.wustl.edu	37	18	19085428	19085428	+	Silent	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr18:19085428C>T	ENST00000580732.2	+	24	4509	c.4128C>T	c.(4126-4128)atC>atT	p.I1376I	GREB1L_ENST00000269218.6_Silent_p.I1267I|GREB1L_ENST00000424526.1_Silent_p.I1376I|GREB1L_ENST00000400483.4_3'UTR			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1376						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GGCCTGACATCGAGAGCTTCA	0.512																																						dbGAP											0													184.0	168.0	173.0					18																	19085428		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.4128C>T	18.37:g.19085428C>T			A4QN17|Q9H8F1	Silent	SNP	NULL	p.I1376	ENST00000580732.2	37	c.4128	CCDS45836.1	18																																																																																			GREB1L	-	NULL	ENSG00000141449		0.512	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	195	0.00	0	C	NM_024935		19085428	19085428	+1	no_errors	ENST00000424526	ensembl	human	known	69_37n	silent	122	25.61	42	SNP	1.000	T
HCN4	10021	genome.wustl.edu	37	15	73615867	73615867	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr15:73615867G>A	ENST00000261917.3	-	8	3560	c.2567C>T	c.(2566-2568)tCc>tTc	p.S856F		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	856					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GATGTGGAAGGAGGATGAAGA	0.677																																						dbGAP											0													55.0	56.0	56.0					15																	73615867		2198	4293	6491	-	-	-	SO:0001583	missense	0			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2567C>T	15.37:g.73615867G>A	ENSP00000261917:p.Ser856Phe		Q9UMQ7	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.S856F	ENST00000261917.3	37	c.2567	CCDS10248.1	15	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750143	0.49257	.	.	ENSG00000138622	ENST00000261917	D	0.83992	-1.79	3.38	3.38	0.38709	.	.	.	.	.	D	0.83087	0.5178	L	0.40543	1.245	0.52501	D	0.999959	D	0.61697	0.99	P	0.53313	0.723	D	0.85342	0.1096	9	0.62326	D	0.03	.	14.9457	0.71029	0.0:0.0:1.0:0.0	.	856	Q9Y3Q4	HCN4_HUMAN	F	856	ENSP00000261917:S856F	ENSP00000261917:S856F	S	-	2	0	HCN4	71402920	1.000000	0.71417	0.843000	0.33291	0.865000	0.49528	3.175000	0.50855	1.710000	0.51325	0.462000	0.41574	TCC	HCN4	-	NULL	ENSG00000138622		0.677	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	HGNC	protein_coding	OTTHUMT00000268900.2	38	0.00	0	G	NM_005477		73615867	73615867	-1	no_errors	ENST00000261917	ensembl	human	known	69_37n	missense	32	15.38	6	SNP	1.000	A
HEPH	9843	genome.wustl.edu	37	X	65427137	65427137	+	Silent	SNP	C	C	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chrX:65427137C>A	ENST00000343002.2	+	13	3056	c.2392C>A	c.(2392-2394)Cgg>Agg	p.R798R	HEPH_ENST00000419594.1_Silent_p.R609R|HEPH_ENST00000441993.2_Silent_p.R801R|HEPH_ENST00000519389.1_Silent_p.R852R|HEPH_ENST00000374727.3_Silent_p.R801R|HEPH_ENST00000336279.5_Silent_p.R531R			Q9BQS7	HEPH_HUMAN	hephaestin	798	Plastocyanin-like 5.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CAGGATCCCTCGGCCAAGGAC	0.473																																						dbGAP											0													107.0	88.0	94.0					X																	65427137		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.2392C>A	X.37:g.65427137C>A			B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.R852	ENST00000343002.2	37	c.2554		X																																																																																			HEPH	-	superfamily_Cupredoxin	ENSG00000089472		0.473	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1	281	0.35	1	C	NM_138737		65427137	65427137	+1	no_errors	ENST00000519389	ensembl	human	known	69_37n	silent	156	25.00	52	SNP	0.000	A
IQCF3	401067	genome.wustl.edu	37	3	51864469	51864469	+	Silent	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr3:51864469G>A	ENST00000456080.1	+	8	1282	c.117G>A	c.(115-117)caG>caA	p.Q39Q	IQCF3_ENST00000437810.2_Silent_p.Q39Q|IQCF3_ENST00000462079.1_3'UTR|IQCF3_ENST00000444293.1_Intron|IQCF3_ENST00000446775.1_Silent_p.Q39Q|IQCF3_ENST00000440739.2_Silent_p.Q39Q			P0C7M6	IQCF3_HUMAN	IQ motif containing F3	39										endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CAGCTGGGCAGATCCAGGCCT	0.577																																						dbGAP											0													57.0	64.0	62.0					3																	51864469		2163	4269	6432	-	-	-	SO:0001819	synonymous_variant	0			AK057432	CCDS46837.1	3p21.31	2008-06-12			ENSG00000229972	ENSG00000229972			31816	protein-coding gene	gene with protein product							Standard	NM_001085479		Approved		uc021wyz.1	P0C7M6	OTTHUMG00000156910	ENST00000456080.1:c.117G>A	3.37:g.51864469G>A			B2RUV0	Silent	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.Q39	ENST00000456080.1	37	c.117	CCDS46837.1	3																																																																																			IQCF3	-	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS	ENSG00000229972		0.577	IQCF3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF3	HGNC	protein_coding	OTTHUMT00000346579.2	55	0.00	0	G	NM_001085479		51864469	51864469	+1	no_errors	ENST00000437810	ensembl	human	known	69_37n	silent	53	22.06	15	SNP	0.679	A
JAK3	3718	genome.wustl.edu	37	19	17945508	17945508	+	Missense_Mutation	SNP	C	C	T	rs202027945		TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr19:17945508C>T	ENST00000527670.1	-	16	2251	c.2222G>A	c.(2221-2223)cGg>cAg	p.R741Q	JAK3_ENST00000534444.1_Missense_Mutation_p.R741Q|JAK3_ENST00000458235.1_Missense_Mutation_p.R741Q			P52333	JAK3_HUMAN	Janus kinase 3	741	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CAGCTGCTGCCGGTCCTCATA	0.587		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""								C|||	1	0.000199681	0.0008	0.0	5008	,	,		14357	0.0		0.0	False		,,,				2504	0.0					dbGAP		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0													48.0	59.0	56.0					19																	17945508		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2222G>A	19.37:g.17945508C>T	ENSP00000432511:p.Arg741Gln		Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak3,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom	p.R741Q	ENST00000527670.1	37	c.2222	CCDS12366.1	19	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	7.201	0.593532	0.13875	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	D;D;D	0.82526	-1.62;-1.62;-1.62	4.8	-0.625	0.11548	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.811383	0.11395	N	0.568428	T	0.73156	0.3551	L	0.52011	1.625	0.09310	N	1	B;B	0.17038	0.02;0.001	B;B	0.15484	0.013;0.007	T	0.54483	-0.8287	10	0.13853	T	0.58	-18.6813	7.5805	0.27961	0.0:0.401:0.0:0.599	.	741;741	P52333-2;P52333	.;JAK3_HUMAN	Q	741	ENSP00000391676:R741Q;ENSP00000432511:R741Q;ENSP00000436421:R741Q	ENSP00000391676:R741Q	R	-	2	0	JAK3	17806508	0.000000	0.05858	0.176000	0.23000	0.821000	0.46438	-1.108000	0.03313	0.004000	0.14682	-0.347000	0.07816	CGG	JAK3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_cat_dom	ENSG00000105639		0.587	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	HGNC	protein_coding	OTTHUMT00000385549.1	25	0.00	0	C	NM_000215		17945508	17945508	-1	no_errors	ENST00000458235	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.046	T
LPA	4018	genome.wustl.edu	37	6	160968970	160968970	+	Splice_Site	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr6:160968970C>T	ENST00000316300.5	-	32	5200		c.e32-1		LPA_ENST00000447678.1_Splice_Site			P08519	APOA_HUMAN	lipoprotein, Lp(a)						blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)	p.?(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	AACATACAGTCTGTAGAAAAA	0.483																																						dbGAP											1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											63.0	67.0	65.0					6																	160968970		2187	4293	6480	-	-	-	SO:0001630	splice_region_variant	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5156-1G>A	6.37:g.160968970C>T			Q5VTD7|Q9UD88	Splice_Site	SNP	-	e32-1	ENST00000316300.5	37	c.5156-1	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	C	6.493	0.459118	0.12342	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.54	2.54	0.30619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3543	0.16053	0.0:0.8326:0.0:0.1674	.	.	.	.	.	-1	.	.	.	-	.	.	LPA	160888960	1.000000	0.71417	0.669000	0.29828	0.124000	0.20399	3.900000	0.56295	1.422000	0.47177	0.205000	0.17691	.	LPA	-	-	ENSG00000198670		0.483	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	230	0.00	0	C	NM_005577	Intron	160968970	160968970	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	splice_site	166	26.87	61	SNP	0.965	T
LRRC16B	90668	genome.wustl.edu	37	14	24532005	24532005	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr14:24532005C>T	ENST00000342740.5	+	29	2810	c.2656C>T	c.(2656-2658)Cgg>Tgg	p.R886W	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	886						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		GGGCCGAGGCCGGAACCATGA	0.632																																						dbGAP											0													100.0	110.0	107.0					14																	24532005		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.2656C>T	14.37:g.24532005C>T	ENSP00000340467:p.Arg886Trp		Q8TEF7|Q96HS9	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.R886W	ENST00000342740.5	37	c.2656	CCDS32054.1	14	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180818	0.57800	.	.	ENSG00000186648	ENST00000342740	T	0.17691	2.26	5.37	4.46	0.54185	.	0.000000	0.43110	D	0.000611	T	0.18841	0.0452	L	0.40543	1.245	0.80722	D	1	D	0.69078	0.997	P	0.47044	0.535	T	0.01133	-1.1441	10	0.72032	D	0.01	-14.0294	11.0277	0.47755	0.1934:0.8066:0.0:0.0	.	886	Q8ND23	LR16B_HUMAN	W	886	ENSP00000340467:R886W	ENSP00000340467:R886W	R	+	1	2	LRRC16B	23601845	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.843000	0.27640	1.200000	0.43188	0.561000	0.74099	CGG	LRRC16B	-	NULL	ENSG00000186648		0.632	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	HGNC	protein_coding	OTTHUMT00000416527.1	74	0.00	0	C	NM_138360		24532005	24532005	+1	no_errors	ENST00000342740	ensembl	human	known	69_37n	missense	78	23.53	24	SNP	1.000	T
LY75	4065	genome.wustl.edu	37	2	160714934	160714934	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr2:160714934A>T	ENST00000263636.4	-	16	2349	c.2322T>A	c.(2320-2322)ttT>ttA	p.F774L	LY75-CD302_ENST00000505052.1_Missense_Mutation_p.F774L|LY75_ENST00000554112.1_Missense_Mutation_p.F774L|LY75_ENST00000553424.1_Missense_Mutation_p.F774L|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.F774L	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	774	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TCAAATAAATAAATTCTCTAT	0.363																																						dbGAP											0													98.0	97.0	97.0					2																	160714934		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.2322T>A	2.37:g.160714934A>T	ENSP00000263636:p.Phe774Leu		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.F774L	ENST00000263636.4	37	c.2322	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	A	13.43	2.235862	0.39498	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.06933	3.24;3.24;3.24;3.24;3.24	5.15	-1.84	0.07809	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	1.172700	0.06685	N	0.768682	T	0.02848	0.0085	N	0.04043	-0.29	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.10450	0.003;0.005;0.003	T	0.45190	-0.9278	10	0.11794	T	0.64	-0.4792	1.0883	0.01658	0.4512:0.1488:0.2561:0.1439	.	774;774;774	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	L	774	ENSP00000451511:F774L;ENSP00000451446:F774L;ENSP00000263636:F774L;ENSP00000423463:F774L;ENSP00000421035:F774L	ENSP00000423463:F774L	F	-	3	2	LY75;LY75-CD302	160423180	0.000000	0.05858	0.000000	0.03702	0.751000	0.42716	0.038000	0.13862	-0.225000	0.09913	0.379000	0.24179	TTT	LY75	-	superfamily_C-type_lectin_fold,smart_C-type_lectin	ENSG00000054219		0.363	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	300	0.00	0	A			160714934	160714934	-1	no_errors	ENST00000554112	ensembl	human	known	69_37n	missense	218	20.15	55	SNP	0.001	T
MAOA	4128	genome.wustl.edu	37	X	43590602	43590602	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chrX:43590602A>G	ENST00000338702.3	+	7	883	c.760A>G	c.(760-762)Atc>Gtc	p.I254V	MAOA_ENST00000497485.1_3'UTR|MAOA_ENST00000542639.1_Missense_Mutation_p.I121V	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A	254					cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	AAGTGACAACATCATCATAGA	0.448																																						dbGAP											0													119.0	81.0	94.0					X																	43590602		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.760A>G	X.37:g.43590602A>G	ENSP00000340684:p.Ile254Val		B4DF46|Q16426	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_mOase_FAD-bd,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_FAD_bind_dom,prints_Flavin_amine_oxidase	p.I254V	ENST00000338702.3	37	c.760	CCDS14260.1	X	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.791345	0.00623	.	.	ENSG00000189221	ENST00000338702;ENST00000542639	D;D	0.89343	-2.5;-2.5	5.91	2.27	0.28462	Amine oxidase (1);	0.050075	0.85682	D	0.000000	T	0.56108	0.1963	N	0.00188	-1.89	0.37950	D	0.932626	B	0.02656	0.0	B	0.04013	0.001	T	0.59386	-0.7464	10	0.02654	T	1	.	7.4196	0.27065	0.5173:0.0:0.4827:0.0	.	254	P21397	AOFA_HUMAN	V	254;121	ENSP00000340684:I254V;ENSP00000440846:I121V	ENSP00000340684:I254V	I	+	1	0	MAOA	43475546	0.994000	0.37717	0.029000	0.17559	0.001000	0.01503	2.448000	0.44926	0.329000	0.23460	-1.155000	0.01812	ATC	MAOA	-	pfam_Amino_oxidase	ENSG00000189221		0.448	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOA	HGNC	protein_coding	OTTHUMT00000056300.1	126	0.00	0	A	NM_000240		43590602	43590602	+1	no_errors	ENST00000338702	ensembl	human	known	69_37n	missense	116	14.71	20	SNP	0.885	G
MAOB	4129	genome.wustl.edu	37	X	43698178	43698178	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chrX:43698178G>T	ENST00000378069.4	-	3	362	c.215C>A	c.(214-216)gCc>gAc	p.A72D	MAOB_ENST00000538942.1_Missense_Mutation_p.A56D|MAOB_ENST00000487544.1_5'UTR|MAOB_ENST00000536181.1_Missense_Mutation_p.A56D	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	72					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	TAGCTCCTTGGCTAATCTCAA	0.408																																						dbGAP											0													138.0	118.0	125.0					X																	43698178		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.215C>A	X.37:g.43698178G>T	ENSP00000367309:p.Ala72Asp		B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,prints_Flavin_amine_oxidase	p.A72D	ENST00000378069.4	37	c.215	CCDS14261.1	X	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984358	0.74474	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	T;T;T	0.11169	2.8;2.8;2.8	5.13	5.13	0.70059	Amine oxidase (1);	0.162241	0.53938	D	0.000043	T	0.43942	0.1270	M	0.92970	3.365	0.80722	D	1	D;D;D	0.61080	0.989;0.969;0.982	D;D;D	0.76575	0.988;0.974;0.983	T	0.55224	-0.8174	10	0.46703	T	0.11	-8.1376	17.9488	0.89046	0.0:0.0:1.0:0.0	.	56;72;72	B7Z5H3;Q8TBI1;P27338	.;.;AOFB_HUMAN	D	72;56;56	ENSP00000367309:A72D;ENSP00000441613:A56D;ENSP00000442240:A56D	ENSP00000367309:A72D	A	-	2	0	MAOB	43583122	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	9.187000	0.94912	2.259000	0.74868	0.513000	0.50165	GCC	MAOB	-	pfam_Amino_oxidase	ENSG00000069535		0.408	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOB	HGNC	protein_coding	OTTHUMT00000056303.1	253	0.00	0	G	NM_000898		43698178	43698178	-1	no_errors	ENST00000378069	ensembl	human	known	69_37n	missense	163	22.75	48	SNP	1.000	T
MTSS1	9788	genome.wustl.edu	37	8	125565583	125565583	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr8:125565583G>A	ENST00000518547.1	-	14	2391	c.1918C>T	c.(1918-1920)Cgg>Tgg	p.R640W	MTSS1_ENST00000524090.1_Missense_Mutation_p.R530W|MTSS1_ENST00000431961.2_Missense_Mutation_p.R358W|MTSS1_ENST00000325064.5_Missense_Mutation_p.R644W|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000354184.4_Missense_Mutation_p.R358W|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000378017.3_Missense_Mutation_p.R615W|MTSS1_ENST00000395508.2_Missense_Mutation_p.R414W	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	640	Pro-rich.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.R640W(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TGCTCCCCCCGCTCTTCTGGC	0.642																																					Esophageal Squamous(160;622 1893 3862 8546 12509)	dbGAP											1	Substitution - Missense(1)	endometrium(1)											48.0	49.0	49.0					8																	125565583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1918C>T	8.37:g.125565583G>A	ENSP00000429064:p.Arg640Trp		J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfscan_WH2_dom	p.R640W	ENST00000518547.1	37	c.1918	CCDS6353.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.05|12.05	1.821049|1.821049	0.32237|0.32237	.|.	.|.	ENSG00000170873|ENSG00000170873	ENST00000519168|ENST00000378017;ENST00000518547;ENST00000354184;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090	.|T;T;T;T;T;T;T	.|0.32023	.|1.47;1.48;1.48;1.48;1.48;1.48;1.47	5.9|5.9	2.92|2.92	0.33932|0.33932	.|.	.|0.366329	.|0.26731	.|N	.|0.022797	T|T	0.20414|0.20414	0.0491|0.0491	N|N	0.08118|0.08118	0|0	0.18873|0.18873	N|N	0.999984|0.999984	.|P;D;D;P;D;D;D	.|0.76494	.|0.937;0.994;0.976;0.746;0.994;0.997;0.999	.|B;B;B;B;P;P;P	.|0.54270	.|0.109;0.431;0.443;0.145;0.711;0.747;0.743	T|T	0.04400|0.04400	-1.0954|-1.0954	5|10	.|0.54805	.|T	.|0.06	-18.9241|-18.9241	2.4751|2.4751	0.04574|0.04574	0.1191:0.1362:0.2896:0.4551|0.1191:0.1362:0.2896:0.4551	.|.	.|530;414;615;640;615;358;289	.|E7EWW5;B7Z3B6;A5YM41;O43312;O43312-4;O43312-2;Q6ZTG0	.|.;.;.;MTSS1_HUMAN;.;.;.	V|W	427|615;640;358;414;644;358;530	.|ENSP00000367256:R615W;ENSP00000429064:R640W;ENSP00000346119:R358W;ENSP00000378884:R414W;ENSP00000322804:R644W;ENSP00000393606:R358W;ENSP00000428319:R530W	.|ENSP00000322804:R644W	A|R	-|-	2|1	0|2	MTSS1|MTSS1	125634764|125634764	0.007000|0.007000	0.16637|0.16637	0.997000|0.997000	0.53966|0.53966	0.873000|0.873000	0.50193|0.50193	0.739000|0.739000	0.26173|0.26173	0.773000|0.773000	0.33404|0.33404	0.561000|0.561000	0.74099|0.74099	GCG|CGG	MTSS1	-	NULL	ENSG00000170873		0.642	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTSS1	HGNC	protein_coding	OTTHUMT00000109625.3	120	0.00	0	G	NM_014751		125565583	125565583	-1	no_errors	ENST00000518547	ensembl	human	known	69_37n	missense	172	15.20	31	SNP	0.108	A
MYT1L	23040	genome.wustl.edu	37	2	1926197	1926197	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr2:1926197C>A	ENST00000399161.2	-	10	2091	c.1344G>T	c.(1342-1344)atG>atT	p.M448I	MYT1L_ENST00000428368.2_Missense_Mutation_p.M448I	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	448					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCTTCTCCCTCATGGCCTTTG	0.532																																						dbGAP											0													174.0	169.0	171.0					2																	1926197		2005	4153	6158	-	-	-	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1344G>T	2.37:g.1926197C>A	ENSP00000382114:p.Met448Ile		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.M448I	ENST00000399161.2	37	c.1344		2	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888907	0.52014	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.43294	0.95;0.95	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.37892	0.1020	L	0.32530	0.975	0.80722	D	1	P;P	0.42941	0.69;0.794	B;B	0.39805	0.23;0.31	T	0.06862	-1.0803	10	0.34782	T	0.22	-43.2725	20.2936	0.98544	0.0:1.0:0.0:0.0	.	448;448	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	I	448;396;448	ENSP00000382114:M448I;ENSP00000396103:M448I	ENSP00000295067:M396I	M	-	3	0	MYT1L	1905204	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	5.935000	0.70145	2.801000	0.96364	0.655000	0.94253	ATG	MYT1L	-	NULL	ENSG00000186487		0.532	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	256	0.00	0	C	NM_015025		1926197	1926197	-1	no_errors	ENST00000399161	ensembl	human	known	69_37n	missense	225	20.21	57	SNP	1.000	A
NOD1	10392	genome.wustl.edu	37	7	30496531	30496531	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr7:30496531C>G	ENST00000222823.4	-	4	532	c.7G>C	c.(7-9)Gag>Cag	p.E3Q	NOD1_ENST00000423334.2_Missense_Mutation_p.E3Q	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	3					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						TGGCCCTGCTCTTCCATAGTT	0.498																																						dbGAP											0													124.0	111.0	115.0					7																	30496531		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.7G>C	7.37:g.30496531C>G	ENSP00000222823:p.Glu3Gln		B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.E3Q	ENST00000222823.4	37	c.7	CCDS5427.1	7	.	.	.	.	.	.	.	.	.	.	C	17.43	3.388880	0.61956	.	.	ENSG00000106100	ENST00000222823;ENST00000423334;ENST00000411552;ENST00000419799;ENST00000413433;ENST00000419601	T	0.70399	-0.48	5.8	1.81	0.25067	.	0.842953	0.10971	N	0.613865	T	0.47229	0.1434	N	0.08118	0	0.09310	N	0.999999	B;B	0.18461	0.028;0.012	B;B	0.12156	0.006;0.007	T	0.27938	-1.0059	10	0.24483	T	0.36	.	8.131	0.31027	0.0:0.3377:0.0:0.6623	.	3;3	B4DTU3;Q9Y239	.;NOD1_HUMAN	Q	3	ENSP00000222823:E3Q	ENSP00000222823:E3Q	E	-	1	0	NOD1	30463056	0.003000	0.15002	0.545000	0.28153	0.959000	0.62525	0.455000	0.21843	0.098000	0.17522	-0.290000	0.09829	GAG	NOD1	-	NULL	ENSG00000106100		0.498	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	HGNC	protein_coding	OTTHUMT00000250443.2	184	0.00	0	C			30496531	30496531	-1	no_errors	ENST00000222823	ensembl	human	known	69_37n	missense	138	28.12	54	SNP	0.446	G
PAICS	10606	genome.wustl.edu	37	4	57314718	57314718	+	Silent	SNP	G	G	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr4:57314718G>T	ENST00000512576.1	+	4	689	c.528G>T	c.(526-528)ctG>ctT	p.L176L	PAICS_ENST00000399688.3_Silent_p.L183L|PAICS_ENST00000264221.2_Silent_p.L176L|PAICS_ENST00000514888.1_Silent_p.L84L	NM_001079524.1	NP_001072992.1	P22234	PUR6_HUMAN	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	176	SAICAR synthetase.				'de novo' IMP biosynthetic process (GO:0006189)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|phosphoribosylaminoimidazole carboxylase activity (GO:0004638)|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity (GO:0004639)			endometrium(1)|kidney(2)|large_intestine(1)|urinary_tract(1)	5	Glioma(25;0.08)|all_neural(26;0.101)				L-Aspartic Acid(DB00128)	TTGAAATACTGGAGAAATCCT	0.378																																					GBM(53;429 1144 8755 40726)	dbGAP											0													41.0	36.0	38.0					4																	57314718		1820	4088	5908	-	-	-	SO:0001819	synonymous_variant	0			X53793	CCDS47060.1, CCDS47061.1	4q12	2012-07-13			ENSG00000128050	ENSG00000128050	4.1.1.21, 6.3.2.6		8587	protein-coding gene	gene with protein product		172439		PAIS		2253271, 8106516	Standard	NM_006452		Approved	ADE2H1, AIRC	uc003hbt.1	P22234	OTTHUMG00000160957	ENST00000512576.1:c.528G>T	4.37:g.57314718G>T			E9PDH9|Q68CQ5	Silent	SNP	pfam_SAICAR_synth,pfam_N5-CAIR_Mutase_PurE_dom,superfamily_N5-CAIR_Mutase_PurE_dom,tigrfam_N5-CAIR_Mutase_PurE_dom	p.L176	ENST00000512576.1	37	c.528	CCDS47061.1	4																																																																																			PAICS	-	pfam_SAICAR_synth	ENSG00000128050		0.378	PAICS-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAICS	HGNC	protein_coding	OTTHUMT00000363136.2	134	0.00	0	G	NM_006452		57314718	57314718	+1	no_errors	ENST00000264221	ensembl	human	known	69_37n	silent	118	25.32	40	SNP	1.000	T
PC	5091	genome.wustl.edu	37	11	66617203	66617203	+	Nonsense_Mutation	SNP	G	G	T	rs199771464		TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr11:66617203G>T	ENST00000393958.2	-	20	3119	c.3026C>A	c.(3025-3027)tCa>tAa	p.S1009*	PC_ENST00000393960.1_Nonsense_Mutation_p.S1009*|PC_ENST00000528224.1_5'UTR|PC_ENST00000393955.2_Nonsense_Mutation_p.S1009*|PC_ENST00000529047.1_Nonsense_Mutation_p.S129*	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	1009					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CATAGCTGCTGAGAGCACATC	0.622																																						dbGAP											0													116.0	91.0	99.0					11																	66617203		2200	4295	6495	-	-	-	SO:0001587	stop_gained	0			U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.3026C>A	11.37:g.66617203G>T	ENSP00000377530:p.Ser1009*		B4DN00|Q16705	Nonsense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Carboxylase_cons_dom,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_PYR_CT,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pirsf_Pyruv_COase,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_PYR_CT,pfscan_Biotin_lipoyl,tigrfam_Pyruv_COase	p.S1009*	ENST00000393958.2	37	c.3026	CCDS8152.1	11	.	.	.	.	.	.	.	.	.	.	G	41	9.063091	0.99053	.	.	ENSG00000173599	ENST00000529047;ENST00000393955;ENST00000393958;ENST00000393960	.	.	.	4.89	4.89	0.63831	.	0.144148	0.48767	D	0.000177	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1236	15.5897	0.76517	0.0:0.0:1.0:0.0	.	.	.	.	X	129;1009;1009;1009	.	ENSP00000377527:S1009X	S	-	2	0	PC	66373779	1.000000	0.71417	0.952000	0.39060	0.765000	0.43378	6.005000	0.70716	2.538000	0.85594	0.462000	0.41574	TCA	PC	-	pfam_Carboxylase_cons_dom,pirsf_Pyruv_COase,tigrfam_Pyruv_COase	ENSG00000173599		0.622	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PC	HGNC	protein_coding	OTTHUMT00000393115.1	56	0.00	0	G	NM_001040716		66617203	66617203	-1	no_errors	ENST00000393958	ensembl	human	known	69_37n	nonsense	97	13.39	15	SNP	0.996	T
PCDHB7	56129	genome.wustl.edu	37	5	140552846	140552846	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr5:140552846G>C	ENST00000231137.3	+	1	604	c.430G>C	c.(430-432)Gaa>Caa	p.E144Q		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	144	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAAATATTAGAAAGTACCAC	0.448																																						dbGAP											0													51.0	55.0	54.0					5																	140552846		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.430G>C	5.37:g.140552846G>C	ENSP00000231137:p.Glu144Gln		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E144Q	ENST00000231137.3	37	c.430	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161505	0.78226	.	.	ENSG00000113212	ENST00000231137	T	0.75938	-0.98	4.61	4.61	0.57282	Cadherin (3);Cadherin-like (1);	.	.	.	.	D	0.91805	0.7407	H	0.98370	4.215	0.48571	D	0.999677	D	0.89917	1.0	D	0.97110	1.0	D	0.95255	0.8363	9	0.87932	D	0	.	17.4139	0.87494	0.0:0.0:1.0:0.0	.	144	Q9Y5E2	PCDB7_HUMAN	Q	144	ENSP00000231137:E144Q	ENSP00000231137:E144Q	E	+	1	0	PCDHB7	140533030	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.384000	0.73177	2.248000	0.74166	0.655000	0.94253	GAA	PCDHB7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000113212		0.448	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	82	0.00	0	G	NM_018940		140552846	140552846	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	missense	61	37.11	36	SNP	0.999	C
PLA1A	51365	genome.wustl.edu	37	3	119327774	119327774	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr3:119327774C>T	ENST00000273371.4	+	3	505	c.433C>T	c.(433-435)Ctt>Ttt	p.L145F	PLA1A_ENST00000495992.1_Intron|PLA1A_ENST00000488919.1_5'UTR|PLA1A_ENST00000494440.1_Missense_Mutation_p.L129F	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	145					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CGAGATCTCCCTTTTCCTCAA	0.468																																						dbGAP											0													110.0	105.0	107.0					3																	119327774		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.433C>T	3.37:g.119327774C>T	ENSP00000273371:p.Leu145Phe		B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	p.L145F	ENST00000273371.4	37	c.433	CCDS2991.1	3	.	.	.	.	.	.	.	.	.	.	C	5.836	0.338517	0.11069	.	.	ENSG00000144837	ENST00000273371;ENST00000494440;ENST00000475963	D;D;D	0.90844	-2.74;-2.74;-2.65	5.41	2.4	0.29515	Lipase, N-terminal (1);	0.747371	0.13962	N	0.350762	T	0.78509	0.4294	N	0.16066	0.365	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.61267	-0.7097	10	0.10902	T	0.67	-2.5429	7.0181	0.24899	0.417:0.5016:0.0:0.0814	.	145	Q53H76	PLA1A_HUMAN	F	145;129;11	ENSP00000273371:L145F;ENSP00000418793:L129F;ENSP00000417295:L11F	ENSP00000273371:L145F	L	+	1	0	PLA1A	120810464	0.000000	0.05858	0.280000	0.24747	0.013000	0.08279	-0.281000	0.08456	0.599000	0.29845	0.462000	0.41574	CTT	PLA1A	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH	ENSG00000144837		0.468	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA1A	HGNC	protein_coding	OTTHUMT00000355252.2	285	0.00	0	C			119327774	119327774	+1	no_errors	ENST00000273371	ensembl	human	known	69_37n	missense	197	26.77	72	SNP	0.002	T
RAB13	5872	genome.wustl.edu	37	1	153954902	153954902	+	Missense_Mutation	SNP	G	G	A	rs202131118		TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr1:153954902G>A	ENST00000368575.3	-	7	614	c.499C>T	c.(499-501)Cgg>Tgg	p.R167W	RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family	167					cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAGATGTCCCGGGCCAGGGAA	0.512													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18115	0.0		0.0	False		,,,				2504	0.0				Ovarian(138;395 2427 24306 43415)	dbGAP											0													154.0	166.0	162.0					1																	153954902		2203	4300	6503	-	-	-	SO:0001583	missense	0			X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.499C>T	1.37:g.153954902G>A	ENSP00000357564:p.Arg167Trp		A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R167W	ENST00000368575.3	37	c.499	CCDS1058.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	14.32	2.499719	0.44455	.	.	ENSG00000143545	ENST00000368575	T	0.79454	-1.27	4.6	3.64	0.41730	.	0.135173	0.47093	D	0.000252	T	0.68696	0.3029	M	0.84326	2.69	0.51767	D	0.999937	B	0.11235	0.004	B	0.06405	0.002	T	0.75399	-0.3331	10	0.72032	D	0.01	.	9.973	0.41765	0.0:0.0:0.7991:0.2009	.	167	P51153	RAB13_HUMAN	W	167	ENSP00000357564:R167W	ENSP00000357564:R167W	R	-	1	2	RAB13	152221526	0.990000	0.36364	1.000000	0.80357	0.999000	0.98932	0.630000	0.24553	2.387000	0.81309	0.655000	0.94253	CGG	RAB13	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase	ENSG00000143545		0.512	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB13	HGNC	protein_coding	OTTHUMT00000088992.1	236	0.00	0	G	NM_002870		153954902	153954902	-1	no_errors	ENST00000368575	ensembl	human	known	69_37n	missense	325	14.02	53	SNP	1.000	A
SEC24C	9632	genome.wustl.edu	37	10	75528883	75528883	+	Silent	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr10:75528883C>T	ENST00000339365.2	+	18	2559	c.2397C>T	c.(2395-2397)ctC>ctT	p.L799L	SEC24C_ENST00000540668.1_Silent_p.L47L|SEC24C_ENST00000411652.2_Silent_p.L680L|SEC24C_ENST00000535742.1_Silent_p.L47L|SEC24C_ENST00000345254.4_Silent_p.L799L|SEC24C_ENST00000496827.1_3'UTR	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	799					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					ACGATCGGCTCAATGAAGAGA	0.547																																						dbGAP											0													60.0	53.0	55.0					10																	75528883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.2397C>T	10.37:g.75528883C>T			B4DZT4|Q8WV25	Silent	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.L799	ENST00000339365.2	37	c.2397	CCDS7332.1	10																																																																																			SEC24C	-	pfam_Sec23_24_beta_S	ENSG00000176986		0.547	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	112	0.88	1	C			75528883	75528883	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	silent	115	21.77	32	SNP	0.989	T
SEC24C	9632	genome.wustl.edu	37	10	75530080	75530080	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr10:75530080C>T	ENST00000339365.2	+	22	3067	c.2905C>T	c.(2905-2907)Cga>Tga	p.R969*	SEC24C_ENST00000540668.1_Nonsense_Mutation_p.R217*|FUT11_ENST00000372841.3_5'Flank|SEC24C_ENST00000411652.2_Nonsense_Mutation_p.R850*|FUT11_ENST00000394790.1_5'Flank|SEC24C_ENST00000535742.1_Nonsense_Mutation_p.R217*|SEC24C_ENST00000345254.4_Nonsense_Mutation_p.R969*|SEC24C_ENST00000496827.1_3'UTR	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	969					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					ACCAGCAGTTCGAGCCTCTGA	0.507																																						dbGAP											0													207.0	212.0	210.0					10																	75530080		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.2905C>T	10.37:g.75530080C>T	ENSP00000343405:p.Arg969*		B4DZT4|Q8WV25	Nonsense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.R969*	ENST00000339365.2	37	c.2905	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895558	0.72639	.	.	ENSG00000176986	ENST00000535742;ENST00000345254;ENST00000540668;ENST00000339365;ENST00000411652	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3224	15.6513	0.77095	0.1378:0.8622:0.0:0.0	.	.	.	.	X	217;969;217;969;850	.	ENSP00000343405:R969X	R	+	1	2	SEC24C	75200086	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.348000	0.44045	2.733000	0.93635	0.655000	0.94253	CGA	SEC24C	-	pfam_Gelsolin_dom	ENSG00000176986		0.507	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	185	0.47	1	C			75530080	75530080	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	nonsense	130	23.65	48	SNP	1.000	T
SEC24C	9632	genome.wustl.edu	37	10	75530798	75530798	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr10:75530798C>T	ENST00000339365.2	+	24	3392	c.3230C>T	c.(3229-3231)tCt>tTt	p.S1077F	SEC24C_ENST00000540668.1_Missense_Mutation_p.S325F|FUT11_ENST00000372841.3_5'Flank|SEC24C_ENST00000411652.2_Missense_Mutation_p.S958F|FUT11_ENST00000394790.1_5'Flank|SEC24C_ENST00000535742.1_Missense_Mutation_p.S325F|SEC24C_ENST00000345254.4_Missense_Mutation_p.S1077F	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	1077					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GGGGGAGCATCTTATGTGGAC	0.498																																						dbGAP											0													188.0	187.0	187.0					10																	75530798		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.3230C>T	10.37:g.75530798C>T	ENSP00000343405:p.Ser1077Phe		B4DZT4|Q8WV25	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.S1077F	ENST00000339365.2	37	c.3230	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	C	23.3	4.393832	0.83011	.	.	ENSG00000176986	ENST00000535742;ENST00000345254;ENST00000540668;ENST00000339365;ENST00000411652	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.76659	0.4018	H	0.94847	3.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81872	-0.0733	10	0.87932	D	0	-17.1802	20.6721	0.99693	0.0:1.0:0.0:0.0	.	958;1077	E7EP00;P53992	.;SC24C_HUMAN	F	325;1077;325;1077;958	ENSP00000446174:S325F;ENSP00000321845:S1077F;ENSP00000445023:S325F;ENSP00000343405:S1077F;ENSP00000402913:S958F	ENSP00000343405:S1077F	S	+	2	0	SEC24C	75200804	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	TCT	SEC24C	-	NULL	ENSG00000176986		0.498	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	195	0.00	0	C			75530798	75530798	+1	no_errors	ENST00000339365	ensembl	human	known	69_37n	missense	145	19.44	35	SNP	1.000	T
SLC30A10	55532	genome.wustl.edu	37	1	220089147	220089147	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr1:220089147C>G	ENST00000366926.3	-	4	1263	c.1102G>C	c.(1102-1104)Gaa>Caa	p.E368Q	SLC30A10_ENST00000536446.1_Missense_Mutation_p.E123Q|SLC30A10_ENST00000484079.1_5'UTR	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	368					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		TGGAAGATTTCTCGAATTTTT	0.458																																					Colon(76;360 1614 43677 51136)	dbGAP											0													122.0	118.0	119.0					1																	220089147		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.1102G>C	1.37:g.220089147C>G	ENSP00000355893:p.Glu368Gln		Q49AL9|Q9NPW0	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.E368Q	ENST00000366926.3	37	c.1102	CCDS31026.1	1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225428	0.39300	.	.	ENSG00000196660	ENST00000366926;ENST00000536446	T;T	0.63417	-0.04;-0.04	6.02	5.09	0.68999	.	0.250879	0.40554	N	0.001069	T	0.46190	0.1380	N	0.25485	0.75	0.80722	D	1	B	0.21071	0.051	B	0.27608	0.081	T	0.35101	-0.9802	9	.	.	.	-26.3839	7.5421	0.27744	0.0:0.7132:0.1467:0.1401	.	368	Q6XR72	ZNT10_HUMAN	Q	368;123	ENSP00000355893:E368Q;ENSP00000439489:E123Q	.	E	-	1	0	SLC30A10	218155770	0.986000	0.35501	1.000000	0.80357	0.789000	0.44602	1.399000	0.34566	1.514000	0.48869	0.650000	0.86243	GAA	SLC30A10	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000196660		0.458	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A10	HGNC	protein_coding	OTTHUMT00000357709.1	64	0.00	0	C	NM_018713		220089147	220089147	-1	no_errors	ENST00000366926	ensembl	human	known	69_37n	missense	95	15.18	17	SNP	1.000	G
SLC38A3	10991	genome.wustl.edu	37	3	50252845	50252845	+	RNA	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr3:50252845C>T	ENST00000420502.1	+	0	480									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		TCGCCTTGCTCTCCAGCTACT	0.607																																						dbGAP											0													93.0	95.0	95.0					3																	50252845		2016	4173	6189	-	-	-			0			U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50252845C>T				RNA	SNP	-	NULL	ENST00000420502.1	37	NULL		3																																																																																			SLC38A3	-	-	ENSG00000188338		0.607	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	SLC38A3	HGNC	processed_transcript	OTTHUMT00000345635.2	95	0.00	0	C	NM_006841		50252845	50252845	+1	no_errors	ENST00000420502	ensembl	human	known	69_37n	rna	72	20.88	19	SNP	0.910	T
SPATA13	221178	genome.wustl.edu	37	13	24798398	24798398	+	Intron	SNP	C	C	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr13:24798398C>G	ENST00000382095.4	+	2	185				SPATA13_ENST00000382108.3_Missense_Mutation_p.S444C|SPATA13_ENST00000474317.1_3'UTR|SPATA13_ENST00000424834.2_Missense_Mutation_p.S444C|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.S444C	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		AGCAAAGACTCCTGTGACCCA	0.582																																						dbGAP											0													51.0	58.0	56.0					13																	24798398		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.-222-25217C>G	13.37:g.24798398C>G			A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.S444C	ENST00000382095.4	37	c.1331	CCDS9305.1	13	.	.	.	.	.	.	.	.	.	.	C	10.22	1.290001	0.23478	.	.	ENSG00000182957	ENST00000382108	T	0.80393	-1.37	4.15	4.15	0.48705	.	0.212890	0.23373	U	0.048887	T	0.75012	0.3792	L	0.29908	0.895	0.31348	N	0.682869	.	.	.	.	.	.	T	0.78563	-0.2156	8	0.72032	D	0.01	.	9.452	0.38731	0.0:0.9019:0.0:0.0981	.	.	.	.	C	444	ENSP00000371542:S444C	ENSP00000371542:S444C	S	+	2	0	SPATA13	23696398	0.003000	0.15002	0.005000	0.12908	0.006000	0.05464	1.111000	0.31159	2.142000	0.66516	0.585000	0.79938	TCC	SPATA13	-	NULL	ENSG00000182957		0.582	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPATA13	HGNC	protein_coding	OTTHUMT00000044180.2	87	0.00	0	C	NM_153023		24798398	24798398	+1	no_errors	ENST00000382108	ensembl	human	known	69_37n	missense	63	20.25	16	SNP	0.008	G
SRCAP	10847	genome.wustl.edu	37	16	30732773	30732773	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr16:30732773C>T	ENST00000262518.4	+	21	3902	c.3517C>T	c.(3517-3519)Ccc>Tcc	p.P1173S	SRCAP_ENST00000344771.4_Intron|SRCAP_ENST00000395059.2_Missense_Mutation_p.P1173S	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1173	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CATTCTATCTCCCGATATGCA	0.577																																						dbGAP											0													78.0	68.0	71.0					16																	30732773		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3517C>T	16.37:g.30732773C>T	ENSP00000262518:p.Pro1173Ser		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.P1173S	ENST00000262518.4	37	c.3517	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700858	0.68501	.	.	ENSG00000080603	ENST00000262518;ENST00000395059	D;D	0.90955	-2.76;-2.69	5.26	5.26	0.73747	.	.	.	.	.	D	0.89213	0.6651	N	0.11560	0.145	0.80722	D	1	D;P	0.54397	0.966;0.943	P;P	0.60473	0.875;0.753	D	0.89509	0.3770	9	0.37606	T	0.19	-3.3816	17.8119	0.88619	0.0:1.0:0.0:0.0	.	1173;1173	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	S	1173	ENSP00000262518:P1173S;ENSP00000378499:P1173S	ENSP00000262518:P1173S	P	+	1	0	SRCAP	30640274	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.483000	0.73617	2.735000	0.93741	0.563000	0.77884	CCC	SRCAP	-	NULL	ENSG00000080603		0.577	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	62	0.00	0	C	NM_006662		30732773	30732773	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	missense	68	20.93	18	SNP	1.000	T
ST6GALNAC2	10610	genome.wustl.edu	37	17	74566725	74566725	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr17:74566725G>A	ENST00000225276.5	-	6	1014	c.695C>T	c.(694-696)tCa>tTa	p.S232L	RP11-666A8.9_ENST00000588104.1_RNA|ST6GALNAC2_ENST00000586520.1_5'Flank	NM_006456.2	NP_006447.2	Q9UJ37	SIA7B_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2	232					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	11						GCGGATGTCTGAGGGGATGAA	0.572																																						dbGAP											0													87.0	73.0	77.0					17																	74566725		2203	4300	6503	-	-	-	SO:0001583	missense	0			U14550	CCDS11747.1	17q25.1	2013-03-01	2003-12-05	2005-02-07	ENSG00000070731	ENSG00000070731	2.4.99.7	"""Sialyltransferases"""	10867	protein-coding gene	gene with protein product		610137	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"", ""sialyltransferase-like 1"""	SIAT7, SIAT7B, SIATL1		11984005	Standard	NM_006456		Approved	ST6GalNAII, STHM	uc002jsg.4	Q9UJ37	OTTHUMG00000180301	ENST00000225276.5:c.695C>T	17.37:g.74566725G>A	ENSP00000225276:p.Ser232Leu		Q12971	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.S232L	ENST00000225276.5	37	c.695	CCDS11747.1	17	.	.	.	.	.	.	.	.	.	.	G	11.59	1.684267	0.29872	.	.	ENSG00000070731	ENST00000225276	T	0.30714	1.52	5.42	2.35	0.29111	.	0.221242	0.37304	N	0.002149	T	0.31949	0.0813	L	0.61218	1.895	0.31125	N	0.708388	P	0.38395	0.629	B	0.42827	0.399	T	0.26258	-1.0108	10	0.35671	T	0.21	-4.7611	7.8076	0.29211	0.1495:0.1342:0.7163:0.0	.	232	Q9UJ37	SIA7B_HUMAN	L	232	ENSP00000225276:S232L	ENSP00000225276:S232L	S	-	2	0	ST6GALNAC2	72078320	1.000000	0.71417	0.099000	0.21106	0.212000	0.24457	6.288000	0.72679	0.270000	0.21984	0.561000	0.74099	TCA	ST6GALNAC2	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000070731		0.572	ST6GALNAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC2	HGNC	protein_coding	OTTHUMT00000450650.1	41	0.00	0	G	NM_006456		74566725	74566725	-1	no_errors	ENST00000225276	ensembl	human	known	69_37n	missense	78	21.21	21	SNP	0.410	A
SUN5	140732	genome.wustl.edu	37	20	31573550	31573550	+	Missense_Mutation	SNP	C	C	A	rs373087559		TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr20:31573550C>A	ENST00000356173.3	-	11	981	c.889G>T	c.(889-891)Gtc>Ttc	p.V297F	SUN5_ENST00000375523.3_Missense_Mutation_p.V272F	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	297	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						ACATAGATGACGAAGTCCTTG	0.537																																						dbGAP											0													123.0	96.0	105.0					20																	31573550		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.889G>T	20.37:g.31573550C>A	ENSP00000348496:p.Val297Phe		A6NJ82|Q5T9R0	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.V297F	ENST00000356173.3	37	c.889	CCDS13209.1	20	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062634	0.55432	.	.	ENSG00000167098	ENST00000356173;ENST00000375523	T;T	0.44083	0.93;0.93	5.71	5.71	0.89125	Sad1/UNC-like, C-terminal (2);	0.266290	0.37261	N	0.002171	T	0.57417	0.2052	L	0.48642	1.525	0.80722	D	1	D	0.69078	0.997	D	0.70487	0.969	T	0.56625	-0.7948	10	0.59425	D	0.04	-48.6352	15.3428	0.74311	0.0:1.0:0.0:0.0	.	297	Q8TC36	SUN5_HUMAN	F	297;272	ENSP00000348496:V297F;ENSP00000364673:V272F	ENSP00000348496:V297F	V	-	1	0	SUN5	31037211	0.988000	0.35896	0.998000	0.56505	0.367000	0.29736	2.734000	0.47368	2.688000	0.91661	0.655000	0.94253	GTC	SUN5	-	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	ENSG00000167098		0.537	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUN5	HGNC	protein_coding	OTTHUMT00000078659.1	104	0.00	0	C	NM_080675		31573550	31573550	-1	no_errors	ENST00000356173	ensembl	human	known	69_37n	missense	190	12.44	27	SNP	0.997	A
SYNE2	23224	genome.wustl.edu	37	14	64540727	64540727	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr14:64540727C>A	ENST00000344113.4	+	53	10951	c.10739C>A	c.(10738-10740)aCt>aAt	p.T3580N	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000394768.2_5'Flank|SYNE2_ENST00000554584.1_Missense_Mutation_p.T3613N|SYNE2_ENST00000555002.1_Missense_Mutation_p.T214N|SYNE2_ENST00000358025.3_Missense_Mutation_p.T3580N	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3580					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTGGTGCAGACTGAAATCCAA	0.323																																						dbGAP											0													126.0	125.0	125.0					14																	64540727		1819	4066	5885	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.10739C>A	14.37:g.64540727C>A	ENSP00000341781:p.Thr3580Asn		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.T3580N	ENST00000344113.4	37	c.10739	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	8.292	0.817867	0.16607	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002	T;T;T;T	0.56275	0.83;0.83;0.47;4.18	5.3	3.33	0.38152	.	0.566593	0.17108	N	0.186717	T	0.24470	0.0593	N	0.04508	-0.205	0.27902	N	0.938925	B;B	0.09022	0.001;0.002	B;B	0.08055	0.001;0.003	T	0.15122	-1.0448	10	0.15499	T	0.54	.	6.0448	0.19753	0.2072:0.6314:0.0:0.1614	.	3580;3580	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	N	3580;3580;3613;3613;214	ENSP00000350719:T3580N;ENSP00000341781:T3580N;ENSP00000452570:T3613N;ENSP00000450831:T214N	ENSP00000261678:T3613N	T	+	2	0	SYNE2	63610480	0.989000	0.36119	0.995000	0.50966	0.833000	0.47200	0.887000	0.28254	1.233000	0.43693	0.655000	0.94253	ACT	SYNE2	-	NULL	ENSG00000054654		0.323	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	210	0.47	1	C	NM_182914		64540727	64540727	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	143	16.37	28	SNP	0.546	A
TBX3	6926	genome.wustl.edu	37	12	115118757	115118758	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr12:115118757_115118758insC	ENST00000257566.3	-	2	972_973	c.583_584insG	c.(583-585)gaafs	p.E195fs	TBX3_ENST00000349155.2_Frame_Shift_Ins_p.E195fs	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	195					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CATCCACTGTTCCCCAGTAGCG	0.455																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.584dupG	12.37:g.115118761_115118761dupC	ENSP00000257566:p.Glu195fs		Q8TB20|Q9UKF8	Frame_Shift_Ins	INS	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.E195fs	ENST00000257566.3	37	c.584_583	CCDS9176.1	12																																																																																			TBX3	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000135111		0.455	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	206	0.00	0	-	NM_016569, NM_005996		115118757	115118758	-1	no_errors	ENST00000257566	ensembl	human	known	69_37n	frame_shift_ins	172	28.33	68	INS	1.000:1.000	C
TMC7	79905	genome.wustl.edu	37	16	19020581	19020581	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr16:19020581G>A	ENST00000304381.5	+	2	285	c.155G>A	c.(154-156)aGg>aAg	p.R52K	RNU6-1340P_ENST00000384438.1_RNA|TMC7_ENST00000569532.1_Missense_Mutation_p.R52K|TMC7_ENST00000421369.3_5'UTR	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	52					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						ATTGCACGTAGGAGAACGACT	0.498																																						dbGAP											0													95.0	88.0	91.0					16																	19020581		2197	4300	6497	-	-	-	SO:0001583	missense	0			AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.155G>A	16.37:g.19020581G>A	ENSP00000304710:p.Arg52Lys		E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	pfam_TMC	p.R52K	ENST00000304381.5	37	c.155	CCDS10573.1	16	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299659	0.40694	.	.	ENSG00000170537	ENST00000304381	T	0.71222	-0.55	5.33	0.45	0.16624	.	0.170845	0.49916	N	0.000128	T	0.57095	0.2030	L	0.37850	1.14	0.80722	D	1	B;B;B	0.25169	0.119;0.004;0.003	B;B;B	0.24974	0.057;0.016;0.006	T	0.46414	-0.9193	10	0.39692	T	0.17	.	10.7242	0.46057	0.2088:0.0:0.7912:0.0	.	52;52;52	B4DF02;Q7Z402;B3KSZ3	.;TMC7_HUMAN;.	K	52	ENSP00000304710:R52K	ENSP00000304710:R52K	R	+	2	0	TMC7	18928082	0.722000	0.28017	0.706000	0.30403	0.750000	0.42670	0.248000	0.18198	-0.097000	0.12307	0.650000	0.86243	AGG	TMC7	-	NULL	ENSG00000170537		0.498	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC7	HGNC	protein_coding	OTTHUMT00000254276.3	172	0.00	0	G	NM_024847		19020581	19020581	+1	no_errors	ENST00000304381	ensembl	human	known	69_37n	missense	157	14.67	27	SNP	0.566	A
TMEM191A	84222	genome.wustl.edu	37	22	21055496	21055496	+	RNA	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr22:21055496G>A	ENST00000450925.2	+	0	95					NR_026815.1		Q9H0A3	T191A_HUMAN	transmembrane protein 191A (pseudogene)							integral component of membrane (GO:0016021)											ctgattttctgatgttgaaca	0.383																																						dbGAP											0													160.0	118.0	131.0					22																	21055496		692	1591	2283	-	-	-			0			AL136879		22q11.21	2012-04-20	2012-04-20		ENSG00000226287	ENSG00000226287			25317	pseudogene	pseudogene			"""transmembrane protein 191A"""			11230166	Standard	NR_026815		Approved	DKFZp434N035, TMEM191AP	uc002zsx.1	Q9H0A3	OTTHUMG00000150164		22.37:g.21055496G>A			B2R8E2	RNA	SNP	-	NULL	ENST00000450925.2	37	NULL		22																																																																																			TMEM191A	-	-	ENSG00000226287		0.383	TMEM191A-001	KNOWN	basic	processed_transcript	TMEM191A	HGNC	processed_transcript	OTTHUMT00000316649.1	479	0.00	0	G			21055496	21055496	+1	no_errors	ENST00000359859	ensembl	human	known	69_37n	rna	337	22.71	99	SNP	0.176	A
TNKS	8658	genome.wustl.edu	37	8	9619112	9619112	+	Silent	SNP	C	C	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr8:9619112C>A	ENST00000310430.6	+	21	3266	c.3240C>A	c.(3238-3240)atC>atA	p.I1080I	TNKS_ENST00000518281.1_Silent_p.I843I	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	1080	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		ACAAATTAATCAAAGGAGTAG	0.368																																						dbGAP											0													77.0	74.0	75.0					8																	9619112		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.3240C>A	8.37:g.9619112C>A			O95272|Q4G0F2	Silent	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom	p.I1080	ENST00000310430.6	37	c.3240	CCDS5974.1	8																																																																																			TNKS	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000173273		0.368	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS	HGNC	protein_coding	OTTHUMT00000206935.1	276	0.36	1	C	NM_003747		9619112	9619112	+1	no_errors	ENST00000310430	ensembl	human	known	69_37n	silent	106	27.89	41	SNP	1.000	A
TRIM45	80263	genome.wustl.edu	37	1	117663630	117663630	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr1:117663630C>G	ENST00000256649.4	-	1	720	c.194G>C	c.(193-195)cGa>cCa	p.R65P	TRIM45_ENST00000369464.3_Missense_Mutation_p.R65P|TRIM45_ENST00000369461.3_Intron	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	65					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		GTCTCCCCCTCGGATGTCCAC	0.537																																						dbGAP											0													81.0	80.0	80.0					1																	117663630		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.194G>C	1.37:g.117663630C>G	ENSP00000256649:p.Arg65Pro		Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_B-box,pfscan_Znf_RING	p.R65P	ENST00000256649.4	37	c.194	CCDS893.1	1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404821	0.42613	.	.	ENSG00000134253	ENST00000256649;ENST00000369464	T;D	0.82711	-1.48;-1.64	4.91	3.99	0.46301	Zinc finger, RING-type (2);	0.191023	0.31415	N	0.007695	T	0.61451	0.2348	L	0.44542	1.39	0.80722	D	1	P;P	0.43857	0.69;0.819	B;B	0.40134	0.318;0.32	T	0.60959	-0.7159	10	0.23302	T	0.38	0.3621	7.175	0.25738	0.0:0.8047:0.0:0.1953	.	65;65	Q9H8W5-2;Q9H8W5	.;TRI45_HUMAN	P	65	ENSP00000256649:R65P;ENSP00000358476:R65P	ENSP00000256649:R65P	R	-	2	0	TRIM45	117465153	0.023000	0.18921	0.982000	0.44146	0.620000	0.37586	1.929000	0.40114	1.276000	0.44395	0.561000	0.74099	CGA	TRIM45	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000134253		0.537	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM45	HGNC	protein_coding	OTTHUMT00000033503.1	66	0.00	0	C	NM_025188		117663630	117663630	-1	no_errors	ENST00000256649	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	0.999	G
TRIM49B	283116	genome.wustl.edu	37	11	49053416	49053416	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr11:49053416G>A	ENST00000332682.7	+	2	293	c.265G>A	c.(265-267)Gag>Aag	p.E89K		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	89						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						CCTGAGCTCTGAGGAGCAAAT	0.483																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.265G>A	11.37:g.49053416G>A	ENSP00000330216:p.Glu89Lys			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E89K	ENST00000332682.7	37	c.265	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	G	12.77	2.037797	0.35989	.	.	ENSG00000182053	ENST00000332682	T	0.43294	0.95	0.49	0.49	0.16861	.	.	.	.	.	T	0.24122	0.0584	L	0.31420	0.93	0.21256	N	0.999742	.	.	.	.	.	.	T	0.23048	-1.0199	7	0.12766	T	0.61	.	2.9188	0.05762	0.3811:0.0:0.6189:0.0	.	.	.	.	K	89	ENSP00000330216:E89K	ENSP00000330216:E89K	E	+	1	0	AC084851.1	49009992	0.000000	0.05858	0.056000	0.19401	0.021000	0.10359	0.265000	0.18515	0.513000	0.28278	0.184000	0.17185	GAG	TRIM49B	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000182053		0.483	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		232	0.00	0	G			49053416	49053416	+1	no_errors	ENST00000332682	ensembl	human	known	69_37n	missense	183	25.61	63	SNP	0.710	A
TRIO	7204	genome.wustl.edu	37	5	14472760	14472760	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr5:14472760T>C	ENST00000344204.4	+	39	5996	c.5972T>C	c.(5971-5973)gTg>gCg	p.V1991A	TRIO_ENST00000537187.1_Missense_Mutation_p.V1991A	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1991	DH 2. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CTTGGCTATGTGGTTGAGGTG	0.398																																						dbGAP											0													234.0	199.0	211.0					5																	14472760		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.5972T>C	5.37:g.14472760T>C	ENSP00000339299:p.Val1991Ala		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.V1991A	ENST00000344204.4	37	c.5972	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	T	31	5.070528	0.93950	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000541447	T;T	0.64438	-0.1;-0.1	5.38	5.38	0.77491	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.79627	0.4478	M	0.87456	2.885	0.58432	D	0.999999	D;P	0.56287	0.975;0.711	P;P	0.59595	0.86;0.474	D	0.83933	0.0307	10	0.87932	D	0	.	15.4139	0.74948	0.0:0.0:0.0:1.0	.	1991;1991	O75962-5;O75962	.;TRIO_HUMAN	A	1991;1991;1678;71	ENSP00000339299:V1991A;ENSP00000446348:V1991A	ENSP00000339299:V1991A	V	+	2	0	TRIO	14525760	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.040000	0.89188	2.046000	0.60703	0.533000	0.62120	GTG	TRIO	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000038382		0.398	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	557	0.00	0	T	NM_007118		14472760	14472760	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	missense	474	20.87	125	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179600355	179600355	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr2:179600355C>A	ENST00000591111.1	-	48	14091	c.13867G>T	c.(13867-13869)Gat>Tat	p.D4623Y	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D3696Y|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D4940Y|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12375	Ig-like 26.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTATTTTATCTTCAAAACAG	0.438																																						dbGAP											0													70.0	68.0	69.0					2																	179600355		1832	4080	5912	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13867G>T	2.37:g.179600355C>A	ENSP00000465570:p.Asp4623Tyr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D3696Y	ENST00000591111.1	37	c.11086		2	.	.	.	.	.	.	.	.	.	.	C	11.36	1.617202	0.28801	.	.	ENSG00000155657	ENST00000342992	T	0.46451	0.87	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.63861	0.2547	L	0.58669	1.825	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.63422	-0.6641	9	0.87932	D	0	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	4623	Q8WZ42	TITIN_HUMAN	Y	3696	ENSP00000343764:D3696Y	ENSP00000343764:D3696Y	D	-	1	0	TTN	179308600	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.920000	0.63390	2.885000	0.99019	0.655000	0.94253	GAT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	269	0.00	0	C	NM_133378		179600355	179600355	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	181	23.21	55	SNP	1.000	A
UBE3A	7337	genome.wustl.edu	37	15	25616325	25616325	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr15:25616325C>G	ENST00000397954.2	-	4	1004	c.1005G>C	c.(1003-1005)caG>caC	p.Q335H	UBE3A_ENST00000232165.3_Missense_Mutation_p.Q332H|UBE3A_ENST00000428984.2_Missense_Mutation_p.Q312H|UBE3A_ENST00000566215.1_Missense_Mutation_p.Q312H|UBE3A_ENST00000438097.1_Missense_Mutation_p.Q312H|SNHG14_ENST00000554726.1_RNA			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	335					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		TTCTCCGAATCTGGTCTGCAT	0.393																																						dbGAP											0			GRCh37	CD982995	UBE3A	D							94.0	92.0	92.0					15																	25616325		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.1005G>C	15.37:g.25616325C>G	ENSP00000381045:p.Gln335His		A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	p.Q335H	ENST00000397954.2	37	c.1005	CCDS45192.1	15	.	.	.	.	.	.	.	.	.	.	C	10.56	1.384405	0.25031	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.19394	2.15;2.15;2.16;2.16	5.74	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.12475	0.0303	N	0.15975	0.35	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.10019	-1.0648	10	0.27082	T	0.32	.	11.4149	0.49945	0.0:0.8446:0.0:0.1554	.	332;335	Q05086-3;Q05086	.;UBE3A_HUMAN	H	332;332;335;312;312	ENSP00000232165:Q332H;ENSP00000381045:Q335H;ENSP00000411258:Q312H;ENSP00000401265:Q312H	ENSP00000232165:Q332H	Q	-	3	2	UBE3A	23167418	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.317000	0.43770	1.447000	0.47661	0.591000	0.81541	CAG	UBE3A	-	pirsf_Ubiquitin-protein_ligase_E6-AP	ENSG00000114062		0.393	UBE3A-003	KNOWN	basic|CCDS	protein_coding	UBE3A	HGNC	protein_coding	OTTHUMT00000434203.1	189	0.00	0	C	NM_000462		25616325	25616325	-1	no_errors	ENST00000397954	ensembl	human	known	69_37n	missense	125	13.10	19	SNP	1.000	G
WDFY1	57590	genome.wustl.edu	37	2	224782704	224782704	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr2:224782704C>T	ENST00000233055.4	-	2	263	c.161G>A	c.(160-162)aGa>aAa	p.R54K		NM_020830.3	NP_065881.1	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	54						cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)	18		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		ACCACTGTCTCTTTTCAGCCA	0.358																																						dbGAP											0													86.0	76.0	79.0					2																	224782704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037856	CCDS33387.1	2q36.2	2013-01-09	2003-03-13		ENSG00000085449	ENSG00000085449		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20451	protein-coding gene	gene with protein product			"""WD40 and FYVE domain containing 1"""			11739631	Standard	NM_020830		Approved	KIAA1435, FENS-1, WDF1, ZFYVE17	uc002vnq.3	Q8IWB7	OTTHUMG00000153370	ENST00000233055.4:c.161G>A	2.37:g.224782704C>T	ENSP00000233055:p.Arg54Lys		Q53S17|Q9H9D5|Q9P2B3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_FYVE,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,smart_WD40_repeat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R54K	ENST00000233055.4	37	c.161	CCDS33387.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.120209	0.94385	.	.	ENSG00000085449	ENST00000233055;ENST00000429915	T;T	0.31769	1.66;1.48	5.35	5.35	0.76521	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.47857	0.1468	L	0.58510	1.815	0.80722	D	1	P	0.44690	0.841	P	0.57204	0.815	T	0.16719	-1.0393	10	0.23302	T	0.38	-18.4332	17.8493	0.88740	0.0:1.0:0.0:0.0	.	54	Q8IWB7	WDFY1_HUMAN	K	54	ENSP00000233055:R54K;ENSP00000395416:R54K	ENSP00000233055:R54K	R	-	2	0	WDFY1	224490948	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.840000	0.75369	2.498000	0.84270	0.563000	0.77884	AGA	WDFY1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000085449		0.358	WDFY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY1	HGNC	protein_coding	OTTHUMT00000330908.1	190	0.00	0	C	NM_020830		224782704	224782704	-1	no_errors	ENST00000233055	ensembl	human	known	69_37n	missense	151	22.16	43	SNP	1.000	T
WEE1	7465	genome.wustl.edu	37	11	9598152	9598152	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr11:9598152G>A	ENST00000450114.2	+	4	1218	c.965G>A	c.(964-966)gGa>gAa	p.G322E	snoU13_ENST00000458785.1_RNA|WEE1_ENST00000299613.6_Missense_Mutation_p.G108E	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	322	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		AGGCTGGATGGATGCATTTAT	0.403																																						dbGAP											0													122.0	126.0	125.0					11																	9598152		2201	4294	6495	-	-	-	SO:0001583	missense	0			X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.965G>A	11.37:g.9598152G>A	ENSP00000402084:p.Gly322Glu		B3KVE1|D3DQV0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_cat_dom	p.G322E	ENST00000450114.2	37	c.965	CCDS7800.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.450238	0.96205	.	.	ENSG00000166483	ENST00000450114;ENST00000299613	T;T	0.52526	0.66;0.66	5.61	5.61	0.85477	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77061	0.4075	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82045	-0.0652	10	0.87932	D	0	-17.8693	19.6415	0.95760	0.0:0.0:1.0:0.0	.	130;322	Q6MZL0;P30291	.;WEE1_HUMAN	E	322;108	ENSP00000402084:G322E;ENSP00000299613:G108E	ENSP00000299613:G108E	G	+	2	0	WEE1	9554728	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.638000	0.89438	0.650000	0.86243	GGA	WEE1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_cat_dom	ENSG00000166483		0.403	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WEE1	HGNC	protein_coding	OTTHUMT00000386757.1	425	0.00	0	G	NM_003390		9598152	9598152	+1	no_errors	ENST00000450114	ensembl	human	known	69_37n	missense	278	18.66	64	SNP	1.000	A
WNT2	7472	genome.wustl.edu	37	7	116955280	116955280	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr7:116955280C>T	ENST00000265441.3	-	3	732	c.433G>A	c.(433-435)Gcc>Acc	p.A145T	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	145					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CTGTCCTTGGCGCTTCCCATC	0.473																																						dbGAP											0													150.0	135.0	140.0					7																	116955280		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.433G>A	7.37:g.116955280C>T	ENSP00000265441:p.Ala145Thr		A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.A145T	ENST00000265441.3	37	c.433	CCDS5771.1	7	.	.	.	.	.	.	.	.	.	.	C	10.24	1.296997	0.23650	.	.	ENSG00000105989	ENST00000265441	T	0.75704	-0.96	5.56	1.3	0.21679	.	0.261889	0.38548	N	0.001660	T	0.55386	0.1917	L	0.28776	0.89	0.24240	N	0.995362	B;B	0.12013	0.005;0.005	B;B	0.10450	0.005;0.005	T	0.45011	-0.9290	10	0.51188	T	0.08	.	2.9212	0.05770	0.3319:0.4205:0.1099:0.1377	.	145;145	A4D0V1;P09544	.;WNT2_HUMAN	T	145	ENSP00000265441:A145T	ENSP00000265441:A145T	A	-	1	0	WNT2	116742516	0.056000	0.20664	0.298000	0.25002	0.947000	0.59692	0.502000	0.22594	0.333000	0.23563	0.655000	0.94253	GCC	WNT2	-	pfam_Wnt,smart_Wnt	ENSG00000105989		0.473	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2	HGNC	protein_coding	OTTHUMT00000059749.3	262	0.00	0	C	NM_003391		116955280	116955280	-1	no_errors	ENST00000265441	ensembl	human	known	69_37n	missense	210	21.93	59	SNP	0.064	T
XBP1	7494	genome.wustl.edu	37	22	29191587	29191588	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr22:29191587_29191588insG	ENST00000216037.6	-	5	804_805	c.732_733insC	c.(730-735)ccctttfs	p.F245fs	XBP1_ENST00000344347.5_Frame_Shift_Ins_p.L236fs|XBP1_ENST00000405219.3_Frame_Shift_Ins_p.F195fs|XBP1_ENST00000403532.3_Frame_Shift_Ins_p.F250fs	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1	245					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						TGACAGAGAAAGGGAGGCTGGT	0.525																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.733dupC	22.37:g.29191590_29191590dupG	ENSP00000216037:p.Phe245fs		Q8WYK6|Q969P1|Q96BD7	Frame_Shift_Ins	INS	pfam_bZIP_2,pfam_bZIP_1,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.L236fs	ENST00000216037.6	37	c.707_706	CCDS13847.1	22																																																																																			XBP1	-	NULL	ENSG00000100219		0.525	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	XBP1	HGNC	protein_coding	OTTHUMT00000321274.1	110	0.00	0	-	NM_005080		29191587	29191588	-1	no_errors	ENST00000344347	ensembl	human	known	69_37n	frame_shift_ins	87	19.44	21	INS	1.000:1.000	G
ZNF131	7690	genome.wustl.edu	37	5	43175004	43175004	+	Silent	SNP	G	G	A			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr5:43175004G>A	ENST00000399534.1	+	7	1685	c.1641G>A	c.(1639-1641)cgG>cgA	p.R547R	ZNF131_ENST00000505606.2_Silent_p.R513R|ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000509156.1_Silent_p.R547R|ZNF131_ENST00000509634.1_Silent_p.R513R|ZNF131_ENST00000306938.4_Silent_p.R513R			P52739	ZN131_HUMAN	zinc finger protein 131	547					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						ATGTTGAACGGGTCAATCAAA	0.473																																						dbGAP											0													76.0	74.0	75.0					5																	43175004		1975	4155	6130	-	-	-	SO:0001819	synonymous_variant	0			U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.1641G>A	5.37:g.43175004G>A			B4DRL3|Q6PIF0	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R547	ENST00000399534.1	37	c.1641		5																																																																																			ZNF131	-	NULL	ENSG00000172262		0.473	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	ZNF131	HGNC	protein_coding	OTTHUMT00000367982.1	97	0.00	0	G	NM_003432		43175004	43175004	+1	no_errors	ENST00000399534	ensembl	human	known	69_37n	silent	78	35.54	43	SNP	1.000	A
ZNF295-AS1	150142	genome.wustl.edu	37	21	43444748	43444748	+	lincRNA	SNP	C	C	G			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr21:43444748C>G	ENST00000596595.1	+	0	2557							Q8N0V1	ZNAS1_HUMAN	ZNF295 antisense RNA 1																		GAGCCTTCCTCCCAGGAGGGA	0.602																																						dbGAP											0													120.0	121.0	121.0					21																	43444748		692	1591	2283	-	-	-			0					21q22.3	2012-10-12	2012-08-15	2011-08-11	ENSG00000237232	ENSG00000237232		"""Long non-coding RNAs"""	23130	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 121"", ""non-protein coding RNA 318"", ""ZNF295 antisense RNA 1 (non-protein coding)"""	C21orf121, NCRNA00318			Standard	NR_119384		Approved	PRED87	uc011aeu.1	Q8N0V1	OTTHUMG00000086787		21.37:g.43444748C>G				RNA	SNP	-	NULL	ENST00000596595.1	37	NULL		21																																																																																			ZNF295-AS1	-	-	ENSG00000237232		0.602	ZNF295-AS1-201	KNOWN	basic	lincRNA	ZNF295-AS1	HGNC	lincRNA		222	0.00	0	C	NR_027273		43444748	43444748	+1	no_errors	ENST00000412906	ensembl	human	known	69_37n	rna	151	25.62	52	SNP	0.000	G
ZNF660	285349	genome.wustl.edu	37	3	44636310	44636310	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A1AK-01A-21D-A12Q-09	TCGA-AR-A1AK-10A-01D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	52f7c22f-84cb-4263-93bf-1ae8cf8abbd2	eccf2a84-ba31-455f-942a-2c1dc7b08cc8	g.chr3:44636310C>T	ENST00000322734.2	+	3	958	c.625C>T	c.(625-627)Cag>Tag	p.Q209*	RP11-944L7.4_ENST00000457331.1_RNA	NM_173658.2	NP_775929.2	Q6AZW8	ZN660_HUMAN	zinc finger protein 660	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		TATGGACCATCAGAGAATTCA	0.373																																						dbGAP											0													80.0	86.0	84.0					3																	44636310		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK094189	CCDS2716.1	3p21.32	2013-01-08			ENSG00000144792	ENSG00000144792		"""Zinc fingers, C2H2-type"""	26720	protein-coding gene	gene with protein product							Standard	NM_173658		Approved	FLJ36870	uc003cnl.1	Q6AZW8	OTTHUMG00000133097	ENST00000322734.2:c.625C>T	3.37:g.44636310C>T	ENSP00000324605:p.Gln209*		Q7Z331|Q8N9M8	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q209*	ENST00000322734.2	37	c.625	CCDS2716.1	3	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657187	0.88154	.	.	ENSG00000144792	ENST00000322734	.	.	.	4.35	3.48	0.39840	.	.	.	.	.	.	.	.	.	.	.	0.45261	D	0.998262	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0778	0.19925	0.0:0.7033:0.0:0.2967	.	.	.	.	X	209	.	.	Q	+	1	0	ZNF660	44611314	0.000000	0.05858	0.839000	0.33178	0.964000	0.63967	0.192000	0.17096	1.173000	0.42796	0.650000	0.86243	CAG	ZNF660	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000144792		0.373	ZNF660-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF660	HGNC	protein_coding	OTTHUMT00000256756.4	280	0.00	0	C	NM_173658		44636310	44636310	+1	no_errors	ENST00000322734	ensembl	human	known	69_37n	nonsense	184	21.03	49	SNP	0.120	T
