#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ALS2CR11	151254	genome.wustl.edu	37	2	202446931	202446931	+	Missense_Mutation	SNP	G	G	A	rs576434498		TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr2:202446931G>A	ENST00000286195.3	-	5	570	c.526C>T	c.(526-528)Cgt>Tgt	p.R176C	ALS2CR11_ENST00000439140.1_Missense_Mutation_p.R176C|ALS2CR11_ENST00000439802.1_Missense_Mutation_p.R176C|ALS2CR11_ENST00000450242.1_Missense_Mutation_p.R176C	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	176										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						TCATCATAACGTCTGGGAACC	0.289																																						dbGAP											0													74.0	75.0	75.0					2																	202446931		2202	4297	6499	-	-	-	SO:0001583	missense	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.526C>T	2.37:g.202446931G>A	ENSP00000286195:p.Arg176Cys		C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.R176C	ENST00000286195.3	37	c.526	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	G	17.36	3.368815	0.61624	.	.	ENSG00000155754	ENST00000286195;ENST00000439802;ENST00000439140;ENST00000450242	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.16	5.16	0.70880	.	0.588155	0.16509	N	0.211310	T	0.66867	0.2833	M	0.61703	1.905	0.45930	D	0.998765	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.988;0.951;0.991	T	0.67102	-0.5755	10	0.87932	D	0	.	16.0114	0.80406	0.0:0.0:1.0:0.0	.	176;176;176	Q53TS8-2;E9PGG4;Q53TS8	.;.;AL2SA_HUMAN	C	176	ENSP00000286195:R176C;ENSP00000400672:R176C;ENSP00000409937:R176C;ENSP00000399016:R176C	ENSP00000286195:R176C	R	-	1	0	ALS2CR11	202155176	1.000000	0.71417	1.000000	0.80357	0.521000	0.34408	2.349000	0.44054	2.838000	0.97847	0.591000	0.81541	CGT	ALS2CR11	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000155754		0.289	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	56	0.00	0	G	NM_152525		202446931	202446931	-1	no_errors	ENST00000286195	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	A
AMPH	273	genome.wustl.edu	37	7	38471799	38471799	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr7:38471799T>A	ENST00000356264.2	-	13	1363	c.1148A>T	c.(1147-1149)gAc>gTc	p.D383V	AMPH_ENST00000471913.1_5'Flank|AMPH_ENST00000428293.2_Missense_Mutation_p.D383V|AMPH_ENST00000325590.5_Missense_Mutation_p.D383V	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	383					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						CGTCCATAGGTCCCAGGGCAA	0.318																																						dbGAP											0													106.0	107.0	107.0					7																	38471799		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1148A>T	7.37:g.38471799T>A	ENSP00000348602:p.Asp383Val		A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_Amphiphysin,prints_Amphiphysin_1,prints_SH3_domain	p.D383V	ENST00000356264.2	37	c.1148	CCDS5456.1	7	.	.	.	.	.	.	.	.	.	.	T	21.0	4.086940	0.76642	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242	T;T;T	0.80566	-1.08;-1.39;-0.72	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.87497	0.6192	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.84720	0.0739	10	0.17369	T	0.5	-32.7667	15.6977	0.77512	0.0:0.0:0.0:1.0	.	383;383;139	P49418-2;P49418;Q8NFL4	.;AMPH_HUMAN;.	V	383;383;383;153	ENSP00000317441:D383V;ENSP00000348602:D383V;ENSP00000390734:D383V	ENSP00000317441:D383V	D	-	2	0	AMPH	38438324	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	5.407000	0.66363	2.112000	0.64535	0.533000	0.62120	GAC	AMPH	-	NULL	ENSG00000078053		0.318	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	96	0.00	0	T	NM_001635		38471799	38471799	-1	no_errors	ENST00000356264	ensembl	human	known	69_37n	missense	61	26.51	22	SNP	1.000	A
BCO1	53630	genome.wustl.edu	37	16	81314502	81314502	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr16:81314502C>G	ENST00000258168.2	+	8	1603	c.1142C>G	c.(1141-1143)aCa>aGa	p.T381R	BCMO1_ENST00000425577.2_Missense_Mutation_p.T312R	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						GTGGCATCTACAACAGCCACG	0.393																																						dbGAP											0													67.0	65.0	65.0					16																	81314502		2202	4300	6502	-	-	-	SO:0001583	missense	0																														ENST00000258168.2:c.1142C>G	16.37:g.81314502C>G	ENSP00000258168:p.Thr381Arg			Missense_Mutation	SNP	pfam_Carotenoid_Oase	p.T381R	ENST00000258168.2	37	c.1142	CCDS10934.1	16	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266594	0.80358	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.95377	-3.69;-3.37	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.98245	0.9419	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.991	D	0.98152	1.0442	10	0.49607	T	0.09	-25.618	19.5968	0.95544	0.0:1.0:0.0:0.0	.	312;381	E7EM88;Q9HAY6	.;BCDO1_HUMAN	R	381;312	ENSP00000258168:T381R;ENSP00000400586:T312R	ENSP00000258168:T381R	T	+	2	0	BCMO1	79872003	0.998000	0.40836	0.684000	0.30055	0.857000	0.48899	5.343000	0.65976	2.793000	0.96121	0.655000	0.94253	ACA	BCMO1	-	pfam_Carotenoid_Oase	ENSG00000135697		0.393	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	HGNC	protein_coding	OTTHUMT00000269056.1	58	0.00	0	C			81314502	81314502	+1	no_errors	ENST00000258168	ensembl	human	known	69_37n	missense	16	58.97	23	SNP	0.970	G
CACNG8	59283	genome.wustl.edu	37	19	54481413	54481413	+	Silent	SNP	C	C	T			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr19:54481413C>T	ENST00000270458.2	+	2	400	c.297C>T	c.(295-297)ggC>ggT	p.G99G		NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	99					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		TGAAAAGAGGCGTCTGCGTGA	0.632																																						dbGAP											0													39.0	35.0	36.0					19																	54481413		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.297C>T	19.37:g.54481413C>T			Q9BXT0|Q9BY23	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g8su,prints_Claudin	p.G99	ENST00000270458.2	37	c.297	CCDS33104.1	19																																																																																			CACNG8	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000142408		0.632	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	CACNG8	HGNC	protein_coding	OTTHUMT00000139361.3	16	0.00	0	C			54481413	54481413	+1	no_errors	ENST00000270458	ensembl	human	known	69_37n	silent	14	30.00	6	SNP	0.998	T
CCDC168	643677	genome.wustl.edu	37	13	103388683	103388683	+	Silent	SNP	G	G	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr13:103388683G>A	ENST00000322527.2	-	1	476	c.477C>T	c.(475-477)ttC>ttT	p.F159F		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	159																	CAGTGATGCTGAACACTTGTG	0.512																																						dbGAP											0													207.0	165.0	178.0					13																	103388683		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.477C>T	13.37:g.103388683G>A			Q8N800	Silent	SNP	NULL	p.F159	ENST00000322527.2	37	c.477		13																																																																																			CCDC168	-	NULL	ENSG00000175820		0.512	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		93	0.00	0	G	NM_001146197		103388683	103388683	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	silent	27	58.46	38	SNP	0.000	A
CERS3	204219	genome.wustl.edu	37	15	101019663	101019663	+	Silent	SNP	T	T	C			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr15:101019663T>C	ENST00000394113.1	-	9	1176	c.486A>G	c.(484-486)ttA>ttG	p.L162L	CERS3_ENST00000538112.2_Silent_p.L162L|CERS3_ENST00000284382.4_Silent_p.L162L|CERS3_ENST00000560944.1_Intron			Q8IU89	CERS3_HUMAN	ceramide synthase 3	162	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AAACCTCCCATAAGTCATATA	0.383																																						dbGAP											0													100.0	98.0	99.0					15																	101019663		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.486A>G	15.37:g.101019663T>C			Q8NE64|Q8NEN6	Silent	SNP	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,smart_TLC-dom,pfscan_TLC-dom,pfscan_Homeodomain	p.L162	ENST00000394113.1	37	c.486	CCDS10384.1	15																																																																																			CERS3	-	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000154227		0.383	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	CERS3	HGNC	protein_coding	OTTHUMT00000313594.4	68	0.00	0	T	NM_178842		101019663	101019663	-1	no_errors	ENST00000284382	ensembl	human	known	69_37n	silent	23	50.00	23	SNP	0.137	C
CYP7B1	9420	genome.wustl.edu	37	8	65528612	65528612	+	Silent	SNP	T	T	C			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr8:65528612T>C	ENST00000310193.3	-	3	659	c.486A>G	c.(484-486)aaA>aaG	p.K162K	CYP7B1_ENST00000523954.1_5'Flank	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	162					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				CAAAAACTTGTTTTAGATTCT	0.368																																						dbGAP											0													68.0	66.0	66.0					8																	65528612		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.486A>G	8.37:g.65528612T>C			B2RN07|Q9UNF5	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.K162	ENST00000310193.3	37	c.486	CCDS6180.1	8																																																																																			CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000172817		0.368	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	50	0.00	0	T			65528612	65528612	-1	no_errors	ENST00000310193	ensembl	human	known	69_37n	silent	52	11.86	7	SNP	0.005	C
FAM149B1	317662	genome.wustl.edu	37	10	74987940	74987940	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr10:74987940C>A	ENST00000242505.6	+	8	1195	c.1021C>A	c.(1021-1023)Ccg>Acg	p.P341T		NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	341										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						TACCTCAAATCCGGTAAGCCC	0.483																																						dbGAP											0													119.0	94.0	102.0					10																	74987940		692	1591	2283	-	-	-	SO:0001583	missense	0			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.1021C>A	10.37:g.74987940C>A	ENSP00000242505:p.Pro341Thr		Q9Y2I0	Missense_Mutation	SNP	pfam_DUF3719	p.P341T	ENST00000242505.6	37	c.1021	CCDS44435.1	10	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676258	0.47886	.	.	ENSG00000138286	ENST00000242505;ENST00000429173;ENST00000445951	T;T	0.46451	0.87;0.87	6.17	3.28	0.37604	.	0.872178	0.10473	N	0.670546	T	0.31295	0.0792	L	0.56769	1.78	0.80722	D	1	P;P;B	0.44627	0.839;0.828;0.44	B;B;B	0.33620	0.114;0.167;0.08	T	0.15065	-1.0450	10	0.30854	T	0.27	-19.5515	4.5425	0.12066	0.1608:0.6041:0.1548:0.0804	.	319;131;341	B4E0M2;B3KN32;Q96BN6	.;.;F149B_HUMAN	T	341;131;136	ENSP00000242505:P341T;ENSP00000402293:P136T	ENSP00000242505:P341T	P	+	1	0	FAM149B1	74657946	0.968000	0.33430	0.837000	0.33122	0.910000	0.53928	0.781000	0.26774	0.895000	0.36342	0.655000	0.94253	CCG	FAM149B1	-	NULL	ENSG00000138286		0.483	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM149B1	HGNC	protein_coding	OTTHUMT00000145438.1	74	0.00	0	C	NM_173348		74987940	74987940	+1	no_errors	ENST00000242505	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	0.983	A
FAM157B	100132403	genome.wustl.edu	37	9	141107536	141107537	+	lincRNA	INS	-	-	GCA	rs367832601|rs554298933|rs370981092		TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr9:141107536_141107537insGCA	ENST00000446912.2	+	0	19_20							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		CGgcagcggcggcagcagcagc	0.545																																						dbGAP											0																																										-	-	-			0					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107543_141107545dupGCA				RNA	INS	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			FAM157B	-	-	ENSG00000233013		0.545	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2	28	0.00	0	-	NM_001145249		141107536	141107537	+1	no_errors	ENST00000446912	ensembl	human	known	69_37n	rna	34	12.82	5	INS	0.033:0.036	GCA
FRYL	285527	genome.wustl.edu	37	4	48591834	48591834	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr4:48591834T>A	ENST00000503238.1	-	15	1567	c.1568A>T	c.(1567-1569)gAc>gTc	p.D523V	FRYL_ENST00000358350.4_Missense_Mutation_p.D523V|FRYL_ENST00000507711.1_Missense_Mutation_p.D523V|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000506685.1_Missense_Mutation_p.D229V|FRYL_ENST00000537810.1_Missense_Mutation_p.D523V			O94915	FRYL_HUMAN	FRY-like	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						AACTTCTTTGTCCAAATGTCT	0.363																																						dbGAP											0													191.0	176.0	181.0					4																	48591834		1877	4117	5994	-	-	-	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1568A>T	4.37:g.48591834T>A	ENSP00000426064:p.Asp523Val		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D523V	ENST00000503238.1	37	c.1568	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	T	27.7	4.855168	0.91355	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000506685	T;T;T;T	0.51325	1.66;1.66;1.66;0.71	5.9	5.9	0.94986	Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.71913	0.3396	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	T	0.76531	-0.2925	10	0.87932	D	0	.	16.0046	0.80354	0.0:0.0:0.0:1.0	.	523;523	F2Z2S2;O94915	.;FRYL_HUMAN	V	523;523;523;523;229	ENSP00000426064:D523V;ENSP00000351113:D523V;ENSP00000441114:D523V;ENSP00000421584:D523V	ENSP00000351113:D523V	D	-	2	0	FRYL	48286591	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.664000	0.83830	2.255000	0.74692	0.523000	0.50628	GAC	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.363	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	97	0.00	0	T			48591834	48591834	-1	no_errors	ENST00000358350	ensembl	human	known	69_37n	missense	29	43.14	22	SNP	1.000	A
GCN1L1	10985	genome.wustl.edu	37	12	120597695	120597695	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr12:120597695G>T	ENST00000300648.6	-	24	2695	c.2683C>A	c.(2683-2685)Ccc>Acc	p.P895T		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	895					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTGATCCTGGGAGCAGCCAGG	0.577																																						dbGAP											0													69.0	78.0	75.0					12																	120597695		2011	4178	6189	-	-	-	SO:0001583	missense	0			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.2683C>A	12.37:g.120597695G>T	ENSP00000300648:p.Pro895Thr		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.P895T	ENST00000300648.6	37	c.2683	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453520	0.63290	.	.	ENSG00000089154	ENST00000300648	T	0.05319	3.46	5.95	5.95	0.96441	Armadillo-like helical (1);Armadillo-type fold (1);	0.050351	0.85682	D	0.000000	T	0.13243	0.0321	M	0.75777	2.31	0.80722	D	1	P	0.39940	0.696	B	0.37601	0.254	T	0.01021	-1.1478	10	0.46703	T	0.11	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	895	Q92616	GCN1L_HUMAN	T	895	ENSP00000300648:P895T	ENSP00000300648:P895T	P	-	1	0	GCN1L1	119082078	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.115000	0.77110	2.824000	0.97209	0.655000	0.94253	CCC	GCN1L1	-	superfamily_ARM-type_fold	ENSG00000089154		0.577	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	48	0.00	0	G			120597695	120597695	-1	no_errors	ENST00000300648	ensembl	human	known	69_37n	missense	31	11.11	4	SNP	1.000	T
GTF3C1	2975	genome.wustl.edu	37	16	27492404	27492404	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr16:27492404C>A	ENST00000356183.4	-	27	4207	c.4192G>T	c.(4192-4194)Gcc>Tcc	p.A1398S	GTF3C1_ENST00000561623.1_Missense_Mutation_p.A1398S	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1398					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.A1398T(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCTTACCTGGCGAACAGCTCC	0.507																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											99.0	90.0	93.0					16																	27492404		2197	4300	6497	-	-	-	SO:0001583	missense	0			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.4192G>T	16.37:g.27492404C>A	ENSP00000348510:p.Ala1398Ser		B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.A1398S	ENST00000356183.4	37	c.4192	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512121	0.27036	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.20463	2.07	5.64	3.3	0.37823	.	0.375050	0.26738	N	0.022747	T	0.12050	0.0293	L	0.39020	1.185	0.29463	N	0.857609	B;B	0.32010	0.033;0.351	B;B	0.27715	0.02;0.082	T	0.14392	-1.0474	10	0.08381	T	0.77	.	7.5862	0.27993	0.1256:0.675:0.1226:0.0768	.	1398;1398	Q12789;Q12789-3	TF3C1_HUMAN;.	S	1398;1394	ENSP00000348510:A1398S	ENSP00000348510:A1398S	A	-	1	0	GTF3C1	27399905	0.934000	0.31675	1.000000	0.80357	0.991000	0.79684	0.017000	0.13399	1.338000	0.45544	0.655000	0.94253	GCC	GTF3C1	-	NULL	ENSG00000077235		0.507	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	54	0.00	0	C	NM_001520		27492404	27492404	-1	no_errors	ENST00000356183	ensembl	human	known	69_37n	missense	33	34.62	18	SNP	1.000	A
HEXB	3074	genome.wustl.edu	37	5	74014695	74014695	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr5:74014695C>G	ENST00000261416.7	+	11	1433	c.1316C>G	c.(1315-1317)tCt>tGt	p.S439C	HEXB_ENST00000513539.1_Intron|HEXB_ENST00000511181.1_Missense_Mutation_p.S214C|HEXB_ENST00000509579.1_5'Flank|GFM2_ENST00000515125.1_5'Flank	NM_000521.3	NP_000512	P07686	HEXB_HUMAN	hexosaminidase B (beta polypeptide)	439					astrocyte cell migration (GO:0043615)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|ganglioside catabolic process (GO:0006689)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|lipid storage (GO:0019915)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|male courtship behavior (GO:0008049)|myelination (GO:0042552)|neuromuscular process controlling balance (GO:0050885)|oligosaccharide catabolic process (GO:0009313)|oogenesis (GO:0048477)|penetration of zona pellucida (GO:0007341)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(3)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.72e-57)		GTCACAGCATCTGGCTTCCCT	0.418																																					Melanoma(66;841 1270 13391 18706 27225)	dbGAP											0													188.0	174.0	179.0					5																	74014695		2203	4300	6503	-	-	-	SO:0001583	missense	0			M13519	CCDS4022.1	5q13.3	2012-10-02			ENSG00000049860	ENSG00000049860	3.2.1.52		4879	protein-coding gene	gene with protein product		606873				2579389, 3013851	Standard	NM_000521		Approved		uc003kdf.4	P07686	OTTHUMG00000102057	ENST00000261416.7:c.1316C>G	5.37:g.74014695C>G	ENSP00000261416:p.Ser439Cys			Missense_Mutation	SNP	pfam_Glyco_hydro_20_cat-core,pfam_Glyco_hydro_20b,superfamily_Glycoside_hydrolase_SF,prints_Beta_hexosaminidase_sua/sub	p.S439C	ENST00000261416.7	37	c.1316	CCDS4022.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.81|14.81	2.646790|2.646790	0.47258|0.47258	.|.	.|.	ENSG00000049860|ENSG00000049860	ENST00000513336|ENST00000511181;ENST00000261416	.|D;D	.|0.95885	.|-3.84;-3.84	5.98|5.98	4.19|4.19	0.49359|0.49359	.|Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);	.|0.491515	.|0.22581	.|N	.|0.058213	D|D	0.96100|0.96100	0.8729|0.8729	M|M	0.75884|0.75884	2.315|2.315	0.80722|0.80722	D|D	1|1	.|P	.|0.45283	.|0.855	.|P	.|0.51324	.|0.666	D|D	0.95324|0.95324	0.8423|0.8423	5|10	.|0.87932	.|D	.|0	-6.5787|-6.5787	11.8345|11.8345	0.52316|0.52316	0.2479:0.6328:0.1193:0.0|0.2479:0.6328:0.1193:0.0	.|.	.|439	.|P07686	.|HEXB_HUMAN	M|C	84|214;439	.|ENSP00000426285:S214C;ENSP00000261416:S439C	.|ENSP00000261416:S439C	I|S	+|+	3|2	3|0	HEXB|HEXB	74050451|74050451	1.000000|1.000000	0.71417|0.71417	0.079000|0.079000	0.20413|0.20413	0.082000|0.082000	0.17680|0.17680	3.705000|3.705000	0.54823|0.54823	0.855000|0.855000	0.35359|0.35359	0.585000|0.585000	0.79938|0.79938	ATC|TCT	HEXB	-	pfam_Glyco_hydro_20_cat-core,superfamily_Glycoside_hydrolase_SF	ENSG00000049860		0.418	HEXB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEXB	HGNC	protein_coding	OTTHUMT00000219859.6	99	0.00	0	C	NM_000521		74014695	74014695	+1	no_errors	ENST00000261416	ensembl	human	known	69_37n	missense	101	16.53	20	SNP	0.964	G
KRTAP4-16P	85354	genome.wustl.edu	37	17	39258126	39258126	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr17:39258126G>T	ENST00000440582.1	-	1	335	c.336C>A	c.(334-336)agC>agA	p.S112R						keratin associated protein 4-16, pseudogene											haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						ggcagcagctgctggagatgc	0.642																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AC025904		17q21.2	2013-06-25	2010-01-06	2010-01-06	ENSG00000241241	ENSG00000241241		"""Keratin associated proteins"""	18921	pseudogene	pseudogene			"""keratin associated protein 4 pseudogene 1"""	KRTAP4P1			Standard	NG_005311		Approved	KAP4A			OTTHUMG00000133590	ENST00000440582.1:c.336C>A	17.37:g.39258126G>T	ENSP00000411198:p.Ser112Arg			Missense_Mutation	SNP	NULL	p.S112R	ENST00000440582.1	37	c.336		17	.	.	.	.	.	.	.	.	.	.	.	3.211	-0.161650	0.06502	.	.	ENSG00000241241	ENST00000440582	T	0.00737	5.76	2.5	2.5	0.30297	.	.	.	.	.	T	0.01254	0.0041	.	.	.	0.23396	N	0.997763	.	.	.	.	.	.	T	0.51116	-0.8746	6	0.56958	D	0.05	.	8.5586	0.33496	0.0:0.0:1.0:0.0	.	.	.	.	R	112	ENSP00000411198:S112R	ENSP00000411198:S112R	S	-	3	2	AC100808.7	36511652	.	.	0.990000	0.47175	0.114000	0.19823	.	.	1.397000	0.46682	0.184000	0.17185	AGC	KRTAP4-16P	-	NULL	ENSG00000241241		0.642	KRTAP4-16P-001	PUTATIVE	basic|appris_principal	protein_coding	KRTAP4-16P	HGNC	protein_coding	OTTHUMT00000257694.1	15	0.00	0	G	NG_005311		39258126	39258126	-1	no_errors	ENST00000440582	ensembl	human	putative	69_37n	missense	21	25.00	7	SNP	0.999	T
MGAM	8972	genome.wustl.edu	37	7	141794262	141794262	+	Intron	SNP	C	C	T			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr7:141794262C>T	ENST00000549489.2	+	39	4713				MGAM_ENST00000475668.2_Missense_Mutation_p.T2424I	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGAGACAACACAGCCGCGTGG	0.617																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4619-158C>T	7.37:g.141794262C>T			Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.T2425I	ENST00000549489.2	37	c.7274	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	C	4.764	0.142036	0.09083	.	.	ENSG00000257335	ENST00000475668	.	.	.	5.15	4.25	0.50352	.	.	.	.	.	T	0.34106	0.0886	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.19516	-1.0303	5	0.22109	T	0.4	.	10.385	0.44134	0.1514:0.7023:0.1464:0.0	.	.	.	.	I	2425	.	ENSP00000417515:T2425I	T	+	2	0	MGAM	141440731	0.390000	0.25213	0.842000	0.33263	0.228000	0.25075	1.016000	0.29976	1.253000	0.44018	0.655000	0.94253	ACA	MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.617	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	42	0.00	0	C			141794262	141794262	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	missense	28	47.17	25	SNP	0.343	T
NMI	9111	genome.wustl.edu	37	2	152139454	152139454	+	Silent	SNP	A	A	G			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr2:152139454A>G	ENST00000243346.5	-	2	479	c.9T>C	c.(7-9)gcT>gcC	p.A3A		NM_004688.2	NP_004679.2	Q13287	NMI_HUMAN	N-myc (and STAT) interactor	3					inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription cofactor activity (GO:0003712)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.0571)		CATCTTTATCAGCTTCCATGA	0.264																																						dbGAP											0													50.0	50.0	50.0					2																	152139454		2198	4289	6487	-	-	-	SO:0001819	synonymous_variant	0			U32849	CCDS2192.1	2q23	2008-05-23			ENSG00000123609	ENSG00000123609			7854	protein-coding gene	gene with protein product		603525				8668343, 9989503	Standard	NM_004688		Approved		uc002txi.2	Q13287	OTTHUMG00000131867	ENST00000243346.5:c.9T>C	2.37:g.152139454A>G			B5BU69|Q53TI8|Q9BVE5	Silent	SNP	pfam_Nmi/IFP35,pfam_Interferon_induced_35kDa_N	p.A3	ENST00000243346.5	37	c.9	CCDS2192.1	2																																																																																			NMI	-	NULL	ENSG00000123609		0.264	NMI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMI	HGNC	protein_coding	OTTHUMT00000254817.2	106	0.00	0	A	NM_004688		152139454	152139454	-1	no_errors	ENST00000243346	ensembl	human	known	69_37n	silent	33	45.90	28	SNP	0.000	G
OR4A5	81318	genome.wustl.edu	37	11	51412226	51412226	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr11:51412226A>T	ENST00000319760.6	-	1	222	c.170T>A	c.(169-171)aTg>aAg	p.M57K		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				GAAGAAATACATTGGGGAACC	0.408																																						dbGAP											0													61.0	58.0	59.0					11																	51412226		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.170T>A	11.37:g.51412226A>T	ENSP00000367664:p.Met57Lys		Q6IF84	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M57K	ENST00000319760.6	37	c.170	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	13.03	2.114797	0.37339	.	.	ENSG00000221840	ENST00000319760	T	0.09911	2.93	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000020	T	0.42040	0.1185	H	0.99026	4.405	0.36169	D	0.84862	P	0.52577	0.954	P	0.59948	0.866	T	0.60979	-0.7155	10	0.87932	D	0	.	7.8263	0.29318	1.0:0.0:0.0:0.0	.	57	Q8NH83	OR4A5_HUMAN	K	57	ENSP00000367664:M57K	ENSP00000367664:M57K	M	-	2	0	OR4A5	51268802	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	7.715000	0.84713	1.143000	0.42306	0.136000	0.15936	ATG	OR4A5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000221840		0.408	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	56	0.00	0	A	NM_001005272		51412226	51412226	-1	no_errors	ENST00000319760	ensembl	human	known	69_37n	missense	34	35.71	20	SNP	1.000	T
PKDREJ	10343	genome.wustl.edu	37	22	46657914	46657914	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr22:46657914G>A	ENST00000253255.5	-	1	1305	c.1306C>T	c.(1306-1308)Cgg>Tgg	p.R436W		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	436	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GAGTCCTTCCGAATCACCATT	0.488																																						dbGAP											0													109.0	103.0	105.0					22																	46657914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.1306C>T	22.37:g.46657914G>A	ENSP00000253255:p.Arg436Trp		B1AJY3|O95850	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_LipOase_LH2,pfscan_LipOase_LH2,pfscan_REJ-like,prints_PKD_2	p.R436W	ENST00000253255.5	37	c.1306	CCDS14073.1	22	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533282	0.64972	.	.	ENSG00000130943	ENST00000253255	T	0.70631	-0.5	5.18	0.288	0.15719	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	1.142330	0.06544	N	0.743741	T	0.61825	0.2378	N	0.22421	0.69	0.09310	N	1	D	0.63880	0.993	P	0.47376	0.545	T	0.54390	-0.8301	10	0.46703	T	0.11	-1.1304	9.0782	0.36536	0.0:0.2527:0.3574:0.3899	.	436	Q9NTG1	PKDRE_HUMAN	W	436	ENSP00000253255:R436W	ENSP00000253255:R436W	R	-	1	2	PKDREJ	45036578	0.000000	0.05858	0.000000	0.03702	0.212000	0.24457	0.064000	0.14437	-0.028000	0.13850	0.655000	0.94253	CGG	PKDREJ	-	pfam_PKD/REJ-like,pfscan_REJ-like	ENSG00000130943		0.488	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	52	0.00	0	G	NM_006071		46657914	46657914	-1	no_errors	ENST00000253255	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	0.013	A
POM121	9883	genome.wustl.edu	37	7	72413723	72413724	+	In_Frame_Ins	INS	-	-	CTC	rs67569765|rs148686669	byFrequency	TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr7:72413723_72413724insCTC	ENST00000434423.2	+	11	3191_3192	c.3191_3192insCTC	c.(3190-3195)ttcttc>ttCTCcttc	p.1064_1065FF>FSF	POM121_ENST00000358357.3_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000446813.1_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000257622.4_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000395270.1_In_Frame_Ins_p.799_800FF>FSF			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1064	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				ACTGCTGTCTTCTTCGGTGCAG	0.663																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	Exception_encountered	7.37:g.72413723_72413724insCTC	ENSP00000405562:p.Phe1064_Phe1065insSer		A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	In_Frame_Ins	INS	NULL	p.1065in_frame_insS	ENST00000434423.2	37	c.3191_3192		7																																																																																			POM121	-	NULL	ENSG00000196313		0.663	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	16	0.00	0	-			72413723	72413724	+1	no_errors	ENST00000434423	ensembl	human	known	69_37n	in_frame_ins	20	16.67	4	INS	0.980:0.870	CTC
POTEE	445582	genome.wustl.edu	37	2	132021946	132021946	+	Missense_Mutation	SNP	G	G	A	rs62178369	byFrequency	TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr2:132021946G>A	ENST00000356920.5	+	15	3012	c.2918G>A	c.(2917-2919)gGc>gAc	p.G973D	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	973	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GAATCCTGTGGCATCCATGAA	0.572																																						dbGAP											0													2.0	1.0	1.0					2																	132021946		585	948	1533	-	-	-	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2918G>A	2.37:g.132021946G>A	ENSP00000439189:p.Gly973Asp		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.G973D	ENST00000356920.5	37	c.2918	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	15.99	2.994529	0.54041	.	.	ENSG00000188219	ENST00000356920	D	0.97352	-4.35	.	.	.	.	.	.	.	.	D	0.99074	0.9682	H	0.99946	5.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96048	0.9029	8	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	973	Q6S8J3	POTEE_HUMAN	D	973	ENSP00000439189:G973D	ENSP00000439189:G973D	G	+	2	0	AC131180.1	131738416	1.000000	0.71417	0.305000	0.25099	0.308000	0.27856	6.504000	0.73704	0.119000	0.18210	0.121000	0.15741	GGC	AC131180.1	-	pfam_Actin-like,smart_Actin-like	ENSG00000188219		0.572	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	Clone_based_ensembl_gene	protein_coding		11	0.00	0	G	NM_001083538		132021946	132021946	+1	no_errors	ENST00000356920	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	1.000	A
RBM14	10432	genome.wustl.edu	37	11	66393101	66393101	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr11:66393101G>A	ENST00000310137.4	+	2	1893	c.1754G>A	c.(1753-1755)cGg>cAg	p.R585Q	RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM14-RBM4_ENST00000511114.1_Intron|RBM14_ENST00000409738.4_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM4_ENST00000503028.2_Intron|RBM14_ENST00000393979.3_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	585					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						TCCCCACCCCGGGCCAGCTAC	0.667																																						dbGAP											0													28.0	30.0	30.0					11																	66393101		2180	4267	6447	-	-	-	SO:0001583	missense	0			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1754G>A	11.37:g.66393101G>A	ENSP00000311747:p.Arg585Gln		B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R585Q	ENST00000310137.4	37	c.1754	CCDS8147.1	11	.	.	.	.	.	.	.	.	.	.	G	11.81	1.750051	0.30955	.	.	ENSG00000239306	ENST00000310137	D	0.85339	-1.97	5.22	4.32	0.51571	.	0.198199	0.44285	N	0.000479	T	0.73289	0.3568	N	0.14661	0.345	0.80722	D	1	B	0.18461	0.028	B	0.09377	0.004	T	0.70999	-0.4719	10	0.87932	D	0	-4.9551	11.505	0.50461	0.0864:0.0:0.9136:0.0	.	585	Q96PK6	RBM14_HUMAN	Q	585	ENSP00000311747:R585Q	ENSP00000311747:R585Q	R	+	2	0	RBM14	66149677	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.552000	0.60747	1.444000	0.47605	0.655000	0.94253	CGG	RBM14	-	NULL	ENSG00000239306		0.667	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	HGNC	protein_coding	OTTHUMT00000277128.1	20	0.00	0	G	NM_006328		66393101	66393101	+1	no_errors	ENST00000310137	ensembl	human	known	69_37n	missense	7	75.00	21	SNP	1.000	A
SCN4A	6329	genome.wustl.edu	37	17	62019253	62019253	+	Silent	SNP	G	G	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr17:62019253G>A	ENST00000435607.1	-	24	4465	c.4389C>T	c.(4387-4389)cgC>cgT	p.R1463R	SCN4A_ENST00000578147.1_Silent_p.R1463R	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1463					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCTTGGCCCCGCGGATCAGCC	0.617																																						dbGAP											0													62.0	62.0	62.0					17																	62019253		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.4389C>T	17.37:g.62019253G>A			Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R1463	ENST00000435607.1	37	c.4389	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000007314		0.617	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		40	0.00	0	G	NM_000334		62019253	62019253	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	68	16.05	13	SNP	0.212	A
SLCO1C1	53919	genome.wustl.edu	37	12	20852607	20852607	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr12:20852607G>A	ENST00000266509.2	+	2	465	c.97G>A	c.(97-99)Gaa>Aaa	p.E33K	SLCO1C1_ENST00000540354.1_Missense_Mutation_p.E33K|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.E33K|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.E33K|SLCO1C1_ENST00000545102.1_Intron	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	33					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.E33K(1)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TCCCTCCTCAGAAGAAAAGCA	0.373																																						dbGAP											1	Substitution - Missense(1)	skin(1)											58.0	58.0	58.0					12																	20852607		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.97G>A	12.37:g.20852607G>A	ENSP00000266509:p.Glu33Lys		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.E33K	ENST00000266509.2	37	c.97	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	G	12.05	1.821572	0.32237	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	4.85	1.3	0.21679	Major facilitator superfamily domain, general substrate transporter (1);	1.085690	0.06893	N	0.804657	T	0.29158	0.0725	N	0.08118	0	0.20307	N	0.999914	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.22591	-1.0212	10	0.05721	T	0.95	.	3.2606	0.06848	0.4099:0.0:0.4093:0.1809	.	33;33;33	B7Z3Q3;Q5JPA4;Q9NYB5	.;.;SO1C1_HUMAN	K	33	ENSP00000444149:E33K;ENSP00000438665:E33K;ENSP00000266509:E33K;ENSP00000370964:E33K	ENSP00000266509:E33K	E	+	1	0	SLCO1C1	20743874	1.000000	0.71417	0.537000	0.28052	0.985000	0.73830	1.205000	0.32308	0.054000	0.16065	0.650000	0.86243	GAA	SLCO1C1	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000139155		0.373	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	40	0.00	0	G	NM_017435		20852607	20852607	+1	no_errors	ENST00000381552	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	0.278	A
SNTG1	54212	genome.wustl.edu	37	8	51503450	51503450	+	Silent	SNP	C	C	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr8:51503450C>A	ENST00000522124.1	+	13	1483	c.822C>A	c.(820-822)atC>atA	p.I274I	SNTG1_ENST00000276467.5_Silent_p.I274I|SNTG1_ENST00000517473.1_Silent_p.I274I|SNTG1_ENST00000518864.1_Silent_p.I274I	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	274					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TTAAAAAAATCAACAGAAACT	0.274																																						dbGAP											0													19.0	21.0	20.0					8																	51503450		2187	4262	6449	-	-	-	SO:0001819	synonymous_variant	0			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.822C>A	8.37:g.51503450C>A			Q2M3Q0|Q9NY98	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.Q48K	ENST00000522124.1	37	c.142	CCDS6147.1	8																																																																																			SNTG1	-	NULL	ENSG00000147481		0.274	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	79	0.00	0	C			51503450	51503450	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524004	ensembl	human	known	69_37n	missense	57	19.44	14	SNP	1.000	A
SRGAP3	9901	genome.wustl.edu	37	3	9068659	9068659	+	Silent	SNP	C	C	T	rs149562515		TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr3:9068659C>T	ENST00000383836.3	-	13	1987	c.1560G>A	c.(1558-1560)ccG>ccA	p.P520P	SRGAP3_ENST00000433332.3_5'UTR|SRGAP3_ENST00000360413.3_Silent_p.P496P	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	520	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CGACTACAAGCGGTATAGCTT	0.433			T	RAF1	pilocytic astrocytoma																																	dbGAP		Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													130.0	127.0	128.0					3																	9068659		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1560G>A	3.37:g.9068659C>T			Q8IX13|Q8IZV8	Silent	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.P520	ENST00000383836.3	37	c.1560	CCDS2572.1	3																																																																																			SRGAP3	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000196220		0.433	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	55	0.00	0	C			9068659	9068659	-1	no_errors	ENST00000383836	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.017	T
TFB2M	64216	genome.wustl.edu	37	1	246714526	246714526	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr1:246714526C>T	ENST00000366514.4	-	5	969	c.784G>A	c.(784-786)Gtt>Att	p.V262I	TFB2M_ENST00000544618.1_3'UTR	NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	262					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			ATGTGCAGAACCTTAATCTCA	0.383																																						dbGAP											0													88.0	90.0	89.0					1																	246714526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.784G>A	1.37:g.246714526C>T	ENSP00000355471:p.Val262Ile		Q9H626	Missense_Mutation	SNP	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur	p.V262I	ENST00000366514.4	37	c.784	CCDS1627.1	1	.	.	.	.	.	.	.	.	.	.	C	9.333	1.061144	0.19987	.	.	ENSG00000162851	ENST00000366514	T	0.29655	1.56	5.05	-1.96	0.07525	.	0.521943	0.19382	N	0.115634	T	0.18045	0.0433	L	0.38531	1.155	0.80722	D	1	B	0.26902	0.163	B	0.27076	0.076	T	0.23619	-1.0183	10	0.09590	T	0.72	-1.6774	9.1929	0.37211	0.1496:0.497:0.3533:0.0	.	262	Q9H5Q4	TFB2M_HUMAN	I	262	ENSP00000355471:V262I	ENSP00000355471:V262I	V	-	1	0	TFB2M	244781149	1.000000	0.71417	0.163000	0.22734	0.087000	0.18053	1.378000	0.34328	-0.772000	0.04602	-0.305000	0.09177	GTT	TFB2M	-	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur	ENSG00000162851		0.383	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFB2M	HGNC	protein_coding	OTTHUMT00000096673.1	93	0.00	0	C	NM_022366		246714526	246714526	-1	no_errors	ENST00000366514	ensembl	human	known	69_37n	missense	34	35.85	19	SNP	0.997	T
TRPV3	162514	genome.wustl.edu	37	17	3435985	3435985	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr17:3435985G>A	ENST00000576742.1	-	8	1352	c.1031C>T	c.(1030-1032)cCg>cTg	p.P344L	TRPV3_ENST00000301365.4_Missense_Mutation_p.P344L|TRPV3_ENST00000572519.1_Missense_Mutation_p.P344L	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	344					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	CAGCTGCAGCGGCGTGAGGCC	0.627																																						dbGAP											0													88.0	69.0	75.0					17																	3435985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1031C>T	17.37:g.3435985G>A	ENSP00000461518:p.Pro344Leu		Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel	p.P344L	ENST00000576742.1	37	c.1031	CCDS11029.1	17	.	.	.	.	.	.	.	.	.	.	G	22.3	4.278258	0.80692	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	T	0.79141	-1.24	5.31	5.31	0.75309	Ankyrin repeat-containing domain (3);	0.081748	0.52532	D	0.000065	D	0.89873	0.6841	M	0.87682	2.9	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.995;0.998;0.922;0.998;0.966;0.98;0.928	D	0.91305	0.5070	10	0.87932	D	0	-13.2107	18.3468	0.90325	0.0:0.0:1.0:0.0	.	328;328;344;328;344;344;344	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	L	344;344;328	ENSP00000301365:P344L	ENSP00000301365:P344L	P	-	2	0	TRPV3	3382735	1.000000	0.71417	0.974000	0.42286	0.444000	0.32077	9.391000	0.97249	2.654000	0.90174	0.561000	0.74099	CCG	TRPV3	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000167723		0.627	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPV3	HGNC	protein_coding	OTTHUMT00000207379.2	27	0.00	0	G	NM_145068		3435985	3435985	-1	no_errors	ENST00000301365	ensembl	human	known	69_37n	missense	8	52.94	9	SNP	1.000	A
ZBTB4	57659	genome.wustl.edu	37	17	7366623	7366623	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chr17:7366623G>A	ENST00000311403.4	-	4	2017	c.1678C>T	c.(1678-1680)Cgg>Tgg	p.R560W	ZBTB4_ENST00000380599.4_Missense_Mutation_p.R560W	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	560					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		CGTGGATTCCGGCCCTTGGCC	0.706																																						dbGAP											0													17.0	19.0	18.0					17																	7366623		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.1678C>T	17.37:g.7366623G>A	ENSP00000307858:p.Arg560Trp		B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R560W	ENST00000311403.4	37	c.1678	CCDS11107.1	17	.	.	.	.	.	.	.	.	.	.	G	15.45	2.835900	0.50951	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.04970	3.52;3.52	4.97	2.78	0.32641	.	0.311390	0.23427	N	0.048283	T	0.03695	0.0105	N	0.19112	0.55	0.30675	N	0.752926	P	0.51537	0.946	B	0.37422	0.249	T	0.29701	-1.0003	10	0.38643	T	0.18	-8.6019	9.4047	0.38453	0.0:0.0:0.585:0.415	.	560	Q9P1Z0	ZBTB4_HUMAN	W	560	ENSP00000307858:R560W;ENSP00000369973:R560W	ENSP00000307858:R560W	R	-	1	2	ZBTB4	7307347	0.008000	0.16893	1.000000	0.80357	0.992000	0.81027	0.182000	0.16900	1.278000	0.44430	0.462000	0.41574	CGG	ZBTB4	-	NULL	ENSG00000174282		0.706	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB4	HGNC	protein_coding	OTTHUMT00000226940.2	26	0.00	0	G	NM_020899		7366623	7366623	-1	no_errors	ENST00000311403	ensembl	human	known	69_37n	missense	8	66.67	18	SNP	0.995	A
ZDHHC9	51114	genome.wustl.edu	37	X	128948763	128948763	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A24V-01A-21D-A167-09	TCGA-AR-A24V-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb77af66-bb8f-4590-9be8-5f729373c555	001b2ef0-526e-46f5-8e76-f315023c070c	g.chrX:128948763C>T	ENST00000357166.6	-	6	887	c.496G>A	c.(496-498)Gac>Aac	p.D166N	ZDHHC9_ENST00000371064.3_Missense_Mutation_p.D166N	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	166					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						CAGTGATGGTCGAAGCGCTCT	0.483																																						dbGAP											0													99.0	84.0	89.0					X																	128948763		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.496G>A	X.37:g.128948763C>T	ENSP00000349689:p.Asp166Asn		B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.D166N	ENST00000357166.6	37	c.496	CCDS35395.1	X	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998593	0.93227	.	.	ENSG00000188706	ENST00000357166;ENST00000371064;ENST00000406492	T;T;T	0.54279	0.58;0.58;0.58	5.92	5.06	0.68205	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.85613	0.5737	H	0.99909	4.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91554	0.5259	10	0.87932	D	0	-17.3655	13.7833	0.63094	0.0:0.9239:0.0:0.0761	.	166	Q9Y397	ZDHC9_HUMAN	N	166	ENSP00000349689:D166N;ENSP00000360103:D166N;ENSP00000383991:D166N	ENSP00000349689:D166N	D	-	1	0	ZDHHC9	128776444	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	1.246000	0.43901	0.594000	0.82650	GAC	ZDHHC9	-	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	ENSG00000188706		0.483	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC9	HGNC	protein_coding	OTTHUMT00000058213.1	51	0.00	0	C	NM_016032		128948763	128948763	-1	no_errors	ENST00000357166	ensembl	human	known	69_37n	missense	30	31.82	14	SNP	1.000	T
