#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC5	10057	genome.wustl.edu	37	3	183643468	183643468	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr3:183643468C>G	ENST00000334444.6	-	29	4327	c.4087G>C	c.(4087-4089)Gag>Cag	p.E1363Q	ABCC5_ENST00000265586.6_Missense_Mutation_p.E1320Q	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1363	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	AAGTCTGTCTCTGTGTCCATG	0.458																																						dbGAP											0													137.0	132.0	134.0					3																	183643468		2026	4187	6213	-	-	-	SO:0001583	missense	0			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.4087G>C	3.37:g.183643468C>G	ENSP00000333926:p.Glu1363Gln		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.E1363Q	ENST00000334444.6	37	c.4087	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503942	0.85176	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	T;T	0.80214	-1.35;-1.35	4.91	4.91	0.64330	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.057863	0.64402	D	0.000002	T	0.79736	0.4497	L	0.29908	0.895	0.58432	D	0.999993	P;P	0.50066	0.931;0.475	P;B	0.52031	0.688;0.126	T	0.77720	-0.2482	10	0.30078	T	0.28	-24.3741	18.2928	0.90136	0.0:1.0:0.0:0.0	.	1320;1363	Q86UX3;O15440	.;MRP5_HUMAN	Q	1363;1320	ENSP00000333926:E1363Q;ENSP00000265586:E1320Q	ENSP00000265586:E1320Q	E	-	1	0	ABCC5	185126162	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.839000	0.69395	2.554000	0.86153	0.655000	0.94253	GAG	ABCC5	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000114770		0.458	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1	71	0.00	0	C	NM_005688		183643468	183643468	-1	no_errors	ENST00000334444	ensembl	human	known	69_37n	missense	72	12.20	10	SNP	1.000	G
ACAD8	27034	genome.wustl.edu	37	11	134131253	134131253	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr11:134131253T>C	ENST00000281182.4	+	8	1032	c.926T>C	c.(925-927)cTg>cCg	p.L309P	ACAD8_ENST00000374752.4_Missense_Mutation_p.L182P|ACAD8_ENST00000537423.1_Missense_Mutation_p.L232P|ACAD8_ENST00000543332.1_Missense_Mutation_p.L211P|ACAD8_ENST00000524547.1_3'UTR	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	309					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	GGAGAGCCTCTGGCCAGTAAC	0.602																																					GBM(65;238 1125 33403 41853 48889)	dbGAP											0													83.0	84.0	83.0					11																	134131253		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.926T>C	11.37:g.134131253T>C	ENSP00000281182:p.Leu309Pro		B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	SNP	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C	p.L309P	ENST00000281182.4	37	c.926	CCDS8498.1	11	.	.	.	.	.	.	.	.	.	.	T	23.9	4.470221	0.84533	.	.	ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000543332;ENST00000374752	D;D;D;D	0.97279	-4.2;-4.2;-4.32;-4.2	5.35	5.35	0.76521	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.99083	0.9685	H	0.97806	4.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.996	D	0.99136	1.0854	10	0.87932	D	0	.	15.3046	0.73982	0.0:0.0:0.0:1.0	.	232;182;309	B7Z5W4;Q6ZWP6;Q9UKU7	.;.;ACAD8_HUMAN	P	309;232;211;182	ENSP00000281182:L309P;ENSP00000443763:L232P;ENSP00000438302:L211P;ENSP00000363884:L182P	ENSP00000281182:L309P	L	+	2	0	ACAD8	133636463	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	7.520000	0.81821	2.032000	0.59987	0.459000	0.35465	CTG	ACAD8	-	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCo_DH/oxidase_C	ENSG00000151498		0.602	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD8	HGNC	protein_coding	OTTHUMT00000393607.1	45	0.00	0	T	NM_014384		134131253	134131253	+1	no_errors	ENST00000281182	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	1.000	C
ANGEL2	90806	genome.wustl.edu	37	1	213178661	213178661	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:213178661C>A	ENST00000366962.3	-	5	1002	c.848G>T	c.(847-849)aGa>aTa	p.R283I	ANGEL2_ENST00000360506.2_Missense_Mutation_p.R114I|ANGEL2_ENST00000540642.1_Missense_Mutation_p.R157I|ANGEL2_ENST00000544555.1_Missense_Mutation_p.R114I|ANGEL2_ENST00000535388.1_Missense_Mutation_p.R114I	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	283										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		AACATTGTCTCTGTCCAACAG	0.423																																						dbGAP											0													93.0	93.0	93.0					1																	213178661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.848G>T	1.37:g.213178661C>A	ENSP00000355929:p.Arg283Ile		B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.R283I	ENST00000366962.3	37	c.848	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.280866	0.95489	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642;ENST00000535388	D;D;D;D;D	0.96334	-3.98;-3.65;-3.65;-3.98;-3.65	5.45	5.45	0.79879	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	D	0.98532	0.9510	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.99267	1.0892	10	0.87932	D	0	-20.2607	19.6597	0.95861	0.0:1.0:0.0:0.0	.	157;283	F5H476;Q5VTE6	.;ANGE2_HUMAN	I	283;114;114;157;114	ENSP00000355929:R283I;ENSP00000353696:R114I;ENSP00000443193:R114I;ENSP00000446124:R157I;ENSP00000438141:R114I	ENSP00000353696:R114I	R	-	2	0	ANGEL2	211245284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.354000	0.79424	2.708000	0.92522	0.650000	0.86243	AGA	ANGEL2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000174606		0.423	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	HGNC	protein_coding	OTTHUMT00000089693.1	41	0.00	0	C	NM_144567		213178661	213178661	-1	no_errors	ENST00000366962	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	1.000	A
APOBR	55911	genome.wustl.edu	37	16	28507424	28507424	+	Intron	SNP	C	C	T	rs148114931|rs441214	byFrequency	TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr16:28507424C>T	ENST00000431282.1	+	3	1058				CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Silent_p.A354A|APOBR_ENST00000328423.5_Intron			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGGAGGAGGCCGGGACAGCCT	0.711																																						dbGAP											0													8.0	11.0	10.0					16																	28507424		1858	4004	5862	-	-	-	SO:0001627	intron_variant	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1049-14C>T	16.37:g.28507424C>T			H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	NULL	p.A354	ENST00000431282.1	37	c.1062		16																																																																																			APOBR	-	NULL	ENSG00000184730		0.711	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		10	0.00	0	C	NM_182804		28507424	28507424	+1	no_errors	ENST00000564831	ensembl	human	known	69_37n	silent	19	20.83	5	SNP	0.000	T
ANKRD11	29123	genome.wustl.edu	37	16	89349778	89349778	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr16:89349778C>G	ENST00000301030.4	-	9	3632	c.3172G>C	c.(3172-3174)Gag>Cag	p.E1058Q	ANKRD11_ENST00000378330.2_Missense_Mutation_p.E1058Q	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1058	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCTTTTTTCTCTTTAAAACAT	0.363																																						dbGAP											0													120.0	129.0	126.0					16																	89349778		2198	4300	6498	-	-	-	SO:0001583	missense	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.3172G>C	16.37:g.89349778C>G	ENSP00000301030:p.Glu1058Gln		Q6NTG1|Q6QMF8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1058Q	ENST00000301030.4	37	c.3172	CCDS32513.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.8|21.8	4.198505|4.198505	0.79015|0.79015	.|.	.|.	ENSG00000167522|ENSG00000167522	ENST00000301030;ENST00000378330|ENST00000330736	T;T|.	0.44881|.	0.91;0.91|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.067420|.	0.64402|.	D|.	0.000016|.	T|T	0.75817|0.75817	0.3901|0.3901	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	D|.	0.57899|.	0.981|.	P|.	0.52109|.	0.69|.	T|T	0.77225|0.77225	-0.2666|-0.2666	10|6	0.36615|0.87932	T|D	0.2|0	.|.	19.7404|19.7404	0.96228|0.96228	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1058|.	Q6UB99|.	ANR11_HUMAN|.	Q|N	1058|608	ENSP00000301030:E1058Q;ENSP00000367581:E1058Q|.	ENSP00000301030:E1058Q|ENSP00000330815:K608N	E|K	-|-	1|3	0|2	ANKRD11|ANKRD11	87877279|87877279	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.982000|0.982000	0.71751|0.71751	7.663000|7.663000	0.83820|0.83820	2.734000|2.734000	0.93682|0.93682	0.655000|0.655000	0.94253|0.94253	GAG|AAG	ANKRD11	-	NULL	ENSG00000167522		0.363	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	77	0.00	0	C	NM_013275		89349778	89349778	-1	no_errors	ENST00000301030	ensembl	human	known	69_37n	missense	125	17.22	26	SNP	1.000	G
SMIM7	79086	genome.wustl.edu	37	19	16764862	16764862	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr19:16764862delT	ENST00000487416.2	-	4	242	c.196delA	c.(196-198)atgfs	p.M66fs	CTC-429P9.4_ENST00000600705.1_Intron|SMIM7_ENST00000397349.2_5'UTR|SMIM7_ENST00000597711.1_Intron|SMIM7_ENST00000358726.6_Frame_Shift_Del_p.M66fs|CTC-429P9.4_ENST00000593962.1_5'UTR	NM_024104.3	NP_077009.2	Q9BQ49	SMIM7_HUMAN	small integral membrane protein 7	66						integral component of membrane (GO:0016021)											ATGCAGAACATCATGAAGATG	0.473																																						dbGAP											0													99.0	102.0	101.0					19																	16764862		2020	4185	6205	-	-	-	SO:0001589	frameshift_variant	0			AK025602	CCDS12348.2, CCDS74307.1	19p13.11	2012-10-26	2012-10-26	2012-10-26	ENSG00000214046	ENSG00000214046			28419	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 42"""	C19orf42		12477932	Standard	NM_024104		Approved	MGC2747	uc002ner.3	Q9BQ49	OTTHUMG00000149895	ENST00000487416.2:c.196delA	19.37:g.16764862delT	ENSP00000417147:p.Met66fs		A8MX44	Frame_Shift_Del	DEL	NULL	p.M66fs	ENST00000487416.2	37	c.196	CCDS12348.2	19																																																																																			C19orf42	-	NULL	ENSG00000214046		0.473	SMIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf42	HGNC	protein_coding	OTTHUMT00000313801.2	37	0.00	0	T	NM_024104		16764862	16764862	-1	no_errors	ENST00000487803	ensembl	human	known	69_37n	frame_shift_del	46	20.69	12	DEL	1.000	-
C3orf67	200844	genome.wustl.edu	37	3	58849603	58849603	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr3:58849603G>A	ENST00000482387.1	-	8	995	c.899C>T	c.(898-900)cCt>cTt	p.P300L	C3orf67_ENST00000472469.1_Missense_Mutation_p.P207L|RP11-147N17.1_ENST00000492031.1_RNA|RP11-147N17.1_ENST00000482372.1_RNA|C3orf67_ENST00000295966.7_Missense_Mutation_p.P300L|RP11-147N17.1_ENST00000463703.1_RNA|RP11-147N17.1_ENST00000493123.1_RNA			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	300										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		AGCATTTTCAGGAAAAATCCA	0.373																																						dbGAP											0													36.0	39.0	38.0					3																	58849603		2199	4299	6498	-	-	-	SO:0001583	missense	0			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.899C>T	3.37:g.58849603G>A	ENSP00000417122:p.Pro300Leu		B9EKV6|Q6ZV69	Missense_Mutation	SNP	NULL	p.P300L	ENST00000482387.1	37	c.899		3	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471056	0.43942	.	.	ENSG00000163689	ENST00000295966;ENST00000482387;ENST00000394474;ENST00000472469	T;T;T	0.68181	1.74;1.59;-0.31	4.67	4.67	0.58626	.	0.160978	0.42172	D	0.000741	T	0.79203	0.4406	M	0.70275	2.135	0.80722	D	1	B;D;D	0.89917	0.015;1.0;1.0	B;D;D	0.91635	0.016;0.998;0.999	T	0.75941	-0.3140	10	0.20519	T	0.43	-11.0448	15.694	0.77481	0.0:0.0:1.0:0.0	.	207;300;300	C9J3M8;Q6ZVT6-2;Q6ZVT6	.;.;CC067_HUMAN	L	300;300;5;207	ENSP00000295966:P300L;ENSP00000417122:P300L;ENSP00000417271:P207L	ENSP00000295966:P300L	P	-	2	0	C3orf67	58824643	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	4.283000	0.58977	2.290000	0.77057	0.557000	0.71058	CCT	C3orf67	-	NULL	ENSG00000163689		0.373	C3orf67-003	KNOWN	basic	protein_coding	C3orf67	HGNC	protein_coding	OTTHUMT00000353803.1	25	0.00	0	G	NM_198463		58849603	58849603	-1	no_errors	ENST00000482387	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	A
CACNA1F	778	genome.wustl.edu	37	X	49071972	49071972	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chrX:49071972C>T	ENST00000376265.2	-	28	3362	c.3301G>A	c.(3301-3303)Gag>Aag	p.E1101K	CACNA1F_ENST00000376251.1_Missense_Mutation_p.E1036K|CACNA1F_ENST00000323022.5_Missense_Mutation_p.E1090K	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1101	Dihydropyridine binding. {ECO:0000250}.				axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CCATGGTCCTCTGCATATGCA	0.532																																						dbGAP											0													92.0	74.0	80.0					X																	49071972		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.3301G>A	X.37:g.49071972C>T	ENSP00000365441:p.Glu1101Lys		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.E1101K	ENST00000376265.2	37	c.3301	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	.	15.22	2.769908	0.49680	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.96587	-4.06;-3.99;-3.98	4.44	4.44	0.53790	Ion transport (1);	0.454124	0.21529	N	0.073070	D	0.97648	0.9229	M	0.72118	2.19	0.36410	D	0.863694	D;D	0.71674	0.992;0.998	P;D	0.75484	0.793;0.986	D	0.99958	1.1666	10	0.87932	D	0	.	14.9688	0.71217	0.0:1.0:0.0:0.0	.	1090;1101	F5CIQ9;O60840	.;CAC1F_HUMAN	K	1036;1090;1101	ENSP00000365427:E1036K;ENSP00000321618:E1090K;ENSP00000365441:E1101K	ENSP00000321618:E1090K	E	-	1	0	CACNA1F	48958916	0.999000	0.42202	0.923000	0.36655	0.092000	0.18411	3.656000	0.54467	2.032000	0.59987	0.597000	0.82753	GAG	CACNA1F	-	pfam_Ion_trans_dom	ENSG00000102001		0.532	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	45	0.00	0	C	NM_005183		49071972	49071972	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	1.000	T
CACNB1	782	genome.wustl.edu	37	17	37331819	37331819	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr17:37331819G>A	ENST00000394303.3	-	14	1631	c.1424C>T	c.(1423-1425)cCc>cTc	p.P475L	RP5-906A24.2_ENST00000579256.1_RNA	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	475					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AAGGCCTGGGGGCTGGCCCAG	0.692											OREG0024371	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(5;100 366 38393 41452 45827)	dbGAP											0													58.0	72.0	67.0					17																	37331819		2050	4173	6223	-	-	-	SO:0001583	missense	0				CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.1424C>T	17.37:g.37331819G>A	ENSP00000377840:p.Pro475Leu	869	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_VDCC_L_bsu,superfamily_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b1su	p.P475L	ENST00000394303.3	37	c.1424	CCDS42311.1	17	.	.	.	.	.	.	.	.	.	.	G	13.61	2.289083	0.40494	.	.	ENSG00000067191	ENST00000539338;ENST00000394303	T	0.76839	-1.05	5.14	3.07	0.35406	.	0.882541	0.10217	N	0.701428	T	0.62319	0.2418	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.56625	-0.7948	10	0.31617	T	0.26	-6.3142	6.2731	0.20965	0.1621:0.0:0.6866:0.1513	.	475	Q02641	CACB1_HUMAN	L	425;475	ENSP00000377840:P475L	ENSP00000377840:P475L	P	-	2	0	CACNB1	34585345	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	0.955000	0.29188	1.416000	0.47057	0.561000	0.74099	CCC	CACNB1	-	NULL	ENSG00000067191		0.692	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB1	HGNC	protein_coding	OTTHUMT00000256945.3	21	0.00	0	G			37331819	37331819	-1	no_errors	ENST00000394303	ensembl	human	known	69_37n	missense	49	30.99	22	SNP	0.999	A
CANX	821	genome.wustl.edu	37	5	179149818	179149818	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr5:179149818C>T	ENST00000247461.4	+	11	1396	c.1196C>T	c.(1195-1197)cCc>cTc	p.P399L	CANX_ENST00000504734.1_Missense_Mutation_p.P399L|CANX_ENST00000512607.2_Missense_Mutation_p.P291L|CANX_ENST00000415618.2_Missense_Mutation_p.P434L|CANX_ENST00000452673.2_Missense_Mutation_p.P399L	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	399	4 X approximate repeats.|P domain (Extended arm). {ECO:0000250}.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)	p.P399H(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	ATCTGGAAACCCAGGAAAATA	0.363																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											64.0	67.0	66.0					5																	179149818		2203	4300	6503	-	-	-	SO:0001583	missense	0			L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.1196C>T	5.37:g.179149818C>T	ENSP00000247461:p.Pro399Leu		B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,superfamily_Calreticulin/calnexin_P,prints_Calret/calnex	p.P434L	ENST00000247461.4	37	c.1301	CCDS4447.1	5	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914899	0.92178	.	.	ENSG00000127022	ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000512607	T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43	5.39	5.39	0.77823	Calreticulin/calnexin, P (2);	0.099528	0.64402	D	0.000001	T	0.81178	0.4768	H	0.95816	3.725	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.67548	0.952;0.923	D	0.86701	0.1929	10	0.87932	D	0	-2.989	19.5041	0.95108	0.0:1.0:0.0:0.0	.	434;399	B4DGP8;P27824	.;CALX_HUMAN	L	399;434;399;399;291	ENSP00000424063:P399L;ENSP00000394817:P434L;ENSP00000391646:P399L;ENSP00000247461:P399L;ENSP00000423588:P291L	ENSP00000247461:P399L	P	+	2	0	CANX	179082424	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.784000	0.85713	2.676000	0.91093	0.650000	0.86243	CCC	CANX	-	pfam_Calret/calnex,superfamily_Calreticulin/calnexin_P	ENSG00000127022		0.363	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CANX	HGNC	protein_coding	OTTHUMT00000253500.2	60	0.00	0	C	NM_001024649		179149818	179149818	+1	no_errors	ENST00000415618	ensembl	human	known	69_37n	missense	50	19.35	12	SNP	1.000	T
CARD9	64170	genome.wustl.edu	37	9	139259656	139259656	+	Silent	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr9:139259656G>A	ENST00000371732.5	-	11	1536	c.1371C>T	c.(1369-1371)ggC>ggT	p.G457G	CARD9_ENST00000460290.1_5'UTR|DNLZ_ENST00000371738.3_5'Flank|CARD9_ENST00000371734.3_Silent_p.G457G|DNLZ_ENST00000371739.3_5'Flank	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	457					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		GGCTCCCCCCGCCGGCAAGGC	0.672																																						dbGAP											0													41.0	49.0	46.0					9																	139259656		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.1371C>T	9.37:g.139259656G>A			Q5SXM5|Q5SXM6|Q9H854	Silent	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.G457	ENST00000371732.5	37	c.1371	CCDS6997.1	9																																																																																			CARD9	-	NULL	ENSG00000187796		0.672	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD9	HGNC	protein_coding	OTTHUMT00000055053.1	17	0.00	0	G	NM_052813		139259656	139259656	-1	no_errors	ENST00000371732	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	0.000	A
MCUR1	63933	genome.wustl.edu	37	6	13791083	13791083	+	Silent	SNP	C	C	T	rs572372696		TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr6:13791083C>T	ENST00000379170.4	-	9	1176	c.1038G>A	c.(1036-1038)acG>acA	p.T346T		NM_001031713.3	NP_001026883.1	Q96AQ8	MCUR1_HUMAN	mitochondrial calcium uniporter regulator 1	346					calcium ion import (GO:0070509)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	integral component of mitochondrial inner membrane (GO:0031305)											CTGTTAGGCACGTAAATATAG	0.323																																						dbGAP											0													88.0	91.0	90.0					6																	13791083		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC016850	CCDS35495.1	6p23	2013-03-13	2013-03-13	2013-03-13	ENSG00000050393	ENSG00000050393			21097	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 79"", ""coiled-coil domain containing 90A"""	C6orf79, CCDC90A		23178883	Standard	NM_001031713		Approved	FLJ20958	uc003nbc.2	Q96AQ8	OTTHUMG00000014279	ENST00000379170.4:c.1038G>A	6.37:g.13791083C>T			Q96JS7|Q9H7F8	Silent	SNP	pfam_DUF1640	p.T346	ENST00000379170.4	37	c.1038	CCDS35495.1	6																																																																																			CCDC90A	-	pfam_DUF1640	ENSG00000050393		0.323	MCUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC90A	HGNC	protein_coding	OTTHUMT00000039909.3	37	0.00	0	C	NM_022102		13791083	13791083	-1	no_errors	ENST00000379170	ensembl	human	known	69_37n	silent	72	11.11	9	SNP	0.970	T
CASP8AP2	9994	genome.wustl.edu	37	6	90573973	90573973	+	RNA	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr6:90573973C>T	ENST00000551025.1	+	0	3982									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TGACCTTAATCACCTGAGACC	0.423																																					Colon(187;1656 2025 17045 31481 39901)	dbGAP											0													63.0	62.0	62.0					6																	90573973		1880	4120	6000	-	-	-			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90573973C>T				RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.423	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		42	0.00	0	C	NM_001137667		90573973	90573973	+1	no_errors	ENST00000237177	ensembl	human	known	69_37n	rna	21	16.00	4	SNP	0.998	T
SPDL1	54908	genome.wustl.edu	37	5	169018164	169018164	+	Missense_Mutation	SNP	T	T	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr5:169018164T>A	ENST00000265295.4	+	3	551	c.272T>A	c.(271-273)cTg>cAg	p.L91Q	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		AAAATGCACCTGGAGAAATTG	0.368																																						dbGAP											0													94.0	97.0	96.0					5																	169018164		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.272T>A	5.37:g.169018164T>A	ENSP00000265295:p.Leu91Gln			Missense_Mutation	SNP	NULL	p.L91Q	ENST00000265295.4	37	c.272	CCDS4370.1	5	.	.	.	.	.	.	.	.	.	.	T	14.19	2.461757	0.43736	.	.	ENSG00000040275	ENST00000265295;ENST00000274631;ENST00000508247;ENST00000513941;ENST00000513795	T	0.38401	1.14	5.37	4.19	0.49359	.	0.303860	0.30686	N	0.009096	T	0.56396	0.1982	M	0.68952	2.095	0.44234	D	0.997071	D;D	0.89917	0.999;1.0	D;D	0.91635	0.976;0.999	T	0.58544	-0.7618	10	0.72032	D	0.01	-11.136	11.8602	0.52461	0.1312:0.0:0.0:0.8688	.	91;91	Q96EA4-2;Q96EA4	.;SPDLY_HUMAN	Q	91	ENSP00000265295:L91Q	ENSP00000265295:L91Q	L	+	2	0	CCDC99	168950742	1.000000	0.71417	0.883000	0.34634	0.140000	0.21249	4.916000	0.63362	0.952000	0.37798	-0.333000	0.08304	CTG	CCDC99	-	NULL	ENSG00000040275		0.368	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC99	HGNC	protein_coding	OTTHUMT00000252829.2	32	0.00	0	T	NM_017785		169018164	169018164	+1	no_errors	ENST00000265295	ensembl	human	known	69_37n	missense	49	27.94	19	SNP	0.969	A
CNTD1	124817	genome.wustl.edu	37	17	40951117	40951117	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr17:40951117C>T	ENST00000588408.1	+	1	308	c.32C>T	c.(31-33)tCc>tTc	p.S11F	COA3_ENST00000328434.7_5'Flank|CNTD1_ENST00000588527.1_Intron	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1	11										central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CGATCGGCCTCCCTCGTTGAC	0.582																																						dbGAP											0													48.0	41.0	44.0					17																	40951117		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.32C>T	17.37:g.40951117C>T	ENSP00000465204:p.Ser11Phe		Q658Q6|Q8NEP1	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like	p.S11F	ENST00000588408.1	37	c.32	CCDS11440.1	17	.	.	.	.	.	.	.	.	.	.	C	15.26	2.782266	0.49891	.	.	ENSG00000176563	ENST00000315066	.	.	.	5.04	2.95	0.34219	.	0.690868	0.14429	N	0.320115	T	0.33323	0.0859	L	0.50333	1.59	0.09310	N	0.999991	B	0.06786	0.001	B	0.04013	0.001	T	0.19943	-1.0290	9	0.44086	T	0.13	-2.9022	5.5635	0.17157	0.1679:0.667:0.0:0.1651	.	11	Q8N815	CNTD1_HUMAN	F	11	.	ENSP00000316647:S11F	S	+	2	0	CNTD1	38204643	0.001000	0.12720	0.002000	0.10522	0.497000	0.33675	0.912000	0.28597	1.298000	0.44778	0.655000	0.94253	TCC	CNTD1	-	NULL	ENSG00000176563		0.582	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTD1	HGNC	protein_coding	OTTHUMT00000452398.1	17	0.00	0	C	NM_173478		40951117	40951117	+1	no_errors	ENST00000588408	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	0.001	T
CPXCR1	53336	genome.wustl.edu	37	X	88008722	88008722	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chrX:88008722C>T	ENST00000276127.4	+	3	566	c.307C>T	c.(307-309)Cac>Tac	p.H103Y	CPXCR1_ENST00000373111.1_Missense_Mutation_p.H103Y	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	103							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						ATTGGTCTCTCACAAGCCCTT	0.408																																						dbGAP											0													37.0	33.0	34.0					X																	88008722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.307C>T	X.37:g.88008722C>T	ENSP00000276127:p.His103Tyr		B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.H103Y	ENST00000276127.4	37	c.307	CCDS14458.1	X	.	.	.	.	.	.	.	.	.	.	C	5.244	0.230551	0.09969	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.42513	0.97;0.97	2.21	0.385	0.16249	.	2.048310	0.02955	N	0.142247	T	0.24890	0.0604	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.10520	-1.0626	9	.	.	.	.	4.1893	0.10413	0.0:0.6098:0.0:0.3902	.	103	Q8N123	CPXCR_HUMAN	Y	103	ENSP00000276127:H103Y;ENSP00000362203:H103Y	.	H	+	1	0	CPXCR1	87895378	0.004000	0.15560	0.001000	0.08648	0.053000	0.15095	0.159000	0.16442	-0.007000	0.14345	-0.198000	0.12761	CAC	CPXCR1	-	NULL	ENSG00000147183		0.408	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXCR1	HGNC	protein_coding	OTTHUMT00000057418.1	33	0.00	0	C	NM_033048		88008722	88008722	+1	no_errors	ENST00000276127	ensembl	human	known	69_37n	missense	12	65.71	23	SNP	0.001	T
CRYBG3	131544	genome.wustl.edu	37	3	97596567	97596567	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr3:97596567G>A	ENST00000182096.4	+	1	749	c.685G>A	c.(685-687)Gat>Aat	p.D229N		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2177							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						CCAGTTGCCAGATCCTTCCAT	0.473																																						dbGAP											0													79.0	83.0	81.0					3																	97596567		2096	4231	6327	-	-	-	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.685G>A	3.37:g.97596567G>A	ENSP00000182096:p.Asp229Asn		B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.D229N	ENST00000182096.4	37	c.685		3	.	.	.	.	.	.	.	.	.	.	G	9.589	1.125629	0.20959	.	.	ENSG00000080200	ENST00000182096	T	0.75367	-0.93	5.66	4.78	0.61160	.	3.578970	0.00582	N	0.000330	T	0.69061	0.3069	L	0.29908	0.895	0.22378	N	0.999152	B	0.06786	0.001	B	0.04013	0.001	T	0.54397	-0.8300	10	0.52906	T	0.07	.	10.8192	0.46595	0.1507:0.0:0.8493:0.0	.	229	Q68DQ2	CRBG3_HUMAN	N	229	ENSP00000182096:D229N	ENSP00000182096:D229N	D	+	1	0	CRYBG3	99079257	0.997000	0.39634	0.381000	0.26106	0.058000	0.15608	2.639000	0.46570	1.398000	0.46701	0.555000	0.69702	GAT	CRYBG3	-	NULL	ENSG00000080200		0.473	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	30	0.00	0	G	NM_153605		97596567	97596567	+1	no_errors	ENST00000182096	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.022	A
DENND2C	163259	genome.wustl.edu	37	1	115130504	115130504	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:115130504G>C	ENST00000393274.1	-	19	3126	c.2501C>G	c.(2500-2502)tCt>tGt	p.S834C	DENND2C_ENST00000393277.1_Missense_Mutation_p.S722C|DENND2C_ENST00000393276.3_Missense_Mutation_p.S777C|DENND2C_ENST00000481894.1_5'UTR	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	834	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATGTTCAAAGAATAATGTCC	0.458																																						dbGAP											0													82.0	73.0	76.0					1																	115130504		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2501C>G	1.37:g.115130504G>C	ENSP00000376955:p.Ser834Cys		B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.S834C	ENST00000393274.1	37	c.2501	CCDS58018.1	1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686089	0.88639	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.46819	0.86;0.86;0.86	5.91	5.91	0.95273	dDENN (3);	0.157748	0.64402	D	0.000018	T	0.67373	0.2886	M	0.80982	2.52	0.31437	N	0.672478	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.982	T	0.68213	-0.5468	10	0.87932	D	0	.	20.3592	0.98849	0.0:0.0:1.0:0.0	.	834;777	Q68D51;Q68D51-3	DEN2C_HUMAN;.	C	777;834;834;722	ENSP00000376957:S777C;ENSP00000376955:S834C;ENSP00000376958:S722C	ENSP00000358553:S834C	S	-	2	0	DENND2C	114932027	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.553000	0.82203	2.822000	0.97130	0.558000	0.71614	TCT	DENND2C	-	pfam_dDENN_dom,smart_dDENN_dom,pfscan_dDENN_dom	ENSG00000175984		0.458	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	46	0.00	0	G	NM_198459		115130504	115130504	-1	no_errors	ENST00000393274	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	C
EDNRB	1910	genome.wustl.edu	37	13	78492504	78492504	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr13:78492504C>T	ENST00000334286.5	-	1	441	c.205G>A	c.(205-207)Gcg>Acg	p.A69T	EDNRB_ENST00000377211.4_Missense_Mutation_p.A159T|EDNRB_ENST00000446573.1_Missense_Mutation_p.A69T|EDNRB_ENST00000475537.1_5'UTR|RNF219-AS1_ENST00000607862.1_RNA	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	69					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	GGCACCTCCGCAGGTGCCAAC	0.592																																						dbGAP											0													79.0	81.0	80.0					13																	78492504		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.205G>A	13.37:g.78492504C>T	ENSP00000335311:p.Ala69Thr		A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_ETB_rcpt,prints_Endthln_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Bombsn_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.A69T	ENST00000334286.5	37	c.205	CCDS9461.1	13	.	.	.	.	.	.	.	.	.	.	C	9.162	1.019028	0.19355	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.71698	-0.59;-0.39;-0.53	4.75	3.91	0.45181	.	0.303746	0.35936	N	0.002888	T	0.55513	0.1925	L	0.40543	1.245	0.09310	N	1	B;B;B	0.15141	0.006;0.012;0.002	B;B;B	0.15052	0.007;0.012;0.002	T	0.34976	-0.9807	10	0.14252	T	0.57	-7.2302	7.4652	0.27318	0.0:0.3047:0.5611:0.1342	.	69;159;69	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	T	159;69;69	ENSP00000366416:A159T;ENSP00000403401:A69T;ENSP00000335311:A69T	ENSP00000335311:A69T	A	-	1	0	EDNRB	77390505	0.519000	0.26242	0.110000	0.21437	0.105000	0.19272	0.178000	0.16820	1.136000	0.42199	0.591000	0.81541	GCG	EDNRB	-	prints_ETB_rcpt	ENSG00000136160		0.592	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	HGNC	protein_coding	OTTHUMT00000276505.1	41	0.00	0	C			78492504	78492504	-1	no_errors	ENST00000334286	ensembl	human	known	69_37n	missense	19	45.71	16	SNP	0.003	T
EIF4G2	1982	genome.wustl.edu	37	11	10824832	10824832	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr11:10824832C>A	ENST00000526148.1	-	10	1333	c.823G>T	c.(823-825)Gat>Tat	p.D275Y	EIF4G2_ENST00000525995.1_5'Flank|EIF4G2_ENST00000339995.5_Missense_Mutation_p.D275Y|EIF4G2_ENST00000396525.2_Missense_Mutation_p.D275Y|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000525681.1_Missense_Mutation_p.D275Y|RP11-685M7.5_ENST00000532365.1_RNA	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AAGTACTGATCCATTAAGGAC	0.353																																						dbGAP											0													66.0	59.0	62.0					11																	10824832		2201	4294	6495	-	-	-	SO:0001583	missense	0			U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.823G>T	11.37:g.10824832C>A	ENSP00000433664:p.Asp275Tyr			Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_W2_domain,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.D275Y	ENST00000526148.1	37	c.823	CCDS31428.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.112190	0.94339	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000531416;ENST00000532082	T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57	6.07	6.07	0.98685	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.69833	0.3155	H	0.94345	3.525	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	T	0.77107	-0.2710	9	0.87932	D	0	-9.0627	20.6593	0.99626	0.0:1.0:0.0:0.0	.	275;275;348	P78344-2;P78344;B4DZF2	.;IF4G2_HUMAN;.	Y	275;275;275;275;348;275;275	ENSP00000433664:D275Y;ENSP00000433371:D275Y;ENSP00000340281:D275Y;ENSP00000379778:D275Y;ENSP00000431583:D275Y;ENSP00000433121:D275Y	ENSP00000340281:D275Y	D	-	1	0	EIF4G2	10781408	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.713000	0.84693	2.885000	0.99019	0.655000	0.94253	GAT	EIF4G2	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	ENSG00000110321		0.353	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	EIF4G2	HGNC	protein_coding	OTTHUMT00000386603.1	51	0.00	0	C	NM_001418		10824832	10824832	-1	no_start_codon	ENST00000339995	ensembl	human	known	69_37n	missense	58	10.77	7	SNP	1.000	A
F5	2153	genome.wustl.edu	37	1	169509917	169509917	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:169509917G>C	ENST00000367797.3	-	13	4612	c.4411C>G	c.(4411-4413)Cag>Gag	p.Q1471E	F5_ENST00000367796.3_Missense_Mutation_p.Q1476E	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1471	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AGCAATGACTGACTAGATTCA	0.438																																						dbGAP											0													87.0	89.0	88.0					1																	169509917		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.4411C>G	1.37:g.169509917G>C	ENSP00000356771:p.Gln1471Glu		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.Q1476E	ENST00000367797.3	37	c.4426	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	g	17.37	3.373007	0.61624	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98362	-4.88;-4.89	5.46	5.46	0.80206	.	0.595828	0.16576	N	0.208389	D	0.93009	0.7775	L	0.40543	1.245	0.24283	N	0.995197	P	0.46395	0.877	B	0.39971	0.315	D	0.92250	0.5808	9	0.05833	T	0.94	-2.5051	15.1702	0.72865	0.0:0.0:1.0:0.0	.	1471	P12259	FA5_HUMAN	E	1471;1476	ENSP00000356771:Q1471E;ENSP00000356770:Q1476E	ENSP00000356770:Q1476E	Q	-	1	0	F5	167776541	0.318000	0.24598	0.013000	0.15412	0.008000	0.06430	3.747000	0.55134	2.733000	0.93635	0.467000	0.42956	CAG	F5	-	NULL	ENSG00000198734		0.438	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	43	0.00	0	G	NM_000130		169509917	169509917	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	0.106	C
FAM160A2	84067	genome.wustl.edu	37	11	6235673	6235673	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr11:6235673G>A	ENST00000449352.2	-	11	2788	c.2525C>T	c.(2524-2526)gCa>gTa	p.A842V	FAM160A2_ENST00000529360.1_5'UTR|FAM160A2_ENST00000265978.4_Missense_Mutation_p.A856V			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	842					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GGCAGGTCCTGCTGCAGGGCC	0.587																																						dbGAP											0													110.0	106.0	108.0					11																	6235673		2201	4296	6497	-	-	-	SO:0001583	missense	0				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.2525C>T	11.37:g.6235673G>A	ENSP00000416918:p.Ala842Val		Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.A856V	ENST00000449352.2	37	c.2567	CCDS44530.1	11	.	.	.	.	.	.	.	.	.	.	g	10.88	1.475364	0.26511	.	.	ENSG00000051009	ENST00000449352;ENST00000265978	T;T	0.08546	3.08;3.08	5.17	4.25	0.50352	.	0.332477	0.31370	N	0.007761	T	0.09202	0.0227	L	0.54323	1.7	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.06405	0.002;0.002	T	0.11518	-1.0584	10	0.26408	T	0.33	-0.0666	10.2998	0.43646	0.0764:0.137:0.7866:0.0	.	842;856	Q8N612;Q8N612-2	F16A2_HUMAN;.	V	842;856	ENSP00000416918:A842V;ENSP00000265978:A856V	ENSP00000265978:A856V	A	-	2	0	FAM160A2	6192249	0.868000	0.29978	1.000000	0.80357	0.870000	0.49936	3.209000	0.51122	1.150000	0.42419	-0.523000	0.04350	GCA	FAM160A2	-	NULL	ENSG00000051009		0.587	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	HGNC	protein_coding	OTTHUMT00000383759.1	34	0.00	0	G	NM_032127		6235673	6235673	-1	no_errors	ENST00000265978	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.983	A
FAM184A	79632	genome.wustl.edu	37	6	119327762	119327762	+	Silent	SNP	G	G	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr6:119327762G>C	ENST00000338891.7	-	7	2108	c.1665C>G	c.(1663-1665)ctC>ctG	p.L555L	FAM184A_ENST00000521531.1_Silent_p.L555L|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000352896.5_Silent_p.L435L|FAM184A_ENST00000368475.4_Silent_p.L435L|FAM184A_ENST00000522284.1_Silent_p.L435L	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	555						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						CCATATCTTGGAGGTGGCCAA	0.353																																						dbGAP											0													104.0	96.0	99.0					6																	119327762		1839	4076	5915	-	-	-	SO:0001819	synonymous_variant	0			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1665C>G	6.37:g.119327762G>C			B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Silent	SNP	superfamily_Prefoldin	p.L555	ENST00000338891.7	37	c.1665	CCDS43499.1	6																																																																																			FAM184A	-	superfamily_Prefoldin	ENSG00000111879		0.353	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184A	HGNC	protein_coding	OTTHUMT00000042009.3	46	0.00	0	G	NM_024581		119327762	119327762	-1	no_errors	ENST00000338891	ensembl	human	known	69_37n	silent	36	18.18	8	SNP	1.000	C
FAM193A	8603	genome.wustl.edu	37	4	2691340	2691340	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr4:2691340G>C	ENST00000324666.5	+	12	1917	c.1566G>C	c.(1564-1566)tgG>tgC	p.W522C	FAM193A_ENST00000505311.1_Missense_Mutation_p.W522C|FAM193A_ENST00000382839.3_Missense_Mutation_p.W522C|FAM193A_ENST00000502458.1_Missense_Mutation_p.W544C|FAM193A_ENST00000545951.1_Missense_Mutation_p.W522C	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	522										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						CTCCAGAGTGGAATAGTTCTA	0.393																																						dbGAP											0													88.0	90.0	89.0					4																	2691340		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.1566G>C	4.37:g.2691340G>C	ENSP00000324587:p.Trp522Cys		B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	NULL	p.W522C	ENST00000324666.5	37	c.1566	CCDS58875.1	4	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730464	0.69074	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	5.38	5.38	0.77491	.	0.118977	0.64402	D	0.000008	T	0.49677	0.1571	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.993;1.0;1.0;1.0	D;P;D;D;D	0.87578	0.998;0.8;0.998;0.997;0.998	T	0.48658	-0.9016	10	0.72032	D	0.01	-8.86	18.1813	0.89779	0.0:0.0:1.0:0.0	.	522;544;522;544;522	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	C	522;522;522;544;376	ENSP00000372290:W522C;ENSP00000324587:W522C;ENSP00000443617:W522C;ENSP00000427505:W544C;ENSP00000427260:W376C	ENSP00000324587:W522C	W	+	3	0	FAM193A	2661138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.351000	0.79395	2.532000	0.85374	0.558000	0.71614	TGG	FAM193A	-	NULL	ENSG00000125386		0.393	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM193A	HGNC	protein_coding	OTTHUMT00000360903.1	54	0.00	0	G	NM_003704		2691340	2691340	+1	no_errors	ENST00000324666	ensembl	human	known	69_37n	missense	82	13.68	13	SNP	1.000	C
SPATA31A3	727830	genome.wustl.edu	37	9	40705911	40705912	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr9:40705911_40705912insA	ENST00000356699.5	+	4	3597_3598	c.3568_3569insA	c.(3568-3570)caafs	p.Q1190fs	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1190					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGCTGAGAGCCAAAAAACAGTA	0.436																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3574dupA	9.37:g.40705917_40705917dupA	ENSP00000349132:p.Gln1190fs			Frame_Shift_Ins	INS	NULL	p.T1192fs	ENST00000356699.5	37	c.3568_3569	CCDS47969.1	9																																																																																			FAM75A3	-	NULL	ENSG00000147926		0.436	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A3	HGNC	protein_coding	OTTHUMT00000036919.1	24	0.00	0	-	NM_001083124		40705911	40705912	+1	no_errors	ENST00000356699	ensembl	human	known	69_37n	frame_shift_ins	26	43.48	20	INS	0.000:0.001	A
FANCE	2178	genome.wustl.edu	37	6	35423762	35423762	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr6:35423762C>G	ENST00000229769.2	+	2	672	c.487C>G	c.(487-489)Cag>Gag	p.Q163E		NM_021922.2	NP_068741.1	Q9HB96	FANCE_HUMAN	Fanconi anemia, complementation group E	163	Interaction with FANCC.				DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)|skin(2)	13						ATGCCAGAGACAGCTCCAAAG	0.607			"""N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia E	6	6p21-p22	2178	"""Fanconi anemia, complementation group E"""		L	0													18.0	20.0	19.0					6																	35423762		2198	4296	6494	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF265210	CCDS4805.1	6p22-p21	2014-09-17			ENSG00000112039	ENSG00000112039		"""Fanconi anemia, complementation groups"""	3586	protein-coding gene	gene with protein product		613976		FACE		7662964, 11001585	Standard	XM_005248885		Approved	FAE	uc003oko.1	Q9HB96	OTTHUMG00000014565	ENST00000229769.2:c.487C>G	6.37:g.35423762C>G	ENSP00000229769:p.Gln163Glu		A8K907|Q4ZGH2	Missense_Mutation	SNP	pfam_Fanconi_anaemia_gr_E_prot_C	p.Q163E	ENST00000229769.2	37	c.487	CCDS4805.1	6	.	.	.	.	.	.	.	.	.	.	C	10.35	1.325901	0.24080	.	.	ENSG00000112039	ENST00000229769	T	0.49720	0.77	5.43	5.43	0.79202	.	0.356593	0.30547	N	0.009384	T	0.21468	0.0517	L	0.29908	0.895	0.27204	N	0.960088	B	0.32918	0.39	B	0.27380	0.079	T	0.13282	-1.0515	10	0.51188	T	0.08	-22.7668	15.9621	0.79939	0.0:1.0:0.0:0.0	.	163	Q9HB96	FANCE_HUMAN	E	163	ENSP00000229769:Q163E	ENSP00000229769:Q163E	Q	+	1	0	FANCE	35531740	0.853000	0.29707	0.220000	0.23810	0.087000	0.18053	2.467000	0.45093	2.548000	0.85928	0.561000	0.74099	CAG	FANCE	-	NULL	ENSG00000112039		0.607	FANCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCE	HGNC	protein_coding	OTTHUMT00000040282.1	14	0.00	0	C			35423762	35423762	+1	no_errors	ENST00000229769	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.664	G
GNA14	9630	genome.wustl.edu	37	9	80049397	80049397	+	Silent	SNP	G	G	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr9:80049397G>C	ENST00000341700.6	-	3	864	c.351C>G	c.(349-351)gtC>gtG	p.V117V	GNA14_ENST00000464095.1_5'Flank	NM_004297.3	NP_004288.1	O95837	GNA14_HUMAN	guanine nucleotide binding protein (G protein), alpha 14	117					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	24						AGAGCATGGAGACCTTGTCCA	0.532											OREG0019263	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													127.0	102.0	110.0					9																	80049397		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF105201	CCDS6657.1	9q21	2008-05-23			ENSG00000156049	ENSG00000156049			4382	protein-coding gene	gene with protein product		604397				10191087, 17620339	Standard	NM_004297		Approved		uc004aku.3	O95837	OTTHUMG00000020058	ENST00000341700.6:c.351C>G	9.37:g.80049397G>C		1195	B1ALW3	Silent	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q	p.V117	ENST00000341700.6	37	c.351	CCDS6657.1	9																																																																																			GNA14	-	pfam_Gprotein_alpha_su,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000156049		0.532	GNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA14	HGNC	protein_coding	OTTHUMT00000052759.1	37	0.00	0	G			80049397	80049397	-1	no_errors	ENST00000341700	ensembl	human	known	69_37n	silent	47	14.55	8	SNP	0.007	C
GSDMC	56169	genome.wustl.edu	37	8	130774954	130774954	+	Silent	SNP	G	G	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr8:130774954G>C	ENST00000276708.4	-	5	1475	c.594C>G	c.(592-594)ctC>ctG	p.L198L		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	198						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						TCTTCACTCTGAGACTCTCTC	0.458																																						dbGAP											0													193.0	172.0	179.0					8																	130774954		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.594C>G	8.37:g.130774954G>C			Q5XKF3|Q6P494	Silent	SNP	pfam_Gasdermin	p.L198	ENST00000276708.4	37	c.594	CCDS6360.1	8																																																																																			GSDMC	-	pfam_Gasdermin	ENSG00000147697		0.458	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	80	0.00	0	G			130774954	130774954	-1	no_errors	ENST00000276708	ensembl	human	known	69_37n	silent	96	14.29	16	SNP	0.000	C
HERC2	8924	genome.wustl.edu	37	15	28419587	28419587	+	Silent	SNP	G	G	A	rs142399136	byFrequency	TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr15:28419587G>A	ENST00000261609.7	-	65	10119	c.10011C>T	c.(10009-10011)ccC>ccT	p.P3337P		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGAAGAGGACGGGCTCGTGGA	0.512																																						dbGAP											0													33.0	29.0	30.0					15																	28419587		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10011C>T	15.37:g.28419587G>A				Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.P3337	ENST00000261609.7	37	c.10011	CCDS10021.1	15																																																																																			HERC2	-	NULL	ENSG00000128731		0.512	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	24	0.00	0	G	NM_004667		28419587	28419587	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	0.000	A
IL37	27178	genome.wustl.edu	37	2	113675354	113675354	+	Splice_Site	SNP	G	G	T	rs138939950	byFrequency	TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr2:113675354G>T	ENST00000263326.3	+	4	450	c.408G>T	c.(406-408)aaG>aaT	p.K136N	IL37_ENST00000349806.3_Splice_Site_p.K75N|IL37_ENST00000352179.3_Splice_Site_p.K115N|IL37_ENST00000311328.2_Splice_Site_p.K110N|IL37_ENST00000353225.3_Splice_Site_p.K96N	NM_014439.3	NP_055254.2	Q9NZH6	IL37_HUMAN	interleukin 37	136					immune response (GO:0006955)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	interleukin-1 receptor binding (GO:0005149)			NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(2)|skin(3)	19						TTCAGCTGAAGGTGAGAGTTC	0.488																																						dbGAP											0													99.0	102.0	101.0					2																	113675354		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF201832	CCDS2103.1, CCDS2104.1, CCDS2105.1, CCDS2106.1, CCDS2107.1	2q12-q14.1	2011-06-06	2011-06-06	2011-06-06	ENSG00000125571	ENSG00000125571		"""Interleukins and interleukin receptors"""	15563	protein-coding gene	gene with protein product	"""interleukin 1, zeta"", ""interleukin-1 homolog 4"", ""interleukin-1-related protein"""	605510	"""interleukin 1 family, member 7 (zeta)"""	IL1F7		10625660, 10512743, 12496389	Standard	NM_014439		Approved	FIL1, FIL1Z, FIL1(ZETA), IL-1H4, IL-1RP1, IL-1F7	uc002tij.3	Q9NZH6	OTTHUMG00000131345	ENST00000263326.3:c.408+1G>T	2.37:g.113675354G>T			B5BU97|Q56AP9|Q8TD04|Q8TD05|Q9HBF2|Q9HBF3|Q9UHA6	Missense_Mutation	SNP	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,smart_Interleukin_1,prints_Interleukin_1,prints_IL_rcpt_IL1RA	p.K136N	ENST00000263326.3	37	c.408	CCDS2103.1	2	.	.	.	.	.	.	.	.	.	.	g	12.84	2.057054	0.36277	.	.	ENSG00000125571	ENST00000263326;ENST00000352179;ENST00000349806;ENST00000353225;ENST00000311328	T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16	2.93	2.93	0.34026	.	0.461273	0.16811	N	0.198566	T	0.44993	0.1320	M	0.79805	2.47	0.25346	N	0.98891	D;D;D;D;D	0.89917	0.999;0.998;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.964;0.934;0.998;0.998;0.999	T	0.13495	-1.0507	10	0.72032	D	0.01	-27.6172	9.5541	0.39328	0.0:0.0:1.0:0.0	.	110;75;96;115;136	Q9NZH6-2;Q9NZH6-5;Q9NZH6-3;Q9NZH6-4;Q9NZH6	.;.;.;.;IL37_HUMAN	N	136;115;75;96;110	ENSP00000263326:K136N;ENSP00000263327:K115N;ENSP00000263328:K75N;ENSP00000309208:K96N;ENSP00000309883:K110N	ENSP00000263326:K136N	K	+	3	2	IL37	113391825	1.000000	0.71417	1.000000	0.80357	0.222000	0.24845	0.460000	0.21924	1.940000	0.56252	0.651000	0.88453	AAG	IL37	-	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,smart_Interleukin_1	ENSG00000125571		0.488	IL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL37	HGNC	protein_coding	OTTHUMT00000254126.1	33	0.00	0	G	NM_014439	Missense_Mutation	113675354	113675354	+1	no_errors	ENST00000263326	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	1.000	T
KIAA1217	56243	genome.wustl.edu	37	10	24508619	24508619	+	Silent	SNP	A	A	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr10:24508619A>G	ENST00000376454.3	+	2	165	c.135A>G	c.(133-135)gaA>gaG	p.E45E	KIAA1217_ENST00000458595.1_Silent_p.E45E|KIAA1217_ENST00000376452.3_Silent_p.E45E|KIAA1217_ENST00000376462.1_5'UTR	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	45					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GAACCAAGGAACGCCTTTCTA	0.458																																						dbGAP											0													73.0	66.0	69.0					10																	24508619		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.135A>G	10.37:g.24508619A>G			A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	pfam_AIP3_C	p.E45	ENST00000376454.3	37	c.135	CCDS31165.1	10																																																																																			KIAA1217	-	NULL	ENSG00000120549		0.458	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	20	0.00	0	A	NM_019590		24508619	24508619	+1	no_errors	ENST00000376454	ensembl	human	known	69_37n	silent	14	46.15	12	SNP	0.427	G
KIAA1328	57536	genome.wustl.edu	37	18	34415224	34415224	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr18:34415224C>G	ENST00000280020.5	+	3	144	c.122C>G	c.(121-123)tCa>tGa	p.S41*	KIAA1328_ENST00000591619.1_Nonsense_Mutation_p.S37*|KIAA1328_ENST00000435985.2_5'UTR|KIAA1328_ENST00000592521.1_Nonsense_Mutation_p.S41*|KIAA1328_ENST00000543923.1_5'UTR	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328	41										central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		AATGTCAGATCAAGACACAAG	0.393																																						dbGAP											0													142.0	143.0	143.0					18																	34415224		1862	4092	5954	-	-	-	SO:0001587	stop_gained	0			AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.122C>G	18.37:g.34415224C>G	ENSP00000280020:p.Ser41*		Q05DL0|Q49AG6|Q9P2L8	Nonsense_Mutation	SNP	NULL	p.S41*	ENST00000280020.5	37	c.122	CCDS45855.1	18	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984004	0.74474	.	.	ENSG00000150477	ENST00000280020;ENST00000383055	.	.	.	5.11	3.29	0.37713	.	0.579479	0.14566	N	0.311747	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	9.867	0.41150	0.0:0.8339:0.0:0.1661	.	.	.	.	X	41	.	ENSP00000280020:S41X	S	+	2	0	KIAA1328	32669222	1.000000	0.71417	0.989000	0.46669	0.495000	0.33615	1.659000	0.37387	1.122000	0.41944	0.557000	0.71058	TCA	KIAA1328	-	NULL	ENSG00000150477		0.393	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1328	HGNC	protein_coding	OTTHUMT00000440455.1	49	0.00	0	C	NM_020776		34415224	34415224	+1	no_errors	ENST00000280020	ensembl	human	known	69_37n	nonsense	52	10.34	6	SNP	0.992	G
KLB	152831	genome.wustl.edu	37	4	39439551	39439551	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr4:39439551C>T	ENST00000257408.4	+	3	1638	c.1541C>T	c.(1540-1542)aCg>aTg	p.T514M		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	514					carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						AAAGAGTCCACGCCAGATGTG	0.418																																						dbGAP											0													97.0	93.0	94.0					4																	39439551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1541C>T	4.37:g.39439551C>T	ENSP00000257408:p.Thr514Met		Q2M3K8	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.T514M	ENST00000257408.4	37	c.1541	CCDS3451.1	4	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630754	0.46944	.	.	ENSG00000134962	ENST00000257408	T	0.28255	1.62	6.03	4.32	0.51571	.	0.210804	0.51477	D	0.000096	T	0.29620	0.0739	N	0.24115	0.695	0.35990	D	0.836654	D;D	0.67145	0.996;0.996	P;P	0.50490	0.642;0.548	T	0.33445	-0.9868	10	0.51188	T	0.08	-19.7687	13.2782	0.60200	0.0:0.8717:0.0:0.1283	.	514;514	B7ZL50;Q86Z14	.;KLOTB_HUMAN	M	514	ENSP00000257408:T514M	ENSP00000257408:T514M	T	+	2	0	KLB	39115946	0.836000	0.29430	0.706000	0.30403	0.334000	0.28698	1.664000	0.37439	0.897000	0.36392	-0.126000	0.14955	ACG	KLB	-	NULL	ENSG00000134962		0.418	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	HGNC	protein_coding	OTTHUMT00000250429.1	44	0.00	0	C	NM_175737		39439551	39439551	+1	no_errors	ENST00000257408	ensembl	human	known	69_37n	missense	66	13.16	10	SNP	0.988	T
LINS	55180	genome.wustl.edu	37	15	101120811	101120811	+	Silent	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr15:101120811G>A	ENST00000314742.8	-	2	459	c.237C>T	c.(235-237)aaC>aaT	p.N79N	LINS_ENST00000560133.1_Intron|LINS_ENST00000559149.1_5'UTR|LINS_ENST00000561308.1_Silent_p.N79N	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	79										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						TCATCTGAGAGTTGGTCTTCA	0.488																																						dbGAP											0													107.0	100.0	102.0					15																	101120811		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.237C>T	15.37:g.101120811G>A			Q96FW2|Q9NVQ3	Silent	SNP	NULL	p.N79	ENST00000314742.8	37	c.237	CCDS10385.1	15																																																																																			LINS	-	NULL	ENSG00000140471		0.488	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINS	HGNC	protein_coding	OTTHUMT00000313592.1	56	0.00	0	G	NM_018148		101120811	101120811	-1	no_errors	ENST00000314742	ensembl	human	known	69_37n	silent	46	14.81	8	SNP	0.000	A
LIPK	643414	genome.wustl.edu	37	10	90512357	90512357	+	Silent	SNP	C	C	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr10:90512357C>G	ENST00000404190.1	+	9	1044	c.1044C>G	c.(1042-1044)ccC>ccG	p.P348P		NM_001080518.1	NP_001073987.1	Q5VXJ0	LIPK_HUMAN	lipase, family member K	348					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	12		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		TGGCTGATCCCAAGGATGTTG	0.368																																						dbGAP											0													49.0	47.0	48.0					10																	90512357		1890	4121	6011	-	-	-	SO:0001819	synonymous_variant	0				CCDS44455.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000204021	ENSG00000204021			23444	protein-coding gene	gene with protein product		613922	"""lipase-like, ab-hydrolase domain containing 2"""	LIPL2			Standard	NM_001080518		Approved	bA186O14.2	uc010qmv.2	Q5VXJ0	OTTHUMG00000018693	ENST00000404190.1:c.1044C>G	10.37:g.90512357C>G			A7KIH8	Silent	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.P348	ENST00000404190.1	37	c.1044	CCDS44455.1	10																																																																																			LIPK	-	pfam_AB_hydrolase_1	ENSG00000204021		0.368	LIPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPK	HGNC	protein_coding	OTTHUMT00000049253.2	30	0.00	0	C	XM_061222		90512357	90512357	+1	no_errors	ENST00000404190	ensembl	human	known	69_37n	silent	23	30.30	10	SNP	0.022	G
LRP8	7804	genome.wustl.edu	37	1	53715175	53715175	+	Silent	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:53715175G>A	ENST00000306052.6	-	18	2831	c.2730C>T	c.(2728-2730)acC>acT	p.T910T	LRP8_ENST00000354412.3_Intron|LRP8_ENST00000347547.2_Silent_p.T740T|LRP8_ENST00000465675.1_Intron|LRP8_ENST00000371454.2_Intron	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	910					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						ccggttctctggtctccccaa	0.597																																						dbGAP											0													40.0	36.0	38.0					1																	53715175		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2730C>T	1.37:g.53715175G>A			B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.T910	ENST00000306052.6	37	c.2730	CCDS578.1	1																																																																																			LRP8	-	NULL	ENSG00000157193		0.597	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	HGNC	protein_coding	OTTHUMT00000024699.1	20	0.00	0	G	NM_004631		53715175	53715175	-1	no_errors	ENST00000306052	ensembl	human	known	69_37n	silent	13	31.58	6	SNP	1.000	A
MAP1A	4130	genome.wustl.edu	37	15	43813808	43813808	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr15:43813808G>T	ENST00000300231.5	+	4	587	c.137G>T	c.(136-138)gGt>gTt	p.G46V	MAP1A_ENST00000382031.1_Missense_Mutation_p.G284V|MAP1A_ENST00000399453.1_Missense_Mutation_p.G46V			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	46					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TTCCCAGGTGGTCGTGGGGAC	0.557																																						dbGAP											0													117.0	116.0	116.0					15																	43813808		2186	4283	6469	-	-	-	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.137G>T	15.37:g.43813808G>T	ENSP00000300231:p.Gly46Val		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.G46V	ENST00000300231.5	37	c.137	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	G	15.16	2.752442	0.49362	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.27890	1.64;1.64;1.64	5.22	5.22	0.72569	.	.	.	.	.	T	0.66858	0.2832	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75462	-0.3309	9	0.87932	D	0	-15.6719	18.9574	0.92664	0.0:0.0:1.0:0.0	.	46	P78559	MAP1A_HUMAN	V	284;46;46;46	ENSP00000371462:G284V;ENSP00000382380:G46V;ENSP00000300231:G46V	ENSP00000300231:G46V	G	+	2	0	MAP1A	41601100	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.720000	0.93068	0.561000	0.74099	GGT	MAP1A	-	NULL	ENSG00000166963		0.557	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	56	0.00	0	G	NM_002373		43813808	43813808	+1	no_errors	ENST00000399453	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	1.000	T
MBD1	4152	genome.wustl.edu	37	18	47799778	47799778	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr18:47799778delC	ENST00000591416.1	-	13	1941	c.1510delG	c.(1510-1512)gatfs	p.D504fs	MBD1_ENST00000398493.1_Frame_Shift_Del_p.D448fs|MBD1_ENST00000382948.5_Frame_Shift_Del_p.D504fs|MBD1_ENST00000588937.1_Intron|MBD1_ENST00000590208.1_Frame_Shift_Del_p.D504fs|MBD1_ENST00000585672.1_Frame_Shift_Del_p.D454fs|MBD1_ENST00000424334.2_Frame_Shift_Del_p.D555fs|MBD1_ENST00000339998.6_Intron|MBD1_ENST00000353909.3_Frame_Shift_Del_p.D455fs|MBD1_ENST00000349085.2_Intron|MBD1_ENST00000585595.1_Frame_Shift_Del_p.D529fs|MBD1_ENST00000269471.5_Intron|MBD1_ENST00000591535.1_Intron|MBD1_ENST00000347968.3_Frame_Shift_Del_p.D448fs|MBD1_ENST00000269468.5_Frame_Shift_Del_p.D504fs|MBD1_ENST00000398488.1_Intron|MBD1_ENST00000398495.2_Frame_Shift_Del_p.D473fs|MBD1_ENST00000587605.1_Intron|MBD1_ENST00000436910.1_Intron|MBD1_ENST00000457839.2_Frame_Shift_Del_p.D529fs			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	504					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						TCCTGGGTATCCGCCTTCTCT	0.597																																						dbGAP											0													133.0	103.0	113.0					18																	47799778		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1510delG	18.37:g.47799778delC	ENSP00000467017:p.Asp504fs		A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Frame_Shift_Del	DEL	pfam_Znf_CXXC,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_CXXC	p.D555fs	ENST00000591416.1	37	c.1663	CCDS11943.1	18																																																																																			MBD1	-	NULL	ENSG00000141644		0.597	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MBD1	HGNC	protein_coding	OTTHUMT00000255926.3	21	0.00	0	C	NM_015846		47799778	47799778	-1	no_errors	ENST00000424334	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	0.896	-
NEDD4	4734	genome.wustl.edu	37	15	56207669	56207669	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr15:56207669C>T	ENST00000508342.1	-	1	1660	c.1361G>A	c.(1360-1362)cGa>cAa	p.R454Q	NEDD4_ENST00000506154.1_Missense_Mutation_p.R454Q|NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000338963.2_Missense_Mutation_p.R454Q	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	454					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AATACTTCTTCGTAAAATACC	0.373																																						dbGAP											0													127.0	128.0	127.0					15																	56207669		2193	4292	6485	-	-	-	SO:0001583	missense	0			D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1361G>A	15.37:g.56207669C>T	ENSP00000424827:p.Arg454Gln		A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.R454Q	ENST00000508342.1	37	c.1361		15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	6.206|6.206	0.406221|0.406221	0.11754|0.11754	.|.	.|.	ENSG00000069869|ENSG00000069869	ENST00000508871|ENST00000508342;ENST00000338963;ENST00000506154	.|T;T;T	.|0.14893	.|2.49;2.49;2.47	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|7739.210000	.|0.00166	.|N	.|0.000000	T|T	0.07098|0.07098	0.0180|0.0180	N|N	0.01048|0.01048	-1.04|-1.04	0.18873|0.18873	N|N	0.999984|0.999984	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.01281	.|0.0;0.0;0.0	T|T	0.43065|0.43065	-0.9414|-0.9414	5|10	.|0.02654	.|T	.|1	.|.	10.7572|10.7572	0.46243|0.46243	0.0:0.0744:0.0:0.9256|0.0:0.0744:0.0:0.9256	.|.	.|454;454;454	.|P46934-2;P46934;P46934-3	.|.;NEDD4_HUMAN;.	K|Q	62|454	.|ENSP00000424827:R454Q;ENSP00000345530:R454Q;ENSP00000422705:R454Q	.|ENSP00000345530:R454Q	E|R	-|-	1|2	0|0	NEDD4|NEDD4	53994961|53994961	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.917000|0.917000	0.54804|0.54804	3.963000|3.963000	0.56773|0.56773	0.921000|0.921000	0.36994|0.36994	-0.550000|-0.550000	0.04213|0.04213	GAA|CGA	NEDD4	-	NULL	ENSG00000069869		0.373	NEDD4-002	KNOWN	basic	protein_coding	NEDD4	HGNC	protein_coding	OTTHUMT00000359817.1	44	0.00	0	C	NM_198400		56207669	56207669	-1	no_errors	ENST00000508342	ensembl	human	known	69_37n	missense	38	48.65	36	SNP	1.000	T
NHSL1	57224	genome.wustl.edu	37	6	138751809	138751809	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr6:138751809G>A	ENST00000427025.2	-	5	4313	c.3685C>T	c.(3685-3687)Cga>Tga	p.R1229*	NHSL1_ENST00000343505.5_Nonsense_Mutation_p.R1225*	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	1229										breast(2)|endometrium(4)|kidney(1)	7						GGCACAGCTCGGAGGGCTTCG	0.617																																						dbGAP											0													20.0	20.0	20.0					6																	138751809		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.3685C>T	6.37:g.138751809G>A	ENSP00000394546:p.Arg1229*		Q3ZCS5|Q5SYE8|Q9P2J0	Nonsense_Mutation	SNP	NULL	p.R1229*	ENST00000427025.2	37	c.3685	CCDS55063.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.348686	0.97494	.	.	ENSG00000135540	ENST00000427025;ENST00000343505	.	.	.	3.76	-1.67	0.08238	.	1.900310	0.03785	U	0.261927	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	1.7294	1.1758	0.01835	0.2195:0.0997:0.2317:0.449	.	.	.	.	X	1229;1225	.	ENSP00000344672:R1225X	R	-	1	2	NHSL1	138793502	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-0.168000	0.09925	-0.701000	0.05063	0.561000	0.74099	CGA	NHSL1	-	NULL	ENSG00000135540		0.617	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	HGNC	protein_coding	OTTHUMT00000043700.2	14	0.00	0	G	XM_050421		138751809	138751809	-1	no_errors	ENST00000427025	ensembl	human	known	69_37n	nonsense	12	25.00	4	SNP	0.001	A
NUP155	9631	genome.wustl.edu	37	5	37310731	37310731	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr5:37310731C>T	ENST00000231498.3	-	23	2754	c.2551G>A	c.(2551-2553)Gct>Act	p.A851T	NUP155_ENST00000381843.2_Missense_Mutation_p.A792T|NUP155_ENST00000513532.1_Intron|NUP155_ENST00000502533.1_5'UTR	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	851					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCATCAACAGCGGCATTATCT	0.373																																						dbGAP											0													153.0	148.0	150.0					5																	37310731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.2551G>A	5.37:g.37310731C>T	ENSP00000231498:p.Ala851Thr		Q9UBE9|Q9UFL5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup133/Nup155_C,pfam_Nucleoporin_Nup133/Nup155_N,superfamily_WD40_repeat_dom	p.A851T	ENST00000231498.3	37	c.2551	CCDS3921.1	5	.	.	.	.	.	.	.	.	.	.	C	17.56	3.420610	0.62622	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056	T;T	0.74737	-0.86;-0.87	5.85	5.85	0.93711	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.160351	0.56097	D	0.000024	T	0.55016	0.1894	N	0.05078	-0.115	0.80722	D	1	B	0.12630	0.006	B	0.12837	0.008	T	0.51585	-0.8687	10	0.26408	T	0.33	-3.4837	14.9405	0.70989	0.1429:0.8571:0.0:0.0	.	851	O75694	NU155_HUMAN	T	851;792;813	ENSP00000231498:A851T;ENSP00000371265:A792T	ENSP00000231498:A851T	A	-	1	0	NUP155	37346488	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.726000	0.61986	2.772000	0.95346	0.650000	0.86243	GCT	NUP155	-	pfam_Nucleoporin_Nup133/Nup155_C	ENSG00000113569		0.373	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	HGNC	protein_coding	OTTHUMT00000207593.2	39	0.00	0	C	NM_153485, NM_004298		37310731	37310731	-1	no_errors	ENST00000231498	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	1.000	T
OR4X1	390113	genome.wustl.edu	37	11	48285568	48285568	+	Silent	SNP	G	G	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr11:48285568G>T	ENST00000320048.1	+	1	156	c.156G>T	c.(154-156)gtG>gtT	p.V52V		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						CCAGCAAAGTGCTCACCTCCC	0.488																																						dbGAP											0													169.0	152.0	157.0					11																	48285568		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.156G>T	11.37:g.48285568G>T			Q6IF74	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V52	ENST00000320048.1	37	c.156	CCDS31487.1	11																																																																																			OR4X1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176567		0.488	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X1	HGNC	protein_coding	OTTHUMT00000383373.1	87	0.00	0	G	NM_001004726		48285568	48285568	+1	no_errors	ENST00000320048	ensembl	human	known	69_37n	silent	112	16.42	22	SNP	0.001	T
P2RY1	5028	genome.wustl.edu	37	3	152554344	152554344	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr3:152554344C>T	ENST00000305097.3	+	1	1609	c.773C>T	c.(772-774)tCg>tTg	p.S258L	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	258					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AGGAGAAAATCGATTTACCTG	0.428																																						dbGAP											0													103.0	101.0	102.0					3																	152554344		2203	4300	6503	-	-	-	SO:0001583	missense	0			U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.773C>T	3.37:g.152554344C>T	ENSP00000304767:p.Ser258Leu			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_P2Y_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.S258L	ENST00000305097.3	37	c.773	CCDS3169.1	3	.	.	.	.	.	.	.	.	.	.	C	26.0	4.694082	0.88735	.	.	ENSG00000169860	ENST00000305097	T	0.34472	1.36	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.59169	0.2174	M	0.68728	2.09	0.80722	D	1	D	0.76494	0.999	D	0.65573	0.936	T	0.60954	-0.7160	10	0.72032	D	0.01	.	18.5615	0.91101	0.0:1.0:0.0:0.0	.	258	P47900	P2RY1_HUMAN	L	258	ENSP00000304767:S258L	ENSP00000304767:S258L	S	+	2	0	P2RY1	154037034	1.000000	0.71417	0.984000	0.44739	0.753000	0.42808	7.711000	0.84669	2.618000	0.88619	0.563000	0.77884	TCG	P2RY1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000169860		0.428	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY1	HGNC	protein_coding	OTTHUMT00000356943.1	54	0.00	0	C	NM_002563		152554344	152554344	+1	no_errors	ENST00000305097	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	1.000	T
PARP8	79668	genome.wustl.edu	37	5	50090154	50090154	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr5:50090154C>G	ENST00000281631.5	+	11	1009	c.851C>G	c.(850-852)tCt>tGt	p.S284C	PARP8_ENST00000514067.2_Missense_Mutation_p.S284C|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000514342.2_Missense_Mutation_p.S37C|PARP8_ENST00000505697.2_Missense_Mutation_p.S284C|PARP8_ENST00000503750.2_Missense_Mutation_p.S284C|PARP8_ENST00000505554.1_Missense_Mutation_p.S263C	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	284						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.S284F(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				CATTTATTTTCTACTTTGCGC	0.398																																						dbGAP											1	Substitution - Missense(1)	lung(1)											153.0	156.0	155.0					5																	50090154		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.851C>G	5.37:g.50090154C>G	ENSP00000281631:p.Ser284Cys		Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.S284C	ENST00000281631.5	37	c.851	CCDS3954.1	5	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191631	0.78902	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.72269	0.3439	L	0.38175	1.15	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.76071	0.965;0.923;0.987	T	0.68949	-0.5274	8	.	.	.	-11.86	19.5707	0.95413	0.0:1.0:0.0:0.0	.	176;284;284	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	C	284;284;37;284;284;263;37;37	.	.	S	+	2	0	PARP8	50125911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.425000	0.73370	2.690000	0.91761	0.655000	0.94253	TCT	PARP8	-	NULL	ENSG00000151883		0.398	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	73	0.00	0	C	NM_024615		50090154	50090154	+1	no_errors	ENST00000281631	ensembl	human	known	69_37n	missense	67	18.29	15	SNP	1.000	G
PHLDB2	90102	genome.wustl.edu	37	3	111603283	111603283	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr3:111603283G>A	ENST00000431670.2	+	2	770	c.359G>A	c.(358-360)gGa>gAa	p.G120E	PHLDB2_ENST00000412622.1_Missense_Mutation_p.G120E|PHLDB2_ENST00000393923.3_Missense_Mutation_p.G147E|PHLDB2_ENST00000393925.3_Missense_Mutation_p.G120E|PHLDB2_ENST00000481953.1_Missense_Mutation_p.G120E|PHLDB2_ENST00000477695.1_Missense_Mutation_p.G120E|PHLDB2_ENST00000478922.1_Missense_Mutation_p.G120E	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	120						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TCCCTCAGTGGATATCCACTT	0.443																																						dbGAP											0													208.0	225.0	219.0					3																	111603283		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.359G>A	3.37:g.111603283G>A	ENSP00000405405:p.Gly120Glu		A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G120E	ENST00000431670.2	37	c.359	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	G	12.59	1.983415	0.35036	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	T;T;T;T;T;T	0.32988	1.43;1.46;1.45;1.46;1.46;1.45	5.66	4.77	0.60923	.	0.270585	0.37437	N	0.002084	T	0.37376	0.1001	L	0.47716	1.5	0.09310	N	1	B;B;D;B;B	0.59767	0.049;0.17;0.986;0.047;0.197	B;B;P;B;B	0.56474	0.018;0.067;0.799;0.021;0.119	T	0.15665	-1.0429	10	0.32370	T	0.25	.	8.281	0.31900	0.083:0.159:0.7581:0.0	.	120;120;120;120;147	Q86SQ0;G5E9V3;E9PDY7;Q86SQ0-2;Q86SQ0-3	PHLB2_HUMAN;.;.;.;.	E	147;147;120;120;120;120;120;120;120	ENSP00000377500:G147E;ENSP00000405405:G120E;ENSP00000405292:G120E;ENSP00000418296:G120E;ENSP00000377502:G120E;ENSP00000418319:G120E	ENSP00000352764:G147E	G	+	2	0	PHLDB2	113085973	.	.	0.026000	0.17262	0.786000	0.44442	.	.	1.484000	0.48361	0.655000	0.94253	GGA	PHLDB2	-	NULL	ENSG00000144824		0.443	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1	30	0.00	0	G	NM_145753		111603283	111603283	+1	no_errors	ENST00000393925	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	0.075	A
POLR1A	25885	genome.wustl.edu	37	2	86276113	86276113	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr2:86276113C>T	ENST00000263857.6	-	18	2906	c.2528G>A	c.(2527-2529)cGa>cAa	p.R843Q	POLR1A_ENST00000409681.1_Missense_Mutation_p.R843Q			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	843					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CCATTTTCCTCGGACCTCATC	0.488																																						dbGAP											0													98.0	94.0	95.0					2																	86276113		1955	4134	6089	-	-	-	SO:0001583	missense	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.2528G>A	2.37:g.86276113C>T	ENSP00000263857:p.Arg843Gln		B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.R843Q	ENST00000263857.6	37	c.2528	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	C	7.673	0.687477	0.14973	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.76578	-1.03;-1.03	5.57	-3.75	0.04372	RNA polymerase Rpb1, domain 4 (1);	0.569045	0.18691	N	0.133845	T	0.49660	0.1570	N	0.04636	-0.2	0.18873	N	0.999985	B	0.06786	0.001	B	0.08055	0.003	T	0.41197	-0.9522	10	0.08599	T	0.76	0.0272	14.3101	0.66410	0.0:0.2858:0.0:0.7142	.	843	O95602	RPA1_HUMAN	Q	843	ENSP00000263857:R843Q;ENSP00000386300:R843Q	ENSP00000263857:R843Q	R	-	2	0	POLR1A	86129624	0.156000	0.22821	0.094000	0.20943	0.241000	0.25554	0.016000	0.13377	-0.591000	0.05859	-1.581000	0.00855	CGA	POLR1A	-	pfam_RNA_pol_Rpb1_4	ENSG00000068654		0.488	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	48	0.00	0	C	NM_015425		86276113	86276113	-1	no_errors	ENST00000263857	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	0.005	T
PPOX	5498	genome.wustl.edu	37	1	161137894	161137894	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:161137894G>A	ENST00000367999.4	+	5	714	c.448G>A	c.(448-450)Gcc>Acc	p.A150T	PPOX_ENST00000544598.1_Intron|PPOX_ENST00000352210.5_Missense_Mutation_p.A150T|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000495483.1_Intron	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	150					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GCACAGTTTTGCCCAGCGCCG	0.597																																						dbGAP											0													49.0	52.0	51.0					1																	161137894		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.448G>A	1.37:g.161137894G>A	ENSP00000356978:p.Ala150Thr		D3DVG0|Q5VTW8	Missense_Mutation	SNP	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	p.A150T	ENST00000367999.4	37	c.448	CCDS1221.1	1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319949	0.60634	.	.	ENSG00000143224	ENST00000352210;ENST00000367999	D;D	0.96168	-3.93;-3.93	5.69	4.78	0.61160	Amine oxidase (1);	0.177454	0.48767	N	0.000166	D	0.86368	0.5916	L	0.27053	0.805	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.83074	-0.0141	10	0.37606	T	0.19	-9.1669	12.4877	0.55883	0.0805:0.0:0.9195:0.0	.	150	P50336	PPOX_HUMAN	T	150	ENSP00000343943:A150T;ENSP00000356978:A150T	ENSP00000343943:A150T	A	+	1	0	PPOX	159404518	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.270000	0.51600	1.413000	0.46997	0.650000	0.86243	GCC	PPOX	-	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	ENSG00000143224		0.597	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	HGNC	protein_coding	OTTHUMT00000082993.1	21	0.00	0	G	NM_000309		161137894	161137894	+1	no_errors	ENST00000352210	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	1.000	A
PRB4	5545	genome.wustl.edu	37	12	11461753	11461753	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr12:11461753C>T	ENST00000535904.1	-	3	197	c.164G>A	c.(163-165)gGa>gAa	p.G55E	PRB4_ENST00000445719.2_Missense_Mutation_p.G55E|PRB4_ENST00000279575.1_Missense_Mutation_p.G55E			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	76	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						TTGTGGCTTTCCTGGAGGAGG	0.607										HNSCC(22;0.051)																												dbGAP											0													195.0	210.0	205.0					12																	11461753		2191	4283	6474	-	-	-	SO:0001583	missense	0				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.164G>A	12.37:g.11461753C>T	ENSP00000442834:p.Gly55Glu		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	NULL	p.G55E	ENST00000535904.1	37	c.164	CCDS8641.1	12	.	.	.	.	.	.	.	.	.	.	.	6.034	0.374555	0.11409	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.03982	3.74;3.74;3.74	0.956	-4.78E-4	0.14038	.	.	.	.	.	T	0.06645	0.0170	M	0.74881	2.28	0.09310	N	1	B	0.16603	0.018	B	0.14023	0.01	T	0.35599	-0.9782	9	0.66056	D	0.02	.	3.231	0.06749	0.0:0.6845:0.0:0.3155	.	55	E9PAL0	.	E	55	ENSP00000279575:G55E;ENSP00000442834:G55E;ENSP00000412740:G55E	ENSP00000279575:G55E	G	-	2	0	PRB4	11353020	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-1.114000	0.03293	-0.015000	0.14150	0.196000	0.17591	GGA	PRB4	-	NULL	ENSG00000230657		0.607	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB4	HGNC	protein_coding	OTTHUMT00000402308.1	123	0.81	1	C	NM_002723		11461753	11461753	-1	no_errors	ENST00000279575	ensembl	human	known	69_37n	missense	108	23.40	33	SNP	0.002	T
ROPN1B	152015	genome.wustl.edu	37	3	125694466	125694466	+	Silent	SNP	C	C	T	rs541348602		TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr3:125694466C>T	ENST00000514116.1	+	4	492	c.177C>T	c.(175-177)gtC>gtT	p.V59V	ROPN1B_ENST00000511082.1_5'Flank|ROPN1B_ENST00000505382.1_5'UTR|ROPN1B_ENST00000251776.4_Silent_p.V59V			Q9BZX4	ROP1B_HUMAN	rhophilin associated tail protein 1B	59					acrosome reaction (GO:0007340)|cytokinesis (GO:0000910)|fusion of sperm to egg plasma membrane (GO:0007342)|Rho protein signal transduction (GO:0007266)|single organismal cell-cell adhesion (GO:0016337)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(114;0.151)		CTGAGCGAGTCGCTTTGTGTA	0.512													c|||	1	0.000199681	0.0008	0.0	5008	,	,		20614	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													109.0	98.0	102.0					3																	125694466		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF231410	CCDS33841.1	3q21.2	2011-01-20	2011-01-20		ENSG00000114547	ENSG00000114547			31927	protein-coding gene	gene with protein product			"""ropporin, rhophilin associated protein 1B"""				Standard	XM_005247137		Approved		uc003eih.3	Q9BZX4	OTTHUMG00000162651	ENST00000514116.1:c.177C>T	3.37:g.125694466C>T			D3DNA6|Q96BM7	Silent	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.V59	ENST00000514116.1	37	c.177	CCDS33841.1	3																																																																																			ROPN1B	-	NULL	ENSG00000114547		0.512	ROPN1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ROPN1B	HGNC	protein_coding	OTTHUMT00000369931.1	56	0.00	0	C	NM_001012337		125694466	125694466	+1	no_errors	ENST00000251776	ensembl	human	known	69_37n	silent	59	15.71	11	SNP	0.001	T
ROR1	4919	genome.wustl.edu	37	1	64605929	64605929	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:64605929G>C	ENST00000371079.1	+	6	1123	c.748G>C	c.(748-750)Gat>Cat	p.D250H	ROR1_ENST00000371080.1_Missense_Mutation_p.D250H|ROR1_ENST00000545203.1_5'UTR|ROR1_ENST00000482426.1_3'UTR|RP11-24J23.2_ENST00000424995.1_RNA	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	250	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						CTTGTGTCGCGATGAATGTGA	0.468																																						dbGAP											0													131.0	118.0	122.0					1																	64605929		2203	4300	6503	-	-	-	SO:0001583	missense	0			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.748G>C	1.37:g.64605929G>C	ENSP00000360120:p.Asp250His		Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D250H	ENST00000371079.1	37	c.748	CCDS626.1	1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.024722	0.93518	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.55052	0.54;0.54	5.92	5.92	0.95590	Frizzled domain (2);Kringle (1);	0.000000	0.44483	D	0.000454	T	0.69033	0.3066	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.69829	-0.5039	10	0.87932	D	0	.	20.3343	0.98733	0.0:0.0:1.0:0.0	.	250;250	Q01973;Q66K77	ROR1_HUMAN;.	H	250;250;253	ENSP00000360121:D250H;ENSP00000360120:D250H	ENSP00000360120:D250H	D	+	1	0	ROR1	64378517	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.835000	0.99442	2.822000	0.97130	0.650000	0.86243	GAT	ROR1	-	pirsf_Tyr_kinase_rcpt_ROR,pfam_Frizzled_dom,superfamily_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000185483		0.468	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR1	HGNC	protein_coding	OTTHUMT00000025002.1	42	0.00	0	G	NM_005012		64605929	64605929	+1	no_errors	ENST00000371079	ensembl	human	known	69_37n	missense	36	20.00	9	SNP	1.000	C
RPL10L	140801	genome.wustl.edu	37	14	47120792	47120792	+	Missense_Mutation	SNP	C	C	T	rs562526716		TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr14:47120792C>T	ENST00000298283.3	-	1	236	c.148G>A	c.(148-150)Ggc>Agc	p.G50S		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	50					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						ACCATGTGGCCACCGAGTGGG	0.507													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17595	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													91.0	93.0	93.0					14																	47120792		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.148G>A	14.37:g.47120792C>T	ENSP00000298283:p.Gly50Ser		Q8IUD1	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.G50S	ENST00000298283.3	37	c.148	CCDS32071.1	14	.	.	.	.	.	.	.	.	.	.	C	17.33	3.362642	0.61403	.	.	ENSG00000165496	ENST00000298283	T	0.71579	-0.58	4.17	4.17	0.49024	Ribosomal protein L10e/L16 (2);	0.112719	0.64402	D	0.000013	T	0.73938	0.3651	M	0.63843	1.955	0.54753	D	0.999988	B	0.15473	0.013	B	0.38156	0.266	T	0.72861	-0.4164	10	0.45353	T	0.12	-24.9562	14.7976	0.69889	0.0:1.0:0.0:0.0	.	50	Q96L21	RL10L_HUMAN	S	50	ENSP00000298283:G50S	ENSP00000298283:G50S	G	-	1	0	RPL10L	46190542	0.986000	0.35501	0.759000	0.31340	0.823000	0.46562	6.851000	0.75425	2.608000	0.88229	0.655000	0.94253	GGC	RPL10L	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	ENSG00000165496		0.507	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10L	HGNC	protein_coding	OTTHUMT00000349819.1	44	0.00	0	C			47120792	47120792	-1	no_errors	ENST00000298283	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.999	T
RPS6KA5	9252	genome.wustl.edu	37	14	91360826	91360826	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr14:91360826C>A	ENST00000261991.3	-	13	1748	c.1575G>T	c.(1573-1575)atG>atT	p.M525I	RPS6KA5_ENST00000418736.2_Missense_Mutation_p.M525I|RPS6KA5_ENST00000536315.2_Missense_Mutation_p.M446I	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	525	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		CAAGCTTCCTCATGATGTAGC	0.438																																						dbGAP											0													148.0	123.0	131.0					14																	91360826		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.1575G>T	14.37:g.91360826C>A	ENSP00000261991:p.Met525Ile		O95316|Q96AF7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_Aminoglycoside_PTrfase,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_AGC-kinase_C,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	p.M525I	ENST00000261991.3	37	c.1575	CCDS9893.1	14	.	.	.	.	.	.	.	.	.	.	C	16.57	3.160205	0.57368	.	.	ENSG00000100784	ENST00000261991;ENST00000536315;ENST00000418736	T;T;T	0.64260	-0.09;-0.09;-0.09	5.66	5.66	0.87406	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57021	0.2025	N	0.17248	0.465	0.80722	D	1	P;P	0.50617	0.779;0.937	P;P	0.47430	0.547;0.519	T	0.62789	-0.6780	10	0.62326	D	0.03	.	19.7559	0.96291	0.0:1.0:0.0:0.0	.	525;525	O75582-2;O75582	.;KS6A5_HUMAN	I	525;446;525	ENSP00000261991:M525I;ENSP00000442803:M446I;ENSP00000402787:M525I	ENSP00000261991:M525I	M	-	3	0	RPS6KA5	90430579	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	7.818000	0.86416	2.656000	0.90262	0.655000	0.94253	ATG	RPS6KA5	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000100784		0.438	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA5	HGNC	protein_coding	OTTHUMT00000411442.2	34	0.00	0	C	NM_004755		91360826	91360826	-1	no_errors	ENST00000261991	ensembl	human	known	69_37n	missense	40	20.00	10	SNP	1.000	A
SHISA5	51246	genome.wustl.edu	37	3	48538577	48538577	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr3:48538577C>T	ENST00000296444.2	-	2	562	c.226G>A	c.(226-228)Gag>Aag	p.E76K	SHISA5_ENST00000442747.1_Missense_Mutation_p.E45K|SHISA5_ENST00000443308.2_Intron|SHISA5_ENST00000444115.1_Missense_Mutation_p.E45K	NM_001272065.1|NM_016479.3	NP_001258994.1|NP_057563.3	Q8N114	SHSA5_HUMAN	shisa family member 5	76					intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			large_intestine(1)|lung(1)	2						CACCTGGCCTCAGGCACAGCA	0.572																																						dbGAP											0													111.0	90.0	97.0					3																	48538577		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF520698	CCDS2770.1, CCDS63621.1, CCDS63622.1, CCDS63623.1	3p21.31	2013-07-31	2013-07-31		ENSG00000164054	ENSG00000164054		"""Shisa homologs"""	30376	protein-coding gene	gene with protein product		607290	"""shisa homolog 5 (Xenopus laevis)"""			11042152, 12135983	Standard	NM_016479		Approved	SCOTIN, hShisa5	uc011bbk.1	Q8N114	OTTHUMG00000133529	ENST00000296444.2:c.226G>A	3.37:g.48538577C>T	ENSP00000296444:p.Glu76Lys		B3KW99|F8W9N8|Q69YY9|Q7Z433|Q8NHL9|Q96MW8|Q9BV58	Missense_Mutation	SNP	NULL	p.E76K	ENST00000296444.2	37	c.226	CCDS2770.1	3	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423037	0.83559	.	.	ENSG00000164054	ENST00000296444;ENST00000444115;ENST00000442747;ENST00000417841	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	4.29	0.396	0.16309	.	2.995420	0.01632	N	0.023595	T	0.42200	0.1192	L	0.54323	1.7	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.07177	-1.0786	10	0.27785	T	0.31	-11.5711	4.1854	0.10395	0.0:0.5444:0.173:0.2826	.	76	Q8N114	SHSA5_HUMAN	K	76;45;45;45	ENSP00000296444:E76K;ENSP00000407957:E45K;ENSP00000408223:E45K;ENSP00000412509:E45K	ENSP00000296444:E76K	E	-	1	0	SHISA5	48513581	0.000000	0.05858	0.000000	0.03702	0.955000	0.61496	-1.073000	0.03430	0.050000	0.15949	0.650000	0.86243	GAG	SHISA5	-	NULL	ENSG00000164054		0.572	SHISA5-001	KNOWN	basic|CCDS	protein_coding	SHISA5	HGNC	protein_coding	OTTHUMT00000257504.3	32	0.00	0	C	NM_016479		48538577	48538577	-1	no_errors	ENST00000296444	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.000	T
SLC13A5	284111	genome.wustl.edu	37	17	6606341	6606341	+	Missense_Mutation	SNP	C	C	T	rs201674669		TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr17:6606341C>T	ENST00000433363.2	-	5	897	c.664G>A	c.(664-666)Gcc>Acc	p.A222T	SLC13A5_ENST00000573648.1_Missense_Mutation_p.A222T|SLC13A5_ENST00000293800.6_Missense_Mutation_p.A205T|SLC13A5_ENST00000381074.4_Missense_Mutation_p.A179T	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	222					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						GTCAGGGTGGCGGTGCCCCCG	0.642																																						dbGAP											0													121.0	101.0	108.0					17																	6606341		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.664G>A	17.37:g.6606341C>T	ENSP00000406220:p.Ala222Thr		B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.A222T	ENST00000433363.2	37	c.664	CCDS11079.1	17	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140641	0.56936	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T	0.03124	4.04;4.04	5.47	5.47	0.80525	.	0.045981	0.85682	D	0.000000	T	0.18800	0.0451	M	0.78916	2.43	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.995;0.991;0.995;0.995;0.995	T	0.00080	-1.2110	10	0.40728	T	0.16	.	17.1977	0.86898	0.0:1.0:0.0:0.0	.	222;179;179;205;222	B7ZLB4;F8W7N2;B7Z4P2;B3KXR0;Q86YT5	.;.;.;.;S13A5_HUMAN	T	222;222;179	ENSP00000406220:A222T;ENSP00000370464:A179T	ENSP00000293800:A222T	A	-	1	0	SLC13A5	6547065	1.000000	0.71417	0.966000	0.40874	0.260000	0.26232	5.588000	0.67517	2.746000	0.94184	0.561000	0.74099	GCC	SLC13A5	-	pfam_Na/sul_symport	ENSG00000141485		0.642	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A5	HGNC	protein_coding	OTTHUMT00000219853.2	35	0.00	0	C	NM_177550		6606341	6606341	-1	no_errors	ENST00000433363	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	1.000	T
SLC8A1	6546	genome.wustl.edu	37	2	40405590	40405590	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr2:40405590T>C	ENST00000403092.1	-	3	1885	c.1852A>G	c.(1852-1854)Aaa>Gaa	p.K618E	SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000405901.3_Missense_Mutation_p.K618E|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1_ENST00000406785.2_Intron|SLC8A1_ENST00000542756.1_Missense_Mutation_p.K618E|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1_ENST00000402441.1_Intron|SLC8A1_ENST00000542024.1_Intron|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1_ENST00000332839.4_Missense_Mutation_p.K618E|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000405269.1_Intron|SLC8A1_ENST00000408028.2_Intron|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1_ENST00000406391.2_Intron|SLC8A1-AS1_ENST00000444629.1_RNA			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	618	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GTCTTGTTTTTCTCATACTCC	0.468																																						dbGAP											0													239.0	235.0	237.0					2																	40405590		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1852A>G	2.37:g.40405590T>C	ENSP00000384763:p.Lys618Glu		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,pfscan_DnaJ_N,prints_Na_Ca_Ex,prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	p.K618E	ENST00000403092.1	37	c.1852	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338174	0.81911	.	.	ENSG00000183023	ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000332839	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.39	5.39	0.77823	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.49423	0.1556	L	0.52011	1.625	0.80722	D	1	P;D	0.89917	0.917;1.0	P;D	0.91635	0.721;0.999	T	0.50800	-0.8785	10	0.87932	D	0	.	13.3557	0.60627	0.0:0.0:0.0:1.0	.	618;618	F6VPY9;P32418	.;NAC1_HUMAN	E	618	ENSP00000440727:K618E;ENSP00000384763:K618E;ENSP00000385678:K618E;ENSP00000332931:K618E	ENSP00000332931:K618E	K	-	1	0	SLC8A1	40259094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.587000	0.82613	2.028000	0.59812	0.482000	0.46254	AAA	SLC8A1	-	pfam_Calx_beta,smart_Calx_beta,tigrfam_Na_Ca_Ex	ENSG00000183023		0.468	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	HGNC	protein_coding	OTTHUMT00000326065.1	75	0.00	0	T	NM_021097		40405590	40405590	-1	no_errors	ENST00000332839	ensembl	human	known	69_37n	missense	70	26.32	25	SNP	1.000	C
SPTA1	6708	genome.wustl.edu	37	1	158647585	158647585	+	Silent	SNP	T	T	C			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:158647585T>C	ENST00000368147.4	-	7	1032	c.852A>G	c.(850-852)gaA>gaG	p.E284E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	284					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGAGTACAGGTTCCTTCTCCT	0.478																																						dbGAP											0													119.0	115.0	116.0					1																	158647585		1979	4163	6142	-	-	-	SO:0001819	synonymous_variant	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.852A>G	1.37:g.158647585T>C			Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E284	ENST00000368147.4	37	c.852	CCDS41423.1	1																																																																																			SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	29	0.00	0	T	NM_003126		158647585	158647585	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	silent	18	57.14	24	SNP	0.993	C
TBC1D1	23216	genome.wustl.edu	37	4	38020062	38020062	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr4:38020062C>T	ENST00000261439.4	+	4	1325	c.970C>T	c.(970-972)Cag>Tag	p.Q324*	TBC1D1_ENST00000508802.1_Nonsense_Mutation_p.Q324*	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	324	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CTTTTGCTCTCAGGTAAATGG	0.313																																						dbGAP											0													56.0	59.0	58.0					4																	38020062		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.970C>T	4.37:g.38020062C>T	ENSP00000261439:p.Gln324*		B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.Q324*	ENST00000261439.4	37	c.970	CCDS33972.1	4	.	.	.	.	.	.	.	.	.	.	C	42	9.350712	0.99145	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000446803	.	.	.	5.75	5.75	0.90469	.	0.000000	0.53938	D	0.000060	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-30.597	19.9273	0.97107	0.0:1.0:0.0:0.0	.	.	.	.	X	324;324;195	.	ENSP00000261439:Q324X	Q	+	1	0	TBC1D1	37696457	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.723000	0.84788	2.718000	0.92993	0.591000	0.81541	CAG	TBC1D1	-	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	ENSG00000065882		0.313	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	75	0.00	0	C	NM_015173		38020062	38020062	+1	no_errors	ENST00000261439	ensembl	human	known	69_37n	nonsense	69	11.54	9	SNP	1.000	T
TBC1D8B	54885	genome.wustl.edu	37	X	106116842	106116842	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chrX:106116842C>G	ENST00000357242.5	+	21	3184	c.3010C>G	c.(3010-3012)Cat>Gat	p.H1004D	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.H998D	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	1004							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TAACTTATTTCATGAGGACCC	0.353																																						dbGAP											0													90.0	91.0	91.0					X																	106116842		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.3010C>G	X.37:g.106116842C>G	ENSP00000349781:p.His1004Asp		B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.H1004D	ENST00000357242.5	37	c.3010	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206812	0.79127	.	.	ENSG00000133138	ENST00000357242;ENST00000276175	T;T	0.08546	3.08;3.08	5.72	5.72	0.89469	.	0.115504	0.64402	D	0.000020	T	0.27697	0.0681	M	0.73962	2.25	0.58432	D	0.999999	D	0.76494	0.999	D	0.80764	0.994	T	0.06481	-1.0824	10	0.14252	T	0.57	-18.5694	17.2862	0.87142	0.0:1.0:0.0:0.0	.	1004	Q0IIM8	TBC8B_HUMAN	D	1004;998	ENSP00000349781:H1004D;ENSP00000276175:H998D	ENSP00000276175:H998D	H	+	1	0	TBC1D8B	106003498	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.399000	0.81585	0.594000	0.82650	CAT	TBC1D8B	-	NULL	ENSG00000133138		0.353	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	HGNC	protein_coding	OTTHUMT00000057807.2	56	0.00	0	C	NM_017752		106116842	106116842	+1	no_errors	ENST00000357242	ensembl	human	known	69_37n	missense	40	28.57	16	SNP	1.000	G
TNR	7143	genome.wustl.edu	37	1	175365832	175365832	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:175365832G>A	ENST00000367674.2	-	5	1796	c.1088C>T	c.(1087-1089)gCc>gTc	p.A363V	TNR_ENST00000263525.2_Missense_Mutation_p.A363V			Q92752	TENR_HUMAN	tenascin R	363	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GCCCCCCAGGGCCGTCGGCTG	0.607																																						dbGAP											0													64.0	64.0	64.0					1																	175365832		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1088C>T	1.37:g.175365832G>A	ENSP00000356646:p.Ala363Val		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.A363V	ENST00000367674.2	37	c.1088	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.200176	0.38905	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.56776	0.44;0.44	5.96	4.96	0.65561	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.435177	0.23807	N	0.044362	T	0.20981	0.0505	N	0.02539	-0.55	0.29284	N	0.869824	B	0.02656	0.0	B	0.08055	0.003	T	0.10359	-1.0633	10	0.19590	T	0.45	.	3.3231	0.07057	0.2223:0.2504:0.5273:0.0	.	363	Q92752	TENR_HUMAN	V	363	ENSP00000356646:A363V;ENSP00000263525:A363V	ENSP00000263525:A363V	A	-	2	0	TNR	173632455	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	2.224000	0.42945	2.826000	0.97356	0.655000	0.94253	GCC	TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.607	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	24	0.00	0	G	NM_003285		175365832	175365832	-1	no_errors	ENST00000263525	ensembl	human	known	69_37n	missense	18	43.75	14	SNP	1.000	A
TTC28	23331	genome.wustl.edu	37	22	28692181	28692184	+	Splice_Site	DEL	CCTA	CCTA	-			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	CCTA	CCTA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr22:28692181_28692184delCCTA	ENST00000397906.2	-	5	1075		c.e5+1		TTC28_ENST00000490475.1_5'Flank	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						AGATAAACTTCCTACCTCTCGATC	0.382																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.933+1TAGG>-	22.37:g.28692181_28692184delCCTA			K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Splice_Site	DEL	-	e5+2	ENST00000397906.2	37	c.933+2_933+1	CCDS46678.1	22																																																																																			TTC28	-	-	ENSG00000100154		0.382	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	86	0	0	CCTA	XM_929318	Intron	28692181	28692184	-1	no_errors	ENST00000397906	ensembl	human	novel	69_37n	splice_site_del	82	12.63	12	DEL	1.000:1.000:1.000:1.000	0
UBE4B	10277	genome.wustl.edu	37	1	10161225	10161225	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:10161225G>A	ENST00000253251.8	+	4	1246	c.407G>A	c.(406-408)cGa>cAa	p.R136Q	UBE4B_ENST00000377157.3_Missense_Mutation_p.R20Q|UBE4B_ENST00000343090.6_Missense_Mutation_p.R136Q					ubiquitination factor E4B									p.R136Q(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GAAAATGATCGAAGAGAAAAG	0.388																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											153.0	145.0	148.0					1																	10161225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.407G>A	1.37:g.10161225G>A	ENSP00000253251:p.Arg136Gln			Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.R136Q	ENST00000253251.8	37	c.407	CCDS110.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.473916	0.96291	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.52526	0.75;0.8;0.66	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.59155	0.2173	L	0.35854	1.095	0.43263	D	0.995204	D;D	0.69078	0.997;0.997	D;D	0.70227	0.968;0.947	T	0.52041	-0.8628	10	0.24483	T	0.36	-9.0481	19.1353	0.93426	0.0:0.0:1.0:0.0	.	136;136	O95155;O95155-2	UBE4B_HUMAN;.	Q	136;20;136	ENSP00000253251:R136Q;ENSP00000366362:R20Q;ENSP00000343001:R136Q	ENSP00000253251:R136Q	R	+	2	0	UBE4B	10083812	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.507000	0.84556	0.557000	0.71058	CGA	UBE4B	-	NULL	ENSG00000130939		0.388	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE4B	HGNC	protein_coding	OTTHUMT00000005017.1	88	0.00	0	G	NM_006048		10161225	10161225	+1	no_errors	ENST00000343090	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	A
UBXN2A	165324	genome.wustl.edu	37	2	24194187	24194187	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr2:24194187A>G	ENST00000309033.4	+	3	327	c.83A>G	c.(82-84)aAt>aGt	p.N28S	UBXN2A_ENST00000446425.2_3'UTR|UBXN2A_ENST00000404924.1_Missense_Mutation_p.N28S|UBXN2A_ENST00000535786.1_Missense_Mutation_p.N28S	NM_181713.3	NP_859064.2	P68543	UBX2A_HUMAN	UBX domain protein 2A	28					regulation of gene expression (GO:0010468)|regulation of protein catabolic process (GO:0042176)|regulation of protein ubiquitination (GO:0031396)	cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)				endometrium(1)|large_intestine(3)|liver(1)|lung(6)	11						CTTGGTAATAATCAACAATCA	0.338																																						dbGAP											0													134.0	143.0	140.0					2																	24194187		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037901	CCDS1704.1	2p24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000173960	ENSG00000173960		"""UBX domain containing"""	27265	protein-coding gene	gene with protein product			"""UBX domain containing 4"""	UBXD4		12477932	Standard	NM_181713		Approved		uc002ren.3	P68543	OTTHUMG00000125497	ENST00000309033.4:c.83A>G	2.37:g.24194187A>G	ENSP00000312107:p.Asn28Ser		A8K577|B7ZKP8|Q569G8	Missense_Mutation	SNP	pfam_SEP_domain,pfam_UBX,superfamily_SEP_domain,smart_SEP_domain,smart_UBX,pfscan_UBX	p.N28S	ENST00000309033.4	37	c.83	CCDS1704.1	2	.	.	.	.	.	.	.	.	.	.	A	8.003	0.755772	0.15846	.	.	ENSG00000173960	ENST00000404924;ENST00000309033;ENST00000535786	T;T;T	0.42900	0.96;0.96;0.96	4.53	2.11	0.27256	.	0.670270	0.14392	N	0.322436	T	0.14657	0.0354	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31888	-0.9927	10	0.02654	T	1	0.0246	4.26	0.10737	0.6339:0.1739:0.1922:0.0	.	28;28	B7ZKP8;P68543	.;UBX2A_HUMAN	S	28	ENSP00000385525:N28S;ENSP00000312107:N28S;ENSP00000440533:N28S	ENSP00000312107:N28S	N	+	2	0	UBXN2A	24047691	0.013000	0.17824	0.022000	0.16811	0.982000	0.71751	0.263000	0.18478	0.343000	0.23821	0.524000	0.50904	AAT	UBXN2A	-	NULL	ENSG00000173960		0.338	UBXN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN2A	HGNC	protein_coding	OTTHUMT00000246824.2	62	0.00	0	A	NM_181713		24194187	24194187	+1	no_errors	ENST00000309033	ensembl	human	known	69_37n	missense	79	30.09	34	SNP	0.006	G
UNC13A	23025	genome.wustl.edu	37	19	17740081	17740081	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr19:17740081C>A	ENST00000519716.2	-	31	3720	c.3721G>T	c.(3721-3723)Gcc>Tcc	p.A1241S	UNC13A_ENST00000428389.2_Missense_Mutation_p.A1329S|UNC13A_ENST00000551649.1_Missense_Mutation_p.A1241S|UNC13A_ENST00000550896.1_Missense_Mutation_p.A1239S|UNC13A_ENST00000252773.7_Missense_Mutation_p.A1241S|UNC13A_ENST00000552293.1_Missense_Mutation_p.A1241S	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1241					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CAGTAGGAGGCAAAGTCCTTG	0.567																																						dbGAP											0													101.0	96.0	97.0					19																	17740081		2062	4207	6269	-	-	-	SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.3721G>T	19.37:g.17740081C>A	ENSP00000429562:p.Ala1241Ser		E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.A1329S	ENST00000519716.2	37	c.3985	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	c	8.570	0.879818	0.17467	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67;2.67	3.59	2.22	0.28083	.	0.292432	0.31323	U	0.007854	T	0.04952	0.0133	N	0.02802	-0.49	0.23336	N	0.997883	B	0.02656	0.0	B	0.06405	0.002	T	0.40608	-0.9554	10	0.22109	T	0.4	-19.989	9.1888	0.37187	0.0:0.8558:0.0:0.1442	.	1241	Q9UPW8	UN13A_HUMAN	S	1241;1329;1241;1241;1241;1239	ENSP00000429562:A1241S;ENSP00000400409:A1329S;ENSP00000252773:A1241S;ENSP00000447236:A1241S;ENSP00000447572:A1241S;ENSP00000446831:A1239S	ENSP00000252773:A1241S	A	-	1	0	UNC13A	17601081	0.993000	0.37304	0.997000	0.53966	0.812000	0.45895	1.025000	0.30090	1.547000	0.49401	0.290000	0.19541	GCC	UNC13A	-	NULL	ENSG00000130477		0.567	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	39	0.00	0	C	XM_038604		17740081	17740081	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	0.836	A
USP34	9736	genome.wustl.edu	37	2	61473500	61473500	+	Silent	SNP	G	G	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr2:61473500G>A	ENST00000398571.2	-	50	6583	c.6507C>T	c.(6505-6507)atC>atT	p.I2169I		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2169	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CTATATCTCTGATAAAGCTAT	0.323																																						dbGAP											0													66.0	60.0	62.0					2																	61473500		1818	4070	5888	-	-	-	SO:0001819	synonymous_variant	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6507C>T	2.37:g.61473500G>A			A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.I2169	ENST00000398571.2	37	c.6507	CCDS42686.1	2																																																																																			USP34	-	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	ENSG00000115464		0.323	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	66	0.00	0	G			61473500	61473500	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	silent	48	15.79	9	SNP	1.000	A
WDR59	79726	genome.wustl.edu	37	16	74943795	74943795	+	Silent	SNP	C	C	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr16:74943795C>A	ENST00000262144.6	-	15	1540	c.1410G>T	c.(1408-1410)ctG>ctT	p.L470L		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	470	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.									breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						TCACTTTCTGCAGGGCTGTGT	0.488																																						dbGAP											0													35.0	36.0	36.0					16																	74943795		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1410G>T	16.37:g.74943795C>A			B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	NULL	p.C20F	ENST00000262144.6	37	c.59	CCDS32488.1	16																																																																																			WDR59	-	NULL	ENSG00000103091		0.488	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR59	HGNC	protein_coding	OTTHUMT00000410601.3	25	0.00	0	C	NM_030581		74943795	74943795	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000569229	ensembl	human	novel	69_37n	missense	34	17.07	7	SNP	1.000	A
WNT2B	7482	genome.wustl.edu	37	1	113058811	113058811	+	Silent	SNP	C	C	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr1:113058811C>A	ENST00000369684.4	+	3	938	c.453C>A	c.(451-453)gtC>gtA	p.V151V	WNT2B_ENST00000256640.5_Silent_p.V59V|WNT2B_ENST00000478360.1_3'UTR|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000369686.5_Silent_p.V132V	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	151				V -> I (in Ref. 1; CAA96283). {ECO:0000305}.	canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGGGGTAGTCCACGCTATTA	0.552																																						dbGAP											0													124.0	116.0	119.0					1																	113058811		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.453C>A	1.37:g.113058811C>A			O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.V151	ENST00000369684.4	37	c.453	CCDS847.1	1																																																																																			WNT2B	-	pfam_Wnt,smart_Wnt,prints_Wnt	ENSG00000134245		0.552	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2B	HGNC	protein_coding	OTTHUMT00000030692.1	24	0.00	0	C	NM_004185		113058811	113058811	+1	no_errors	ENST00000369684	ensembl	human	known	69_37n	silent	16	57.89	22	SNP	0.892	A
XRRA1	143570	genome.wustl.edu	37	11	74617338	74617338	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr11:74617338C>G	ENST00000340360.6	-	10	1256	c.925G>C	c.(925-927)Gat>Cat	p.D309H	XRRA1_ENST00000321448.8_Missense_Mutation_p.D76H|XRRA1_ENST00000527087.1_Missense_Mutation_p.D309H|RP11-147I3.1_ENST00000533875.1_RNA	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						AGTTGCTCATCTGAGTCCTCA	0.502																																						dbGAP											0													124.0	122.0	123.0					11																	74617338		1955	4142	6097	-	-	-	SO:0001583	missense	0			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.925G>C	11.37:g.74617338C>G	ENSP00000339918:p.Asp309His			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.D309H	ENST00000340360.6	37	c.925	CCDS44680.1	11	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501269	0.64298	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418;ENST00000527087	T;T;T	0.51817	0.69;1.45;0.7	5.56	2.33	0.28932	.	0.671525	0.14183	N	0.335896	T	0.47911	0.1471	L	0.53249	1.67	0.19775	N	0.99996	P;B;P;P	0.46512	0.664;0.343;0.739;0.879	B;B;P;P	0.49752	0.253;0.373;0.526;0.621	T	0.32561	-0.9902	10	0.52906	T	0.07	-1.0607	5.7274	0.18020	0.0:0.6288:0.0:0.3711	.	309;76;309;309	Q6P2D8;E9PL06;Q6P2D8-2;Q6P2D8-4	XRRA1_HUMAN;.;.;.	H	309;76;309;309;309	ENSP00000339918:D309H;ENSP00000319303:D76H;ENSP00000435838:D309H	ENSP00000319303:D76H	D	-	1	0	XRRA1	74294986	0.060000	0.20803	0.094000	0.20943	0.227000	0.25037	0.791000	0.26915	0.727000	0.32360	-0.137000	0.14449	GAT	XRRA1	-	NULL	ENSG00000166435		0.502	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	57	0.00	0	C	NM_182969		74617338	74617338	-1	no_errors	ENST00000340360	ensembl	human	known	69_37n	missense	89	11.88	12	SNP	0.133	G
ZNF395	55893	genome.wustl.edu	37	8	28209226	28209228	+	In_Frame_Del	DEL	GCA	GCA	-	rs142343457|rs368917144	byFrequency	TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr8:28209226_28209228delGCA	ENST00000344423.5	-	7	1148_1150	c.1017_1019delTGC	c.(1015-1020)gctgcc>gcc	p.339_340AA>A	ZNF395_ENST00000523095.1_In_Frame_Del_p.339_340AA>A|ZNF395_ENST00000523202.1_In_Frame_Del_p.339_340AA>A	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GGTGCCTgcggcagcagcagcag	0.606																																						dbGAP											0										554,80,3604		203,0,148,2,76,1690						-6.6	0.0			63	1049,5,7094		390,0,269,0,5,3410	no	codingComplex	ZNF395	NM_018660.2		593,0,417,2,81,5100	A1A1,A1A2,A1R,A2A2,A2R,RR		12.9357,14.9599,13.6283				1603,85,10698				-	-	-	SO:0001651	inframe_deletion	0			AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1017_1019delTGC	8.37:g.28209235_28209237delGCA	ENSP00000340494:p.Ala341del		B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	In_Frame_Del	DEL	pfscan_Znf_C2H2	p.A341in_frame_del	ENST00000344423.5	37	c.1019_1017	CCDS6067.1	8																																																																																			ZNF395	-	NULL	ENSG00000186918		0.606	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF395	HGNC	protein_coding	OTTHUMT00000219976.1	32	0.00	0	GCA			28209226	28209228	-1	no_errors	ENST00000344423	ensembl	human	known	69_37n	in_frame_del	16	15.79	3	DEL	0.082:0.295:0.411	-
ZSCAN5C	649137	genome.wustl.edu	37	19	56717432	56717432	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A250-01A-31D-A167-09	TCGA-AR-A250-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f7d9a372-fcd1-4462-9e0b-7eb46ddb68fd	0035e0c2-0376-4050-a03e-df556d408b94	g.chr19:56717432C>A	ENST00000534327.1	+	2	299	c.150C>A	c.(148-150)ttC>ttA	p.F50L	ZSCAN5C_ENST00000376267.1_Missense_Mutation_p.F50L			A6NGD5	ZSA5C_HUMAN	zinc finger and SCAN domain containing 5C	50	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|lung(6)|stomach(1)	8						TCAGGATGTTCAGCTGCCCGA	0.567																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					19q13.43	2013-01-08			ENSG00000204532	ENSG00000204532		"""-"", ""Zinc fingers, C2H2-type"""	34294	protein-coding gene	gene with protein product							Standard	NG_012782		Approved	ZNF495C		A6NGD5	OTTHUMG00000167475	ENST00000534327.1:c.150C>A	19.37:g.56717432C>A	ENSP00000435234:p.Phe50Leu			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.F50L	ENST00000534327.1	37	c.150		19	.	.	.	.	.	.	.	.	.	.	C	13.36	2.212665	0.39102	.	.	ENSG00000204532	ENST00000534327;ENST00000376267	T;T	0.05199	3.48;3.48	1.48	-1.48	0.08745	.	.	.	.	.	T	0.07052	0.0179	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36866	-0.9730	6	0.56958	D	0.05	.	5.4928	0.16785	0.0:0.71:0.0:0.29	.	.	.	.	L	50	ENSP00000435234:F50L;ENSP00000365443:F50L	ENSP00000365443:F50L	F	+	3	2	ZSCAN5C	61409244	0.003000	0.15002	0.001000	0.08648	0.279000	0.26890	-0.077000	0.11394	-0.348000	0.08286	0.195000	0.17529	TTC	ZSCAN5C	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000204532		0.567	ZSCAN5C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ZSCAN5C	HGNC	protein_coding	OTTHUMT00000394739.1	46	0.00	0	C	XM_001131980		56717432	56717432	+1	no_errors	ENST00000376267	ensembl	human	known	69_37n	missense	60	20.00	15	SNP	0.006	A
