#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB1	5243	genome.wustl.edu	37	7	87168661	87168661	+	Splice_Site	SNP	C	C	T	rs199564535		TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr7:87168661C>T	ENST00000265724.3	-	20	2737	c.2320G>A	c.(2320-2322)Ggt>Agt	p.G774S	ABCB1_ENST00000543898.1_Splice_Site_p.G710S	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	774	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	AATGTGAAACCCTGTGGGCAG	0.493																																						dbGAP											0													117.0	95.0	103.0					7																	87168661		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2320-1G>A	7.37:g.87168661C>T			A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.G774S	ENST00000265724.3	37	c.2320	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	C	19.50	3.838699	0.71373	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.89810	-2.57;-2.57	6.03	6.03	0.97812	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.93648	0.7971	M	0.63208	1.945	0.80722	D	1	B;D	0.61080	0.318;0.989	B;D	0.66351	0.173;0.943	D	0.92825	0.6275	10	0.54805	T	0.06	-19.1701	20.5666	0.99351	0.0:1.0:0.0:0.0	.	710;774	B5AK60;P08183	.;MDR1_HUMAN	S	555;774;710	ENSP00000265724:G774S;ENSP00000444095:G710S	ENSP00000265724:G774S	G	-	1	0	ABCB1	87006597	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	7.813000	0.86123	2.854000	0.98071	0.655000	0.94253	GGT	ABCB1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000085563		0.493	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	67	0.00	0	C	NM_000927	Missense_Mutation	87168661	87168661	-1	no_errors	ENST00000265724	ensembl	human	known	69_37n	missense	15	50.00	15	SNP	1.000	T
ABCB7	22	genome.wustl.edu	37	X	74289263	74289263	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:74289263C>A	ENST00000373394.3	-	11	1399	c.1392G>T	c.(1390-1392)caG>caT	p.Q464H	ABCB7_ENST00000253577.3_Missense_Mutation_p.Q465H|ABCB7_ENST00000339447.4_Missense_Mutation_p.Q424H|ABCB7_ENST00000534570.1_5'UTR			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	464					cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						GTGGTGTGATCTGAAGGGGAG	0.443																																						dbGAP											0													92.0	82.0	85.0					X																	74289263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.1392G>T	X.37:g.74289263C>A	ENSP00000362492:p.Gln464His		G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.Q465H	ENST00000373394.3	37	c.1395		X	.	.	.	.	.	.	.	.	.	.	C	9.036	0.988426	0.18966	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949	D;D;D;D	0.90385	-2.66;-2.66;-2.66;-2.66	5.31	3.51	0.40186	ABC transporter, transmembrane domain, type 1 (1);	0.408050	0.29355	N	0.012396	T	0.81754	0.4889	N	0.17764	0.52	0.34121	D	0.664099	B;B;B;B;B	0.11235	0.004;0.0;0.0;0.0;0.0	B;B;B;B;B	0.15052	0.012;0.001;0.001;0.001;0.002	T	0.76096	-0.3084	10	0.30078	T	0.28	-21.2169	9.5111	0.39078	0.0:0.8237:0.0:0.1763	.	438;424;465;464;465	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	H	438;465;424;464;438	ENSP00000253577:Q465H;ENSP00000343849:Q424H;ENSP00000362492:Q464H;ENSP00000436586:Q438H	ENSP00000253577:Q465H	Q	-	3	2	ABCB7	74205988	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	1.228000	0.32588	0.426000	0.26116	0.600000	0.82982	CAG	ABCB7	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000131269		0.443	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	ABCB7	HGNC	protein_coding	OTTHUMT00000057274.1	105	0.00	0	C	NM_004299		74289263	74289263	-1	no_errors	ENST00000253577	ensembl	human	known	69_37n	missense	6	73.91	17	SNP	1.000	A
ABHD16A	7920	genome.wustl.edu	37	6	31660923	31660923	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:31660923C>G	ENST00000395952.3	-	7	669	c.507G>C	c.(505-507)aaG>aaC	p.K169N	ABHD16A_ENST00000440843.2_Missense_Mutation_p.K136N|ABHD16A_ENST00000538874.1_Missense_Mutation_p.R71T|ABHD16A_ENST00000471644.1_5'Flank|XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|ABHD16A_ENST00000375842.4_5'UTR	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	169						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						CTCGAGACTCCTTCCTGAGGA	0.617																																						dbGAP											0													24.0	27.0	26.0					6																	31660923		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.507G>C	6.37:g.31660923C>G	ENSP00000379282:p.Lys169Asn		A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Missense_Mutation	SNP	pfam_AB_hydrolase_1	p.K169N	ENST00000395952.3	37	c.507	CCDS4713.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.89|14.89	2.670355|2.670355	0.47677|0.47677	.|.	.|.	ENSG00000204427|ENSG00000204427	ENST00000395952;ENST00000440843|ENST00000538874	.|.	.|.	.|.	5.63|5.63	2.92|2.92	0.33932|0.33932	.|.	0.454413|.	0.24846|.	N|.	0.035131|.	T|T	0.17066|0.17066	0.0410|0.0410	L|L	0.43152|0.43152	1.355|1.355	0.22389|0.22389	N|N	0.99915|0.99915	B;D|B	0.71674|0.34329	0.008;0.998|0.449	B;D|B	0.73708|0.34180	0.004;0.981|0.177	T|T	0.12941|0.12941	-1.0528|-1.0528	9|8	0.51188|0.87932	T|D	0.08|0	-19.522|-19.522	7.8023|7.8023	0.29180|0.29180	0.0:0.7422:0.0:0.2578|0.0:0.7422:0.0:0.2578	.|.	136;169|71	B7Z4R6;O95870|B7Z8I9	.;ABHGA_HUMAN|.	N|T	169;136|71	.|.	ENSP00000379282:K169N|ENSP00000442151:R71T	K|R	-|-	3|2	2|0	ABHD16A|ABHD16A	31768902|31768902	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	0.760000|0.760000	0.26475|0.26475	0.336000|0.336000	0.23639|0.23639	-0.254000|-0.254000	0.11334|0.11334	AAG|AGG	ABHD16A	-	NULL	ENSG00000204427		0.617	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD16A	HGNC	protein_coding	OTTHUMT00000076342.4	37	0.00	0	C			31660923	31660923	-1	no_errors	ENST00000395952	ensembl	human	known	69_37n	missense	8	57.89	11	SNP	1.000	G
ACTL6B	51412	genome.wustl.edu	37	7	100245120	100245120	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr7:100245120T>A	ENST00000160382.5	-	8	812	c.706A>T	c.(706-708)Aag>Tag	p.K236*		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	236					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TTCTCCTTCTTCTTCCAGTTT	0.607																																						dbGAP											0													79.0	73.0	75.0					7																	100245120		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.706A>T	7.37:g.100245120T>A	ENSP00000160382:p.Lys236*		A4D2D0|O75421	Nonsense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.K236*	ENST00000160382.5	37	c.706	CCDS5702.1	7	.	.	.	.	.	.	.	.	.	.	T	37	6.152299	0.97329	.	.	ENSG00000077080	ENST00000160382	.	.	.	5.38	5.38	0.77491	.	0.151001	0.44483	D	0.000443	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3941	0.60840	0.0:0.0:0.0:1.0	.	.	.	.	X	236	.	ENSP00000160382:K236X	K	-	1	0	ACTL6B	100083056	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.410000	0.80065	2.263000	0.75096	0.379000	0.24179	AAG	ACTL6B	-	pfam_Actin-like,smart_Actin-like	ENSG00000077080		0.607	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6B	HGNC	protein_coding	OTTHUMT00000356745.1	40	0.00	0	T	NM_016188		100245120	100245120	-1	no_errors	ENST00000160382	ensembl	human	known	69_37n	nonsense	10	44.44	8	SNP	1.000	A
ADAMTS17	170691	genome.wustl.edu	37	15	100636566	100636566	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr15:100636566C>T	ENST00000268070.4	-	15	2237	c.2132G>A	c.(2131-2133)gGg>gAg	p.G711E		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	711	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CTCACCTGTCCCCCGGGCGTG	0.567																																						dbGAP											0													118.0	130.0	126.0					15																	100636566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2132G>A	15.37:g.100636566C>T	ENSP00000268070:p.Gly711Glu		Q2I7G4|Q6ZN75	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G711E	ENST00000268070.4	37	c.2132	CCDS10383.1	15	.	.	.	.	.	.	.	.	.	.	C	25.5	4.646829	0.87958	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	T	0.61859	0.07	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.58637	0.2136	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.99	T	0.62732	-0.6792	10	0.31617	T	0.26	.	17.6927	0.88272	0.0:1.0:0.0:0.0	.	468;711	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	E	711;468	ENSP00000268070:G711E	ENSP00000268070:G711E	G	-	2	0	ADAMTS17	98454089	1.000000	0.71417	0.985000	0.45067	0.771000	0.43674	6.694000	0.74587	2.466000	0.83321	0.655000	0.94253	GGG	ADAMTS17	-	NULL	ENSG00000140470		0.567	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS17	HGNC	protein_coding	OTTHUMT00000313595.1	50	0.00	0	C	NM_139057		100636566	100636566	-1	no_errors	ENST00000268070	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	1.000	T
AKAP6	9472	genome.wustl.edu	37	14	33147618	33147618	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr14:33147618G>C	ENST00000280979.4	+	8	3002	c.2832G>C	c.(2830-2832)aaG>aaC	p.K944N	AKAP6_ENST00000557272.1_Missense_Mutation_p.K944N|AKAP6_ENST00000557354.1_Missense_Mutation_p.K944N	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	944					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GCAAGCGAAAGGAAGAGTTTG	0.418																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											0													180.0	167.0	171.0					14																	33147618		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2832G>C	14.37:g.33147618G>C	ENSP00000280979:p.Lys944Asn		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.K944N	ENST00000280979.4	37	c.2832	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420900	0.42918	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.19938	3.37;2.12;2.11	5.0	-2.11	0.07187	.	0.222180	0.39475	N	0.001354	T	0.12263	0.0298	N	0.08118	0	0.35587	D	0.80675	P;D	0.53619	0.651;0.961	B;P	0.47206	0.276;0.541	T	0.13818	-1.0495	10	0.62326	D	0.03	-17.0923	11.618	0.51099	0.4472:0.0:0.5528:0.0	.	944;944	A7E242;Q13023	.;AKAP6_HUMAN	N	944	ENSP00000280979:K944N;ENSP00000450531:K944N;ENSP00000451247:K944N	ENSP00000280979:K944N	K	+	3	2	AKAP6	32217369	0.998000	0.40836	0.937000	0.37676	0.878000	0.50629	0.424000	0.21330	-0.547000	0.06207	-1.099000	0.02127	AAG	AKAP6	-	NULL	ENSG00000151320		0.418	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	204	0.00	0	G	NM_004274		33147618	33147618	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense	34	58.54	48	SNP	0.984	C
AKNAD1	254268	genome.wustl.edu	37	1	109395170	109395170	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:109395170A>T	ENST00000370001.3	-	2	385	c.117T>A	c.(115-117)gaT>gaA	p.D39E	AKNAD1_ENST00000369994.1_Missense_Mutation_p.D39E|AKNAD1_ENST00000369995.3_Missense_Mutation_p.D39E|AKNAD1_ENST00000357393.4_Intron	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	39						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						CTTCAAGGCCATCCTTTTTTG	0.403																																						dbGAP											0													92.0	90.0	91.0					1																	109395170		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.117T>A	1.37:g.109395170A>T	ENSP00000359018:p.Asp39Glu		B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	pfam_TF_AT-hook	p.D39E	ENST00000370001.3	37	c.117	CCDS791.2	1	.	.	.	.	.	.	.	.	.	.	A	11.39	1.625799	0.28889	.	.	ENSG00000162641	ENST00000370001;ENST00000369994;ENST00000369995	T;T;T	0.06687	3.28;3.28;3.27	5.77	1.92	0.25849	.	1.008190	0.07953	N	0.981136	T	0.03220	0.0094	M	0.67953	2.075	0.09310	N	1	P	0.49090	0.919	B	0.38378	0.272	T	0.41342	-0.9514	10	0.56958	D	0.05	-2.5518	2.4068	0.04414	0.4379:0.0:0.344:0.2181	.	39	Q5T1N1	AKND1_HUMAN	E	39	ENSP00000359018:D39E;ENSP00000359011:D39E;ENSP00000359012:D39E	ENSP00000359011:D39E	D	-	3	2	AKNAD1	109196693	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	-0.578000	0.05841	1.249000	0.43950	-0.408000	0.06270	GAT	AKNAD1	-	NULL	ENSG00000162641		0.403	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNAD1	HGNC	protein_coding	OTTHUMT00000030923.2	72	0.00	0	A	NM_152763		109395170	109395170	-1	no_errors	ENST00000370001	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.000	T
AMN	81693	genome.wustl.edu	37	14	103395190	103395190	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr14:103395190G>A	ENST00000299155.5	+	5	424	c.391G>A	c.(391-393)Gac>Aac	p.D131N		NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein	131					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTCTTCGTGGACGCCGAGCG	0.697																																						dbGAP											0													32.0	29.0	30.0					14																	103395190		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7		ENST00000299155.5:c.391G>A	14.37:g.103395190G>A	ENSP00000299155:p.Asp131Asn		Q6UX83	Nonsense_Mutation	SNP	NULL	p.W8*	ENST00000299155.5	37	c.24	CCDS9977.1	14	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373878	0.82573	.	.	ENSG00000166126	ENST00000299155;ENST00000541086	D	0.90324	-2.65	4.03	4.03	0.46877	.	0.169863	0.50627	U	0.000113	D	0.93851	0.8033	M	0.71581	2.175	0.44579	D	0.997541	D	0.89917	1.0	D	0.77004	0.989	D	0.93387	0.6748	10	0.46703	T	0.11	-22.6129	11.7401	0.51788	0.0:0.0:1.0:0.0	.	131	Q9BXJ7	AMNLS_HUMAN	N	131;77	ENSP00000299155:D131N	ENSP00000299155:D131N	D	+	1	0	AMN	102464943	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	2.387000	0.44389	1.808000	0.52836	0.306000	0.20318	GAC	AMN	-	NULL	ENSG00000166126		0.697	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMN	HGNC	protein_coding	OTTHUMT00000415704.1	55	0.00	0	G			103395190	103395190	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000559789	ensembl	human	novel	69_37n	nonsense	3	66.67	6	SNP	1.000	A
ANGPTL1	9068	genome.wustl.edu	37	1	178834198	178834198	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:178834198C>A	ENST00000234816.2	-	3	1161	c.714G>T	c.(712-714)gaG>gaT	p.E238D	RALGPS2_ENST00000367635.3_Intron|RALGPS2_ENST00000367634.2_Intron|ANGPTL1_ENST00000367629.1_Missense_Mutation_p.E238D	NM_004673.3	NP_004664.1	O95841	ANGL1_HUMAN	angiopoietin-like 1	238					transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			breast(2)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	14						CCCTCTGAATCTCGTTACCTC	0.507																																						dbGAP											0													109.0	99.0	102.0					1																	178834198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107253	CCDS1327.1	1q25.2	2013-02-06			ENSG00000116194	ENSG00000116194		"""Fibrinogen C domain containing"""	489	protein-coding gene	gene with protein product	"""angioarrestin"""	603874		ANGPT3		10025962, 9286704	Standard	NM_004673		Approved	ANG3, AngY, ARP1	uc001gma.3	O95841	OTTHUMG00000035075	ENST00000234816.2:c.714G>T	1.37:g.178834198C>A	ENSP00000234816:p.Glu238Asp		Q5T5Z5	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E238D	ENST00000234816.2	37	c.714	CCDS1327.1	1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453449	0.63290	.	.	ENSG00000116194	ENST00000234816;ENST00000367629;ENST00000415564	T;T	0.55930	0.49;0.49	5.32	4.41	0.53225	.	0.183865	0.47455	D	0.000231	T	0.59432	0.2193	L	0.47716	1.5	0.58432	D	0.999992	D	0.69078	0.997	D	0.68192	0.956	T	0.55464	-0.8137	10	0.24483	T	0.36	.	8.5791	0.33617	0.0:0.7646:0.0:0.2354	.	238	O95841	ANGL1_HUMAN	D	238;238;202	ENSP00000234816:E238D;ENSP00000356601:E238D	ENSP00000234816:E238D	E	-	3	2	ANGPTL1	177100821	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.056000	0.57448	1.368000	0.46115	0.650000	0.86243	GAG	ANGPTL1	-	NULL	ENSG00000116194		0.507	ANGPTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL1	HGNC	protein_coding	OTTHUMT00000084924.1	73	0.00	0	C	NM_004673		178834198	178834198	-1	no_errors	ENST00000234816	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	1.000	A
ANO4	121601	genome.wustl.edu	37	12	101430911	101430911	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:101430911G>T	ENST00000392977.3	+	10	1090	c.880G>T	c.(880-882)Gcg>Tcg	p.A294S	RP11-350G24.1_ENST00000549036.1_RNA|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.A259S			Q32M45	ANO4_HUMAN	anoctamin 4	294					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CTATGAAGCTGCGTTTCCCCT	0.343										HNSCC(74;0.22)																												dbGAP											0													365.0	316.0	333.0					12																	101430911		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.880G>T	12.37:g.101430911G>T	ENSP00000376703:p.Ala294Ser		Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	pfam_Anoctamin	p.A294S	ENST00000392977.3	37	c.880		12	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174546	0.78452	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.73681	-0.77;-0.77	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.79215	0.4408	M	0.70787	2.145	0.80722	D	1	P;P	0.44044	0.598;0.825	B;B	0.44278	0.259;0.445	T	0.81306	-0.0992	10	0.66056	D	0.02	.	20.024	0.97514	0.0:0.0:1.0:0.0	.	294;259	Q32M45;Q32M45-2	ANO4_HUMAN;.	S	259;294	ENSP00000376705:A259S;ENSP00000376703:A294S	ENSP00000376703:A294S	A	+	1	0	ANO4	99955042	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.672000	0.98629	2.809000	0.96659	0.655000	0.94253	GCG	ANO4	-	NULL	ENSG00000151572		0.343	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	271	0.00	0	G	NM_178826		101430911	101430911	+1	no_errors	ENST00000392977	ensembl	human	known	69_37n	missense	80	72.32	209	SNP	1.000	T
APOB	338	genome.wustl.edu	37	2	21251331	21251332	+	Missense_Mutation	DNP	AT	AT	GG			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A|T	A|T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr2:21251331_21251332AT>GG	ENST00000233242.1	-	13	1823_1824	c.1696_1697AT>CC	c.(1696-1698)ATg>CCg	p.M566P	APOB_ENST00000399256.4_Missense_Mutation_p.M566P	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	566	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGACTCCTCATCAACATAAGA	0.446																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1696_1697delinsGG	2.37:g.21251331_21251332delinsGG	ENSP00000233242:p.Met566Pro		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.M566T|p.M566L	ENST00000233242.1	37	c.1697|c.1696	CCDS1703.1	2																																																																																			APOB	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000084674		0.446	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	91|94	0.00	0	A|T			21251331|21251332	21251331|21251332	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	G
ARFGAP2	84364	genome.wustl.edu	37	11	47198382	47198382	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr11:47198382G>A	ENST00000524782.1	-	1	251	c.23C>T	c.(22-24)aCc>aTc	p.T8I	ARFGAP2_ENST00000419701.2_5'Flank|ARFGAP2_ENST00000319543.6_5'UTR|ARFGAP2_ENST00000426335.2_Missense_Mutation_p.T8I|ARFGAP2_ENST00000395449.3_5'UTR	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	8					protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CTGGATTTCGGTCTTGTTCGG	0.662																																						dbGAP											0													49.0	51.0	50.0					11																	47198382		2201	4298	6499	-	-	-	SO:0001583	missense	0			AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.23C>T	11.37:g.47198382G>A	ENSP00000434442:p.Thr8Ile		B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.T8I	ENST00000524782.1	37	c.23	CCDS7926.1	11	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418668	0.62622	.	.	ENSG00000149182	ENST00000426335;ENST00000524782;ENST00000526342;ENST00000527927;ENST00000525398;ENST00000525314;ENST00000528444;ENST00000530596	T;T;T;T;T;T;T;T	0.44881	3.36;3.46;2.24;2.71;1.88;1.9;1.46;0.91	5.54	2.61	0.31194	.	0.197104	0.43579	D	0.000541	T	0.52273	0.1724	M	0.78456	2.415	0.80722	D	1	P;P;D;B	0.60575	0.568;0.93;0.988;0.087	B;P;P;B	0.56216	0.204;0.505;0.794;0.068	T	0.49579	-0.8925	10	0.56958	D	0.05	-15.5523	5.3448	0.16004	0.0681:0.1264:0.5437:0.2618	.	8;8;8;8	B7Z6H9;B3KV00;G5E9L0;Q8N6H7	.;.;.;ARFG2_HUMAN	I	8	ENSP00000400226:T8I;ENSP00000434442:T8I;ENSP00000437305:T8I;ENSP00000434433:T8I;ENSP00000431939:T8I;ENSP00000434809:T8I;ENSP00000431684:T8I;ENSP00000435488:T8I	ENSP00000400226:T8I	T	-	2	0	ARFGAP2	47154958	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	2.682000	0.46934	0.275000	0.22094	0.561000	0.74099	ACC	ARFGAP2	-	NULL	ENSG00000149182		0.662	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP2	HGNC	protein_coding	OTTHUMT00000391425.1	52	0.00	0	G	NM_032389		47198382	47198382	-1	no_errors	ENST00000524782	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.997	A
ASMTL	8623	genome.wustl.edu	37	X	1558027	1558027	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:1558027C>T	ENST00000381317.3	-	3	268	c.236G>A	c.(235-237)cGg>cAg	p.R79Q	ASMTL_ENST00000416733.2_Missense_Mutation_p.G25R|ASMTL_ENST00000381333.4_Intron|ASMTL_ENST00000534940.1_Missense_Mutation_p.R21Q	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	79	MAF-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GTCGGGGGCCCGCAGGTCTTT	0.572																																						dbGAP											0													113.0	134.0	127.0					X																	1558027		1912	4113	6025	-	-	-	SO:0001583	missense	0			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.236G>A	X.37:g.1558027C>T	ENSP00000370718:p.Arg79Gln		B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	pfam_Maf,pfam_O_MeTrfase_2,tigrfam_Maf	p.R79Q	ENST00000381317.3	37	c.236	CCDS43917.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	11.32|11.32	1.604829|1.604829	0.28623|0.28623	.|.	.|.	ENSG00000169093|ENSG00000169093	ENST00000416733|ENST00000534940;ENST00000381317	T|T;T	0.04406|0.01947	3.63|4.54;4.57	2.13|2.13	2.13|2.13	0.27403|0.27403	.|.	.|0.142348	.|0.46442	.|U	.|0.000294	T|T	0.01765|0.01765	0.0056|0.0056	L|L	0.39085|0.39085	1.19|1.19	0.09310|0.09310	N|N	1|1	B|B	0.14438|0.32731	0.01|0.382	B|B	0.12156|0.16289	0.007|0.015	T|T	0.47699|0.47699	-0.9097|-0.9097	9|10	0.72032|0.72032	D|D	0.01|0.01	.|.	6.3004|6.3004	0.21109|0.21109	0.0:0.836:0.0:0.164|0.0:0.836:0.0:0.164	.|.	25|79	E7ER97|O95671	.|ASML_HUMAN	R|Q	25|21;79	ENSP00000410578:G25R|ENSP00000446410:R21Q;ENSP00000370718:R79Q	ENSP00000410578:G25R|ENSP00000370718:R79Q	G|R	-|-	1|2	0|0	ASMTL|ASMTL	1518027|1518027	0.996000|0.996000	0.38824|0.38824	0.007000|0.007000	0.13788|0.13788	0.005000|0.005000	0.04900|0.04900	2.046000|2.046000	0.41260|0.41260	0.887000|0.887000	0.36136|0.36136	0.453000|0.453000	0.30009|0.30009	GGG|CGG	ASMTL	-	pfam_Maf,tigrfam_Maf	ENSG00000169093		0.572	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ASMTL	HGNC	protein_coding	OTTHUMT00000055595.1	197	0.00	0	C	NM_004192		1558027	1558027	-1	no_errors	ENST00000381317	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	0.974	T
BIRC6	57448	genome.wustl.edu	37	2	32656007	32656007	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr2:32656007A>G	ENST00000421745.2	+	12	3231	c.3097A>G	c.(3097-3099)Act>Gct	p.T1033A		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1033					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CCGCTTTGAGACTTTGACTCC	0.453																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													104.0	92.0	96.0					2																	32656007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.3097A>G	2.37:g.32656007A>G	ENSP00000393596:p.Thr1033Ala		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.T1033A	ENST00000421745.2	37	c.3097	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211837	0.79240	.	.	ENSG00000115760	ENST00000421745	T	0.74526	-0.85	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.81927	0.4926	L	0.50333	1.59	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	T	0.80211	-0.1476	10	0.33141	T	0.24	.	15.8109	0.78565	1.0:0.0:0.0:0.0	.	1033	Q9NR09	BIRC6_HUMAN	A	1033	ENSP00000393596:T1033A	ENSP00000393596:T1033A	T	+	1	0	BIRC6	32509511	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.132000	0.65825	0.533000	0.62120	ACT	BIRC6	-	NULL	ENSG00000115760		0.453	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	123	0.00	0	A	NM_016252		32656007	32656007	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	missense	35	32.69	17	SNP	1.000	G
C14orf119	55017	genome.wustl.edu	37	14	23566911	23566911	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr14:23566911C>A	ENST00000319074.4	+	2	900	c.44C>A	c.(43-45)tCt>tAt	p.S15Y	ACIN1_ENST00000262710.1_5'Flank|ACIN1_ENST00000555053.1_5'Flank|C14orf119_ENST00000554203.1_Missense_Mutation_p.S15Y|ACIN1_ENST00000457657.1_5'Flank|ACIN1_ENST00000605057.1_5'Flank	NM_017924.3	NP_060394.1	Q9NWQ9	CN119_HUMAN	chromosome 14 open reading frame 119	15						mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(1)|lung(1)	3	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00649)		TCCTTCCCATCTCTCTTACCC	0.448																																						dbGAP											0													293.0	256.0	269.0					14																	23566911		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9588.1	14q11.2	2012-09-25			ENSG00000179933	ENSG00000179933			20270	protein-coding gene	gene with protein product							Standard	NM_017924		Approved	FLJ20671	uc001wiu.3	Q9NWQ9	OTTHUMG00000028717	ENST00000319074.4:c.44C>A	14.37:g.23566911C>A	ENSP00000322238:p.Ser15Tyr		Q6IAA7	Missense_Mutation	SNP	NULL	p.S15Y	ENST00000319074.4	37	c.44	CCDS9588.1	14	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724089	0.48728	.	.	ENSG00000179933	ENST00000319074;ENST00000554203	T;T	0.52057	0.68;0.68	5.48	5.48	0.80851	.	0.505853	0.22398	N	0.060582	T	0.49795	0.1578	L	0.51422	1.61	0.09310	N	1	P	0.35656	0.514	P	0.44518	0.452	T	0.52434	-0.8576	10	0.72032	D	0.01	-11.7041	10.3121	0.43714	0.0:0.9106:0.0:0.0894	.	15	Q9NWQ9	CN119_HUMAN	Y	15	ENSP00000322238:S15Y;ENSP00000450861:S15Y	ENSP00000322238:S15Y	S	+	2	0	C14orf119	22636751	0.789000	0.28775	0.093000	0.20910	0.102000	0.19082	3.225000	0.51246	2.566000	0.86566	0.561000	0.74099	TCT	C14orf119	-	NULL	ENSG00000179933		0.448	C14orf119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf119	HGNC	protein_coding	OTTHUMT00000071713.3	134	0.00	0	C	NM_017924		23566911	23566911	+1	no_errors	ENST00000319074	ensembl	human	known	69_37n	missense	13	60.61	20	SNP	0.100	A
C5orf45	51149	genome.wustl.edu	37	5	179280249	179280249	+	Intron	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr5:179280249G>C	ENST00000292586.6	-	2	217				C5orf45_ENST00000521333.1_Intron|C5orf45_ENST00000376931.2_Intron|C5orf45_ENST00000520698.1_Intron|C5orf45_ENST00000523084.1_Intron|C5orf45_ENST00000403396.2_Missense_Mutation_p.S67C|C5orf45_ENST00000518219.1_Intron|C5orf45_ENST00000518235.1_Intron	NM_016175.3	NP_057259.2	Q6NTE8	CE045_HUMAN	chromosome 5 open reading frame 45											breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12						AGGAAGCTCGGAAGCAGGAGC	0.527																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS34318.1, CCDS34319.1	5q35.3	2008-07-10			ENSG00000161010	ENSG00000161010			30817	protein-coding gene	gene with protein product	"""truncated calcium binding protein"""						Standard	NM_016175		Approved	MGC65027, MGC78537, DKFZp686L2452, LOC51149	uc003mla.3	Q6NTE8	OTTHUMG00000163490	ENST00000292586.6:c.126+128C>G	5.37:g.179280249G>C			B5MD09|E9PAK6|Q7Z3D8|Q9BUC1|Q9UN54	Missense_Mutation	SNP	NULL	p.S67C	ENST00000292586.6	37	c.200	CCDS34319.1	5	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054551	0.36277	.	.	ENSG00000161010	ENST00000403396	T	0.29142	1.58	3.26	1.44	0.22558	.	.	.	.	.	T	0.21145	0.0509	.	.	.	0.09310	N	1	P	0.45827	0.867	B	0.38020	0.263	T	0.13255	-1.0516	8	0.87932	D	0	.	5.7111	0.17935	0.2556:0.0:0.7444:0.0	.	67	Q6NTE8-2	.	C	67	ENSP00000384599:S67C	ENSP00000384599:S67C	S	-	2	0	C5orf45	179212855	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.412000	0.07132	0.383000	0.24910	0.655000	0.94253	TCC	C5orf45	-	NULL	ENSG00000161010		0.527	C5orf45-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C5orf45	HGNC	protein_coding	OTTHUMT00000373760.2	40	0.00	0	G	NM_016175		179280249	179280249	-1	no_errors	ENST00000403396	ensembl	human	known	69_37n	missense	9	55.00	11	SNP	0.001	C
ERMARD	55780	genome.wustl.edu	37	6	170176590	170176590	+	Silent	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:170176590T>A	ENST00000366773.3	+	16	1593	c.1560T>A	c.(1558-1560)gtT>gtA	p.V520V	ERMARD_ENST00000366772.2_Intron|ERMARD_ENST00000588451.1_Silent_p.V384V|ERMARD_ENST00000392095.4_Silent_p.V394V|ERMARD_ENST00000418781.3_Intron	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	520					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GCACACCTGTTCCCACCCTGT	0.602																																						dbGAP											0													83.0	64.0	70.0					6																	170176590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.1560T>A	6.37:g.170176590T>A			B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Silent	SNP	NULL	p.V520	ENST00000366773.3	37	c.1560	CCDS34576.1	6																																																																																			C6orf70	-	NULL	ENSG00000130023		0.602	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf70	HGNC	protein_coding	OTTHUMT00000043238.2	79	0.00	0	T	NM_018341		170176590	170176590	+1	no_errors	ENST00000366773	ensembl	human	known	69_37n	silent	44	13.46	7	SNP	0.000	A
CACNA1C	775	genome.wustl.edu	37	12	2711019	2711019	+	Splice_Site	SNP	G	G	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:2711019G>T	ENST00000347598.4	+	23	2913		c.e23-1		CACNA1C_ENST00000399655.1_Splice_Site|CACNA1C_ENST00000344100.3_Splice_Site|CACNA1C_ENST00000399597.1_Splice_Site|CACNA1C_ENST00000399629.1_Splice_Site|CACNA1C_ENST00000399606.1_Splice_Site|CACNA1C_ENST00000399595.1_Splice_Site|CACNA1C_ENST00000399617.1_Splice_Site|CACNA1C_ENST00000399641.1_Splice_Site|CACNA1C_ENST00000399649.1_Splice_Site|CACNA1C_ENST00000402845.3_Splice_Site|CACNA1C_ENST00000480911.1_Splice_Site|CACNA1C_ENST00000399634.1_Splice_Site|CACNA1C_ENST00000399621.1_Splice_Site|CACNA1C-AS3_ENST00000543559.1_RNA|CACNA1C_ENST00000399644.1_Splice_Site|CACNA1C_ENST00000399637.1_Splice_Site|CACNA1C_ENST00000406454.3_Splice_Site|CACNA1C_ENST00000399603.1_Splice_Site|CACNA1C_ENST00000327702.7_Splice_Site|CACNA1C_ENST00000399638.1_Splice_Site|CACNA1C_ENST00000335762.5_Splice_Site|CACNA1C_ENST00000399591.1_Splice_Site|CACNA1C_ENST00000399601.1_Splice_Site	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTCCCTGCAGATGACTGCTT	0.572																																						dbGAP											0													122.0	128.0	126.0					12																	2711019		2196	4300	6496	-	-	-	SO:0001630	splice_region_variant	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.2914-1G>T	12.37:g.2711019G>T			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Splice_Site	SNP	-	e22-1	ENST00000347598.4	37	c.2854-1	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	16.63	3.175667	0.57692	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8378	0.88706	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1C	2581280	1.000000	0.71417	1.000000	0.80357	0.463000	0.32649	9.587000	0.98229	2.521000	0.84997	0.655000	0.94253	.	CACNA1C	-	-	ENSG00000151067		0.572	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	147	0.00	0	G	NM_000719	Intron	2711019	2711019	+1	no_errors	ENST00000399634	ensembl	human	known	69_37n	splice_site	57	35.96	32	SNP	1.000	T
CDK19	23097	genome.wustl.edu	37	6	110942346	110942346	+	Silent	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:110942346G>C	ENST00000368911.3	-	12	1517	c.1338C>G	c.(1336-1338)ggC>ggG	p.G446G	CDK19_ENST00000413605.2_Silent_p.G322G|CDK19_ENST00000323817.3_Silent_p.G386G	NM_015076.3	NP_055891.1	Q9BWU1	CDK19_HUMAN	cyclin-dependent kinase 19	446							ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)	22						CTGAGTTTGCGCCTGAAGGCC	0.557																																						dbGAP											0													76.0	79.0	78.0					6																	110942346		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL122055	CCDS5085.1, CCDS75503.1	6q21	2011-10-25	2009-12-16	2009-12-16	ENSG00000155111	ENSG00000155111		"""Cyclin-dependent kinases"""	19338	protein-coding gene	gene with protein product		614720	"""cyclin-dependent kinase (CDC2-like) 11"", ""cell division cycle 2-like 6 (CDK8-like)"""	CDK11, CDC2L6		10470851, 19884882	Standard	XM_005266871		Approved	KIAA1028, bA346C16.3	uc003puh.1	Q9BWU1	OTTHUMG00000015365	ENST00000368911.3:c.1338C>G	6.37:g.110942346G>C			Q5JQZ7|Q5JR00|Q8TC78|Q9UPX2	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G446	ENST00000368911.3	37	c.1338	CCDS5085.1	6																																																																																			CDK19	-	NULL	ENSG00000155111		0.557	CDK19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK19	HGNC	protein_coding	OTTHUMT00000041804.1	65	0.00	0	G	NM_015076		110942346	110942346	-1	no_errors	ENST00000368911	ensembl	human	known	69_37n	silent	32	23.81	10	SNP	0.111	C
CDKL5	6792	genome.wustl.edu	37	X	18664154	18664154	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:18664154G>C	ENST00000379989.3	+	20	3026	c.2741G>C	c.(2740-2742)aGa>aCa	p.R914T	CDKL5_ENST00000379996.3_Missense_Mutation_p.R914T|RS1_ENST00000379984.3_Intron|RS1_ENST00000476595.1_Intron	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	914					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					agaagacagagacaccattct	0.488																																						dbGAP											0													169.0	130.0	143.0					X																	18664154		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2741G>C	X.37:g.18664154G>C	ENSP00000369325:p.Arg914Thr		G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R914T	ENST00000379989.3	37	c.2741	CCDS14186.1	X	.	.	.	.	.	.	.	.	.	.	G	7.205	0.594199	0.13875	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.71341	-0.56;-0.56	1.89	1.01	0.19927	.	0.999764	0.08089	U	0.999593	T	0.47581	0.1453	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.40040	-0.9584	10	0.87932	D	0	5.6608	3.8894	0.09113	0.2338:0.0:0.7662:0.0	.	914	O76039	CDKL5_HUMAN	T	914	ENSP00000369332:R914T;ENSP00000369325:R914T	ENSP00000369325:R914T	R	+	2	0	CDKL5	18574075	0.003000	0.15002	0.006000	0.13384	0.002000	0.02628	1.237000	0.32695	0.272000	0.22027	0.418000	0.28097	AGA	CDKL5	-	NULL	ENSG00000008086		0.488	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKL5	HGNC	protein_coding	OTTHUMT00000055945.2	102	0.00	0	G	NM_003159		18664154	18664154	+1	no_errors	ENST00000379989	ensembl	human	known	69_37n	missense	22	55.10	27	SNP	0.005	C
CHD7	55636	genome.wustl.edu	37	8	61773585	61773585	+	Silent	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr8:61773585G>C	ENST00000423902.2	+	35	8210	c.7731G>C	c.(7729-7731)ggG>ggC	p.G2577G	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2577					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TTGAAGATGGGACTAGGCTGG	0.458																																						dbGAP											0													78.0	78.0	78.0					8																	61773585		1943	4144	6087	-	-	-	SO:0001819	synonymous_variant	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.7731G>C	8.37:g.61773585G>C			D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G2577	ENST00000423902.2	37	c.7731	CCDS47865.1	8																																																																																			CHD7	-	pfam_BRK_domain,smart_BRK_domain	ENSG00000171316		0.458	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	95	0.00	0	G	XM_098762		61773585	61773585	+1	no_errors	ENST00000307121	ensembl	human	known	69_37n	silent	20	44.44	16	SNP	1.000	C
CHI3L1	1116	genome.wustl.edu	37	1	203154430	203154430	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:203154430C>T	ENST00000255409.3	-	3	264	c.139G>A	c.(139-141)Gac>Aac	p.D47N		NM_001276.2	NP_001267.2	P36222	CH3L1_HUMAN	chitinase 3-like 1 (cartilage glycoprotein-39)	47					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to tumor necrosis factor (GO:0071356)|chitin catabolic process (GO:0006032)|inflammatory response (GO:0006954)|interleukin-8 secretion (GO:0072606)|lung development (GO:0030324)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase B signaling (GO:0051897)|response to interleukin-1 (GO:0070555)|response to interleukin-6 (GO:0070741)|response to mechanical stimulus (GO:0009612)|response to tumor necrosis factor (GO:0034612)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|extracellular matrix structural constituent (GO:0005201)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|skin(1)	18						AGGAAGCGGTCAAGGGCATCT	0.537																																						dbGAP											0													140.0	126.0	130.0					1																	203154430		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008568	CCDS1435.1	1q32.1	2008-02-05			ENSG00000133048	ENSG00000133048			1932	protein-coding gene	gene with protein product		601525				8245017, 9244440	Standard	NM_001276		Approved	GP39, YKL40	uc001gzi.2	P36222	OTTHUMG00000042122	ENST00000255409.3:c.139G>A	1.37:g.203154430C>T	ENSP00000255409:p.Asp47Asn		B2R7B0|P30923|Q8IVA4|Q96HI7	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.D47N	ENST00000255409.3	37	c.139	CCDS1435.1	1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587826	0.46110	.	.	ENSG00000133048	ENST00000255409	T	0.06528	3.29	5.35	3.38	0.38709	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.463760	0.19671	N	0.108744	T	0.14570	0.0352	M	0.68593	2.085	0.27376	N	0.955553	P	0.48230	0.907	P	0.53649	0.731	T	0.02917	-1.1094	10	0.62326	D	0.03	-18.3841	8.3448	0.32266	0.0:0.7521:0.1547:0.0932	.	47	P36222	CH3L1_HUMAN	N	47	ENSP00000255409:D47N	ENSP00000255409:D47N	D	-	1	0	CHI3L1	201421053	1.000000	0.71417	0.827000	0.32855	0.166000	0.22503	3.432000	0.52824	0.645000	0.30675	0.655000	0.94253	GAC	CHI3L1	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000133048		0.537	CHI3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHI3L1	HGNC	protein_coding	OTTHUMT00000100265.1	93	0.00	0	C	NM_001276		203154430	203154430	-1	no_errors	ENST00000255409	ensembl	human	known	69_37n	missense	67	16.25	13	SNP	1.000	T
CHN2	1124	genome.wustl.edu	37	7	29433303	29433303	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr7:29433303C>G	ENST00000222792.6	+	4	683	c.153C>G	c.(151-153)aaC>aaG	p.N51K	CHN2_ENST00000495789.2_Missense_Mutation_p.N64K|CHN2_ENST00000435288.2_Missense_Mutation_p.N51K|CHN2_ENST00000539406.1_Missense_Mutation_p.N126K|CHN2_ENST00000546235.1_Missense_Mutation_p.N36K|CHN2_ENST00000539389.1_Intron	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	51					positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						aGGTGGAAAACAGACCAAAAT	0.234																																					Ovarian(1;44 48 13232 18918 31480)	dbGAP											0													15.0	15.0	15.0					7																	29433303		2088	4205	6293	-	-	-	SO:0001583	missense	0			L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.153C>G	7.37:g.29433303C>G	ENSP00000222792:p.Asn51Lys		A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.N126K	ENST00000222792.6	37	c.378	CCDS5420.1	7	.	.	.	.	.	.	.	.	.	.	C	10.16	1.273876	0.23221	.	.	ENSG00000106069	ENST00000439384;ENST00000539406;ENST00000222792;ENST00000435288;ENST00000409350;ENST00000495789;ENST00000546235	T;T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01;0.01	5.57	5.57	0.84162	SH2 motif (1);	0.333881	0.36665	N	0.002468	T	0.64571	0.2610	M	0.62723	1.935	0.80722	D	1	B;B;P;B;B	0.52316	0.011;0.421;0.952;0.421;0.421	B;B;P;B;B	0.49085	0.015;0.054;0.6;0.039;0.054	T	0.61252	-0.7100	10	0.06494	T	0.89	.	17.6871	0.88259	0.0:1.0:0.0:0.0	.	36;64;126;51;51	B7Z1W9;B7Z1V0;F5H003;A4D1A2;P52757	.;.;.;.;CHIO_HUMAN	K	126;126;51;51;64;64;36	ENSP00000409843:N126K;ENSP00000444063:N126K;ENSP00000222792:N51K;ENSP00000400282:N51K;ENSP00000386968:N64K;ENSP00000438587:N64K;ENSP00000442812:N36K	ENSP00000222792:N51K	N	+	3	2	CHN2	29399828	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.878000	0.48515	2.775000	0.95449	0.655000	0.94253	AAC	CHN2	-	NULL	ENSG00000106069		0.234	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHN2	HGNC	protein_coding	OTTHUMT00000214228.2	94	0.00	0	C	NM_004067		29433303	29433303	+1	no_errors	ENST00000539406	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	G
CNOT2	4848	genome.wustl.edu	37	12	70726585	70726585	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:70726585G>A	ENST00000418359.3	+	8	1059	c.608G>A	c.(607-609)gGa>gAa	p.G203E	CNOT2_ENST00000548230.1_3'UTR|CNOT2_ENST00000551483.1_5'Flank|CNOT2_ENST00000229195.3_Missense_Mutation_p.G203E	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	203					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			CAGGCATTTGGAATGAATAAC	0.308																																						dbGAP											0													131.0	137.0	135.0					12																	70726585		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.608G>A	12.37:g.70726585G>A	ENSP00000412091:p.Gly203Glu		Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	pfam_NOT	p.G203E	ENST00000418359.3	37	c.608	CCDS31857.1	12	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575780	0.65878	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000552915;ENST00000550641;ENST00000548159;ENST00000551043;ENST00000551873;ENST00000550194;ENST00000550155	T;T;T;T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.68	5.68	0.88126	.	0.151070	0.64402	D	0.000012	T	0.59266	0.2181	L	0.36672	1.1	0.58432	D	0.999997	P	0.35433	0.501	B	0.27608	0.081	T	0.57376	-0.7822	10	0.20519	T	0.43	-4.4175	17.9739	0.89121	0.0:0.0:1.0:0.0	.	203	Q9NZN8	CNOT2_HUMAN	E	203;203;203;142;183;194;203;118;195;13	ENSP00000450318:G203E;ENSP00000229195:G203E;ENSP00000412091:G203E;ENSP00000447497:G142E;ENSP00000448024:G183E;ENSP00000449659:G194E;ENSP00000449260:G203E;ENSP00000450090:G118E;ENSP00000449446:G195E;ENSP00000448499:G13E	ENSP00000229195:G203E	G	+	2	0	CNOT2	69012852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.189000	0.89712	2.678000	0.91216	0.585000	0.79938	GGA	CNOT2	-	NULL	ENSG00000111596		0.308	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT2	HGNC	protein_coding	OTTHUMT00000404260.1	117	0.00	0	G			70726585	70726585	+1	no_errors	ENST00000229195	ensembl	human	known	69_37n	missense	45	42.31	33	SNP	1.000	A
CR2	1380	genome.wustl.edu	37	1	207648368	207648368	+	Silent	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:207648368T>A	ENST00000367058.3	+	13	2535	c.2346T>A	c.(2344-2346)tcT>tcA	p.S782S	CR2_ENST00000458541.2_Silent_p.S755S|CR2_ENST00000367057.3_Silent_p.S841S|CR2_ENST00000367059.3_Silent_p.S782S	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	782					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						GCTTACGATCTCCTCCTGTGA	0.453																																						dbGAP											0													147.0	141.0	143.0					1																	207648368		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2346T>A	1.37:g.207648368T>A			C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S841	ENST00000367058.3	37	c.2523	CCDS1478.1	1																																																																																			CR2	-	NULL	ENSG00000117322		0.453	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	HGNC	protein_coding	OTTHUMT00000088274.1	105	0.00	0	T	NM_001877		207648368	207648368	+1	no_errors	ENST00000367057	ensembl	human	known	69_37n	silent	83	18.27	19	SNP	0.000	A
CSGALNACT2	55454	genome.wustl.edu	37	10	43650986	43650986	+	Missense_Mutation	SNP	A	A	G	rs200474280		TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr10:43650986A>G	ENST00000374466.3	+	2	724	c.389A>G	c.(388-390)aAa>aGa	p.K130R	CSGALNACT2_ENST00000374464.1_Missense_Mutation_p.K130R	NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	130					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)			endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CAAATTGACAAAGCTGAAGTT	0.408																																						dbGAP											0													94.0	83.0	87.0					10																	43650986		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.389A>G	10.37:g.43650986A>G	ENSP00000363590:p.Lys130Arg		B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	pfam_Chond_GalNAc	p.K130R	ENST00000374466.3	37	c.389	CCDS7201.1	10	.	.	.	.	.	.	.	.	.	.	A	12.55	1.970571	0.34754	.	.	ENSG00000169826	ENST00000374466;ENST00000374464	T;T	0.25912	1.81;1.77	5.71	4.58	0.56647	.	0.039178	0.85682	N	0.000000	T	0.23094	0.0558	L	0.49778	1.585	0.52099	D	0.999943	B;B	0.12013	0.002;0.005	B;B	0.14023	0.01;0.01	T	0.03829	-1.1000	10	0.23891	T	0.37	-19.1161	11.1343	0.48365	0.9269:0.0:0.0731:0.0	.	130;130	Q8N6G5;Q8N6G5-2	CGAT2_HUMAN;.	R	130	ENSP00000363590:K130R;ENSP00000363588:K130R	ENSP00000363588:K130R	K	+	2	0	CSGALNACT2	42970992	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.074000	0.76791	1.115000	0.41800	0.528000	0.53228	AAA	CSGALNACT2	-	pfam_Chond_GalNAc	ENSG00000169826		0.408	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSGALNACT2	HGNC	protein_coding	OTTHUMT00000047693.1	63	0.00	0	A	NM_018590		43650986	43650986	+1	no_errors	ENST00000374466	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	G
CXorf21	80231	genome.wustl.edu	37	X	30578016	30578016	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:30578016C>T	ENST00000378962.3	-	3	779	c.457G>A	c.(457-459)Ggc>Agc	p.G153S		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	153										kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						AGCAAAGGGCCATATTCAAAA	0.438																																						dbGAP											0													54.0	53.0	53.0					X																	30578016		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.457G>A	X.37:g.30578016C>T	ENSP00000368245:p.Gly153Ser			Missense_Mutation	SNP	NULL	p.G153S	ENST00000378962.3	37	c.457	CCDS14224.1	X	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244993	0.79912	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000003	T	0.79488	0.4454	M	0.73962	2.25	0.47778	D	0.999513	D	0.89917	1.0	D	0.79784	0.993	T	0.81424	-0.0939	9	0.62326	D	0.03	-25.7028	17.958	0.89075	0.0:1.0:0.0:0.0	.	153	Q9HAI6	CX021_HUMAN	S	153	.	ENSP00000368245:G153S	G	-	1	0	CXorf21	30487937	1.000000	0.71417	0.995000	0.50966	0.907000	0.53573	4.372000	0.59530	2.431000	0.82371	0.513000	0.50165	GGC	CXorf21	-	NULL	ENSG00000120280		0.438	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf21	HGNC	protein_coding	OTTHUMT00000056164.1	67	0.00	0	C	NM_025159		30578016	30578016	-1	no_errors	ENST00000378962	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	1.000	T
DCP1A	55802	genome.wustl.edu	37	3	53326366	53326366	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr3:53326366C>A	ENST00000607628.1	-	7	1225	c.1116G>T	c.(1114-1116)caG>caT	p.Q372H	DCP1A_ENST00000606822.1_Missense_Mutation_p.Q334H|Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000294241.6_Missense_Mutation_p.Q372H|DCP1A_ENST00000480258.1_5'UTR	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	372					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		TGAAGGGGCTCTGGTTGGCAA	0.572																																						dbGAP											0													108.0	108.0	108.0					3																	53326366		2034	4210	6244	-	-	-	SO:0001583	missense	0			AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.1116G>T	3.37:g.53326366C>A	ENSP00000475920:p.Gln372His		B4DHN9|U3KQM8	RNA	SNP	-	NULL	ENST00000607628.1	37	NULL		3																																																																																			DCP1A	-	-	ENSG00000162290		0.572	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	DCP1A	HGNC	protein_coding		128	0.00	0	C	NM_018403		53326366	53326366	-1	no_errors	ENST00000294241	ensembl	human	known	69_37n	rna	33	54.79	40	SNP	0.938	A
DDX59	83479	genome.wustl.edu	37	1	200613627	200613627	+	Silent	SNP	A	A	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:200613627A>G	ENST00000331314.6	-	8	1828	c.1615T>C	c.(1615-1617)Tta>Cta	p.L539L	DDX59_ENST00000447706.2_Intron|DDX59_ENST00000367348.3_Intron	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	539	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						TTTTGACCTAATCTTCCTACT	0.318																																						dbGAP											0													77.0	81.0	80.0					1																	200613627		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.1615T>C	1.37:g.200613627A>G			Q6PJL2|Q8IVW3|Q9H0W3	Missense_Mutation	SNP	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	p.I116T	ENST00000331314.6	37	c.347	CCDS30964.1	1	.	.	.	.	.	.	.	.	.	.	A	8.487	0.861101	0.17178	.	.	ENSG00000118197	ENST00000429498	.	.	.	5.5	1.45	0.22620	.	.	.	.	.	T	0.59142	0.2172	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52041	-0.8628	4	.	.	.	-11.2969	10.7969	0.46466	0.4929:0.0:0.5071:0.0	.	.	.	.	T	116	.	.	I	-	2	0	DDX59	198880250	0.992000	0.36948	0.484000	0.27391	0.997000	0.91878	1.735000	0.38176	-0.005000	0.14395	0.523000	0.50628	ATT	DDX59	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000118197		0.318	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX59	HGNC	protein_coding	OTTHUMT00000086883.2	124	0.00	0	A	NM_001031725.4		200613627	200613627	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429498	ensembl	human	putative	69_37n	missense	89	21.93	25	SNP	0.751	G
DGUOK	1716	genome.wustl.edu	37	2	74177737	74177737	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr2:74177737G>C	ENST00000264093.4	+	4	554	c.469G>C	c.(469-471)Gaa>Caa	p.E157Q	DGUOK_ENST00000348222.1_Intron|DGUOK-AS1_ENST00000453103.1_RNA|DGUOK_ENST00000462685.1_Intron|DGUOK_ENST00000356837.6_Missense_Mutation_p.E135Q	NM_080916.2	NP_550438.1	Q16854	DGUOK_HUMAN	deoxyguanosine kinase	157					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|dGTP metabolic process (GO:0046070)|guanosine metabolic process (GO:0008617)|negative regulation of neuron projection development (GO:0010977)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|protein phosphorylation (GO:0006468)|purine deoxyribonucleoside metabolic process (GO:0046122)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxyguanosine kinase activity (GO:0004138)|nucleoside kinase activity (GO:0019206)			endometrium(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	8					Nelarabine(DB01280)	GAATCTTTTTGAAAATGGTTC	0.468																																						dbGAP											0													190.0	198.0	195.0					2																	74177737		2203	4300	6503	-	-	-	SO:0001583	missense	0			U41668	CCDS1931.1, CCDS1932.1	2p13	2008-02-05			ENSG00000114956	ENSG00000114956	2.7.1.113		2858	protein-coding gene	gene with protein product		601465					Standard	NM_080916		Approved	dGK	uc002sjx.3	Q16854	OTTHUMG00000129819	ENST00000264093.4:c.469G>C	2.37:g.74177737G>C	ENSP00000264093:p.Glu157Gln		P78532|Q16759|Q4ZG09|Q7L1W9|Q96BC1	Missense_Mutation	SNP	pfam_Deoxynucleoside_kinase	p.E157Q	ENST00000264093.4	37	c.469	CCDS1931.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.082512	0.94050	.	.	ENSG00000114956	ENST00000264093;ENST00000356837;ENST00000347161	D;D	0.98120	-4.73;-4.73	5.67	5.67	0.87782	.	0.052008	0.85682	D	0.000000	D	0.98639	0.9544	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.99353	1.0915	10	0.56958	D	0.05	-18.1298	18.5499	0.91060	0.0:0.0:1.0:0.0	.	157	Q16854	DGUOK_HUMAN	Q	157;135;119	ENSP00000264093:E157Q;ENSP00000349294:E135Q	ENSP00000264093:E157Q	E	+	1	0	DGUOK	74031245	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.558000	0.82253	2.667000	0.90743	0.563000	0.77884	GAA	DGUOK	-	pfam_Deoxynucleoside_kinase	ENSG00000114956		0.468	DGUOK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGUOK	HGNC	protein_coding	OTTHUMT00000252050.1	115	0.00	0	G			74177737	74177737	+1	no_errors	ENST00000264093	ensembl	human	known	69_37n	missense	45	27.42	17	SNP	1.000	C
DHCR7	1717	genome.wustl.edu	37	11	71155930	71155930	+	Silent	SNP	G	G	C	rs199798127		TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr11:71155930G>C	ENST00000355527.3	-	3	345	c.69C>G	c.(67-69)acC>acG	p.T23T	DHCR7_ENST00000407721.2_Silent_p.T23T	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	23					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)			endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						CTTGAGATGCGGTTCTGTCAT	0.512									Smith-Lemli-Opitz syndrome																													dbGAP											0													294.0	231.0	252.0					11																	71155930		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	SLOS type I & II	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.69C>G	11.37:g.71155930G>C			B2R6Z2|O60492|O60717	Silent	SNP	pfam_Ergosterol_biosynth_ERG4_ERG24	p.T23	ENST00000355527.3	37	c.69	CCDS8200.1	11																																																																																			DHCR7	-	NULL	ENSG00000172893		0.512	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHCR7	HGNC	protein_coding	OTTHUMT00000394243.1	142	0.00	0	G	NM_001360		71155930	71155930	-1	no_errors	ENST00000355527	ensembl	human	known	69_37n	silent	20	55.56	25	SNP	0.000	C
DIAPH2	1730	genome.wustl.edu	37	X	96603145	96603145	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:96603145G>C	ENST00000324765.8	+	24	3222	c.2875G>C	c.(2875-2877)Gaa>Caa	p.E959Q	DIAPH2_ENST00000373049.4_Missense_Mutation_p.E959Q|DIAPH2_ENST00000373061.3_Missense_Mutation_p.E959Q|DIAPH2_ENST00000355827.4_Missense_Mutation_p.E959Q|DIAPH2_ENST00000373054.4_Missense_Mutation_p.E955Q			O60879	DIAP2_HUMAN	diaphanous-related formin 2	959	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						AGAACAGTATGAAAAACTCTC	0.373																																						dbGAP											0													97.0	80.0	86.0					X																	96603145		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2875G>C	X.37:g.96603145G>C	ENSP00000321348:p.Glu959Gln		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.E959Q	ENST00000324765.8	37	c.2875	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	G	11.50	1.658382	0.29425	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23	5.59	5.59	0.84812	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.284130	0.31246	N	0.007993	T	0.21227	0.0511	L	0.31526	0.94	0.40110	D	0.976472	B;B	0.31459	0.324;0.277	B;B	0.40659	0.336;0.227	T	0.05699	-1.0869	10	0.41790	T	0.15	.	18.5812	0.91171	0.0:0.0:1.0:0.0	.	959;959	O60879;O60879-2	DIAP2_HUMAN;.	Q	959;955;959;959;959;966	ENSP00000362152:E959Q;ENSP00000362145:E955Q;ENSP00000348082:E959Q;ENSP00000362140:E959Q;ENSP00000321348:E959Q	ENSP00000321348:E959Q	E	+	1	0	DIAPH2	96489801	1.000000	0.71417	0.999000	0.59377	0.294000	0.27393	7.799000	0.85936	2.331000	0.79229	0.600000	0.82982	GAA	DIAPH2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000147202		0.373	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	114	0.00	0	G	NM_006729, NM_007309		96603145	96603145	+1	no_errors	ENST00000324765	ensembl	human	known	69_37n	missense	3	78.57	11	SNP	1.000	C
DKC1	1736	genome.wustl.edu	37	X	153993196	153993196	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:153993196T>G	ENST00000369550.5	+	2	249	c.39T>G	c.(37-39)caT>caG	p.H13Q		NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin	13	Nucleolar localization.|Poly-Lys.				cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CAAAGAAACATAAGAAGAAAA	0.313									Congenital Dyskeratosis																													dbGAP											0													147.0	151.0	149.0					X																	153993196		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.39T>G	X.37:g.153993196T>G	ENSP00000358563:p.His13Gln		F5BSB3|O43845|Q96G67|Q9Y505	Missense_Mutation	SNP	pfam_Dyskerin-like,pfam_PsdUridine_synth,pfam_PUA,superfamily_PsdUridine_synth_cat_dom,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,tigrfam_Pseudouridine_synthase-related,tigrfam_Uncharacterised_CHP00451	p.H13Q	ENST00000369550.5	37	c.39	CCDS14761.1	X	.	.	.	.	.	.	.	.	.	.	T	12.68	2.011328	0.35511	.	.	ENSG00000130826	ENST00000369550;ENST00000413910	D;D	0.97232	-4.23;-4.3	5.55	3.21	0.36854	.	0.270947	0.37178	N	0.002216	D	0.91192	0.7225	N	0.19112	0.55	0.26798	N	0.969265	B;B	0.23058	0.079;0.079	B;B	0.23716	0.048;0.048	T	0.82862	-0.0247	10	0.34782	T	0.22	-10.5192	4.3831	0.11304	0.0:0.3406:0.0:0.6593	.	13;13	A8MUT5;O60832	.;DKC1_HUMAN	Q	13	ENSP00000358563:H13Q;ENSP00000400542:H13Q	ENSP00000358563:H13Q	H	+	3	2	DKC1	153646390	0.993000	0.37304	1.000000	0.80357	0.635000	0.38103	-0.080000	0.11339	0.748000	0.32831	0.486000	0.48141	CAT	DKC1	-	NULL	ENSG00000130826		0.313	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKC1	HGNC	protein_coding	OTTHUMT00000061180.5	196	0.00	0	T	NM_001363		153993196	153993196	+1	no_errors	ENST00000369550	ensembl	human	known	69_37n	missense	41	46.75	36	SNP	1.000	G
DYNLRB2	83657	genome.wustl.edu	37	16	80577175	80577175	+	Silent	SNP	A	A	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr16:80577175A>C	ENST00000305904.6	+	2	126	c.6A>C	c.(4-6)gcA>gcC	p.A2A	RP11-525K10.3_ENST00000564411.1_RNA|DYNLRB2_ENST00000568035.1_Silent_p.A2A|DYNLRB2_ENST00000562982.1_Silent_p.A31A|RP11-525K10.3_ENST00000563267.1_RNA|RP11-525K10.3_ENST00000568552.1_RNA|RP11-525K10.3_ENST00000568776.1_RNA|RP11-525K10.3_ENST00000565050.1_RNA|RP11-525K10.3_ENST00000568819.1_RNA	NM_130897.1	NP_570967.1	Q8TF09	DLRB2_HUMAN	dynein, light chain, roadblock-type 2	2					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	cytoplasmic dynein complex (GO:0005868)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			large_intestine(1)|lung(4)|prostate(1)	6						TCTTTCAGGCAGAGGTGGAGG	0.418																																						dbGAP											0													121.0	120.0	120.0					16																	80577175		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF125108	CCDS10929.1	16q23.3	2008-02-05	2005-11-25	2005-11-25	ENSG00000168589	ENSG00000168589		"""Cytoplasmic dyneins"""	15467	protein-coding gene	gene with protein product	"""roadblock domain containing 2"""	607168	"""dynein, cytoplasmic, light polypeptide 2B"""	DNCL2B		11750132, 16260502	Standard	NM_130897		Approved	DNLC2B, ROBLD2	uc002ffo.3	Q8TF09	OTTHUMG00000137622	ENST00000305904.6:c.6A>C	16.37:g.80577175A>C				Silent	SNP	pfam_Dynein_light-rel,smart_Dynein_light-rel,pirsf_Dynein_light_roadblock-type	p.A2	ENST00000305904.6	37	c.6	CCDS10929.1	16																																																																																			DYNLRB2	-	pirsf_Dynein_light_roadblock-type	ENSG00000168589		0.418	DYNLRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNLRB2	HGNC	protein_coding	OTTHUMT00000269043.1	117	0.00	0	A	NM_130897		80577175	80577175	+1	no_errors	ENST00000305904	ensembl	human	known	69_37n	silent	8	70.37	19	SNP	1.000	C
EML1	2009	genome.wustl.edu	37	14	100384181	100384182	+	Missense_Mutation	DNP	TG	TG	CT	rs75430712		TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr14:100384181_100384182TG>CT	ENST00000262233.6	+	16	1954_1955	c.1815_1816TG>CT	c.(1813-1818)acTGgg>acCTgg	p.G606W	EML1_ENST00000334192.4_Missense_Mutation_p.G625W|EML1_ENST00000327921.9_Missense_Mutation_p.G594W	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	606	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				GAACACTCACTGGGAGGTAAGT	0.465																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		Exception_encountered	14.37:g.100384181_100384182delinsCT	ENSP00000262233:p.Gly606Trp		Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	NULL|pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W51R|p.G625W	ENST00000262233.6	37	c.151|c.1873	CCDS32155.1	14																																																																																			EML1	-	NULL|superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000066629		0.465	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EML1	HGNC	protein_coding	OTTHUMT00000413943.1	149|147	0.00	0	T|G	NM_001008707		100384181|100384182	100384181|100384182	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region|no_errors	ENST00000557313|ENST00000334192	ensembl	human	known	69_37n	missense	33|36	38.89|36.84	21	SNP	0.988|1.000	C|T
TLR9	54106	genome.wustl.edu	37	3	52255599	52255599	+	Silent	SNP	G	G	C	rs372118821		TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr3:52255599G>C	ENST00000360658.2	-	2	3366	c.2733C>G	c.(2731-2733)cgC>cgG	p.R911R	TLR9_ENST00000597542.1_Silent_p.R935R|TLR9_ENST00000494383.1_Missense_Mutation_p.R1065G	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	911	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	GCAGCCAGTCGCGTTCCTCCA	0.647																																						dbGAP											0													75.0	84.0	81.0					3																	52255599		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2733C>G	3.37:g.52255599G>C			B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,pfam_Actin-bd_cofilin/tropomyosin,superfamily_TIR_dom,smart_Actin-bd_cofilin/tropomyosin,smart_Leu-rich_rpt_typical-subtyp,smart_TIR_dom,pfscan_TIR_dom	p.R1065G	ENST00000360658.2	37	c.3193	CCDS2848.1	3	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.575381	0.00887	.	.	ENSG00000173366	ENST00000494383	T	0.12147	2.71	5.6	-11.2	0.00127	.	0.000000	0.37955	N	0.001866	T	0.11239	0.0274	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61372	-0.7076	7	0.87932	D	0	.	0.6134	0.00765	0.3489:0.258:0.1584:0.2347	.	.	.	.	G	1065	ENSP00000417517:R1065G	ENSP00000417517:R1065G	R	-	1	2	RP11-330H6.5	52230639	0.000000	0.05858	0.076000	0.20297	0.108000	0.19459	-4.679000	0.00199	-3.998000	0.00083	-1.648000	0.00760	CGA	RP11-330H6.5	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000173366		0.647	TLR9-001	KNOWN	basic|CCDS	protein_coding	ENSG00000173366	Clone_based_vega_gene	protein_coding	OTTHUMT00000350203.1	17	0.00	0	G			52255599	52255599	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000494383	ensembl	human	putative	69_37n	missense	5	50.00	5	SNP	0.027	C
PPY2P	23614	genome.wustl.edu	37	17	26574658	26574658	+	lincRNA	SNP	T	T	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:26574658T>G	ENST00000579045.1	-	0	374				PPY2_ENST00000583761.1_RNA																							TGACCAAGCCTAGGCATGTGC	0.602																																						dbGAP											0																																										-	-	-			0																															17.37:g.26574658T>G				RNA	SNP	-	NULL	ENST00000579045.1	37	NULL		17																																																																																			CTD-2008P7.8	-	-	ENSG00000266830		0.602	CTD-2008P7.8-001	KNOWN	basic	lincRNA	ENSG00000266830	Clone_based_vega_gene	lincRNA	OTTHUMT00000446190.1	61	0.00	0	T			26574658	26574658	-1	no_errors	ENST00000579045	ensembl	human	known	69_37n	rna	24	33.33	12	SNP	0.980	G
EPB41	2035	genome.wustl.edu	37	1	29314146	29314146	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:29314146T>A	ENST00000343067.4	+	2	324	c.197T>A	c.(196-198)tTg>tAg	p.L66*	Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000373800.3_5'UTR|EPB41_ENST00000398863.2_Nonsense_Mutation_p.L66*|EPB41_ENST00000356093.2_Nonsense_Mutation_p.L66*|EPB41_ENST00000373798.1_Nonsense_Mutation_p.L66*|EPB41_ENST00000347529.3_Nonsense_Mutation_p.L66*|EPB41_ENST00000349460.4_5'UTR|EPB41_ENST00000373797.1_Nonsense_Mutation_p.L66*	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	66					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		CATGAAGACTTGACCAAGAAC	0.473																																						dbGAP											0													174.0	168.0	170.0					1																	29314146		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.197T>A	1.37:g.29314146T>A	ENSP00000345259:p.Leu66*		B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Nonsense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.L66*	ENST00000343067.4	37	c.197	CCDS53288.1	1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.692901	0.88735	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000347529;ENST00000373798;ENST00000373797	.	.	.	5.6	4.48	0.54585	.	0.361503	0.21277	N	0.077217	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	3.4427	0.07469	0.1823:0.1636:0.0:0.654	.	.	.	.	X	83;66;66;66;66;66;66;66;66	.	ENSP00000345259:L66X	L	+	2	0	EPB41	29186733	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.374000	0.44274	2.127000	0.65507	0.529000	0.55759	TTG	EPB41	-	pirsf_Band_41_protein	ENSG00000159023		0.473	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	HGNC	protein_coding	OTTHUMT00000010312.1	53	0.00	0	T	NM_203342		29314146	29314146	+1	no_errors	ENST00000343067	ensembl	human	known	69_37n	nonsense	7	71.43	20	SNP	1.000	A
NUTM2F	54754	genome.wustl.edu	37	9	97082784	97082784	+	Silent	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr9:97082784C>G	ENST00000253262.4	-	5	1094	c.1074G>C	c.(1072-1074)ctG>ctC	p.L358L	NUTM2F_ENST00000341207.4_Silent_p.L358L|NUTM2F_ENST00000335456.7_Silent_p.L358L	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	358	Pro-rich.																TGGGTGGTGGCAGGTGGGCCT	0.706																																						dbGAP											0													19.0	27.0	24.0					9																	97082784		1992	4133	6125	-	-	-	SO:0001819	synonymous_variant	0				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1074G>C	9.37:g.97082784C>G			B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Silent	SNP	NULL	p.L358	ENST00000253262.4	37	c.1074	CCDS47994.1	9																																																																																			FAM22F	-	NULL	ENSG00000130950		0.706	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM22F	HGNC	protein_coding	OTTHUMT00000053173.2	112	0.00	0	C	NM_017561		97082784	97082784	-1	no_errors	ENST00000253262	ensembl	human	known	69_37n	silent	44	10.20	5	SNP	0.714	G
FCRL4	83417	genome.wustl.edu	37	1	157559026	157559026	+	Missense_Mutation	SNP	C	C	A	rs138667797		TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:157559026C>A	ENST00000271532.1	-	3	410	c.275G>T	c.(274-276)cGa>cTa	p.R92L	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	92	Ig-like C2-type 1.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				AGGGTTACTTCGTGGGGAGCC	0.498																																						dbGAP											0													72.0	77.0	75.0					1																	157559026		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.275G>T	1.37:g.157559026C>A	ENSP00000271532:p.Arg92Leu		Q96PJ3|Q96RE0	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R92L	ENST00000271532.1	37	c.275	CCDS1166.1	1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.817146	0.00595	.	.	ENSG00000163518	ENST00000271532	T	0.53206	0.63	4.2	-8.41	0.00961	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.649290	0.02075	N	0.051832	T	0.03011	0.0089	N	0.01009	-1.055	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05716	-1.0868	10	0.10636	T	0.68	.	3.6262	0.08114	0.1679:0.1002:0.5291:0.2028	.	92	Q96PJ5	FCRL4_HUMAN	L	92	ENSP00000271532:R92L	ENSP00000271532:R92L	R	-	2	0	FCRL4	155825650	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.546000	0.00435	-3.275000	0.00198	-2.418000	0.00219	CGA	FCRL4	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000163518		0.498	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL4	HGNC	protein_coding	OTTHUMT00000086180.1	74	0.00	0	C	NM_031282		157559026	157559026	-1	no_errors	ENST00000271532	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	0.000	A
FGD6	55785	genome.wustl.edu	37	12	95501370	95501370	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:95501370C>T	ENST00000343958.4	-	12	3525	c.3302G>A	c.(3301-3303)cGg>cAg	p.R1101Q	FGD6_ENST00000546711.1_Missense_Mutation_p.R1101Q|FGD6_ENST00000549499.1_Missense_Mutation_p.R1101Q	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1101	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						CATCACTTTCCGAGACAGCTT	0.413																																						dbGAP											0													138.0	120.0	126.0					12																	95501370		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.3302G>A	12.37:g.95501370C>T	ENSP00000344446:p.Arg1101Gln		Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.R1101Q	ENST00000343958.4	37	c.3302	CCDS31878.1	12	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136738	0.77662	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000551521;ENST00000549499	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	6.06	5.17	0.71159	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.43579	D	0.000547	D	0.88310	0.6402	M	0.88377	2.95	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	D;D	0.97110	0.994;1.0	D	0.89673	0.3885	10	0.48119	T	0.1	-15.7972	16.8865	0.86077	0.1292:0.8708:0.0:0.0	.	1101;1101	Q6ZV73-2;Q6ZV73	.;FGD6_HUMAN	Q	1101;1101;97;1101	ENSP00000344446:R1101Q;ENSP00000450342:R1101Q;ENSP00000450240:R97Q;ENSP00000449005:R1101Q	ENSP00000344446:R1101Q	R	-	2	0	FGD6	94025501	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	7.303000	0.78871	1.562000	0.49601	0.650000	0.86243	CGG	FGD6	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000180263		0.413	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD6	HGNC	protein_coding	OTTHUMT00000407600.1	129	0.77	1	C	NM_018351		95501370	95501370	-1	no_errors	ENST00000343958	ensembl	human	known	69_37n	missense	100	13.04	15	SNP	1.000	T
GALNT9	50614	genome.wustl.edu	37	12	132905608	132905608	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:132905608T>G	ENST00000328957.8	-	1	181	c.182A>C	c.(181-183)gAg>gCg	p.E61A	RP13-895J2.7_ENST00000537720.1_RNA	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	61					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CAGGATGGCCTCACGGTCCCC	0.746																																					Colon(186;2147 2752 13553 41466)	dbGAP											0													15.0	21.0	19.0					12																	132905608		689	1588	2277	-	-	-	SO:0001583	missense	0			AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.182A>C	12.37:g.132905608T>G	ENSP00000329846:p.Glu61Ala		Q52LR8|Q6NT54|Q8NFR1	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.E61A	ENST00000328957.8	37	c.182		12	.	.	.	.	.	.	.	.	.	.	T	15.91	2.972833	0.53614	.	.	ENSG00000182870	ENST00000328957	T	0.54071	0.59	4.03	4.03	0.46877	.	0.086993	0.45606	U	0.000357	T	0.38268	0.1034	L	0.38531	1.155	0.80722	D	1	B;B	0.27013	0.166;0.002	B;B	0.14023	0.01;0.002	T	0.17198	-1.0377	10	0.14252	T	0.57	.	12.9402	0.58337	0.0:0.0:0.0:1.0	.	61;61	B2RXG6;Q9HCQ5	.;GALT9_HUMAN	A	61	ENSP00000329846:E61A	ENSP00000329846:E61A	E	-	2	0	GALNT9	131415681	1.000000	0.71417	0.897000	0.35233	0.880000	0.50808	7.278000	0.78587	1.445000	0.47624	0.260000	0.18958	GAG	GALNT9	-	NULL	ENSG00000182870		0.746	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	GALNT9	HGNC	protein_coding	OTTHUMT00000402967.1	17	0.00	0	T	NM_001122636		132905608	132905608	-1	no_errors	ENST00000328957	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	1.000	G
GALNT9	50614	genome.wustl.edu	37	12	132905684	132905684	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:132905684C>A	ENST00000328957.8	-	1	105	c.106G>T	c.(106-108)Gag>Tag	p.E36*	RP13-895J2.7_ENST00000537720.1_RNA	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	36					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CGCACGAGCTCCTGGGAGCGG	0.677																																					Colon(186;2147 2752 13553 41466)	dbGAP											0													20.0	25.0	23.0					12																	132905684		691	1589	2280	-	-	-	SO:0001587	stop_gained	0			AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.106G>T	12.37:g.132905684C>A	ENSP00000329846:p.Glu36*		Q52LR8|Q6NT54|Q8NFR1	Nonsense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.E36*	ENST00000328957.8	37	c.106		12	.	.	.	.	.	.	.	.	.	.	C	35	5.535607	0.96460	.	.	ENSG00000182870	ENST00000328957	.	.	.	4.03	2.04	0.26737	.	0.425022	0.20053	U	0.100241	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	9.6996	0.40178	0.16:0.6858:0.1543:0.0	.	.	.	.	X	36	.	ENSP00000329846:E36X	E	-	1	0	GALNT9	131415757	1.000000	0.71417	0.059000	0.19551	0.804000	0.45430	3.426000	0.52778	0.119000	0.18210	0.313000	0.20887	GAG	GALNT9	-	NULL	ENSG00000182870		0.677	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	GALNT9	HGNC	protein_coding	OTTHUMT00000402967.1	23	0.00	0	C	NM_001122636		132905684	132905684	-1	no_errors	ENST00000328957	ensembl	human	known	69_37n	nonsense	6	36.36	4	SNP	1.000	A
GPRASP2	114928	genome.wustl.edu	37	X	101971743	101971743	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:101971743A>T	ENST00000535209.1	+	4	2777	c.1946A>T	c.(1945-1947)tAt>tTt	p.Y649F	GPRASP2_ENST00000543253.1_Missense_Mutation_p.Y649F|GPRASP2_ENST00000332262.5_Missense_Mutation_p.Y649F			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	649						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TTGCTTAATTATCCATCCTCT	0.353																																						dbGAP											0													92.0	81.0	84.0					X																	101971743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1946A>T	X.37:g.101971743A>T	ENSP00000437394:p.Tyr649Phe		D3DXA0|Q8NAB4	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.Y649F	ENST00000535209.1	37	c.1946	CCDS14501.1	X	.	.	.	.	.	.	.	.	.	.	A	10.08	1.253151	0.22965	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.29142	1.58;1.58;1.58	4.12	1.57	0.23409	Armadillo-like helical (1);Armadillo-type fold (1);	0.184352	0.26773	N	0.022573	T	0.31702	0.0805	L	0.38175	1.15	0.25966	N	0.982568	D	0.64830	0.994	P	0.62298	0.9	T	0.18650	-1.0330	10	0.11485	T	0.65	.	6.0175	0.19611	0.5705:0.0:0.0:0.4295	.	649	Q96D09	GASP2_HUMAN	F	649	ENSP00000437872:Y649F;ENSP00000437394:Y649F;ENSP00000339057:Y649F	ENSP00000339057:Y649F	Y	+	2	0	GPRASP2	101858399	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	2.052000	0.41316	0.198000	0.20407	-0.567000	0.04161	TAT	GPRASP2	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000158301		0.353	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	HGNC	protein_coding	OTTHUMT00000057626.2	172	0.00	0	A	NM_138437		101971743	101971743	+1	no_errors	ENST00000332262	ensembl	human	known	69_37n	missense	15	48.28	14	SNP	0.999	T
GTF3C1	2975	genome.wustl.edu	37	16	27483171	27483171	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr16:27483171C>A	ENST00000356183.4	-	30	4439	c.4424G>T	c.(4423-4425)aGc>aTc	p.S1475I	GTF3C1_ENST00000561623.1_Missense_Mutation_p.S1475I	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1475					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GTTGACCAAGCTCCTCTTCTG	0.602																																						dbGAP											0													80.0	71.0	74.0					16																	27483171		2197	4300	6497	-	-	-	SO:0001583	missense	0			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4424G>T	16.37:g.27483171C>A	ENSP00000348510:p.Ser1475Ile		B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.S1475I	ENST00000356183.4	37	c.4424	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965582	0.92855	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.26067	1.76	5.04	5.04	0.67666	.	0.101299	0.64402	D	0.000002	T	0.51007	0.1649	M	0.72118	2.19	0.50313	D	0.999865	D;D	0.76494	0.998;0.999	D;D	0.71656	0.929;0.974	T	0.52026	-0.8630	10	0.51188	T	0.08	-17.2302	17.9884	0.89161	0.0:1.0:0.0:0.0	.	1475;1475	Q12789;Q12789-3	TF3C1_HUMAN;.	I	1475;1471	ENSP00000348510:S1475I	ENSP00000348510:S1475I	S	-	2	0	GTF3C1	27390672	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.194000	0.77789	2.342000	0.79632	0.655000	0.94253	AGC	GTF3C1	-	NULL	ENSG00000077235		0.602	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	76	0.00	0	C	NM_001520		27483171	27483171	-1	no_errors	ENST00000356183	ensembl	human	known	69_37n	missense	21	52.27	23	SNP	1.000	A
HCRT	3060	genome.wustl.edu	37	17	40336501	40336503	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:40336501_40336503delGCA	ENST00000293330.1	-	2	151_153	c.65_67delTGC	c.(64-69)ctgccg>ccg	p.L22del		NM_001524.1	NP_001515.1	O43612	OREX_HUMAN	hypocretin (orexin) neuropeptide precursor	22					eating behavior (GO:0042755)|negative regulation of DNA replication (GO:0008156)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of transmission of nerve impulse (GO:0051970)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transmission of nerve impulse (GO:0051971)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)		p.L22delL(1)		breast(1)|central_nervous_system(1)	2		all_cancers(22;1.39e-06)|all_epithelial(22;9.98e-06)|Breast(137;0.000143)|Ovarian(249;0.0221)|Myeloproliferative disorder(1115;0.0255)|Colorectal(1115;0.069)		BRCA - Breast invasive adenocarcinoma(366;0.124)		AGCGCGGgcggcagcagcagcag	0.704																																						dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)																																								-	-	-	SO:0001651	inframe_deletion	0			AF041240	CCDS11421.1	17q21	2013-02-28				ENSG00000161610		"""Endogenous ligands"""	4847	protein-coding gene	gene with protein product	"""prepro-orexin"""	602358				9419374, 9491897	Standard	NM_001524		Approved	PPOX, OX	uc002hzc.1	O43612		ENST00000293330.1:c.65_67delTGC	17.37:g.40336510_40336512delGCA	ENSP00000293330:p.Leu22del			In_Frame_Del	DEL	pfam_Orexin,pirsf_Orexin,prints_Orexin	p.L22in_frame_del	ENST00000293330.1	37	c.67_65	CCDS11421.1	17																																																																																			HCRT	-	pfam_Orexin,pirsf_Orexin	ENSG00000161610		0.704	HCRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRT	HGNC	protein_coding	OTTHUMT00000449792.1	12	0.00	0	GCA	NM_001524		40336501	40336503	-1	no_errors	ENST00000293330	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	0.998:0.999:1.000	-
HDAC6	10013	genome.wustl.edu	37	X	48672886	48672886	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:48672886G>T	ENST00000334136.5	+	11	1024	c.846G>T	c.(844-846)agG>agT	p.R282S	HDAC6_ENST00000444343.2_Missense_Mutation_p.R296S|HDAC6_ENST00000413163.2_Missense_Mutation_p.R227S|HDAC6_ENST00000376619.2_Missense_Mutation_p.R282S			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	282	Histone deacetylase 1.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	AGCAGGGTAGGTTCTGGCCCC	0.537																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0													114.0	102.0	106.0					X																	48672886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.846G>T	X.37:g.48672886G>T	ENSP00000334061:p.Arg282Ser		O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.R296S	ENST00000334136.5	37	c.888	CCDS14306.1	X	.	.	.	.	.	.	.	.	.	.	G	0.029	-1.345814	0.01266	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619;ENST00000436813;ENST00000413163	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.05	-7.06	0.01568	Histone deacetylase domain (2);	0.349499	0.27253	N	0.020218	T	0.28797	0.0714	N	0.12663	0.25	0.20638	N	0.999871	B;B;B	0.27791	0.189;0.002;0.189	B;B;B	0.22152	0.038;0.012;0.038	T	0.42716	-0.9435	10	0.12103	T	0.63	-9.5045	0.6378	0.00805	0.2204:0.2785:0.242:0.2591	.	272;227;282	B4DZN1;E7EUZ1;Q9UBN7	.;.;HDAC6_HUMAN	S	296;282;282;282;227	ENSP00000398566:R296S;ENSP00000334061:R282S;ENSP00000365804:R282S;ENSP00000398801:R227S	ENSP00000334061:R282S	R	+	3	2	HDAC6	48557830	0.000000	0.05858	0.105000	0.21289	0.143000	0.21401	-1.822000	0.01711	-0.962000	0.03604	-0.346000	0.07831	AGG	HDAC6	-	pfam_His_deacetylse_dom	ENSG00000094631		0.537	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	118	0.00	0	G	NM_006044		48672886	48672886	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	missense	35	53.33	40	SNP	0.000	T
HNF1B	6928	genome.wustl.edu	37	17	36099431	36099431	+	Splice_Site	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:36099431G>A	ENST00000225893.4	-	2	905	c.544C>T	c.(544-546)Caa>Taa	p.Q182*	HNF1B_ENST00000427275.2_Splice_Site_p.Q182*|HNF1B_ENST00000560016.1_Splice_Site_p.Q182*|HNF1B_ENST00000561193.1_Splice_Site_p.Q182*	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	182					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			AAACACTTACGTCGGAGGATC	0.547																																					Colon(71;102 1179 9001 27917 43397)	dbGAP											0			GRCh37	CM042491	HNF1B	M							140.0	121.0	127.0					17																	36099431		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.544+1C>T	17.37:g.36099431G>A			B4DKM3|E0YMJ9	Nonsense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeodomain,pfscan_Homeodomain	p.Q182*	ENST00000225893.4	37	c.544	CCDS11324.1	17	.	.	.	.	.	.	.	.	.	.	G	40	7.944435	0.98574	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	.	.	.	5.96	5.96	0.96718	.	0.102593	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.621	19.3889	0.94570	0.0:0.0:1.0:0.0	.	.	.	.	X	182;182;182;70	.	.	Q	-	1	0	HNF1B	33173544	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.826000	0.97356	0.655000	0.94253	CAA;CAG;CAA;CAA	HNF1B	-	pfam_HNF-1_N,superfamily_Lambda_DNA-bd_dom	ENSG00000108753		0.547	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1B	HGNC	protein_coding	OTTHUMT00000256807.3	120	0.00	0	G	NM_000458	Nonsense_Mutation	36099431	36099431	-1	no_errors	ENST00000225893	ensembl	human	known	69_37n	nonsense	31	29.55	13	SNP	1.000	A
IGHJ6	28475	genome.wustl.edu	37	14	106330033	106330033	+	RNA	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr14:106330033C>G	ENST00000390560.2	-	0	0				IGHJ2_ENST00000390564.2_RNA|IGHD7-27_ENST00000439842.1_RNA|IGHJ1_ENST00000390565.1_RNA|IGHJ4_ENST00000461719.1_RNA|IGHJ5_ENST00000488476.1_RNA|IGHJ3_ENST00000463911.1_RNA					immunoglobulin heavy joining 6																		CCTGAGGAGACGGTGACCAGG	0.602																																						dbGAP											0																																										-	-	-			0			J00256		14q32.33	2012-02-08			ENSG00000211900	ENSG00000211900		"""Immunoglobulins / IGH locus"""	5540	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152455		14.37:g.106330033C>G				Missense_Mutation	SNP	NULL	p.V14L	ENST00000390560.2	37	c.40		14																																																																																			IGHJ5	-	NULL	ENSG00000242472		0.602	IGHJ6-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_J_gene	IGHJ5	HGNC	IG_J_gene	OTTHUMT00000326277.1	46	0.00	0	C	NG_001019		106330033	106330033	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000488476	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	0.379	G
ITGA5	3678	genome.wustl.edu	37	12	54803355	54803355	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:54803355A>G	ENST00000293379.4	-	3	637	c.376T>C	c.(376-378)Tcc>Ccc	p.S126P	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|ITGA5_ENST00000547744.1_5'Flank	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	126					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TCTGAGCTGGACAGTGAGGAC	0.597																																						dbGAP											0													49.0	45.0	46.0					12																	54803355		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.376T>C	12.37:g.54803355A>G	ENSP00000293379:p.Ser126Pro		Q96HA5	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.S126P	ENST00000293379.4	37	c.376	CCDS8880.1	12	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316058	0.60524	.	.	ENSG00000161638	ENST00000293379	D	0.85171	-1.95	4.17	3.01	0.34805	.	1.084470	0.07072	N	0.835676	T	0.79094	0.4388	L	0.32530	0.975	0.19300	N	0.999974	P	0.39131	0.661	B	0.40565	0.333	T	0.66069	-0.6015	10	0.37606	T	0.19	.	6.5191	0.22264	0.8888:0.0:0.1112:0.0	.	126	P08648	ITA5_HUMAN	P	126	ENSP00000293379:S126P	ENSP00000293379:S126P	S	-	1	0	ITGA5	53089622	0.068000	0.21057	0.028000	0.17463	0.974000	0.67602	1.040000	0.30278	0.758000	0.33059	0.260000	0.18958	TCC	ITGA5	-	NULL	ENSG00000161638		0.597	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA5	HGNC	protein_coding	OTTHUMT00000406174.1	50	0.00	0	A			54803355	54803355	-1	no_errors	ENST00000293379	ensembl	human	known	69_37n	missense	3	66.67	6	SNP	0.268	G
ITGB3	3690	genome.wustl.edu	37	17	45376772	45376772	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:45376772A>G	ENST00000559488.1	+	11	1805	c.1789A>G	c.(1789-1791)Aat>Gat	p.N597D	ITGB3_ENST00000435993.2_Missense_Mutation_p.N550D|ITGB3_ENST00000560629.1_Missense_Mutation_p.Q585R	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	597	Cysteine-rich tandem repeats.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	CATGTCCAGCAATGGGCTGCT	0.617																																						dbGAP											0													93.0	87.0	89.0					17																	45376772		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.1789A>G	17.37:g.45376772A>G	ENSP00000452786:p.Asn597Asp		A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.N597D	ENST00000559488.1	37	c.1789	CCDS11511.1	17	.	.	.	.	.	.	.	.	.	.	A	5.567	0.289512	0.10567	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	D	0.86865	-2.18	5.84	4.73	0.59995	EGF, extracellular (1);	0.340577	0.36778	N	0.002403	T	0.69967	0.3170	N	0.04508	-0.205	0.39311	D	0.965071	B	0.21381	0.055	B	0.22152	0.038	T	0.63829	-0.6548	10	0.06365	T	0.9	.	12.089	0.53715	0.8559:0.1441:0.0:0.0	.	597	P05106	ITB3_HUMAN	D	597;550	ENSP00000407801:N550D	ENSP00000262017:N597D	N	+	1	0	C17orf57	42731771	0.147000	0.22687	0.998000	0.56505	0.990000	0.78478	0.684000	0.25364	0.990000	0.38787	0.454000	0.30748	AAT	ITGB3	-	pirsf_Integrin_bsu,pfam_EGF_extracell	ENSG00000259207		0.617	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB3	HGNC	protein_coding	OTTHUMT00000416111.3	64	0.00	0	A	NM_000212		45376772	45376772	+1	no_errors	ENST00000262017	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	0.929	G
IVNS1ABP	10625	genome.wustl.edu	37	1	185270573	185270573	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:185270573C>G	ENST00000367498.3	-	9	1510	c.888G>C	c.(886-888)aaG>aaC	p.K296N	IVNS1ABP_ENST00000392007.3_Missense_Mutation_p.K78N|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	296	Sufficient for AHR interaction and signaling.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						TACTTGAAGTCTTTTCTGAAG	0.383																																						dbGAP											0													185.0	176.0	179.0					1																	185270573		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.888G>C	1.37:g.185270573C>G	ENSP00000356468:p.Lys296Asn		A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.K296N	ENST00000367498.3	37	c.888	CCDS1368.1	1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596024	0.66332	.	.	ENSG00000116679	ENST00000367498;ENST00000392007	T;T	0.15834	2.39;2.39	5.74	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	N	0.19112	0.55	0.58432	D	0.999999	D;D	0.76494	0.997;0.999	D;D	0.65874	0.939;0.915	T	0.08229	-1.0732	10	0.87932	D	0	.	14.8752	0.70488	0.0:0.9313:0.0:0.0687	.	78;296	A8MVR0;Q9Y6Y0	.;NS1BP_HUMAN	N	296;78	ENSP00000356468:K296N;ENSP00000375864:K78N	ENSP00000356468:K296N	K	-	3	2	IVNS1ABP	183537196	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.141000	0.31528	1.572000	0.49736	0.563000	0.77884	AAG	IVNS1ABP	-	pirsf_Kelch-like_gigaxonin	ENSG00000116679		0.383	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	177	0.00	0	C	NM_006469		185270573	185270573	-1	no_errors	ENST00000367498	ensembl	human	known	69_37n	missense	115	23.84	36	SNP	1.000	G
KCNMA1	3778	genome.wustl.edu	37	10	78674713	78674713	+	Silent	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr10:78674713G>A	ENST00000286628.8	-	24	2996	c.2997C>T	c.(2995-2997)atC>atT	p.I999I	RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000372443.1_Silent_p.I941I|KCNMA1_ENST00000406533.3_Silent_p.I1003I|RP11-443A13.5_ENST00000426234.1_RNA|KCNMA1_ENST00000372440.1_Silent_p.I941I|KCNMA1_ENST00000404857.1_Silent_p.I982I|KCNMA1_ENST00000354353.5_Silent_p.I1002I|KCNMA1_ENST00000404771.3_Silent_p.I999I|KCNMA1_ENST00000286627.5_Silent_p.I941I|RP11-443A13.5_ENST00000600782.1_RNA	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	999					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TGATGATGGGGATGTTGACCC	0.478																																						dbGAP											0													299.0	269.0	279.0					10																	78674713		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2997C>T	10.37:g.78674713G>A			F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.S892F	ENST00000286628.8	37	c.2675		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.608|9.608	1.130556|1.130556	0.21041|0.21041	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372421;ENST00000434208|ENST00000372403	.|.	.|.	.|.	6.11|6.11	4.23|4.23	0.50019|0.50019	.|.	.|.	.|.	.|.	.|.	T|T	0.57140|0.57140	0.2033|0.2033	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.52931|0.52931	-0.8509|-0.8509	4|4	.|.	.|.	.|.	-15.4172|-15.4172	7.0765|7.0765	0.25207|0.25207	0.141:0.0:0.7182:0.1409|0.141:0.0:0.7182:0.1409	.|.	.|.	.|.	.|.	S|F	930;649|892	.|.	.|.	P|S	-|-	1|2	0|0	KCNMA1|KCNMA1	78344719|78344719	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.820000|3.820000	0.55693|0.55693	0.873000|0.873000	0.35799|0.35799	0.655000|0.655000	0.94253|0.94253	CCC|TCC	KCNMA1	-	NULL	ENSG00000156113		0.478	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	145	0.00	0	G	NM_002247		78674713	78674713	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000372403	ensembl	human	known	69_37n	missense	37	31.48	17	SNP	1.000	A
KIAA1614	57710	genome.wustl.edu	37	1	180886055	180886055	+	Silent	SNP	G	G	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:180886055G>T	ENST00000367588.4	+	2	871	c.816G>T	c.(814-816)ctG>ctT	p.L272L		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	272										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CGGCCCTGCTGGGTGAGCGCT	0.617																																						dbGAP											0													102.0	119.0	113.0					1																	180886055		2082	4221	6303	-	-	-	SO:0001819	synonymous_variant	0			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.816G>T	1.37:g.180886055G>T			Q5VZ45|Q9HCF8	Silent	SNP	NULL	p.L272	ENST00000367588.4	37	c.816	CCDS41442.1	1																																																																																			KIAA1614	-	NULL	ENSG00000135835		0.617	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	HGNC	protein_coding	OTTHUMT00000085151.1	72	0.00	0	G	XM_046531		180886055	180886055	+1	no_errors	ENST00000367588	ensembl	human	known	69_37n	silent	30	18.92	7	SNP	0.000	T
LAMP3	27074	genome.wustl.edu	37	3	182841959	182841960	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr3:182841959_182841960insC	ENST00000265598.3	-	6	1415_1416	c.1160_1161insG	c.(1159-1161)attfs	p.I387fs	LAMP3_ENST00000466939.1_Frame_Shift_Ins_p.I363fs	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	387					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			CGATGGCCCCAATCACAGGAAG	0.455																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.1160_1161insG	3.37:g.182841959_182841960insC	ENSP00000265598:p.Ile387fs		D3DNS4|O94781|Q8NEC8	Frame_Shift_Ins	INS	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.I387fs	ENST00000265598.3	37	c.1161_1160	CCDS3242.1	3																																																																																			LAMP3	-	pfam_Lysosome-assoc_membr_glycop	ENSG00000078081		0.455	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP3	HGNC	protein_coding	OTTHUMT00000350863.1	101	0.00	0	-			182841959	182841960	-1	no_errors	ENST00000265598	ensembl	human	known	69_37n	frame_shift_ins	39	11.36	5	INS	0.985:1.000	C
LIPE	3991	genome.wustl.edu	37	19	42907078	42907078	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr19:42907078C>G	ENST00000244289.4	-	9	2924	c.2648G>C	c.(2647-2649)gGa>gCa	p.G883A	LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000593491.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	883					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				CTCGGAGTTTCCCCTCAGGCT	0.607																																						dbGAP											0													76.0	63.0	67.0					19																	42907078		2203	4300	6503	-	-	-	SO:0001583	missense	0			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.2648G>C	19.37:g.42907078C>G	ENSP00000244289:p.Gly883Ala		Q3LRT2|Q6NSL7	Missense_Mutation	SNP	pfam_HSL_N,pfam_AB_hydrolase_3,pfam_Steryl_acetyl_hydrolase	p.G883A	ENST00000244289.4	37	c.2648	CCDS12607.1	19	.	.	.	.	.	.	.	.	.	.	C	8.103	0.777079	0.16120	.	.	ENSG00000079435	ENST00000244289	T	0.03242	4.0	5.08	2.92	0.33932	.	1.139660	0.06567	N	0.747768	T	0.03695	0.0105	L	0.51422	1.61	0.19775	N	0.999959	P	0.39424	0.673	B	0.29077	0.098	T	0.44097	-0.9350	10	0.13108	T	0.6	-5.1393	7.316	0.26501	0.0:0.7374:0.1698:0.0928	.	883	Q05469	LIPS_HUMAN	A	883	ENSP00000244289:G883A	ENSP00000244289:G883A	G	-	2	0	LIPE	47598918	0.001000	0.12720	0.263000	0.24496	0.020000	0.10135	0.339000	0.19875	0.641000	0.30601	0.591000	0.81541	GGA	LIPE	-	NULL	ENSG00000079435		0.607	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPE	HGNC	protein_coding	OTTHUMT00000463861.1	52	0.00	0	C	NM_005357		42907078	42907078	-1	no_errors	ENST00000244289	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	0.511	G
MAD2L1BP	9587	genome.wustl.edu	37	6	43607982	43607982	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:43607982G>C	ENST00000372171.4	+	3	594	c.537G>C	c.(535-537)caG>caC	p.Q179H	MAD2L1BP_ENST00000451025.2_Missense_Mutation_p.Q211H	NM_014628.2	NP_055443.1	Q15013	MD2BP_HUMAN	MAD2L1 binding protein	179					mitotic cell cycle checkpoint (GO:0007093)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(3)	5	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000351)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GCGTGGACCAGAGCCTGAGCA	0.577																																						dbGAP											0													51.0	49.0	50.0					6																	43607982		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002904	CCDS4904.1, CCDS47431.1	6p21.1	2003-06-23			ENSG00000124688	ENSG00000124688			21059	protein-coding gene	gene with protein product						7788527, 12456649	Standard	NM_014628		Approved	CMT2, KIAA0110, dJ261G23.1	uc003ovu.3	Q15013	OTTHUMG00000014747	ENST00000372171.4:c.537G>C	6.37:g.43607982G>C	ENSP00000361244:p.Gln179His		B4DLV3|E9PAT7|Q6IBB1	Missense_Mutation	SNP	pfam_MAD1/Cdc20-bound-Mad2-bd	p.Q211H	ENST00000372171.4	37	c.633	CCDS4904.1	6	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099289	0.56183	.	.	ENSG00000124688	ENST00000451025;ENST00000372171	T	0.46819	0.86	5.41	3.47	0.39725	.	0.605370	0.17641	N	0.167034	T	0.30634	0.0771	L	0.27053	0.805	0.19300	N	0.999979	P;D	0.56287	0.921;0.975	P;P	0.55011	0.69;0.766	T	0.06409	-1.0828	10	0.59425	D	0.04	-14.3282	7.4429	0.27194	0.1452:0.2422:0.6127:0.0	.	179;211	Q15013;E9PAT7	MD2BP_HUMAN;.	H	211;179	ENSP00000410818:Q211H	ENSP00000361244:Q179H	Q	+	3	2	MAD2L1BP	43715960	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.281000	0.33214	2.539000	0.85634	0.555000	0.69702	CAG	MAD2L1BP	-	pfam_MAD1/Cdc20-bound-Mad2-bd	ENSG00000124688		0.577	MAD2L1BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAD2L1BP	HGNC	protein_coding	OTTHUMT00000040692.2	46	0.00	0	G	NM_014628		43607982	43607982	+1	no_errors	ENST00000451025	ensembl	human	known	69_37n	missense	13	51.85	14	SNP	0.180	C
MCMDC2	157777	genome.wustl.edu	37	8	67793181	67793181	+	Silent	SNP	A	A	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr8:67793181A>G	ENST00000422365.2	+	8	978	c.807A>G	c.(805-807)gcA>gcG	p.A269A	MCMDC2_ENST00000492775.1_Silent_p.A269A|MCMDC2_ENST00000313616.5_Silent_p.A269A|MCMDC2_ENST00000396592.3_Silent_p.A269A|MCMDC2_ENST00000541540.1_Silent_p.A206A	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	269					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						GTATAGAAGCAAATAGCATAA	0.239																																						dbGAP											0													25.0	27.0	26.0					8																	67793181		2188	4252	6440	-	-	-	SO:0001819	synonymous_variant	0			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.807A>G	8.37:g.67793181A>G			B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Silent	SNP	pfam_MCM_DNA-dep_ATPase,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase	p.A269	ENST00000422365.2	37	c.807	CCDS6197.2	8																																																																																			MCMDC2	-	superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase	ENSG00000178460		0.239	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCMDC2	HGNC	protein_coding	OTTHUMT00000347350.1	57	0.00	0	A	NM_173518		67793181	67793181	+1	no_errors	ENST00000422365	ensembl	human	known	69_37n	silent	23	28.12	9	SNP	1.000	G
MED7	9443	genome.wustl.edu	37	5	156565934	156565934	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr5:156565934G>C	ENST00000286317.5	-	2	890	c.509C>G	c.(508-510)tCt>tGt	p.S170C	MED7_ENST00000420343.1_Missense_Mutation_p.S170C	NM_004270.4	NP_004261.1	O43513	MED7_HUMAN	mediator complex subunit 7	170					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(1)|lung(3)|urinary_tract(2)	7	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATCAGGCAAAGAAGCCAAGCA	0.413																																						dbGAP											0													152.0	145.0	147.0					5																	156565934		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104251	CCDS4334.1	5q33.3	2008-02-05	2007-07-30	2007-07-30	ENSG00000155868	ENSG00000155868			2378	protein-coding gene	gene with protein product		605045	"""cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa"""	CRSP9		9989412	Standard	NM_004270		Approved	CRSP33	uc003lwm.4	O43513	OTTHUMG00000130243	ENST00000286317.5:c.509C>G	5.37:g.156565934G>C	ENSP00000286317:p.Ser170Cys			Missense_Mutation	SNP	pfam_Mediatior_Med7	p.S170C	ENST00000286317.5	37	c.509	CCDS4334.1	5	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293647	0.80914	.	.	ENSG00000155868	ENST00000286317;ENST00000420343;ENST00000524289	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.75228	0.3821	L	0.52573	1.65	0.80722	D	1	D	0.69078	0.997	D	0.65987	0.94	T	0.73997	-0.3806	9	0.51188	T	0.08	-1.9568	20.0784	0.97758	0.0:0.0:1.0:0.0	.	170	O43513	MED7_HUMAN	C	170	.	ENSP00000286317:S170C	S	-	2	0	MED7	156498512	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.570000	0.98174	2.736000	0.93811	0.655000	0.94253	TCT	MED7	-	NULL	ENSG00000155868		0.413	MED7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED7	HGNC	protein_coding	OTTHUMT00000252567.2	141	0.00	0	G	NM_004270		156565934	156565934	-1	no_errors	ENST00000286317	ensembl	human	known	69_37n	missense	47	45.35	39	SNP	1.000	C
MSH2	4436	genome.wustl.edu	37	2	47702380	47702380	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr2:47702380A>C	ENST00000233146.2	+	12	2199	c.1976A>C	c.(1975-1977)aAa>aCa	p.K659T	MSH2_ENST00000406134.1_Missense_Mutation_p.K659T|MSH2_ENST00000543555.1_Missense_Mutation_p.K593T	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	659	Interaction with EXO1.				ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TACTTTGAAAAAGATAAACAG	0.323			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	4	Whole gene deletion(2)|Unknown(2)	haematopoietic_and_lymphoid_tissue(3)|prostate(1)											74.0	76.0	75.0					2																	47702380		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1976A>C	2.37:g.47702380A>C	ENSP00000233146:p.Lys659Thr		B4E2Z2|O75488	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.K659T	ENST00000233146.2	37	c.1976	CCDS1834.1	2	.	.	.	.	.	.	.	.	.	.	A	20.9	4.072724	0.76415	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000413880	D;D;D	0.85088	-1.94;-1.94;-1.94	5.96	4.82	0.62117	DNA mismatch repair protein MutS, C-terminal (1);	0.129534	0.64402	D	0.000001	D	0.83663	0.5303	N	0.17922	0.545	0.58432	D	0.999996	P;P;P	0.49783	0.849;0.923;0.928	P;P;P	0.58130	0.624;0.696;0.833	D	0.85571	0.1234	10	0.87932	D	0	-27.3932	11.5174	0.50529	0.9308:0.0:0.0691:0.0	.	593;659;659	B4E2Z2;E9PHA6;P43246	.;.;MSH2_HUMAN	T	659;593;659;659;445	ENSP00000233146:K659T;ENSP00000442697:K593T;ENSP00000384199:K659T	ENSP00000233146:K659T	K	+	2	0	MSH2	47555884	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.528000	0.60580	2.285000	0.76669	0.533000	0.62120	AAA	MSH2	-	pfam_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	ENSG00000095002		0.323	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3	60	0.00	0	A			47702380	47702380	+1	no_errors	ENST00000233146	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	1.000	C
MUC5B	727897	genome.wustl.edu	37	11	1269544	1269544	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr11:1269544delA	ENST00000529681.1	+	31	11492	c.11434delA	c.(11434-11436)accfs	p.T3814fs	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Frame_Shift_Del_p.T3817fs	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3814	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTATCACAGACCACCACACC	0.627																																						dbGAP											0										10,3416		0,10,1703	33.0	42.0	39.0			0.1	0.0	11		39	50,7272		3,44,3614	no	frameshift	MUC5B	NM_002458.2		3,54,5317	A1A1,A1R,RR		0.6829,0.2919,0.5582			1269544	60,10688	1903	4065	5968	-	-	-	SO:0001589	frameshift_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11434delA	11.37:g.1269544delA	ENSP00000436812:p.Thr3814fs		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Frame_Shift_Del	DEL	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T3815fs	ENST00000529681.1	37	c.11443	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.627	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	59	0.00	0	A	XM_001126093		1269544	1269544	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	frame_shift_del	3	33.33	2	DEL	0.000	-
MYH7	4625	genome.wustl.edu	37	14	23891449	23891449	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr14:23891449G>A	ENST00000355349.3	-	25	3347	c.3185C>T	c.(3184-3186)aCc>aTc	p.T1062I		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1062					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GCTCTCCTGGGTCAGCTTCAG	0.597																																						dbGAP											0													151.0	118.0	129.0					14																	23891449		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.3185C>T	14.37:g.23891449G>A	ENSP00000347507:p.Thr1062Ile		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T1062I	ENST00000355349.3	37	c.3185	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692428	0.88735	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.91945	-2.94	4.64	4.64	0.57946	.	.	.	.	.	D	0.92883	0.7736	M	0.78456	2.415	0.52501	D	0.999951	B	0.27117	0.168	B	0.33042	0.157	D	0.92469	0.5984	9	0.87932	D	0	.	18.0449	0.89329	0.0:0.0:1.0:0.0	.	1062	P12883	MYH7_HUMAN	I	1062	ENSP00000347507:T1062I	ENSP00000347507:T1062I	T	-	2	0	MYH7	22961289	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.272000	0.72575	2.585000	0.87301	0.655000	0.94253	ACC	MYH7	-	superfamily_Prefoldin	ENSG00000092054		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	181	0.00	0	G	NM_000257		23891449	23891449	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	missense	26	56.67	34	SNP	1.000	A
MYH8	4626	genome.wustl.edu	37	17	10301949	10301949	+	Silent	SNP	G	G	A	rs199830005		TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:10301949G>A	ENST00000403437.2	-	30	4084	c.3990C>T	c.(3988-3990)aaC>aaT	p.N1330N	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1330					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GTGCCAGGGCGTTCTTGGCCT	0.527									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													dbGAP											0													99.0	96.0	97.0					17																	10301949		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3990C>T	17.37:g.10301949G>A			Q14910	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.N1330	ENST00000403437.2	37	c.3990	CCDS11153.1	17																																																																																			MYH8	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000133020		0.527	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	120	0.00	0	G	NM_002472		10301949	10301949	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	silent	5	82.76	24	SNP	0.879	A
NAT8L	339983	genome.wustl.edu	37	4	2065586	2065586	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr4:2065586C>T	ENST00000423729.2	+	3	641	c.641C>T	c.(640-642)tCt>tTt	p.S214F	NAT8L_ENST00000331662.3_Missense_Mutation_p.S46F	NM_178557.3	NP_848652.2	Q8N9F0	NAT8L_HUMAN	N-acetyltransferase 8-like (GCN5-related, putative)	214	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				metabolic process (GO:0008152)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)	aspartate N-acetyltransferase activity (GO:0017188)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0315)			CTGCGGATGTCTGTGGACTCA	0.662																																						dbGAP											0													82.0	61.0	68.0					4																	2065586		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK094797	CCDS3359.1, CCDS3359.2	4p16.3	2011-11-16	2008-09-24		ENSG00000185818	ENSG00000185818			26742	protein-coding gene	gene with protein product		610647	"""N-acetyltransferase 8-like"""			11397015	Standard	NM_178557		Approved	FLJ37478, Hcml3	uc003geq.2	Q8N9F0	OTTHUMG00000121151	ENST00000423729.2:c.641C>T	4.37:g.2065586C>T	ENSP00000413064:p.Ser214Phe			Missense_Mutation	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.S214F	ENST00000423729.2	37	c.641	CCDS3359.2	4	.	.	.	.	.	.	.	.	.	.	C	30	5.054312	0.93793	.	.	ENSG00000185818	ENST00000423729;ENST00000331662	T;T	0.20738	2.05;2.05	5.54	5.54	0.83059	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.64402	U	0.000001	T	0.30448	0.0765	N	0.20483	0.58	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.03829	-1.1000	10	0.08837	T	0.75	-9.5889	19.0909	0.93227	0.0:1.0:0.0:0.0	.	214	Q8N9F0	NAT8L_HUMAN	F	214;46	ENSP00000413064:S214F;ENSP00000328464:S46F	ENSP00000328464:S46F	S	+	2	0	NAT8L	2035384	1.000000	0.71417	0.979000	0.43373	0.797000	0.45037	5.916000	0.69981	2.604000	0.88044	0.450000	0.29827	TCT	NAT8L	-	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000185818		0.662	NAT8L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT8L	HGNC	protein_coding		38	0.00	0	C	NM_178557		2065586	2065586	+1	no_errors	ENST00000423729	ensembl	human	known	69_37n	missense	4	69.23	9	SNP	1.000	T
NOP10	55505	genome.wustl.edu	37	15	34635251	34635251	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr15:34635251G>C	ENST00000328848.4	-	1	127	c.24C>G	c.(22-24)aaC>aaG	p.N8K	NUTM1_ENST00000333756.4_5'Flank|NUTM1_ENST00000537011.1_5'Flank|NOP10_ENST00000557912.1_Missense_Mutation_p.N8K|NUTM1_ENST00000438749.3_5'Flank	NM_018648.3	NP_061118.1	Q9NPE3	NOP10_HUMAN	NOP10 ribonucleoprotein	8					pseudouridine synthesis (GO:0001522)|rRNA processing (GO:0006364)	box H/ACA RNP complex (GO:0072588)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	snoRNA binding (GO:0030515)			lung(1)|ovary(1)	2						CTCCCTGCTCGTTGAGGTAAT	0.532																																						dbGAP											0													240.0	184.0	203.0					15																	34635251		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB043103	CCDS10037.1	15q14-q15	2014-09-17	2012-12-10	2008-10-13	ENSG00000182117	ENSG00000182117			14378	protein-coding gene	gene with protein product	"""homolog of yeast Nop10p"""	606471	"""nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs)"", ""NOP10 ribonucleoprotein homolog (yeast)"""	NOLA3		11074001, 9843512	Standard	NM_018648		Approved	NOP10P, MGC70651	uc001zie.1	Q9NPE3	OTTHUMG00000129440	ENST00000328848.4:c.24C>G	15.37:g.34635251G>C	ENSP00000332198:p.Asn8Lys			Missense_Mutation	SNP	pfam_H/ACA_rnp_Nop10	p.N8K	ENST00000328848.4	37	c.24	CCDS10037.1	15	.	.	.	.	.	.	.	.	.	.	G	8.644	0.896585	0.17686	.	.	ENSG00000182117	ENST00000328848	T	0.74002	-0.8	5.04	0.645	0.17782	.	0.000000	0.85682	D	0.000000	T	0.63593	0.2524	.	.	.	0.44261	D	0.997114	B	0.32573	0.376	B	0.33121	0.158	T	0.57207	-0.7851	9	0.62326	D	0.03	.	7.8447	0.29419	0.416:0.0:0.584:0.0	.	8	Q9NPE3	NOP10_HUMAN	K	8	ENSP00000332198:N8K	ENSP00000332198:N8K	N	-	3	2	NOP10	32422543	1.000000	0.71417	0.881000	0.34555	0.376000	0.30014	1.357000	0.34090	-0.043000	0.13513	-0.345000	0.07892	AAC	NOP10	-	pfam_H/ACA_rnp_Nop10	ENSG00000182117		0.532	NOP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP10	HGNC	protein_coding	OTTHUMT00000251602.2	190	0.00	0	G	NM_018648		34635251	34635251	-1	no_errors	ENST00000328848	ensembl	human	known	69_37n	missense	21	58.82	30	SNP	1.000	C
NPR2	4882	genome.wustl.edu	37	9	35801760	35801760	+	Splice_Site	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr9:35801760G>A	ENST00000342694.2	+	8	1812	c.1557G>A	c.(1555-1557)ctG>ctA	p.L519L		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	519	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CACTGTCGCTGGTGAGCCCTT	0.547																																						dbGAP											0													190.0	154.0	166.0					9																	35801760		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.1557+1G>A	9.37:g.35801760G>A			B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.L519	ENST00000342694.2	37	c.1557	CCDS6590.1	9																																																																																			NPR2	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000159899		0.547	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	HGNC	protein_coding	OTTHUMT00000052345.1	108	0.00	0	G		Silent	35801760	35801760	+1	no_errors	ENST00000342694	ensembl	human	known	69_37n	silent	65	18.75	15	SNP	1.000	A
NUPR1	26471	genome.wustl.edu	37	16	28549435	28549435	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr16:28549435C>T	ENST00000324873.6	-	2	420	c.154G>A	c.(154-156)Gcc>Acc	p.A52T	NUPR1_ENST00000395641.2_Missense_Mutation_p.A70T	NM_001042483.1|NM_012385.2	NP_001035948.1|NP_036517.1	O60356	NUPR1_HUMAN	nuclear protein, transcriptional regulator, 1	52					acute inflammatory response (GO:0002526)|cell growth (GO:0016049)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male gonad development (GO:0008584)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein modification process (GO:0031401)|protein acetylation (GO:0006473)|protein complex assembly (GO:0006461)|regulation of female gonad development (GO:2000194)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(1)	3						TTGGTGTTGGCAGCAGCTTCT	0.607																																						dbGAP											0													113.0	122.0	119.0					16																	28549435		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF069073	CCDS10634.1, CCDS42137.1	16p11.2	2012-07-04	2012-07-04		ENSG00000176046	ENSG00000176046			29990	protein-coding gene	gene with protein product	"""candidate of metastasis 1"""	614812				9405444, 10493524, 10092851	Standard	NM_012385		Approved	COM1, p8	uc002dqd.1	O60356	OTTHUMG00000131764	ENST00000324873.6:c.154G>A	16.37:g.28549435C>T	ENSP00000315559:p.Ala52Thr		B2R5C4|O60357|Q6FGG3	Missense_Mutation	SNP	pfam_Nuclear_phosphoprot_p8_DNA-bd	p.A52T	ENST00000324873.6	37	c.154	CCDS10634.1	16	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443434	0.25987	.	.	ENSG00000176046	ENST00000324873;ENST00000395641	.	.	.	5.5	-0.662	0.11413	.	0.990599	0.08220	N	0.979249	T	0.22244	0.0536	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.27297	-1.0078	8	0.14656	T	0.56	-4.2427	7.7529	0.28907	0.0:0.455:0.0:0.545	.	52	O60356	NUPR1_HUMAN	T	52;70	.	ENSP00000315559:A52T	A	-	1	0	NUPR1	28456936	0.000000	0.05858	0.697000	0.30258	0.978000	0.69477	0.409000	0.21082	0.071000	0.16664	-0.302000	0.09304	GCC	NUPR1	-	pfam_Nuclear_phosphoprot_p8_DNA-bd	ENSG00000176046		0.607	NUPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUPR1	HGNC	protein_coding	OTTHUMT00000254692.2	118	0.83	1	C	NM_012385		28549435	28549435	-1	no_errors	ENST00000324873	ensembl	human	known	69_37n	missense	25	50.00	26	SNP	0.112	T
NYNRIN	57523	genome.wustl.edu	37	14	24877309	24877309	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr14:24877309C>G	ENST00000382554.3	+	3	751	c.433C>G	c.(433-435)Cct>Gct	p.P145A		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	145					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GCGCTGGGGCCCTGCCCCTCT	0.687																																						dbGAP											0													27.0	32.0	31.0					14																	24877309		1970	4148	6118	-	-	-	SO:0001583	missense	0			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.433C>G	14.37:g.24877309C>G	ENSP00000371994:p.Pro145Ala		Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.P145A	ENST00000382554.3	37	c.433	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726178	0.48833	.	.	ENSG00000205978	ENST00000382554	T	0.09630	2.96	4.93	2.04	0.26737	.	0.348813	0.20520	N	0.090708	T	0.04861	0.0131	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.32402	-0.9908	10	0.72032	D	0.01	.	4.4728	0.11720	0.0:0.5648:0.1683:0.2668	.	145	Q9P2P1	NYNRI_HUMAN	A	145	ENSP00000371994:P145A	ENSP00000371994:P145A	P	+	1	0	NYNRIN	23947149	0.949000	0.32298	1.000000	0.80357	0.980000	0.70556	1.988000	0.40697	0.657000	0.30906	0.563000	0.77884	CCT	NYNRIN	-	NULL	ENSG00000205978		0.687	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	52	0.00	0	C			24877309	24877309	+1	no_errors	ENST00000382554	ensembl	human	known	69_37n	missense	12	60.00	18	SNP	0.137	G
OR13J1	392309	genome.wustl.edu	37	9	35870175	35870175	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr9:35870175G>C	ENST00000377981.2	-	1	286	c.224C>G	c.(223-225)cCc>cGc	p.P75R		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			CACAAAGGTGGGCGTGTAGCA	0.577																																						dbGAP											0													127.0	116.0	120.0					9																	35870175		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.224C>G	9.37:g.35870175G>C	ENSP00000367219:p.Pro75Arg		B2RN66|Q6IF20|Q96R40	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P75R	ENST00000377981.2	37	c.224	CCDS35011.1	9	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945557	0.34377	.	.	ENSG00000168828	ENST00000377981	T	0.00392	7.58	4.78	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.118543	0.38548	N	0.001643	T	0.00241	0.0007	N	0.14661	0.345	0.09310	N	0.999991	B	0.09022	0.002	B	0.04013	0.001	T	0.58973	-0.7541	10	0.87932	D	0	.	16.1337	0.81465	0.0:0.0:1.0:0.0	.	75	Q8NGT2	O13J1_HUMAN	R	75	ENSP00000367219:P75R	ENSP00000367219:P75R	P	-	2	0	OR13J1	35860175	0.997000	0.39634	0.700000	0.30305	0.865000	0.49528	7.647000	0.83462	2.937000	0.99478	0.650000	0.86243	CCC	OR13J1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000168828		0.577	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13J1	HGNC	protein_coding	OTTHUMT00000052381.1	141	0.00	0	G			35870175	35870175	-1	no_errors	ENST00000377981	ensembl	human	known	69_37n	missense	61	22.78	18	SNP	0.438	C
OR5B3	441608	genome.wustl.edu	37	11	58170265	58170265	+	Silent	SNP	A	A	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr11:58170265A>G	ENST00000309403.2	-	1	617	c.618T>C	c.(616-618)ttT>ttC	p.F206F		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GGAGAGCTATAAAGATATTGA	0.383																																						dbGAP											0													65.0	64.0	64.0					11																	58170265		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.618T>C	11.37:g.58170265A>G			Q6IEV6	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F206	ENST00000309403.2	37	c.618	CCDS31549.1	11																																																																																			OR5B3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000172769		0.383	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B3	HGNC	protein_coding	OTTHUMT00000394886.1	48	0.00	0	A	NM_001005469		58170265	58170265	-1	no_errors	ENST00000309403	ensembl	human	known	69_37n	silent	47	12.96	7	SNP	0.003	G
P4HA3	283208	genome.wustl.edu	37	11	74000171	74000171	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr11:74000171C>T	ENST00000331597.4	-	5	767	c.722G>A	c.(721-723)gGa>gAa	p.G241E	P4HA3_ENST00000427714.2_Missense_Mutation_p.G241E	NM_182904.3	NP_878907.1	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha polypeptide III	241						endoplasmic reticulum (GO:0005783)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			NS(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(1)	15	Breast(11;2.31e-05)					cgaaacatttcctgcctgtta	0.353																																						dbGAP											0													32.0	34.0	33.0					11																	74000171		2200	4293	6493	-	-	-	SO:0001583	missense	0			AY327887	CCDS8230.1, CCDS73347.1	11q13	2008-12-09	2008-12-09			ENSG00000149380			30135	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(III)"""	608987	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III"""			14500733	Standard	XM_005273924		Approved	C-P4Halpha(III)	uc001ouz.3	Q7Z4N8		ENST00000331597.4:c.722G>A	11.37:g.74000171C>T	ENSP00000332170:p.Gly241Glu		A0AV13|B4DUD3|Q5EBL3|Q5JPA9	Missense_Mutation	SNP	pfam_Pro_4_hyd_alph_N,pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.G241E	ENST00000331597.4	37	c.722	CCDS8230.1	11	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345404	0.61073	.	.	ENSG00000149380	ENST00000331597;ENST00000427714	T;T	0.66460	-0.21;-0.21	4.54	4.54	0.55810	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.81870	0.4914	M	0.86651	2.83	0.53688	D	0.999979	D;D	0.76494	0.999;0.994	D;D	0.66084	0.941;0.94	D	0.84486	0.0608	10	0.87932	D	0	-15.8989	13.1032	0.59233	0.0:1.0:0.0:0.0	.	241;241	B4DUD3;Q7Z4N8	.;P4HA3_HUMAN	E	241	ENSP00000332170:G241E;ENSP00000401749:G241E	ENSP00000332170:G241E	G	-	2	0	P4HA3	73677819	1.000000	0.71417	1.000000	0.80357	0.537000	0.34900	2.826000	0.48104	2.822000	0.97130	0.650000	0.86243	GGA	P4HA3	-	NULL	ENSG00000149380		0.353	P4HA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HA3	HGNC	protein_coding	OTTHUMT00000382988.1	68	0.00	0	C	NM_182904		74000171	74000171	-1	no_errors	ENST00000331597	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	T
PAX2	5076	genome.wustl.edu	37	10	102584408	102584408	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr10:102584408G>A	ENST00000428433.1	+	9	1542	c.992G>A	c.(991-993)cGt>cAt	p.R331H	PAX2_ENST00000370296.2_Missense_Mutation_p.R331H|PAX2_ENST00000361791.3_Missense_Mutation_p.R308H|PAX2_ENST00000556085.1_Missense_Mutation_p.R307H|PAX2_ENST00000355243.3_Missense_Mutation_p.R308H	NM_003987.3|NM_003990.3	NP_003978|NP_003981.2	Q02962	PAX2_HUMAN	paired box 2	331					aging (GO:0007568)|axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cell fate determination (GO:0001709)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucose stimulus (GO:0071333)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|glial cell differentiation (GO:0010001)|inner ear morphogenesis (GO:0042472)|mesenchymal to epithelial transition (GO:0060231)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|mesonephric duct development (GO:0072177)|mesonephric tubule formation (GO:0072172)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric nephron tubule formation (GO:0072289)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytolysis (GO:0045918)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of programmed cell death (GO:0043069)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|neural tube closure (GO:0001843)|optic chiasma development (GO:0061360)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|optic nerve development (GO:0021554)|optic nerve morphogenesis (GO:0021631)|optic nerve structural organization (GO:0021633)|pancreas development (GO:0031016)|paramesonephric duct development (GO:0061205)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of optic nerve formation (GO:2000597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|protein kinase B signaling (GO:0043491)|reactive oxygen species metabolic process (GO:0072593)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of metanephros size (GO:0035566)|response to nutrient levels (GO:0031667)|retinal pigment epithelium development (GO:0003406)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|ureter development (GO:0072189)|ureter maturation (GO:0035799)|ureter morphogenesis (GO:0072197)|urogenital system development (GO:0001655)|vestibulocochlear nerve formation (GO:0021650)|visual perception (GO:0007601)	centriolar satellite (GO:0034451)|lysosome (GO:0005764)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|superoxide-generating NADPH oxidase activity (GO:0016175)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		TTTCCAGGTCGTGACATGGCG	0.617																																						dbGAP											0													116.0	111.0	113.0					10																	102584408		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7499.1, CCDS41561.1	10q24.31	2011-06-20	2007-07-12		ENSG00000075891	ENSG00000075891		"""Paired boxes"", ""Homeoboxes / PRD class"""	8616	protein-coding gene	gene with protein product		167409	"""paired box gene 2"""			8431641, 7981748	Standard	NM_003990		Approved		uc001krk.4	Q02962	OTTHUMG00000018913	ENST00000428433.1:c.992G>A	10.37:g.102584408G>A	ENSP00000396259:p.Arg331His		Q15105|Q15110|Q15837|Q5SZP2|Q5SZP3	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Pax2_C,superfamily_Homeodomain-like,smart_Paired_dom,prints_Paired_dom,pfscan_Paired_dom	p.R331H	ENST00000428433.1	37	c.992	CCDS53569.1	10	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984076	0.74474	.	.	ENSG00000075891	ENST00000370294;ENST00000370296;ENST00000428433;ENST00000361791;ENST00000355243;ENST00000556085	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	4.06	4.06	0.47325	.	0.378355	0.26457	N	0.024277	T	0.66567	0.2802	M	0.76002	2.32	0.53005	D	0.99996	D;D;D;D;D;D	0.89917	0.999;1.0;0.997;0.996;1.0;0.998	D;D;D;P;D;D	0.72338	0.961;0.944;0.909;0.789;0.977;0.909	T	0.66842	-0.5821	10	0.32370	T	0.25	.	15.6011	0.76626	0.0:0.0:1.0:0.0	.	307;331;308;304;331;308	G3V5U4;Q02962-2;Q02962-3;Q6YFJ8;Q02962;Q02962-4	.;.;.;.;PAX2_HUMAN;.	H	223;331;331;308;308;307	ENSP00000359319:R331H;ENSP00000396259:R331H;ENSP00000355069:R308H;ENSP00000347385:R308H;ENSP00000452527:R307H	ENSP00000347385:R308H	R	+	2	0	PAX2	102574398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	1.976000	0.57569	0.561000	0.74099	CGT	PAX2	-	pfam_Pax2_C	ENSG00000075891		0.617	PAX2-202	KNOWN	basic|CCDS	protein_coding	PAX2	HGNC	protein_coding		78	0.00	0	G			102584408	102584408	+1	no_errors	ENST00000370296	ensembl	human	known	69_37n	missense	7	75.86	22	SNP	1.000	A
PCDHA12	56137	genome.wustl.edu	37	5	140256083	140256083	+	Silent	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr5:140256083C>T	ENST00000398631.2	+	1	1026	c.1026C>T	c.(1024-1026)gaC>gaT	p.D342D	PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	342	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGTTCTGGACGTGAATGACA	0.478																																					Pancreas(113;759 1672 13322 24104 50104)	dbGAP											0													83.0	86.0	85.0					5																	140256083		2200	4298	6498	-	-	-	SO:0001819	synonymous_variant	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1026C>T	5.37:g.140256083C>T			O75278|Q2M1N8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D342	ENST00000398631.2	37	c.1026	CCDS47285.1	5																																																																																			PCDHA12	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000251664		0.478	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	56	0.00	0	C	NM_018903		140256083	140256083	+1	no_errors	ENST00000398631	ensembl	human	known	69_37n	silent	15	31.82	7	SNP	0.865	T
PDE4B	5142	genome.wustl.edu	37	1	66827453	66827453	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:66827453delG	ENST00000329654.4	+	10	1184	c.997delG	c.(997-999)gaafs	p.E333fs	PDE4B_ENST00000423207.2_Frame_Shift_Del_p.E318fs|PDE4B_ENST00000371049.3_Frame_Shift_Del_p.E333fs|PDE4B_ENST00000371045.5_Frame_Shift_Del_p.E161fs|PDE4B_ENST00000480109.2_Frame_Shift_Del_p.E100fs	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	333					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	AGTCAACACTGAAAATGAAGA	0.418																																						dbGAP											0													130.0	109.0	116.0					1																	66827453		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.997delG	1.37:g.66827453delG	ENSP00000332116:p.Glu333fs		A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Frame_Shift_Del	DEL	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.E333fs	ENST00000329654.4	37	c.997	CCDS632.1	1																																																																																			PDE4B	-	NULL	ENSG00000184588		0.418	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	104	0.00	0	G	NM_002600		66827453	66827453	+1	no_errors	ENST00000329654	ensembl	human	known	69_37n	frame_shift_del	9	64.10	25	DEL	1.000	-
PIGZ	80235	genome.wustl.edu	37	3	196675280	196675280	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr3:196675280G>C	ENST00000412723.1	-	3	634	c.488C>G	c.(487-489)tCt>tGt	p.S163C	PIGZ_ENST00000443835.1_Intron	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	163					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)	p.S163F(1)		breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		GTAGGAACCAGACAGCAGGGC	0.617																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											105.0	83.0	91.0					3																	196675280		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.488C>G	3.37:g.196675280G>C	ENSP00000413405:p.Ser163Cys		Q9H9G6	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.S163C	ENST00000412723.1	37	c.488	CCDS3324.1	3	.	.	.	.	.	.	.	.	.	.	G	18.14	3.557905	0.65425	.	.	ENSG00000119227	ENST00000412723	T	0.62788	-0.0	5.26	4.39	0.52855	.	0.868141	0.09837	N	0.749342	T	0.75671	0.3881	M	0.80422	2.495	0.80722	D	1	D	0.62365	0.991	P	0.54499	0.754	T	0.73560	-0.3944	10	0.54805	T	0.06	-5.0589	13.3967	0.60858	0.0762:0.0:0.9238:0.0	.	163	Q86VD9	PIGZ_HUMAN	C	163	ENSP00000413405:S163C	ENSP00000413405:S163C	S	-	2	0	PIGZ	198159677	1.000000	0.71417	0.604000	0.28916	0.930000	0.56654	6.358000	0.73055	1.392000	0.46585	0.543000	0.68304	TCT	PIGZ	-	pfam_GPI_mannosylTrfase	ENSG00000119227		0.617	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGZ	HGNC	protein_coding	OTTHUMT00000340486.2	69	0.00	0	G	NM_025163		196675280	196675280	-1	no_errors	ENST00000412723	ensembl	human	known	69_37n	missense	20	47.37	18	SNP	0.672	C
PIK3R3	8503	genome.wustl.edu	37	1	46511674	46511674	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:46511674G>A	ENST00000262741.5	-	9	1792	c.1103C>T	c.(1102-1104)gCa>gTa	p.A368V	RP4-533D7.4_ENST00000450004.1_RNA|PIK3R3_ENST00000354242.4_Missense_Mutation_p.A309V|PIK3R3_ENST00000540385.1_Missense_Mutation_p.A414V|PIK3R3_ENST00000423209.1_Missense_Mutation_p.A309V|PIK3R3_ENST00000372006.1_Missense_Mutation_p.A368V|PIK3R3_ENST00000488808.1_5'UTR|PIK3R3_ENST00000340332.6_Missense_Mutation_p.A273V|PIK3R3_ENST00000420542.1_Missense_Mutation_p.A368V	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	368	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	CAAGTCCTCTGCTTGTACTCG	0.393																																						dbGAP											0													160.0	151.0	154.0					1																	46511674		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.1103C>T	1.37:g.46511674G>A	ENSP00000262741:p.Ala368Val		B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_PI3kinase_P85,prints_SH2	p.A414V	ENST00000262741.5	37	c.1241	CCDS529.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.865729	0.97043	.	.	ENSG00000117461	ENST00000372006;ENST00000262741;ENST00000420542;ENST00000354242;ENST00000340332;ENST00000540385;ENST00000423209	D;D;D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9	6.08	6.08	0.98989	SH2 motif (4);	0.047393	0.85682	D	0.000000	D	0.96420	0.8832	M	0.80746	2.51	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.988;0.999	P;D;P;D	0.76575	0.851;0.988;0.702;0.952	D	0.95740	0.8782	10	0.59425	D	0.04	-1.1859	20.6634	0.99662	0.0:0.0:1.0:0.0	.	414;401;309;368	F6TDL0;Q7Z3W2;Q92569-2;Q92569	.;.;.;P55G_HUMAN	V	368;368;368;309;273;414;309	ENSP00000361075:A368V;ENSP00000262741:A368V;ENSP00000412546:A368V;ENSP00000346188:A309V;ENSP00000342484:A273V;ENSP00000439913:A414V;ENSP00000391431:A309V	ENSP00000262741:A368V	A	-	2	0	PIK3R3	46284261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.894000	0.99253	0.655000	0.94253	GCA	PIK3R3	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_PI3kinase_P85	ENSG00000117461		0.393	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R3	HGNC	protein_coding	OTTHUMT00000022171.1	174	0.00	0	G	NM_003629		46511674	46511674	-1	no_errors	ENST00000540385	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	1.000	A
PLEKHA6	22874	genome.wustl.edu	37	1	204198106	204198106	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:204198106delC	ENST00000272203.3	-	19	3026	c.2710delG	c.(2710-2712)gagfs	p.E904fs	PLEKHA6_ENST00000414478.1_Frame_Shift_Del_p.E924fs	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	904										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GGCTCTAGCTCCATTTTGCGA	0.602																																						dbGAP											0													109.0	106.0	107.0					1																	204198106		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2710delG	1.37:g.204198106delC	ENSP00000272203:p.Glu904fs		A7MD51|Q5VTI6	Frame_Shift_Del	DEL	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E904fs	ENST00000272203.3	37	c.2710	CCDS1444.1	1																																																																																			PLEKHA6	-	NULL	ENSG00000143850		0.602	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	90	0.00	0	C	NM_014935		204198106	204198106	-1	no_errors	ENST00000272203	ensembl	human	known	69_37n	frame_shift_del	57	12.31	8	DEL	1.000	-
PLEKHA6	22874	genome.wustl.edu	37	1	204230534	204230534	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:204230534T>A	ENST00000272203.3	-	7	740	c.424A>T	c.(424-426)Agc>Tgc	p.S142C	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.S162C|PLEKHA6_ENST00000485632.1_5'UTR	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	142	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TCCTCGGGGCTCTCGGCACTG	0.657																																						dbGAP											0													48.0	47.0	48.0					1																	204230534		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.424A>T	1.37:g.204230534T>A	ENSP00000272203:p.Ser142Cys		A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S142C	ENST00000272203.3	37	c.424	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.441348	0.83993	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.19806	2.12;2.12	5.56	4.41	0.53225	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.183824	0.64402	D	0.000019	T	0.44222	0.1283	M	0.85859	2.78	0.38673	D	0.952362	D	0.55172	0.97	P	0.57911	0.829	T	0.53802	-0.8387	10	0.87932	D	0	-21.0179	11.3355	0.49500	0.0:0.0728:0.0:0.9272	.	142	Q9Y2H5	PKHA6_HUMAN	C	142;162	ENSP00000272203:S142C;ENSP00000402046:S162C	ENSP00000272203:S142C	S	-	1	0	PLEKHA6	202497157	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.611000	0.67674	0.899000	0.36444	0.533000	0.62120	AGC	PLEKHA6	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000143850		0.657	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	58	0.00	0	T	NM_014935		204230534	204230534	-1	no_errors	ENST00000272203	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	A
PNPLA1	285848	genome.wustl.edu	37	6	36262089	36262089	+	Silent	SNP	C	C	T	rs187453727	byFrequency	TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:36262089C>T	ENST00000394571.2	+	4	627	c.627C>T	c.(625-627)caC>caT	p.H209H	PNPLA1_ENST00000312917.5_Silent_p.H123H|PNPLA1_ENST00000388715.3_Silent_p.H114H	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	209					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						CCATCTTCCACGACTTCCGCA	0.622													C|||	7	0.00139776	0.0	0.0	5008	,	,		18421	0.0069		0.0	False		,,,				2504	0.0					dbGAP											0													103.0	83.0	90.0					6																	36262089		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.627C>T	6.37:g.36262089C>T			A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Silent	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.H210	ENST00000394571.2	37	c.630	CCDS54997.1	6																																																																																			PNPLA1	-	superfamily_Acyl_Trfase/lysoPLipase	ENSG00000180316		0.622	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA1	HGNC	protein_coding		47	0.00	0	C	NM_173676		36262089	36262089	+1	no_errors	ENST00000457797	ensembl	human	known	69_37n	silent	13	46.15	12	SNP	0.766	T
PPP1R12B	4660	genome.wustl.edu	37	1	202418224	202418224	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr1:202418224delC	ENST00000608999.1	+	13	1928	c.1775delC	c.(1774-1776)gccfs	p.A592fs	PPP1R12B_ENST00000336894.4_Frame_Shift_Del_p.A592fs	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	592					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			CCTAGCACTGCCAATGGGGTT	0.498																																						dbGAP											0													109.0	89.0	96.0					1																	202418224		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1775delC	1.37:g.202418224delC	ENSP00000476755:p.Ala592fs		A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_12A/B/C_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.N593fs	ENST00000608999.1	37	c.1775	CCDS1426.1	1																																																																																			PPP1R12B	-	pirsf_Pase-1_reg_su_12A/B/C_euk	ENSG00000077157		0.498	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	HGNC	protein_coding	OTTHUMT00000099166.3	94	0.00	0	C	NM_032105		202418224	202418224	+1	no_errors	ENST00000336894	ensembl	human	known	69_37n	frame_shift_del	54	31.25	25	DEL	1.000	-
PRKDC	5591	genome.wustl.edu	37	8	48839765	48839765	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr8:48839765G>T	ENST00000314191.2	-	21	2464	c.2408C>A	c.(2407-2409)tCa>tAa	p.S803*	PRKDC_ENST00000338368.3_Nonsense_Mutation_p.S803*|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	803					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TGACAAGGCTGAAGTCTTCAG	0.358								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											0													87.0	78.0	81.0					8																	48839765		1870	4107	5977	-	-	-	SO:0001587	stop_gained	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.2408C>A	8.37:g.48839765G>T	ENSP00000313420:p.Ser803*		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Nonsense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S803*	ENST00000314191.2	37	c.2408		8	.	.	.	.	.	.	.	.	.	.	G	37	6.161840	0.97338	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	5.83	5.83	0.93111	.	0.425684	0.23479	N	0.047735	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3356	0.60516	0.072:0.0:0.928:0.0	.	.	.	.	X	803	.	ENSP00000313420:S803X	S	-	2	0	PRKDC	49002318	1.000000	0.71417	0.992000	0.48379	0.523000	0.34469	5.407000	0.66363	2.757000	0.94681	0.563000	0.77884	TCA	PRKDC	-	superfamily_ARM-type_fold	ENSG00000253729		0.358	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		142	0.00	0	G	NM_001081640		48839765	48839765	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	nonsense	35	53.33	40	SNP	0.093	T
PTBP1	5725	genome.wustl.edu	37	19	808581	808581	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr19:808581A>G	ENST00000349038.4	+	12	1277	c.1204A>G	c.(1204-1206)Aag>Gag	p.K402E	PTBP1_ENST00000356948.6_Missense_Mutation_p.K428E|PTBP1_ENST00000350092.4_Missense_Mutation_p.K68E|PTBP1_ENST00000394601.4_Missense_Mutation_p.K421E	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	402	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGCACGGGAAGCCCATCCG	0.697																																						dbGAP											0													35.0	27.0	30.0					19																	808581		2196	4298	6494	-	-	-	SO:0001583	missense	0			X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.1204A>G	19.37:g.808581A>G	ENSP00000014112:p.Lys402Glu		Q9BUQ0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.K428E	ENST00000349038.4	37	c.1282	CCDS32859.1	19	.	.	.	.	.	.	.	.	.	.	A	21.2	4.113870	0.77210	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038;ENST00000350092	T;T;T;T	0.51325	0.71;3.24;1.06;1.34	5.14	5.14	0.70334	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.052581	0.85682	D	0.000000	T	0.72692	0.3492	M	0.86953	2.85	0.80722	D	1	B;P;P;P	0.44690	0.377;0.753;0.809;0.841	B;D;D;D	0.68483	0.372;0.916;0.913;0.958	T	0.77542	-0.2549	10	0.87932	D	0	-42.34	14.1336	0.65270	1.0:0.0:0.0:0.0	.	68;402;421;428	A6NLN1;P26599;P26599-2;Q9BUQ0	.;PTBP1_HUMAN;.;.	E	428;421;402;68	ENSP00000349428:K428E;ENSP00000408096:K421E;ENSP00000014112:K402E;ENSP00000342332:K68E	ENSP00000014112:K402E	K	+	1	0	PTBP1	759581	1.000000	0.71417	0.991000	0.47740	0.875000	0.50365	5.930000	0.70104	1.931000	0.55961	0.455000	0.32223	AAG	PTBP1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	ENSG00000011304		0.697	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTBP1	HGNC	protein_coding	OTTHUMT00000457605.1	14	0.00	0	A			808581	808581	+1	no_errors	ENST00000356948	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	1.000	G
PTCHD4	442213	genome.wustl.edu	37	6	47846834	47846835	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:47846834_47846835insT	ENST00000339488.4	-	3	1778_1779	c.1745_1746insA	c.(1744-1746)aagfs	p.K582fs		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	582						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										GGAATTCTGGCTTTTTTAAAAA	0.441																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1746dupA	6.37:g.47846840_47846840dupT	ENSP00000341914:p.Lys582fs		B0QZ29|B4DRK3|Q5T884	Frame_Shift_Ins	INS	pfam_Patched,pfscan_SSD	p.P583fs	ENST00000339488.4	37	c.1746_1745	CCDS34473.2	6																																																																																			PTCHD4	-	pfam_Patched	ENSG00000244694		0.441	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	79	0.00	0	-	NM_001013732		47846834	47846835	-1	no_errors	ENST00000339488	ensembl	human	known	69_37n	frame_shift_ins	34	27.66	13	INS	1.000:1.000	T
PUM2	23369	genome.wustl.edu	37	2	20512037	20512037	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr2:20512037G>A	ENST00000361078.2	-	3	330	c.308C>T	c.(307-309)cCt>cTt	p.P103L	PUM2_ENST00000403432.1_Missense_Mutation_p.P103L|PUM2_ENST00000420234.1_5'UTR|PUM2_ENST00000319801.5_Missense_Mutation_p.P103L|PUM2_ENST00000338086.5_Missense_Mutation_p.P103L|PUM2_ENST00000536417.1_Missense_Mutation_p.P47L			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	103	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTATCAGCAGGAGAAGAACT	0.348																																						dbGAP											0													90.0	86.0	87.0					2																	20512037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.308C>T	2.37:g.20512037G>A	ENSP00000354370:p.Pro103Leu		B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.P103L	ENST00000361078.2	37	c.308		2	.	.	.	.	.	.	.	.	.	.	G	31	5.083945	0.94100	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000403432;ENST00000536417;ENST00000442400	T;T;T;T;T	0.74526	-0.85;-0.66;-0.53;-0.85;-0.59	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.87204	0.6119	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.996;1.0	D	0.87023	0.2130	10	0.87932	D	0	-12.2403	20.6593	0.99626	0.0:0.0:1.0:0.0	.	47;103;103	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	L	103;103;103;103;47;103	ENSP00000338173:P103L;ENSP00000354370:P103L;ENSP00000326746:P103L;ENSP00000385992:P103L;ENSP00000440093:P47L	ENSP00000326746:P103L	P	-	2	0	PUM2	20375518	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	CCT	PUM2	-	NULL	ENSG00000055917		0.348	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	PUM2	HGNC	protein_coding		91	0.00	0	G	NM_015317		20512037	20512037	-1	no_errors	ENST00000361078	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	A
QARS	5859	genome.wustl.edu	37	3	49136104	49136104	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr3:49136104G>A	ENST00000306125.6	-	20	2222	c.1885C>T	c.(1885-1887)Cgc>Tgc	p.R629C	QARS_ENST00000414533.1_Missense_Mutation_p.R618C|QARS_ENST00000470225.1_5'Flank			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	629					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CAAGCCAGGCGCTTAAATCCT	0.582																																						dbGAP											0													16.0	18.0	17.0					3																	49136104		2202	4300	6502	-	-	-	SO:0001583	missense	0			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1885C>T	3.37:g.49136104G>A	ENSP00000307567:p.Arg629Cys		B4DWJ2	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_Gln-tRNA-synth_Ib_RNA-bd_N,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_Gln-tRNA-synth_Ib_RNA-bd_2,superfamily_Ribosomal_L25/Gln-tRNA_synth,prints_Glu/Gln-tRNA-synth_Ib,tigrfam_Gln-tRNA-synth_Ib	p.R629C	ENST00000306125.6	37	c.1885	CCDS2788.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.161811	0.94727	.	.	ENSG00000172053	ENST00000453392;ENST00000306125;ENST00000414533	T;T	0.35605	1.3;1.31	5.74	5.74	0.90152	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.000000	0.85682	D	0.000000	T	0.77765	0.4179	H	0.98996	4.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86615	0.1875	10	0.72032	D	0.01	-19.5979	19.5381	0.95262	0.0:0.0:1.0:0.0	.	618;629	B4DWJ2;P47897	.;SYQ_HUMAN	C	149;629;618	ENSP00000307567:R629C;ENSP00000390015:R618C	ENSP00000307567:R629C	R	-	1	0	QARS	49111108	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.270000	0.95690	2.710000	0.92621	0.561000	0.74099	CGC	QARS	-	pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,tigrfam_Gln-tRNA-synth_Ib	ENSG00000172053		0.582	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QARS	HGNC	protein_coding	OTTHUMT00000345689.2	35	0.00	0	G	NM_005051		49136104	49136104	-1	no_errors	ENST00000306125	ensembl	human	known	69_37n	missense	3	76.92	10	SNP	1.000	A
RASSF2	9770	genome.wustl.edu	37	20	4773210	4773210	+	Silent	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr20:4773210C>T	ENST00000379400.3	-	6	546	c.351G>A	c.(349-351)gaG>gaA	p.E117E	RASSF2_ENST00000478553.1_5'UTR|RASSF2_ENST00000379376.2_Silent_p.E117E	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	117					bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						TCTGGTCACCCTCCGGCGGGG	0.547																																					Melanoma(158;1891 3343 50738)	dbGAP											0													71.0	64.0	66.0					20																	4773210		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.351G>A	20.37:g.4773210C>T			A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Silent	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH	p.E117	ENST00000379400.3	37	c.351	CCDS13083.1	20																																																																																			RASSF2	-	NULL	ENSG00000101265		0.547	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	HGNC	protein_coding	OTTHUMT00000077828.1	80	0.00	0	C	NM_014737		4773210	4773210	-1	no_errors	ENST00000379376	ensembl	human	known	69_37n	silent	47	18.97	11	SNP	0.009	T
RBM12	10137	genome.wustl.edu	37	20	34241980	34241980	+	Nonsense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr20:34241980G>C	ENST00000374114.3	-	3	1528	c.1265C>G	c.(1264-1266)tCa>tGa	p.S422*	CPNE1_ENST00000352393.4_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397446.1_Intron|CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000317619.3_Intron|RBM12_ENST00000359646.1_Nonsense_Mutation_p.S422*|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000397443.1_Intron|RBM12_ENST00000374104.3_Nonsense_Mutation_p.S422*|CPNE1_ENST00000317677.5_5'Flank	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	422						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			TGGTGATCTTGACCTTGATCT	0.408											OREG0004044	type=REGULATORY REGION|Gene=CPNE1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													86.0	91.0	89.0					20																	34241980		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.1265C>G	20.37:g.34241980G>C	ENSP00000363228:p.Ser422*	846	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S422*	ENST00000374114.3	37	c.1265	CCDS13261.1	20	.	.	.	.	.	.	.	.	.	.	G	37	5.993584	0.97184	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	.	.	.	4.77	3.82	0.43975	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.213	15.19	0.73035	0.0:0.1413:0.8587:0.0	.	.	.	.	X	422;422;422;221	.	ENSP00000339879:S221X	S	-	2	0	RBM12	33705394	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.222000	0.95196	1.232000	0.43678	0.549000	0.68633	TCA	RBM12	-	NULL	ENSG00000244462		0.408	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12	HGNC	protein_coding	OTTHUMT00000078894.1	103	0.00	0	G	NM_006047		34241980	34241980	-1	no_errors	ENST00000359646	ensembl	human	known	69_37n	nonsense	25	50.00	26	SNP	1.000	C
REV3L	5980	genome.wustl.edu	37	6	111694984	111694984	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:111694984G>C	ENST00000358835.3	-	14	5028	c.4574C>G	c.(4573-4575)tCt>tGt	p.S1525C	REV3L_ENST00000435970.1_Missense_Mutation_p.S1447C|REV3L_ENST00000368805.1_Missense_Mutation_p.S1525C|REV3L_ENST00000368802.3_Missense_Mutation_p.S1525C			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1525					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TGCCAGTCCAGACTGTCCTTC	0.373								DNA polymerases (catalytic subunits)																														dbGAP											0													173.0	175.0	175.0					6																	111694984		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4574C>G	6.37:g.111694984G>C	ENSP00000351697:p.Ser1525Cys		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.S1525C	ENST00000358835.3	37	c.4574	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430697	0.62844	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02763	4.26;4.26;4.26;4.17	6.04	6.04	0.98038	Ribonuclease H-like (1);	0.000000	0.64402	D	0.000001	T	0.10465	0.0256	M	0.61703	1.905	0.50813	D	0.999895	D	0.89917	1.0	D	0.85130	0.997	T	0.01520	-1.1334	10	0.87932	D	0	-6.2341	20.5948	0.99439	0.0:0.0:1.0:0.0	.	1525	O60673	DPOLZ_HUMAN	C	1525;1525;1525;1447	ENSP00000357792:S1525C;ENSP00000357795:S1525C;ENSP00000351697:S1525C;ENSP00000402003:S1447C	ENSP00000351697:S1525C	S	-	2	0	REV3L	111801677	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.412000	0.90232	2.873000	0.98535	0.563000	0.77884	TCT	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.373	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	176	0.00	0	G	NM_002912		111694984	111694984	-1	no_errors	ENST00000358835	ensembl	human	known	69_37n	missense	59	30.59	26	SNP	1.000	C
RFX6	222546	genome.wustl.edu	37	6	117249959	117249959	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:117249959C>G	ENST00000332958.2	+	18	2452	c.2436C>G	c.(2434-2436)caC>caG	p.H812Q		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	812					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CAGAGTCTCACAGGCTCGGAT	0.418																																						dbGAP											0													134.0	122.0	126.0					6																	117249959		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.2436C>G	6.37:g.117249959C>G	ENSP00000332208:p.His812Gln		Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.H812Q	ENST00000332958.2	37	c.2436	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	C	8.230	0.804511	0.16467	.	.	ENSG00000185002	ENST00000332958	T	0.55234	0.53	5.2	-5.61	0.02489	.	0.178593	0.50627	N	0.000105	T	0.13114	0.0318	N	0.19112	0.55	0.36532	D	0.870816	B	0.24258	0.1	B	0.18263	0.021	T	0.10428	-1.0630	10	0.18276	T	0.48	-17.7942	12.9571	0.58434	0.0:0.7335:0.1002:0.1662	.	812	Q8HWS3	RFX6_HUMAN	Q	812	ENSP00000332208:H812Q	ENSP00000332208:H812Q	H	+	3	2	RFX6	117356652	0.571000	0.26659	0.779000	0.31741	0.283000	0.27025	-0.264000	0.08658	-1.185000	0.02716	-0.940000	0.02684	CAC	RFX6	-	NULL	ENSG00000185002		0.418	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	126	0.00	0	C	NM_173560		117249959	117249959	+1	no_errors	ENST00000332958	ensembl	human	known	69_37n	missense	58	27.50	22	SNP	0.945	G
RNF208	727800	genome.wustl.edu	37	9	140114992	140114992	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr9:140114992C>T	ENST00000392827.1	-	2	841	c.673G>A	c.(673-675)Ggt>Agt	p.G225S	RNF208_ENST00000391553.1_Missense_Mutation_p.G225S			Q9H0X6	RN208_HUMAN	ring finger protein 208	225					protein autoubiquitination (GO:0051865)		ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CCCCACTGACCCCCGGATGGG	0.697																																						dbGAP											0													16.0	18.0	18.0					9																	140114992		2177	4278	6455	-	-	-	SO:0001583	missense	0			AF416715	CCDS7037.2	9q34.3	2007-01-19				ENSG00000212864		"""RING-type (C3HC4) zinc fingers"""	25420	protein-coding gene	gene with protein product						11230166	Standard	NM_031297		Approved	DKFZP761H1710	uc004clz.2	Q9H0X6		ENST00000392827.1:c.673G>A	9.37:g.140114992C>T	ENSP00000376572:p.Gly225Ser		A2BFA0	Missense_Mutation	SNP	pfscan_Znf_RING	p.G225S	ENST00000392827.1	37	c.673	CCDS7037.2	9	.	.	.	.	.	.	.	.	.	.	C	6.356	0.433726	0.12045	.	.	ENSG00000212864	ENST00000392827;ENST00000391553	T;T	0.29655	1.56;1.56	4.22	4.22	0.49857	.	0.072561	0.53938	D	0.000055	T	0.17619	0.0423	N	0.17082	0.46	0.30356	N	0.784332	P	0.40476	0.718	B	0.38616	0.277	T	0.04825	-1.0924	10	0.08179	T	0.78	-4.3363	14.102	0.65062	0.0:1.0:0.0:0.0	.	225	Q9H0X6	RN208_HUMAN	S	225	ENSP00000376572:G225S;ENSP00000375397:G225S	ENSP00000375397:G225S	G	-	1	0	RNF208	139234813	0.956000	0.32656	0.899000	0.35326	0.258000	0.26162	2.829000	0.48128	2.169000	0.68431	0.491000	0.48974	GGT	RNF208	-	NULL	ENSG00000212864		0.697	RNF208-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF208	HGNC	protein_coding	OTTHUMT00000254714.1	40	0.00	0	C	NM_031297		140114992	140114992	-1	no_errors	ENST00000391553	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.970	T
RPS6KA2	6196	genome.wustl.edu	37	6	166831734	166831734	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:166831734G>T	ENST00000265678.4	-	19	2140	c.1917C>A	c.(1915-1917)gaC>gaA	p.D639E	RPS6KA2_ENST00000481261.2_Missense_Mutation_p.D550E|RPS6KA2_ENST00000509742.1_5'UTR|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.D664E|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.D550E|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.D647E	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	639	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CAGATATCGAGTCCCAGTTTC	0.483																																						dbGAP											0													98.0	92.0	94.0					6																	166831734		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.1917C>A	6.37:g.166831734G>T	ENSP00000265678:p.Asp639Glu		B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D664E	ENST00000265678.4	37	c.1992	CCDS5294.1	6	.	.	.	.	.	.	.	.	.	.	g	10.69	1.419774	0.25552	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	4.41	-0.803	0.10886	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.113979	0.56097	D	0.000022	T	0.19046	0.0457	N	0.13198	0.31	0.80722	D	1	B;B;B	0.14438	0.01;0.004;0.002	B;B;B	0.21151	0.033;0.012;0.007	T	0.04281	-1.0963	10	0.18276	T	0.48	.	8.1036	0.30872	0.6426:0.0:0.3574:0.0	.	664;647;639	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	E	639;664;647;550;550	ENSP00000265678:D639E;ENSP00000422435:D664E;ENSP00000427015:D647E;ENSP00000422484:D550E;ENSP00000386050:D550E	ENSP00000265678:D639E	D	-	3	2	RPS6KA2	166751724	0.999000	0.42202	0.992000	0.48379	0.842000	0.47809	0.547000	0.23299	-0.050000	0.13356	0.581000	0.79447	GAC	RPS6KA2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000071242		0.483	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA2	HGNC	protein_coding	OTTHUMT00000043075.3	58	0.00	0	G	NM_021135		166831734	166831734	-1	no_errors	ENST00000510118	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	T
RYR3	6263	genome.wustl.edu	37	15	34064213	34064213	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr15:34064213A>T	ENST00000389232.4	+	63	8979	c.8909A>T	c.(8908-8910)aAc>aTc	p.N2970I	RYR3_ENST00000415757.3_Missense_Mutation_p.N2970I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2970					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACTTCAGAAAACCTGAAACTT	0.478																																						dbGAP											0													79.0	74.0	76.0					15																	34064213		1868	4104	5972	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8909A>T	15.37:g.34064213A>T	ENSP00000373884:p.Asn2970Ile		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.N2970I	ENST00000389232.4	37	c.8909	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	A	13.82	2.350267	0.41599	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.97161	-4.27;-4.27	5.65	5.65	0.86999	.	0.305888	0.34652	N	0.003788	D	0.96188	0.8757	M	0.68317	2.08	0.44447	D	0.997374	B;P	0.37548	0.418;0.599	B;B	0.38156	0.122;0.266	D	0.96516	0.9382	10	0.87932	D	0	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	2970;2970	Q15413-2;Q15413	.;RYR3_HUMAN	I	2970	ENSP00000373884:N2970I;ENSP00000399610:N2970I	ENSP00000354735:N2970I	N	+	2	0	RYR3	31851505	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	4.402000	0.59722	2.371000	0.80710	0.533000	0.62120	AAC	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.478	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	91	0.00	0	A			34064213	34064213	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	13	63.16	24	SNP	1.000	T
SAMD12	401474	genome.wustl.edu	37	8	119391733	119391733	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr8:119391733C>G	ENST00000314727.4	-	4	665	c.529G>C	c.(529-531)Gga>Cga	p.G177R	AC023590.1_ENST00000430457.1_Intron|SAMD12_ENST00000409003.4_Intron|SAMD12_ENST00000527515.1_Intron	NM_207506.2	NP_997389.2	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12	177										endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)	9	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			CCTGTCTGTCCTAATAGTAAG	0.373																																						dbGAP											0													107.0	102.0	104.0					8																	119391733		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096777	CCDS6325.1, CCDS47913.1	8q24.12	2013-01-10			ENSG00000177570	ENSG00000177570		"""Sterile alpha motif (SAM) domain containing"""	31750	protein-coding gene	gene with protein product							Standard	NM_207506		Approved	FLJ39458	uc003yom.2	Q8N8I0	OTTHUMG00000059817	ENST00000314727.4:c.529G>C	8.37:g.119391733C>G	ENSP00000314173:p.Gly177Arg		Q0P502	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.G177R	ENST00000314727.4	37	c.529	CCDS6325.1	8	.	.	.	.	.	.	.	.	.	.	C	10.38	1.335334	0.24253	.	.	ENSG00000177570	ENST00000314727	.	.	.	5.56	-4.13	0.03904	.	6.256780	0.00166	N	0.000001	T	0.15652	0.0377	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08229	-1.0732	8	.	.	.	15.4505	2.1682	0.03843	0.35:0.3399:0.2027:0.1074	.	177	Q8N8I0	SAM12_HUMAN	R	177	.	.	G	-	1	0	SAMD12	119460914	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.741000	0.04855	-0.430000	0.07318	-0.425000	0.05940	GGA	SAMD12	-	NULL	ENSG00000177570		0.373	SAMD12-001	KNOWN	basic|CCDS	protein_coding	SAMD12	HGNC	protein_coding	OTTHUMT00000132989.3	154	0.00	0	C	NM_207506		119391733	119391733	-1	no_errors	ENST00000314727	ensembl	human	known	69_37n	missense	79	45.89	67	SNP	0.000	G
SIGLEC9	27180	genome.wustl.edu	37	19	51628890	51628890	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr19:51628890C>A	ENST00000250360.3	+	2	525	c.458C>A	c.(457-459)aCc>aAc	p.T153N	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.T153N	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	153	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		ATCCCAGGCACCCTGGAGTCC	0.637																																						dbGAP											0													105.0	104.0	104.0					19																	51628890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.458C>A	19.37:g.51628890C>A	ENSP00000250360:p.Thr153Asn		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.T153N	ENST00000250360.3	37	c.458	CCDS12825.1	19	.	.	.	.	.	.	.	.	.	.	.	9.075	0.997844	0.19043	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.03468	3.92;3.92	2.58	-1.03	0.10102	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.575070	0.14494	N	0.316172	T	0.12390	0.0301	M	0.87381	2.88	0.09310	N	1	D	0.58970	0.984	P	0.62184	0.899	T	0.09907	-1.0653	10	0.59425	D	0.04	.	2.1564	0.03814	0.2523:0.4356:0.0:0.3121	.	153	Q9Y336	SIGL9_HUMAN	N	153	ENSP00000413861:T153N;ENSP00000250360:T153N	ENSP00000250360:T153N	T	+	2	0	SIGLEC9	56320702	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.502000	0.06390	-0.009000	0.14296	0.514000	0.50259	ACC	SIGLEC9	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000129450		0.637	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	88	0.00	0	C	NM_014441		51628890	51628890	+1	no_errors	ENST00000440804	ensembl	human	known	69_37n	missense	29	32.56	14	SNP	0.000	A
SIX1	6495	genome.wustl.edu	37	14	61113081	61113081	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr14:61113081C>T	ENST00000247182.6	-	2	1047	c.775G>A	c.(775-777)Ggc>Agc	p.G259S	SIX1_ENST00000554986.1_Missense_Mutation_p.G86S	NM_005982.3	NP_005973.1	Q15475	SIX1_HUMAN	SIX homeobox 1	259					aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|branching involved in ureteric bud morphogenesis (GO:0001658)|cochlea morphogenesis (GO:0090103)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial cell differentiation (GO:0030855)|facial nerve morphogenesis (GO:0021610)|generation of neurons (GO:0048699)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesonephric tubule formation (GO:0072172)|metanephric mesenchyme development (GO:0072075)|middle ear morphogenesis (GO:0042474)|myoblast migration (GO:0051451)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|organ induction (GO:0001759)|otic vesicle development (GO:0071599)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|protein localization to nucleus (GO:0034504)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of neuron differentiation (GO:0045664)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.G259S(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0201)		GTCTGCAGGCCGTGACTGGGC	0.622																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											65.0	67.0	66.0					14																	61113081		2203	4300	6503	-	-	-	SO:0001583	missense	0			X91868	CCDS9748.1	14q23.1	2011-06-20	2007-07-13		ENSG00000126778	ENSG00000126778		"""Homeoboxes / SINE class"""	10887	protein-coding gene	gene with protein product		601205	"""sine oculis homeobox (Drosophila) homolog 1"", ""sine oculis homeobox homolog 1 (Drosophila)"", ""deafness, autosomal dominant 23"""	DFNA23		8617500, 15141091	Standard	NM_005982		Approved		uc001xfb.4	Q15475	OTTHUMG00000140334	ENST00000247182.6:c.775G>A	14.37:g.61113081C>T	ENSP00000247182:p.Gly259Ser		Q53Y16|Q96H64	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.G259S	ENST00000247182.6	37	c.775	CCDS9748.1	14	.	.	.	.	.	.	.	.	.	.	C	13.87	2.367411	0.42003	.	.	ENSG00000126778	ENST00000247182;ENST00000555955;ENST00000553535	D;D;D	0.86769	-2.17;-2.08;-2.08	5.08	0.996	0.19844	.	0.262589	0.46758	N	0.000275	T	0.68742	0.3034	N	0.08118	0	0.46609	D	0.999126	B	0.02656	0.0	B	0.01281	0.0	T	0.55817	-0.8081	10	0.08179	T	0.78	-5.7459	10.3571	0.43972	0.0:0.6542:0.0:0.3458	.	259	Q15475	SIX1_HUMAN	S	259;75;75	ENSP00000247182:G259S;ENSP00000450952:G75S;ENSP00000450739:G75S	ENSP00000247182:G259S	G	-	1	0	SIX1	60182834	0.958000	0.32768	0.989000	0.46669	0.936000	0.57629	0.081000	0.14823	0.323000	0.23307	0.655000	0.94253	GGC	SIX1	-	NULL	ENSG00000126778		0.622	SIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX1	HGNC	protein_coding	OTTHUMT00000276951.3	92	0.00	0	C			61113081	61113081	-1	no_errors	ENST00000247182	ensembl	human	known	69_37n	missense	15	59.46	22	SNP	0.994	T
SLC25A39	51629	genome.wustl.edu	37	17	42398003	42398003	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:42398003C>A	ENST00000377095.5	-	9	907	c.788G>T	c.(787-789)gGc>gTc	p.G263V	SLC25A39_ENST00000590194.1_Missense_Mutation_p.G255V|SLC25A39_ENST00000537904.2_Missense_Mutation_p.G240V|SLC25A39_ENST00000225308.8_Missense_Mutation_p.G255V|SLC25A39_ENST00000586016.1_Missense_Mutation_p.G131V	NM_001143780.1	NP_001137252.1	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39	263					heme biosynthetic process (GO:0006783)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCCTGAGATGCCACCAGCCAC	0.602																																						dbGAP											0													96.0	103.0	101.0					17																	42398003		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC096819	CCDS11482.1, CCDS45700.1	17q12	2013-05-22			ENSG00000013306	ENSG00000013306		"""Solute carriers"""	24279	protein-coding gene	gene with protein product		610820				16949250	Standard	NM_001143780		Approved	FLJ22407, CGI-69	uc002ign.2	Q9BZJ4	OTTHUMG00000132628	ENST00000377095.5:c.788G>T	17.37:g.42398003C>A	ENSP00000366299:p.Gly263Val		A8JZZ2|D3DX51|D3DX54|Q4V9M1|Q9P182|Q9UF66|Q9Y379	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.G263V	ENST00000377095.5	37	c.788	CCDS45700.1	17	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019814	0.35606	.	.	ENSG00000013306	ENST00000225308;ENST00000377095;ENST00000537904	T;T;T	0.80304	-1.36;-1.36;-1.36	5.38	4.37	0.52481	Mitochondrial carrier domain (2);	0.250921	0.37761	N	0.001954	T	0.78304	0.4262	L	0.53780	1.695	0.80722	D	1	B;P;B	0.41848	0.014;0.763;0.011	B;B;B	0.43155	0.026;0.41;0.015	T	0.79598	-0.1737	10	0.52906	T	0.07	-15.0848	12.6967	0.57008	0.0:0.6707:0.3293:0.0	.	240;263;255	B4DFG5;Q9BZJ4;Q9BZJ4-2	.;S2539_HUMAN;.	V	255;263;240	ENSP00000225308:G255V;ENSP00000366299:G263V;ENSP00000444540:G240V	ENSP00000225308:G255V	G	-	2	0	SLC25A39	39753529	1.000000	0.71417	1.000000	0.80357	0.292000	0.27327	5.663000	0.68038	2.793000	0.96121	0.655000	0.94253	GGC	SLC25A39	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000013306		0.602	SLC25A39-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A39	HGNC	protein_coding	OTTHUMT00000457745.1	94	0.00	0	C	NM_016016		42398003	42398003	-1	no_errors	ENST00000377095	ensembl	human	known	69_37n	missense	40	24.53	13	SNP	1.000	A
SLC38A4	55089	genome.wustl.edu	37	12	47172298	47172298	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:47172298C>G	ENST00000447411.1	-	10	1185	c.979G>C	c.(979-981)Gta>Cta	p.V327L	SLC38A4_ENST00000266579.4_Missense_Mutation_p.V327L	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	327					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					GAGTTGAATACAAAGTATTTG	0.448																																						dbGAP											0													74.0	69.0	70.0					12																	47172298		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.979G>C	12.37:g.47172298C>G	ENSP00000389843:p.Val327Leu		A8K553	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.V327L	ENST00000447411.1	37	c.979	CCDS8750.1	12	.	.	.	.	.	.	.	.	.	.	C	13.59	2.283288	0.40394	.	.	ENSG00000139209	ENST00000447411;ENST00000266579	T;T	0.02050	4.48;4.48	5.35	2.54	0.30619	.	0.354717	0.29396	N	0.012271	T	0.04227	0.0117	M	0.76328	2.33	0.46954	D	0.999263	B	0.21606	0.058	B	0.33121	0.158	T	0.24404	-1.0161	10	0.11182	T	0.66	-10.2979	10.4104	0.44289	0.0:0.7878:0.0:0.2122	.	327	Q969I6	S38A4_HUMAN	L	327	ENSP00000389843:V327L;ENSP00000266579:V327L	ENSP00000266579:V327L	V	-	1	0	SLC38A4	45458565	1.000000	0.71417	0.928000	0.36995	0.938000	0.57974	2.111000	0.41883	0.761000	0.33130	0.484000	0.47621	GTA	SLC38A4	-	pfam_AA_transpt_TM	ENSG00000139209		0.448	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A4	HGNC	protein_coding	OTTHUMT00000404574.1	53	0.00	0	C			47172298	47172298	-1	no_errors	ENST00000266579	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	0.993	G
SLC39A5	283375	genome.wustl.edu	37	12	56625219	56625219	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr12:56625219C>A	ENST00000266980.4	+	2	454	c.161C>A	c.(160-162)aCt>aAt	p.T54N	SLC39A5_ENST00000454355.2_Missense_Mutation_p.T54N	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	54					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGGACGCTGACTGCAGGGGGC	0.662																																						dbGAP											0													61.0	66.0	65.0					12																	56625219		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.161C>A	12.37:g.56625219C>A	ENSP00000266980:p.Thr54Asn		B2R808|Q8N6Y3	Missense_Mutation	SNP	pfam_ZIP	p.T54N	ENST00000266980.4	37	c.161	CCDS8912.2	12	.	.	.	.	.	.	.	.	.	.	C	15.22	2.767811	0.49574	.	.	ENSG00000139540	ENST00000424625;ENST00000419753;ENST00000454355;ENST00000417965;ENST00000436633;ENST00000266980;ENST00000437277	T;T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75;1.75	4.52	3.56	0.40772	.	0.000000	0.52532	D	0.000068	T	0.29850	0.0746	L	0.41961	1.31	0.43890	D	0.99651	D	0.53151	0.958	P	0.50082	0.63	T	0.02844	-1.1103	10	0.33940	T	0.23	-7.778	14.1267	0.65225	0.0:0.8491:0.1509:0.0	.	54	Q6ZMH5	S39A5_HUMAN	N	54;54;54;54;25;54;54	ENSP00000404155:T54N;ENSP00000402891:T54N;ENSP00000405360:T54N;ENSP00000414868:T54N;ENSP00000391711:T25N;ENSP00000266980:T54N;ENSP00000407399:T54N	ENSP00000266980:T54N	T	+	2	0	SLC39A5	54911486	0.987000	0.35691	0.988000	0.46212	0.774000	0.43823	3.466000	0.53071	2.234000	0.73211	0.561000	0.74099	ACT	SLC39A5	-	NULL	ENSG00000139540		0.662	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A5	HGNC	protein_coding	OTTHUMT00000346834.1	44	0.00	0	C	NM_173596		56625219	56625219	+1	no_errors	ENST00000266980	ensembl	human	known	69_37n	missense	3	75.00	9	SNP	0.985	A
SLC7A6OS	84138	genome.wustl.edu	37	16	68330554	68330554	+	IGR	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr16:68330554T>A	ENST00000263997.6	-	0	4189				SLC7A6_ENST00000219343.6_Missense_Mutation_p.F432I|SLC7A6_ENST00000566454.1_Missense_Mutation_p.F432I	NM_032178.2	NP_115554.2	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite strand						hematopoietic progenitor cell differentiation (GO:0002244)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		CCCCATCGTGTTCTGCATATG	0.502																																						dbGAP											0													291.0	252.0	265.0					16																	68330554		2198	4300	6498	-	-	-	SO:0001628	intergenic_variant	0				CCDS10865.1	16q22.1	2010-03-11			ENSG00000103061	ENSG00000103061			25807	protein-coding gene	gene with protein product							Standard	NM_032178		Approved	FLJ13291	uc002evw.2	Q96CW6	OTTHUMG00000137558		16.37:g.68330554T>A			Q8TCZ3|Q9H8R8	Missense_Mutation	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1	p.F432I	ENST00000263997.6	37	c.1294	CCDS10865.1	16	.	.	.	.	.	.	.	.	.	.	T	33	5.245810	0.95272	.	.	ENSG00000103064	ENST00000219343	D	0.90444	-2.67	5.49	5.49	0.81192	Amino acid permease domain (1);	0.041594	0.85682	D	0.000000	D	0.95140	0.8425	M	0.85542	2.76	0.80722	D	1	D	0.54397	0.966	D	0.64687	0.928	D	0.95627	0.8686	10	0.72032	D	0.01	.	13.8342	0.63400	0.0:0.0:0.0:1.0	.	432	Q92536	YLAT2_HUMAN	I	432	ENSP00000219343:F432I	ENSP00000219343:F432I	F	+	1	0	SLC7A6	66888055	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.923000	0.87546	2.216000	0.71823	0.459000	0.35465	TTC	SLC7A6	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1	ENSG00000103064		0.502	SLC7A6OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A6	HGNC	protein_coding	OTTHUMT00000268894.3	234	0.00	0	T	NM_032178		68330554	68330554	+1	no_errors	ENST00000219343	ensembl	human	known	69_37n	missense	15	72.88	43	SNP	1.000	A
SNCAIP	9627	genome.wustl.edu	37	5	121780266	121780266	+	Silent	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr5:121780266T>A	ENST00000261368.8	+	8	1693	c.1431T>A	c.(1429-1431)gtT>gtA	p.V477V	SNCAIP_ENST00000379533.2_Silent_p.V524V|SNCAIP_ENST00000504884.2_3'UTR|CTC-210G5.1_ENST00000509993.1_RNA|CTC-210G5.1_ENST00000503529.1_RNA|SNCAIP_ENST00000379538.3_Silent_p.V111V|SNCAIP_ENST00000542191.1_Silent_p.V35V|SNCAIP_ENST00000414317.2_Silent_p.V79V|CTC-210G5.1_ENST00000510972.1_RNA|CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000503116.2_3'UTR|CTC-210G5.1_ENST00000506053.1_RNA|SNCAIP_ENST00000379536.2_Silent_p.V417V|SNCAIP_ENST00000261367.7_Silent_p.V524V	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	477					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		AGACCTTGGTTGAATATGGAG	0.483																																						dbGAP											0													124.0	118.0	120.0					5																	121780266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1431T>A	5.37:g.121780266T>A			D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V524	ENST00000261368.8	37	c.1572	CCDS4131.1	5																																																																																			SNCAIP	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000064692		0.483	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	104	0.00	0	T			121780266	121780266	+1	no_errors	ENST00000379533	ensembl	human	known	69_37n	silent	34	24.44	11	SNP	0.999	A
SNRNP70	6625	genome.wustl.edu	37	19	49610881	49610881	+	Splice_Site	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr19:49610881G>C	ENST00000598441.1	+	9	801		c.e9-1		SNRNP70_ENST00000221448.5_Splice_Site			P08621	RU17_HUMAN	small nuclear ribonucleoprotein 70kDa (U1)						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	12						CCCTGCCCCAGGAGGAGGCCT	0.627																																						dbGAP											0													59.0	61.0	60.0					19																	49610881		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS12756.1, CCDS74417.1	19q13.3	2013-02-12	2008-10-29	2008-10-29		ENSG00000104852		"""RNA binding motif (RRM) containing"""	11150	protein-coding gene	gene with protein product		180740	"""small nuclear ribonucleoprotein 70kDa (RNP antigen)"""	RNPU1Z, RPU1, SNRP70			Standard	XM_005259177		Approved	U1-70K, Snp1	uc021uxh.1	P08621		ENST00000598441.1:c.578-1G>C	19.37:g.49610881G>C			B3KUA3|P78493|P78494|Q15364|Q15686|Q15687|Q15689|Q99377|Q9UE45|Q9UE46|Q9UE47|Q9UE48|Q9UFQ6	Splice_Site	SNP	-	e8-1	ENST00000598441.1	37	c.578-1	CCDS12756.1	19	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287350	0.40494	.	.	ENSG00000104852	ENST00000221448;ENST00000544278	.	.	.	4.24	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7987	0.78433	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SNRNP70	54302693	1.000000	0.71417	0.991000	0.47740	0.398000	0.30690	8.479000	0.90431	2.095000	0.63458	0.462000	0.41574	.	SNRNP70	-	-	ENSG00000104852		0.627	SNRNP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP70	HGNC	protein_coding	OTTHUMT00000466266.1	57	0.00	0	G	NM_003089	Intron	49610881	49610881	+1	no_errors	ENST00000221448	ensembl	human	known	69_37n	splice_site	3	82.35	14	SNP	1.000	C
SOGA1	140710	genome.wustl.edu	37	20	35415036	35415036	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr20:35415036G>A	ENST00000357779.3	-	15	4450	c.4124C>T	c.(4123-4125)gCt>gTt	p.A1375V	SOGA1_ENST00000456801.2_Missense_Mutation_p.A1216V|SOGA1_ENST00000279034.6_Intron|SOGA1_ENST00000237536.4_Missense_Mutation_p.A1613V			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	1375					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GTCACAAACAGCGTCCTAGGA	0.587																																						dbGAP											0													88.0	97.0	94.0					20																	35415036		692	1591	2283	-	-	-	SO:0001583	missense	0			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.4124C>T	20.37:g.35415036G>A	ENSP00000350424:p.Ala1375Val		A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	pfam_DUF3166	p.A1375V	ENST00000357779.3	37	c.4124		20	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723609	0.30593	.	.	ENSG00000149639	ENST00000237536;ENST00000456801;ENST00000357779	T;T;T	0.18016	2.24;2.25;2.25	5.27	5.27	0.74061	.	0.487104	0.22969	N	0.053453	T	0.14141	0.0342	L	0.40543	1.245	0.09310	N	0.999999	.	.	.	.	.	.	T	0.24190	-1.0167	8	0.12430	T	0.62	-6.8401	6.7854	0.23670	0.0861:0.0:0.7372:0.1767	.	.	.	.	V	1613;1216;1375	ENSP00000237536:A1613V;ENSP00000413886:A1216V;ENSP00000350424:A1375V	ENSP00000237536:A1613V	A	-	2	0	KIAA0889	34848450	0.972000	0.33761	0.860000	0.33809	0.864000	0.49448	2.761000	0.47589	2.758000	0.94735	0.561000	0.74099	GCT	SOGA1	-	NULL	ENSG00000149639		0.587	SOGA1-201	KNOWN	basic	protein_coding	SOGA1	HGNC	protein_coding		108	0.92	1	G	NM_199181		35415036	35415036	-1	no_errors	ENST00000357779	ensembl	human	known	69_37n	missense	28	45.10	23	SNP	0.121	A
STARD3	10948	genome.wustl.edu	37	17	37809976	37809976	+	Silent	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:37809976C>T	ENST00000336308.5	+	2	410	c.192C>T	c.(190-192)atC>atT	p.I64I	STARD3_ENST00000580611.1_Silent_p.I64I|STARD3_ENST00000544210.2_Silent_p.I64I|STARD3_ENST00000578232.1_3'UTR|STARD3_ENST00000394250.4_Silent_p.I64I	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	64	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGCTCTTCATCTCCCTGCTCT	0.612											OREG0024381	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													114.0	88.0	97.0					17																	37809976		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.192C>T	17.37:g.37809976C>T		873	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Silent	SNP	pfam_MENTAL,pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	p.I64	ENST00000336308.5	37	c.192	CCDS11341.1	17																																																																																			STARD3	-	pfam_MENTAL	ENSG00000131748		0.612	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3	HGNC	protein_coding	OTTHUMT00000256933.1	136	0.00	0	C			37809976	37809976	+1	no_errors	ENST00000336308	ensembl	human	known	69_37n	silent	31	39.62	21	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152464831	152464831	+	Missense_Mutation	SNP	A	A	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr6:152464831A>C	ENST00000367255.5	-	138	25647	c.25046T>G	c.(25045-25047)aTa>aGa	p.I8349R	SYNE1_ENST00000341594.5_Missense_Mutation_p.I7961R|SYNE1_ENST00000539504.1_Missense_Mutation_p.I504R|SYNE1_ENST00000265368.4_Missense_Mutation_p.I8349R|SYNE1_ENST00000423061.1_Missense_Mutation_p.I8301R|SYNE1_ENST00000356820.4_Missense_Mutation_p.I2873R|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000448038.1_Missense_Mutation_p.I8301R|SYNE1_ENST00000354674.4_Missense_Mutation_p.I527R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8349					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGTTTGCTGTATCTGAAAACG	0.522										HNSCC(10;0.0054)																												dbGAP											0													150.0	142.0	145.0					6																	152464831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.25046T>G	6.37:g.152464831A>C	ENSP00000356224:p.Ile8349Arg		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.I8349R	ENST00000367255.5	37	c.25046	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	13.29	2.194290	0.38806	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.55930	0.58;4.61;1.39;0.55;0.49;0.55;0.68;2.57;1.54;4.59	6.16	5.0	0.66597	.	0.304319	0.32836	N	0.005586	T	0.26122	0.0637	L	0.28274	0.84	0.49213	D	0.999765	B;B;B;B;B	0.25772	0.134;0.134;0.001;0.001;0.001	B;B;B;B;B	0.27380	0.079;0.079;0.002;0.001;0.001	T	0.18085	-1.0348	10	0.87932	D	0	.	12.2288	0.54476	0.9341:0.0:0.0659:0.0	.	8349;8349;8301;8301;551	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	R	8349;504;995;8301;8349;8301;7961;2873;534;529;1294;527	ENSP00000356224:I8349R;ENSP00000441052:I504R;ENSP00000356226:I995R;ENSP00000396024:I8301R;ENSP00000265368:I8349R;ENSP00000390975:I8301R;ENSP00000341887:I7961R;ENSP00000349276:I2873R;ENSP00000356220:I1294R;ENSP00000346701:I527R	ENSP00000265368:I8349R	I	-	2	0	SYNE1	152506524	1.000000	0.71417	0.933000	0.37362	0.533000	0.34776	6.779000	0.75057	1.148000	0.42385	0.528000	0.53228	ATA	SYNE1	-	NULL	ENSG00000131018		0.522	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	102	0.00	0	A	NM_182961		152464831	152464831	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	1.000	C
SYT17	51760	genome.wustl.edu	37	16	19195047	19195047	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr16:19195047G>A	ENST00000355377.2	+	5	927	c.529G>A	c.(529-531)Gag>Aag	p.E177K	SYT17_ENST00000562711.2_Missense_Mutation_p.E173K|SYT17_ENST00000568115.1_Missense_Mutation_p.E116K|SYT17_ENST00000562034.1_Missense_Mutation_p.E116K	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	177					exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						TCTGACAGACGAGGAGATCCT	0.577																																						dbGAP											0													104.0	82.0	90.0					16																	19195047		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.529G>A	16.37:g.19195047G>A	ENSP00000347538:p.Glu177Lys		O43330|Q9NZ18	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.E177K	ENST00000355377.2	37	c.529	CCDS10575.1	16	.	.	.	.	.	.	.	.	.	.	g	20.9	4.068195	0.76301	.	.	ENSG00000103528	ENST00000355377	T	0.17854	2.25	5.51	5.51	0.81932	C2 calcium/lipid-binding domain, CaLB (1);	0.077304	0.49916	D	0.000127	T	0.12220	0.0297	L	0.29908	0.895	0.80722	D	1	P;P	0.36483	0.553;0.555	B;B	0.22152	0.018;0.038	T	0.13150	-1.0520	10	0.19147	T	0.46	.	19.4121	0.94679	0.0:0.0:1.0:0.0	.	177;116	Q9BSW7;B4DJB2	SYT17_HUMAN;.	K	177	ENSP00000347538:E177K	ENSP00000347538:E177K	E	+	1	0	SYT17	19102548	1.000000	0.71417	0.996000	0.52242	0.881000	0.50899	7.331000	0.79192	2.573000	0.86826	0.556000	0.70494	GAG	SYT17	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000103528		0.577	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT17	HGNC	protein_coding	OTTHUMT00000254286.2	50	0.00	0	G	NM_016524		19195047	19195047	+1	no_errors	ENST00000355377	ensembl	human	known	69_37n	missense	13	55.17	16	SNP	1.000	A
TAF7L	54457	genome.wustl.edu	37	X	100531448	100531448	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:100531448C>T	ENST00000372907.3	-	10	1029	c.1018G>A	c.(1018-1020)Gat>Aat	p.D340N	TAF7L_ENST00000372905.2_Intron|TAF7L_ENST00000324762.6_Intron|TAF7L_ENST00000356784.1_Missense_Mutation_p.D254N	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	340	Glu-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						tcatcttcatcatcctcatcc	0.413																																					Ovarian(104;431 1530 3210 15406 18594)	dbGAP											0													219.0	175.0	190.0					X																	100531448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.1018G>A	X.37:g.100531448C>T	ENSP00000361998:p.Asp340Asn		Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	pfam_TAFII55_prot_cons_reg	p.D340N	ENST00000372907.3	37	c.1018	CCDS35347.1	X	.	.	.	.	.	.	.	.	.	.	c	7.358	0.624331	0.14193	.	.	ENSG00000102387	ENST00000372907;ENST00000356784	T;T	0.20069	3.65;2.1	4.56	-3.3	0.05003	Armadillo-like helical (1);	1.425020	0.05265	U	0.516431	T	0.12050	0.0293	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33471	-0.9867	10	0.18276	T	0.48	0.0484	6.6749	0.23087	0.0:0.2139:0.3932:0.3929	.	340	Q5H9L4	TAF7L_HUMAN	N	340;254	ENSP00000361998:D340N;ENSP00000349235:D254N	ENSP00000349235:D254N	D	-	1	0	TAF7L	100418104	0.001000	0.12720	0.001000	0.08648	0.027000	0.11550	0.160000	0.16462	-0.573000	0.05998	-0.475000	0.04921	GAT	TAF7L	-	NULL	ENSG00000102387		0.413	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF7L	HGNC	protein_coding	OTTHUMT00000057526.2	332	0.00	0	C			100531448	100531448	-1	no_errors	ENST00000372907	ensembl	human	known	69_37n	missense	22	54.17	26	SNP	0.002	T
TBX20	57057	genome.wustl.edu	37	7	35242254	35242254	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr7:35242254G>C	ENST00000408931.3	-	8	1658	c.1132C>G	c.(1132-1134)Ccc>Gcc	p.P378A		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	378					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						TGAGGAATGGGTGTTGCTATG	0.567																																						dbGAP											0													72.0	74.0	74.0					7																	35242254		1985	4159	6144	-	-	-	SO:0001583	missense	0			AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.1132C>G	7.37:g.35242254G>C	ENSP00000386170:p.Pro378Ala		A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.P378A	ENST00000408931.3	37	c.1132	CCDS43568.1	7	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375836	0.42105	.	.	ENSG00000164532	ENST00000408931	D	0.88586	-2.4	5.46	4.38	0.52667	.	0.315549	0.33457	N	0.004890	T	0.81602	0.4857	N	0.24115	0.695	0.51233	D	0.999914	B	0.23591	0.088	B	0.20184	0.028	T	0.77672	-0.2500	10	0.33940	T	0.23	.	15.1102	0.72349	0.0799:0.0:0.9201:0.0	.	378	Q9UMR3	TBX20_HUMAN	A	378	ENSP00000386170:P378A	ENSP00000386170:P378A	P	-	1	0	TBX20	35208779	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.224000	0.58593	2.548000	0.85928	0.609000	0.83330	CCC	TBX20	-	NULL	ENSG00000164532		0.567	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX20	HGNC	protein_coding	OTTHUMT00000216870.2	135	0.00	0	G	NM_020417		35242254	35242254	-1	no_errors	ENST00000408931	ensembl	human	known	69_37n	missense	75	23.47	23	SNP	1.000	C
TES	26136	genome.wustl.edu	37	7	115889294	115889294	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr7:115889294G>A	ENST00000358204.4	+	3	549	c.334G>A	c.(334-336)Gag>Aag	p.E112K	AC002066.1_ENST00000446355.2_RNA|TES_ENST00000485009.1_3'UTR|AC073130.3_ENST00000444244.1_RNA|TES_ENST00000393481.2_Missense_Mutation_p.E103K|TES_ENST00000537767.1_Intron	NM_015641.3	NP_056456.1	Q9UGI8	TES_HUMAN	testis derived transcript (3 LIM domains)	112	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	12	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)			AGTTACCTATGAGTGGGCTCC	0.388																																						dbGAP											0													113.0	106.0	108.0					7																	115889294		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ250865	CCDS5763.1, CCDS5764.1	7q31.2	2004-04-20			ENSG00000135269	ENSG00000135269			14620	protein-coding gene	gene with protein product		606085				10950921	Standard	NM_015641		Approved	DKFZP586B2022, TESS-2, TESTIN	uc003vho.3	Q9UGI8	OTTHUMG00000023092	ENST00000358204.4:c.334G>A	7.37:g.115889294G>A	ENSP00000350937:p.Glu112Lys		A4D0U6|Q9GZQ1|Q9HAJ9	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.E112K	ENST00000358204.4	37	c.334	CCDS5763.1	7	.	.	.	.	.	.	.	.	.	.	G	34	5.307237	0.95629	.	.	ENSG00000135269	ENST00000358204;ENST00000455989;ENST00000257721;ENST00000393481	D;D;D	0.86562	-2.14;-2.14;-2.14	5.53	5.53	0.82687	PET domain (2);	0.000000	0.64402	D	0.000002	D	0.92877	0.7734	M	0.72353	2.195	0.80722	D	1	D;D	0.60575	0.969;0.988	P;D	0.64877	0.783;0.93	D	0.92897	0.6336	10	0.66056	D	0.02	-25.3146	19.8389	0.96675	0.0:0.0:1.0:0.0	.	112;112	B7Z5L5;Q9UGI8	.;TES_HUMAN	K	112;27;112;103	ENSP00000350937:E112K;ENSP00000413002:E27K;ENSP00000377121:E103K	ENSP00000257721:E112K	E	+	1	0	TES	115676530	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	8.794000	0.91867	2.755000	0.94549	0.650000	0.86243	GAG	TES	-	pfam_PET_domain	ENSG00000135269		0.388	TES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TES	HGNC	protein_coding	OTTHUMT00000059413.2	66	0.00	0	G	NM_015641		115889294	115889294	+1	no_errors	ENST00000358204	ensembl	human	known	69_37n	missense	18	53.85	21	SNP	1.000	A
TEX101	83639	genome.wustl.edu	37	19	43920373	43920373	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr19:43920373A>T	ENST00000598265.1	+	3	353	c.187A>T	c.(187-189)Acc>Tcc	p.T63S	TEX101_ENST00000602198.1_Missense_Mutation_p.T81S|TEX101_ENST00000253435.7_Missense_Mutation_p.T81S|TEX101_ENST00000601707.1_3'UTR	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	63						acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				TTGCCAGGAAACCATACTAAT	0.478																																						dbGAP											0													72.0	69.0	70.0					19																	43920373		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.187A>T	19.37:g.43920373A>T	ENSP00000472769:p.Thr63Ser		Q7L5R2|Q9BPY7	Missense_Mutation	SNP	pfam_LY6_UPAR	p.T81S	ENST00000598265.1	37	c.241	CCDS59393.1	19	.	.	.	.	.	.	.	.	.	.	A	8.244	0.807417	0.16467	.	.	ENSG00000131126	ENST00000253435;ENST00000407156	T	0.69806	-0.43	4.12	-0.632	0.11523	.	1.075330	0.07175	N	0.853031	T	0.49064	0.1535	N	0.25825	0.765	0.09310	N	1	B;B	0.31174	0.115;0.311	B;B	0.32533	0.039;0.147	T	0.34601	-0.9822	10	0.30854	T	0.27	-6.3407	4.1803	0.10372	0.3745:0.0:0.1029:0.5225	.	63;81	Q9BY14;Q9BY14-2	TX101_HUMAN;.	S	81;76	ENSP00000253435:T81S	ENSP00000253435:T81S	T	+	1	0	TEX101	48612213	0.157000	0.22836	0.034000	0.17996	0.015000	0.08874	0.135000	0.15952	-0.230000	0.09840	-0.496000	0.04628	ACC	TEX101	-	NULL	ENSG00000131126		0.478	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	TEX101	HGNC	protein_coding	OTTHUMT00000463176.1	90	0.00	0	A	NM_031451		43920373	43920373	+1	no_errors	ENST00000253435	ensembl	human	known	69_37n	missense	20	52.38	22	SNP	0.041	T
TRANK1	9881	genome.wustl.edu	37	3	36899136	36899136	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr3:36899136T>C	ENST00000429976.2	-	12	2192	c.1945A>G	c.(1945-1947)Act>Gct	p.T649A	TRANK1_ENST00000428977.2_Missense_Mutation_p.T99A|TRANK1_ENST00000301807.6_Missense_Mutation_p.T99A	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	649							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GTTCTGGCAGTGGCACCACAT	0.597																																						dbGAP											0													95.0	97.0	97.0					3																	36899136		2033	4179	6212	-	-	-	SO:0001583	missense	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.1945A>G	3.37:g.36899136T>C	ENSP00000416168:p.Thr649Ala		Q8N8K0	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.T649A	ENST00000429976.2	37	c.1945	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	T	9.673	1.147142	0.21288	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.29655	1.56;1.97;1.56	5.32	-4.67	0.03319	.	0.829257	0.10301	N	0.691145	T	0.09818	0.0241	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33979	-0.9847	10	0.09843	T	0.71	.	3.0015	0.06015	0.1232:0.3948:0.1261:0.3559	.	649	O15050	TRNK1_HUMAN	A	99;649;99	ENSP00000416826:T99A;ENSP00000416168:T649A;ENSP00000301807:T99A	ENSP00000301807:T99A	T	-	1	0	TRANK1	36874140	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.210000	0.02999	-0.747000	0.04759	0.528000	0.53228	ACT	TRANK1	-	NULL	ENSG00000168016		0.597	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		69	0.00	0	T	NM_014831		36899136	36899136	-1	no_errors	ENST00000429976	ensembl	human	known	69_37n	missense	18	61.70	29	SNP	0.000	C
TRIM4	89122	genome.wustl.edu	37	7	99517012	99517012	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr7:99517012delC	ENST00000355947.2	-	1	142	c.13delG	c.(13-15)gacfs	p.D5fs	TRIM4_ENST00000349062.2_Frame_Shift_Del_p.D5fs|TRIM4_ENST00000354241.5_Frame_Shift_Del_p.D5fs	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	5					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				TCCTGGATGTCCTCAGCTTCC	0.672																																						dbGAP											0													12.0	12.0	12.0					7																	99517012		2199	4292	6491	-	-	-	SO:0001589	frameshift_variant	0			AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.13delG	7.37:g.99517012delC	ENSP00000348216:p.Asp5fs		A4D298|Q75MK1|Q96F06|Q9C036	Frame_Shift_Del	DEL	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.D5fs	ENST00000355947.2	37	c.13	CCDS5679.1	7																																																																																			TRIM4	-	NULL	ENSG00000146833		0.672	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM4	HGNC	protein_coding	OTTHUMT00000345050.1	12	0.00	0	C	NM_033017		99517012	99517012	-1	no_errors	ENST00000355947	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	0.986	-
TRPM2	7226	genome.wustl.edu	37	21	45789136	45789136	+	Silent	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr21:45789136G>C	ENST00000397928.1	+	5	1126	c.681G>C	c.(679-681)ctG>ctC	p.L227L	TRPM2_ENST00000300481.9_Silent_p.L227L|TRPM2_ENST00000397932.2_Silent_p.L227L|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300482.5_Silent_p.L227L	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	227					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						ACTTCAGCCTGAGCAGCAGCT	0.672																																						dbGAP											0													53.0	45.0	48.0					21																	45789136		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.681G>C	21.37:g.45789136G>C			D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.L227	ENST00000397928.1	37	c.681	CCDS13710.1	21																																																																																			TRPM2	-	NULL	ENSG00000142185		0.672	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	36	0.00	0	G	NM_003307		45789136	45789136	+1	no_errors	ENST00000300482	ensembl	human	known	69_37n	silent	7	50.00	7	SNP	1.000	C
TXNDC8	255220	genome.wustl.edu	37	9	113066787	113066787	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr9:113066787C>A	ENST00000374511.3	-	5	329	c.281G>T	c.(280-282)aGa>aTa	p.R94I	TXNDC8_ENST00000423740.2_Missense_Mutation_p.R74I|TXNDC8_ENST00000374510.4_Missense_Mutation_p.R94I			Q6A555	TXND8_HUMAN	thioredoxin domain containing 8 (spermatozoa)	94					acrosome assembly (GO:0001675)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|sperm flagellum (GO:0036126)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						GCAAATTATTCTTTTGATTCT	0.363																																						dbGAP											0													140.0	136.0	137.0					9																	113066787		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035743	CCDS35104.1, CCDS69639.1, CCDS75872.1	9q31.3	2007-08-16	2007-08-16	2007-08-16	ENSG00000204193	ENSG00000204193			31454	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 3"""						Standard	XM_005251879		Approved	bA427L11.2, TRX6, SPTRX-3	uc004bes.3	Q6A555	OTTHUMG00000020481	ENST00000374511.3:c.281G>T	9.37:g.113066787C>A	ENSP00000363635:p.Arg94Ile		A1L4I2|A6NDK7|Q5T934	Missense_Mutation	SNP	pfam_Thioredoxin_domain	p.R94I	ENST00000374511.3	37	c.281		9	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775503	0.70107	.	.	ENSG00000204193	ENST00000374511;ENST00000374510;ENST00000423740	T;T;T	0.37235	2.19;2.19;1.21	4.25	4.25	0.50352	.	0.137236	0.34133	N	0.004240	T	0.49779	0.1577	L	0.51422	1.61	0.47949	D	0.999557	D;D	0.76494	0.999;0.962	D;P	0.63597	0.916;0.601	T	0.51826	-0.8656	10	0.87932	D	0	-16.6952	12.3325	0.55048	0.0:1.0:0.0:0.0	.	74;94	B7ZME0;Q6A555-2	.;.	I	94;94;74	ENSP00000363635:R94I;ENSP00000363634:R94I;ENSP00000408768:R74I	ENSP00000363634:R94I	R	-	2	0	TXNDC8	112106608	1.000000	0.71417	0.996000	0.52242	0.939000	0.58152	1.794000	0.38774	2.357000	0.79964	0.467000	0.42956	AGA	TXNDC8	-	NULL	ENSG00000204193		0.363	TXNDC8-201	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC8	HGNC	protein_coding		185	0.00	0	C	NM_001003936		113066787	113066787	-1	no_errors	ENST00000374511	ensembl	human	known	69_37n	missense	57	42.42	42	SNP	0.998	A
VPRBP	9730	genome.wustl.edu	37	3	51440606	51440606	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr3:51440606T>A	ENST00000335891.5	-	16	3098	c.3089A>T	c.(3088-3090)gAt>gTt	p.D1030V				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1479					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		CACCTCCTCATCTGCATCAGA	0.542																																						dbGAP											0													126.0	126.0	126.0					3																	51440606		2077	4217	6294	-	-	-	SO:0001583	missense	0			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.3089A>T	3.37:g.51440606T>A	ENSP00000338857:p.Asp1030Val		Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.D1030V	ENST00000335891.5	37	c.3089		3	.	.	.	.	.	.	.	.	.	.	T	17.90	3.502538	0.64298	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.57273	0.41;0.41	5.29	5.29	0.74685	.	0.140286	0.64402	D	0.000006	T	0.61912	0.2385	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.66118	-0.6003	10	0.72032	D	0.01	-17.521	15.2308	0.73386	0.0:0.0:0.0:1.0	.	1479	Q9Y4B6	VPRBP_HUMAN	V	1050;1030	ENSP00000393183:D1050V;ENSP00000338857:D1030V	ENSP00000338857:D1030V	D	-	2	0	VPRBP	51415646	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	5.206000	0.65192	2.015000	0.59207	0.455000	0.32223	GAT	VPRBP	-	NULL	ENSG00000145041		0.542	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	VPRBP	HGNC	protein_coding		112	0.00	0	T	NM_014703		51440606	51440606	-1	no_errors	ENST00000335891	ensembl	human	known	69_37n	missense	41	40.58	28	SNP	1.000	A
WDFY3	23001	genome.wustl.edu	37	4	85663022	85663022	+	Silent	SNP	C	C	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr4:85663022C>T	ENST00000295888.4	-	38	6533	c.6126G>A	c.(6124-6126)gtG>gtA	p.V2042V	WDFY3_ENST00000322366.6_Silent_p.V2042V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2042					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		ACACATTGTTCACCAATACCT	0.368																																						dbGAP											0													80.0	82.0	81.0					4																	85663022		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6126G>A	4.37:g.85663022C>T			Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V2042	ENST00000295888.4	37	c.6126	CCDS3609.1	4																																																																																			WDFY3	-	NULL	ENSG00000163625		0.368	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	64	0.00	0	C	NM_014991		85663022	85663022	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	silent	11	52.17	12	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	49988074	49988074	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr10:49988074G>A	ENST00000325239.5	+	18	3513	c.3486G>A	c.(3484-3486)tgG>tgA	p.W1162*	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1162						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GTGGTCAGTGGCATCACTTGG	0.537																																						dbGAP											0													175.0	154.0	161.0					10																	49988074		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.3486G>A	10.37:g.49988074G>A	ENSP00000320563:p.Trp1162*		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W1162*	ENST00000325239.5	37	c.3486	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	9.992642|9.992642	0.99313|0.99313	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002|ENST00000426033;ENST00000325239	.|.	.|.	.|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|.	.|.	.|.	.|.	T|.	0.73690|.	0.3619|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71593|.	-0.4546|.	4|.	.|.	.|.	.|.	.|.	17.0135|17.0135	0.86413|0.86413	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	T|X	253|1162	.|.	.|.	A|W	+|+	1|3	0|0	WDFY4|WDFY4	49658080|49658080	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.730000|0.730000	0.41778|0.41778	8.694000|8.694000	0.91293|0.91293	2.698000|2.698000	0.92095|0.92095	0.561000|0.561000	0.74099|0.74099	GCA|TGG	WDFY4	-	NULL	ENSG00000128815		0.537	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		153	0.00	0	G	XM_033379		49988074	49988074	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	nonsense	22	50.00	22	SNP	1.000	A
WFIKKN2	124857	genome.wustl.edu	37	17	48913406	48913406	+	Silent	SNP	G	G	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:48913406G>A	ENST00000311378.4	+	1	636	c.108G>A	c.(106-108)ccG>ccA	p.P36P	WFIKKN2_ENST00000426127.1_Intron	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	36					muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.P36P(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TGGCGCTGCCGCCCATCCGCT	0.682																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)																																								-	-	-	SO:0001819	synonymous_variant	0			AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.108G>A	17.37:g.48913406G>A			Q6UXZ9	Silent	SNP	pfam_Prot_inh_Kunz-m,pfam_Ig_I-set,pfam_Netrin_module_non-TIMP,pfam_Whey_acidic_protein_4-diS_core,pfam_Kazal-type_dom,pfam_Ig_V-set,superfamily_TIMP-like_OB-fold,superfamily_Prot_inh_Kunz-m,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Ig_sub,smart_Ig_sub2,smart_Prot_inh_Kunz-m,pfscan_Netrin_domain,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like,prints_Prot_inh_Kunz-m	p.P36	ENST00000311378.4	37	c.108	CCDS11575.1	17																																																																																			WFIKKN2	-	superfamily_Whey_acidic_protein_4-diS_core	ENSG00000173714		0.682	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN2	HGNC	protein_coding	OTTHUMT00000368358.1	33	0.00	0	G	NM_175575		48913406	48913406	+1	no_errors	ENST00000311378	ensembl	human	known	69_37n	silent	12	37.50	9	SNP	0.009	A
YEATS2	55689	genome.wustl.edu	37	3	183524710	183524710	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr3:183524710C>A	ENST00000305135.5	+	28	4036	c.3841C>A	c.(3841-3843)Caa>Aaa	p.Q1281K	YEATS2-AS1_ENST00000425008.3_RNA|YEATS2-AS1_ENST00000609871.1_RNA|YEATS2-AS1_ENST00000609195.1_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1281					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GGAGGACCTGCAACAGTTCCA	0.522																																						dbGAP											0													60.0	62.0	61.0					3																	183524710		1986	4164	6150	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3841C>A	3.37:g.183524710C>A	ENSP00000306983:p.Gln1281Lys		A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.Q1281K	ENST00000305135.5	37	c.3841	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778509	0.49786	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.25414	1.8	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	T	0.23532	0.0569	L	0.43152	1.355	0.50313	D	0.999863	B	0.34372	0.451	B	0.30179	0.112	T	0.02774	-1.1112	10	0.66056	D	0.02	-14.2117	14.7791	0.69751	0.0:0.7372:0.2628:0.0	.	1281	Q9ULM3	YETS2_HUMAN	K	1281	ENSP00000306983:Q1281K	ENSP00000306983:Q1281K	Q	+	1	0	YEATS2	185007404	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.632000	0.54287	2.782000	0.95742	0.655000	0.94253	CAA	YEATS2	-	NULL	ENSG00000163872		0.522	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	75	0.00	0	C	NM_018023		183524710	183524710	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	26	43.48	20	SNP	1.000	A
YWHAG	7532	genome.wustl.edu	37	7	75959386	75959386	+	Silent	SNP	C	C	T	rs569904540		TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr7:75959386C>T	ENST00000307630.3	-	2	474	c.252G>A	c.(250-252)gcG>gcA	p.A84A		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	84					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						TCTCCCGGTACGCACGGACCA	0.542													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20351	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													246.0	211.0	223.0					7																	75959386		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.252G>A	7.37:g.75959386C>T			O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Silent	SNP	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.A84	ENST00000307630.3	37	c.252	CCDS5584.1	7																																																																																			YWHAG	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3	ENSG00000170027		0.542	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAG	HGNC	protein_coding	OTTHUMT00000253002.1	111	0.00	0	C	NM_012479		75959386	75959386	-1	no_errors	ENST00000307630	ensembl	human	known	69_37n	silent	20	51.22	21	SNP	0.869	T
ZBTB49	166793	genome.wustl.edu	37	4	4322987	4322987	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr4:4322987A>T	ENST00000337872.4	+	8	2363	c.2242A>T	c.(2242-2244)Act>Tct	p.T748S	ZBTB49_ENST00000538529.1_Missense_Mutation_p.T231S|ZBTB49_ENST00000355834.3_Missense_Mutation_p.T626S|RP11-265O12.1_ENST00000509015.1_lincRNA	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	748					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						CTCCAGCATGACTCTCTGGGG	0.542																																						dbGAP											0													53.0	50.0	51.0					4																	4322987		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.2242A>T	4.37:g.4322987A>T	ENSP00000338807:p.Thr748Ser		Q59FJ4|Q5EBN0|Q8TB80	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T748S	ENST00000337872.4	37	c.2242	CCDS3375.1	4	.	.	.	.	.	.	.	.	.	.	A	26.3	4.726467	0.89298	.	.	ENSG00000168826	ENST00000355834;ENST00000337872;ENST00000538529	T;T;T	0.30714	1.52;2.14;2.45	4.88	4.88	0.63580	.	0.000000	0.52532	D	0.000079	T	0.53286	0.1787	M	0.75264	2.295	0.54753	D	0.999982	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.994	T	0.51228	-0.8732	10	0.20519	T	0.43	.	14.7911	0.69844	1.0:0.0:0.0:0.0	.	626;748	Q6ZSB9-2;Q6ZSB9	.;ZBT49_HUMAN	S	626;748;231	ENSP00000348091:T626S;ENSP00000338807:T748S;ENSP00000445653:T231S	ENSP00000338807:T748S	T	+	1	0	ZBTB49	4373888	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.524000	0.73791	1.965000	0.57142	0.528000	0.53228	ACT	ZBTB49	-	NULL	ENSG00000168826		0.542	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB49	HGNC	protein_coding	OTTHUMT00000206688.3	54	0.00	0	A	NM_145291		4322987	4322987	+1	no_errors	ENST00000337872	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	T
ZFP64	55734	genome.wustl.edu	37	20	50769649	50769649	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr20:50769649T>G	ENST00000216923.4	-	6	1431	c.1082A>C	c.(1081-1083)cAc>cCc	p.H361P	ZFP64_ENST00000346617.4_Missense_Mutation_p.H307P|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Missense_Mutation_p.H359P|ZFP64_ENST00000477786.1_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	361					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GATACGCTCGTGGATGCGCAG	0.597																																						dbGAP											0													113.0	104.0	107.0					20																	50769649		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1082A>C	20.37:g.50769649T>G	ENSP00000216923:p.His361Pro		Q9NTS7|Q9NVH4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H361P	ENST00000216923.4	37	c.1082	CCDS13440.1	20	.	.	.	.	.	.	.	.	.	.	T	14.60	2.583732	0.46006	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083;ENST00000371516	T;T;T	0.19532	2.2;2.21;2.14	5.79	4.66	0.58398	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000005	T	0.65626	0.2709	H	0.99475	4.585	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.87578	0.998;0.991;0.993	T	0.79588	-0.1741	10	0.87932	D	0	-27.6066	12.9095	0.58173	0.0:0.0:0.1357:0.8643	.	307;359;361	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	P	361;307;359;203;514	ENSP00000216923:H361P;ENSP00000344615:H307P;ENSP00000360570:H359P	ENSP00000216923:H361P	H	-	2	0	ZFP64	50203056	1.000000	0.71417	0.991000	0.47740	0.266000	0.26442	8.040000	0.89188	0.973000	0.38340	0.496000	0.49642	CAC	ZFP64	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000020256		0.597	ZFP64-003	KNOWN	basic|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079744.1	119	0.00	0	T	NM_018197		50769649	50769649	-1	no_errors	ENST00000216923	ensembl	human	known	69_37n	missense	29	53.23	33	SNP	1.000	G
ZFPM2	23414	genome.wustl.edu	37	8	106814376	106814376	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr8:106814376G>C	ENST00000407775.2	+	8	2316	c.2066G>C	c.(2065-2067)tGt>tCt	p.C689S	RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.C557S|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000378472.4_Missense_Mutation_p.C420S|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.C557S|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000522296.1_3'UTR	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	689					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AAGACTACCTGTGAAGCTTGC	0.453																																						dbGAP											0													72.0	70.0	70.0					8																	106814376		1991	4160	6151	-	-	-	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2066G>C	8.37:g.106814376G>C	ENSP00000384179:p.Cys689Ser		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C689S	ENST00000407775.2	37	c.2066	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045291	0.75846	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	D;D;D;D	0.99925	-8.03;-8.03;-8.03;-8.03	5.72	5.72	0.89469	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	D	0.99919	0.9962	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96419	0.9310	10	0.49607	T	0.09	.	19.88	0.96892	0.0:0.0:1.0:0.0	.	689	Q8WW38	FOG2_HUMAN	S	689;557;557;420	ENSP00000384179:C689S;ENSP00000430757:C557S;ENSP00000428720:C557S;ENSP00000367733:C420S	ENSP00000367733:C420S	C	+	2	0	ZFPM2	106883552	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.708000	0.92522	0.561000	0.74099	TGT	ZFPM2	-	smart_Znf_C2H2-like	ENSG00000169946		0.453	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	66	0.00	0	G			106814376	106814376	+1	no_errors	ENST00000407775	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	C
ZNF41	7592	genome.wustl.edu	37	X	47308257	47308257	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chrX:47308257G>C	ENST00000377065.4	-	5	1551	c.912C>G	c.(910-912)agC>agG	p.S304R	ZNF41_ENST00000313116.7_Missense_Mutation_p.S304R|ZNF41_ENST00000397050.2_Missense_Mutation_p.S314R|ZNF41_ENST00000465311.1_5'Flank	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	346					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				AGACTTTGTTGCTTTTGTCAC	0.428																																						dbGAP											0													87.0	80.0	82.0					X																	47308257		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.912C>G	X.37:g.47308257G>C	ENSP00000366265:p.Ser304Arg		A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S314R	ENST00000377065.4	37	c.942	CCDS14279.1	X	.	.	.	.	.	.	.	.	.	.	G	9.508	1.104943	0.20632	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.15017	2.46;2.46;2.46	3.32	0.962	0.19643	Zinc finger, C2H2 (1);	1.026630	0.07797	N	0.955822	T	0.11110	0.0271	N	0.19112	0.55	0.09310	N	0.999998	B;B;B;B;B	0.09022	0.001;0.001;0.002;0.001;0.0	B;B;B;B;B	0.08055	0.002;0.002;0.003;0.003;0.001	T	0.34925	-0.9809	10	0.66056	D	0.02	.	5.7186	0.17974	0.7278:0.0:0.2722:0.0	.	304;306;314;338;346	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	R	304;304;314	ENSP00000315173:S304R;ENSP00000366265:S304R;ENSP00000380243:S314R	ENSP00000315173:S304R	S	-	3	2	ZNF41	47193201	0.007000	0.16637	0.000000	0.03702	0.002000	0.02628	0.155000	0.16362	0.100000	0.17581	-0.351000	0.07748	AGC	ZNF41	-	pfscan_Znf_C2H2	ENSG00000147124		0.428	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF41	HGNC	protein_coding	OTTHUMT00000056429.1	113	0.00	0	G	NM_153380		47308257	47308257	-1	no_errors	ENST00000397050	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	0.387	C
ZNF786	136051	genome.wustl.edu	37	7	148768278	148768278	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr7:148768278C>G	ENST00000491431.1	-	4	1650	c.1586G>C	c.(1585-1587)aGa>aCa	p.R529T	ZNF786_ENST00000451334.3_Missense_Mutation_p.R492T|ZNF786_ENST00000316286.9_Missense_Mutation_p.R443T	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	529					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GCTGTGCACTCTCAGGTGCTC	0.652																																						dbGAP											0													28.0	32.0	31.0					7																	148768278		2123	4246	6369	-	-	-	SO:0001583	missense	0			AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.1586G>C	7.37:g.148768278C>G	ENSP00000417470:p.Arg529Thr		A1A568|B4DMI1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R529T	ENST00000491431.1	37	c.1586	CCDS47738.1	7	.	.	.	.	.	.	.	.	.	.	C	15.35	2.806789	0.50421	.	.	ENSG00000197362	ENST00000316286;ENST00000491431;ENST00000451334	T;T;T	0.25414	1.8;1.8;1.8	4.71	3.81	0.43845	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.214697	0.23063	N	0.052342	T	0.44159	0.1280	M	0.82056	2.57	0.09310	N	1	D	0.56746	0.977	P	0.56216	0.794	T	0.32877	-0.9890	10	0.72032	D	0.01	-13.8098	10.9774	0.47473	0.0:0.907:0.0:0.093	.	529	Q8N393	ZN786_HUMAN	T	443;529;492	ENSP00000313516:R443T;ENSP00000417470:R529T;ENSP00000404984:R492T	ENSP00000313516:R443T	R	-	2	0	ZNF786	148399211	0.000000	0.05858	0.014000	0.15608	0.706000	0.40770	-0.186000	0.09670	2.459000	0.83118	0.655000	0.94253	AGA	ZNF786	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197362		0.652	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF786	HGNC	protein_coding	OTTHUMT00000352751.1	35	0.00	0	C	NM_152411		148768278	148768278	-1	no_errors	ENST00000491431	ensembl	human	known	69_37n	missense	5	54.55	6	SNP	0.001	G
ZNF830	91603	genome.wustl.edu	37	17	33288605	33288605	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr17:33288605C>A	ENST00000361952.3	+	1	57	c.20C>A	c.(19-21)gCc>gAc	p.A7D	CCT6B_ENST00000421975.3_5'Flank|CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000314144.5_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	7					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				TCCGCCTCCGCCCGGACTCCG	0.557																																						dbGAP											0													70.0	76.0	74.0					17																	33288605		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.20C>A	17.37:g.33288605C>A	ENSP00000354518:p.Ala7Asp		Q96F60|Q96GZ5|Q9BU38	Missense_Mutation	SNP	smart_Znf_U1	p.A7D	ENST00000361952.3	37	c.20	CCDS32618.1	17	.	.	.	.	.	.	.	.	.	.	C	6.343	0.431355	0.12045	.	.	ENSG00000198783	ENST00000361952	T	0.18502	2.21	4.57	2.52	0.30459	.	0.519574	0.20434	N	0.092414	T	0.16214	0.0390	L	0.44542	1.39	0.09310	N	1	B	0.23058	0.079	B	0.26517	0.07	T	0.21415	-1.0246	10	0.72032	D	0.01	-11.6925	11.1484	0.48444	0.0:0.6389:0.3611:0.0	.	7	Q96NB3	ZN830_HUMAN	D	7	ENSP00000354518:A7D	ENSP00000354518:A7D	A	+	2	0	ZNF830	30312718	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.931000	0.28871	0.817000	0.34445	0.655000	0.94253	GCC	ZNF830	-	NULL	ENSG00000198783		0.557	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF830	HGNC	protein_coding	OTTHUMT00000448018.1	47	0.00	0	C	NM_052857		33288605	33288605	+1	no_errors	ENST00000361952	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	0.000	A
ZSWIM2	151112	genome.wustl.edu	37	2	187693353	187693353	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24H-01A-11D-A167-09	TCGA-AR-A24H-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6bb61dce-289d-4e39-8298-df5abe8049a2	c1697a30-99bb-4999-b91a-36d587c1faab	g.chr2:187693353T>A	ENST00000295131.2	-	9	1299	c.1260A>T	c.(1258-1260)aaA>aaT	p.K420N		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	420					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			GATCTGGTTCTTTCTGCTTTG	0.323																																						dbGAP											0													76.0	78.0	77.0					2																	187693353		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1260A>T	2.37:g.187693353T>A	ENSP00000295131:p.Lys420Asn		B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	pfam_Znf_SWIM,pfam_Znf_ZZ,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Znf_ZZ	p.K420N	ENST00000295131.2	37	c.1260	CCDS33348.1	2	.	.	.	.	.	.	.	.	.	.	T	10.62	1.402180	0.25291	.	.	ENSG00000163012	ENST00000295131	T	0.22945	1.93	5.3	1.34	0.21922	.	0.494039	0.18897	N	0.128155	T	0.10766	0.0263	N	0.08118	0	0.21386	N	0.999703	B	0.17667	0.023	B	0.14023	0.01	T	0.19418	-1.0306	10	0.40728	T	0.16	-6.4395	4.9854	0.14187	0.0:0.1688:0.1556:0.6756	.	420	Q8NEG5	ZSWM2_HUMAN	N	420	ENSP00000295131:K420N	ENSP00000295131:K420N	K	-	3	2	ZSWIM2	187401598	0.935000	0.31712	0.970000	0.41538	0.408000	0.30992	0.926000	0.28804	0.419000	0.25927	0.482000	0.46254	AAA	ZSWIM2	-	NULL	ENSG00000163012		0.323	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM2	HGNC	protein_coding	OTTHUMT00000334565.1	70	0.00	0	T	NM_182521		187693353	187693353	-1	no_errors	ENST00000295131	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	0.896	A
