#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
APBA2	321	genome.wustl.edu	37	15	29347021	29347021	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr15:29347021A>G	ENST00000558402.1	+	5	1533	c.934A>G	c.(934-936)Aag>Gag	p.K312E	APBA2_ENST00000561069.1_Missense_Mutation_p.K312E|APBA2_ENST00000558330.1_Missense_Mutation_p.K312E|APBA2_ENST00000558259.1_Missense_Mutation_p.K312E|APBA2_ENST00000411764.1_Missense_Mutation_p.K312E			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	312					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		AGAGAGGCTGAAGTGGCCCCA	0.652																																						dbGAP											0													15.0	18.0	17.0					15																	29347021		2185	4258	6443	-	-	-	SO:0001583	missense	0			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.934A>G	15.37:g.29347021A>G	ENSP00000453293:p.Lys312Glu		E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.K312E	ENST00000558402.1	37	c.934	CCDS10022.1	15	.	.	.	.	.	.	.	.	.	.	A	3.588	-0.084133	0.07097	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.27402	1.67	5.24	4.1	0.47936	.	0.179793	0.46442	D	0.000281	T	0.25382	0.0617	M	0.61703	1.905	0.43047	D	0.994646	B;P;B	0.37688	0.393;0.605;0.393	B;B;B	0.32980	0.11;0.156;0.11	T	0.05683	-1.0870	10	0.07482	T	0.82	.	11.5427	0.50675	0.8499:0.1501:0.0:0.0	.	312;312;312	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	E	312	ENSP00000409312:K312E	ENSP00000219865:K312E	K	+	1	0	APBA2	27134313	1.000000	0.71417	0.996000	0.52242	0.049000	0.14656	3.906000	0.56340	0.798000	0.33994	-0.323000	0.08544	AAG	APBA2	-	NULL	ENSG00000034053		0.652	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3	77	0.00	0	A	NM_005503		29347021	29347021	+1	no_errors	ENST00000558259	ensembl	human	known	69_37n	missense	73	10.98	9	SNP	1.000	G
ARHGAP21	57584	genome.wustl.edu	37	10	24885700	24885700	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr10:24885700A>G	ENST00000396432.2	-	17	3932	c.3446T>C	c.(3445-3447)cTa>cCa	p.L1149P	ARHGAP21_ENST00000493154.1_5'Flank|ARHGAP21_ENST00000320481.6_Missense_Mutation_p.L936P	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1148	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GCAGTCATCTAGTCGGACGCC	0.453																																						dbGAP											0													120.0	111.0	114.0					10																	24885700		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3446T>C	10.37:g.24885700A>G	ENSP00000379709:p.Leu1149Pro		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.L1149P	ENST00000396432.2	37	c.3446	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	A	24.9	4.582924	0.86748	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410	T;T;T	0.77620	1.73;1.73;-1.11	5.62	5.62	0.85841	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	D	0.89230	0.6656	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.90906	0.4772	10	0.87932	D	0	.	16.1135	0.81278	1.0:0.0:0.0:0.0	.	1139;1148	F8W9U9;Q5T5U3	.;RHG21_HUMAN	P	1149;598;936;1139	ENSP00000379709:L1149P;ENSP00000365604:L936P;ENSP00000365592:L1139P	ENSP00000365604:L936P	L	-	2	0	ARHGAP21	24925706	1.000000	0.71417	0.998000	0.56505	0.833000	0.47200	9.188000	0.94921	2.267000	0.75376	0.383000	0.25322	CTA	ARHGAP21	-	superfamily_Rho_GTPase_activation_prot,pfscan_RhoGAP_dom	ENSG00000107863		0.453	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	74	0.00	0	A	NM_020824		24885700	24885700	-1	no_errors	ENST00000396432	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	1.000	G
BNC2	54796	genome.wustl.edu	37	9	16437297	16437297	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr9:16437297C>T	ENST00000380672.4	-	6	952	c.895G>A	c.(895-897)Gct>Act	p.A299T	BNC2_ENST00000380666.2_Missense_Mutation_p.A299T|BNC2_ENST00000380667.2_Missense_Mutation_p.A232T|BNC2_ENST00000545497.1_Missense_Mutation_p.A204T	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TCTAAGTGAGCAAGGAGGCTG	0.468																																						dbGAP											0													232.0	217.0	222.0					9																	16437297		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.895G>A	9.37:g.16437297C>T	ENSP00000370047:p.Ala299Thr			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A299T	ENST00000380672.4	37	c.895	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	C	4.293	0.053676	0.08291	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T	0.03663	3.85;3.85;3.85;3.85;3.85	6.07	6.07	0.98685	.	0.159261	0.56097	D	0.000028	T	0.02533	0.0077	N	0.11064	0.09	0.36780	D	0.884296	B;B;B;B;B;B;B;B;B;B	0.24533	0.01;0.001;0.105;0.004;0.007;0.004;0.001;0.001;0.004;0.001	B;B;B;B;B;B;B;B;B;B	0.20767	0.007;0.001;0.031;0.005;0.009;0.003;0.001;0.002;0.002;0.001	T	0.55554	-0.8123	10	0.13108	T	0.6	-13.2109	13.9747	0.64265	0.2645:0.7355:0.0:0.0	.	204;232;336;299;125;299;257;299;204;64	F5H586;B1APH0;Q06HC4;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;.;BNC2_HUMAN;.;.	T	299;256;336;327;232;204;125;299;299	ENSP00000370047:A299T;ENSP00000408370:A256T;ENSP00000370042:A232T;ENSP00000444640:A204T;ENSP00000370041:A299T	ENSP00000370041:A299T	A	-	1	0	BNC2	16427297	0.945000	0.32115	1.000000	0.80357	0.999000	0.98932	1.301000	0.33447	2.885000	0.99019	0.655000	0.94253	GCT	BNC2	-	NULL	ENSG00000173068		0.468	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	74	0.00	0	C	NM_017637		16437297	16437297	-1	no_errors	ENST00000380672	ensembl	human	known	69_37n	missense	58	14.71	10	SNP	0.970	T
CCDC23	374969	genome.wustl.edu	37	1	43282143	43282144	+	Frame_Shift_Del	DEL	TC	TC	-	rs563737990		TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:43282143_43282144delTC	ENST00000372521.4	-	2	170_171	c.72_73delGA	c.(70-75)cagaaafs	p.K25fs	CCDC23_ENST00000372522.1_Frame_Shift_Del_p.K25fs|CCDC23_ENST00000537227.1_Frame_Shift_Del_p.K25fs|CCDC23_ENST00000497437.1_5'UTR|ERMAP_ENST00000372517.2_5'Flank	NM_199342.3	NP_955374.1	Q8N300	CCD23_HUMAN	coiled-coil domain containing 23	25					negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein ubiquitination (GO:0031397)|protein secretion (GO:0009306)	apical part of cell (GO:0045177)				large_intestine(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGGGCTGATTTCTGTTTGGCCT	0.47																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL512353, CAH72714	CCDS474.1	1p34.2	2008-02-05			ENSG00000177868	ENSG00000177868			29204	protein-coding gene	gene with protein product							Standard	NM_199342		Approved	MGC45441	uc001cib.2	Q8N300	OTTHUMG00000007566	ENST00000372521.4:c.72_73delGA	1.37:g.43282143_43282144delTC	ENSP00000361599:p.Lys25fs		A8K5P1|D3DPW7	Frame_Shift_Del	DEL	NULL	p.K25fs	ENST00000372521.4	37	c.73_72	CCDS474.1	1																																																																																			CCDC23	-	NULL	ENSG00000177868		0.470	CCDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC23	HGNC	protein_coding	OTTHUMT00000019997.1	48	0.00	0	TC	NM_199342		43282143	43282144	-1	no_errors	ENST00000372521	ensembl	human	known	69_37n	frame_shift_del	38	13.64	6	DEL	1.000:1.000	-
CHRFAM7A	89832	genome.wustl.edu	37	15	30665226	30665226	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr15:30665226C>T	ENST00000299847.2	-	6	736	c.283G>A	c.(283-285)Gca>Aca	p.A95T	CHRFAM7A_ENST00000401522.3_Missense_Mutation_p.A4T|CHRFAM7A_ENST00000397827.3_Missense_Mutation_p.A4T|CHRFAM7A_ENST00000567722.1_5'Flank	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	95						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		CTGATATCTGCCTCCTGCATC	0.512																																						dbGAP											0													71.0	69.0	69.0					15																	30665226		2177	4270	6447	-	-	-	SO:0001583	missense	0			AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.283G>A	15.37:g.30665226C>T	ENSP00000299847:p.Ala95Thr		A8KAB9	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	p.A95T	ENST00000299847.2	37	c.283	CCDS32184.1	15	.	.	.	.	.	.	.	.	.	.	.	17.31	3.358506	0.61403	.	.	ENSG00000166664	ENST00000299847;ENST00000397827;ENST00000401522	T;T;T	0.79247	-1.25;-1.25;-1.25	2.07	2.07	0.26955	Neurotransmitter-gated ion-channel ligand-binding (3);	0.051096	0.85682	D	0.000000	T	0.74450	0.3718	M	0.68728	2.09	0.45594	D	0.998538	B	0.30709	0.291	B	0.38803	0.282	T	0.73861	-0.3849	10	0.54805	T	0.06	.	5.9797	0.19401	0.3079:0.692:0.0:0.0	.	95	Q494W8	CRFM7_HUMAN	T	95;4;4	ENSP00000299847:A95T;ENSP00000380927:A4T;ENSP00000385389:A4T	ENSP00000299847:A95T	A	-	1	0	CHRFAM7A	28452518	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.242000	0.65389	1.475000	0.48197	0.398000	0.26397	GCA	CHRFAM7A	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000166664		0.512	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRFAM7A	HGNC	protein_coding	OTTHUMT00000430700.1	55	0.00	0	C	NM_148911		30665226	30665226	-1	no_errors	ENST00000299847	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	T
CNGA2	1260	genome.wustl.edu	37	X	150911871	150911871	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chrX:150911871C>G	ENST00000329903.4	+	6	929	c.896C>G	c.(895-897)tCc>tGc	p.S299C		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	299					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					ATCTCCAAATCCATAGGCTTT	0.488																																						dbGAP											0													175.0	156.0	163.0					X																	150911871		2203	4300	6503	-	-	-	SO:0001583	missense	0			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.896C>G	X.37:g.150911871C>G	ENSP00000328478:p.Ser299Cys		A0AVD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.S299C	ENST00000329903.4	37	c.896	CCDS14701.1	X	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669650	0.47677	.	.	ENSG00000183862	ENST00000329903	D	0.97186	-4.28	4.96	4.96	0.65561	Ion transport (1);	0.055955	0.64402	D	0.000001	D	0.97845	0.9292	M	0.77820	2.39	0.40857	D	0.983802	D	0.56287	0.975	P	0.60173	0.87	D	0.98095	1.0411	10	0.40728	T	0.16	.	14.8649	0.70406	0.0:1.0:0.0:0.0	.	299	Q16280	CNGA2_HUMAN	C	299	ENSP00000328478:S299C	ENSP00000328478:S299C	S	+	2	0	CNGA2	150662527	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.687000	0.68219	2.183000	0.69458	0.529000	0.55759	TCC	CNGA2	-	pfam_Ion_trans_dom	ENSG00000183862		0.488	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA2	HGNC	protein_coding	OTTHUMT00000060888.1	61	0.00	0	C	NM_005140		150911871	150911871	+1	no_errors	ENST00000329903	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	G
COL6A4P1	344875	genome.wustl.edu	37	3	15215441	15215441	+	RNA	SNP	G	G	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr3:15215441G>T	ENST00000446690.2	-	0	1441					NR_027927.1				collagen, type VI, alpha 4 pseudogene 1																		TTTGGTACTTGTCCCTGCCAA	0.483																																						dbGAP											0																																										-	-	-			0			AB299979		3p25.1	2013-01-16	2010-05-24	2010-05-24	ENSG00000230524	ENSG00000230524		"""Collagens"""	33484	pseudogene	pseudogene	"""von Willebrand factor A domain containing 6"", ""collagen, type VI, alpha 4"", ""collagen, type VI, alpha 4, pseudogene"""	612397	"""dual von Willebrand factor A domains"""	DVWA		19507504, 19486942	Standard	NR_027927		Approved	VWA6, DIVA, COL6A4, COL6A4P	uc011avo.1		OTTHUMG00000154983		3.37:g.15215441G>T				RNA	SNP	-	NULL	ENST00000446690.2	37	NULL		3																																																																																			COL6A4P1	-	-	ENSG00000230524		0.483	COL6A4P1-002	KNOWN	basic	processed_transcript	COL6A4P1	HGNC	pseudogene	OTTHUMT00000337912.1	53	0.00	0	G	NR_027927		15215441	15215441	-1	no_errors	ENST00000491915	ensembl	human	known	69_37n	rna	32	20.00	8	SNP	0.960	T
CPT1A	1374	genome.wustl.edu	37	11	68552320	68552320	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr11:68552320C>A	ENST00000265641.5	-	10	1280	c.1126G>T	c.(1126-1128)Ggg>Tgg	p.G376W	CPT1A_ENST00000540367.1_Missense_Mutation_p.G376W|CPT1A_ENST00000539743.1_Missense_Mutation_p.G376W|CPT1A_ENST00000376618.2_Missense_Mutation_p.G376W	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	376					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	CTGGCCTCCCCGGGCTGAGGC	0.647																																						dbGAP											0													57.0	53.0	54.0					11																	68552320		2200	4294	6494	-	-	-	SO:0001583	missense	0			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1126G>T	11.37:g.68552320C>A	ENSP00000265641:p.Gly376Trp		Q8TCU0|Q9BWK0	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.G376W	ENST00000265641.5	37	c.1126	CCDS8185.1	11	.	.	.	.	.	.	.	.	.	.	C	22.7	4.317900	0.81469	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54	5.06	5.06	0.68205	.	0.053966	0.85682	D	0.000000	D	0.96062	0.8717	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96914	0.9669	10	0.62326	D	0.03	.	18.4282	0.90615	0.0:1.0:0.0:0.0	.	376;376	P50416;P50416-2	CPT1A_HUMAN;.	W	376	ENSP00000439084:G376W;ENSP00000365803:G376W;ENSP00000265641:G376W;ENSP00000446108:G376W	ENSP00000265641:G376W	G	-	1	0	CPT1A	68308896	1.000000	0.71417	0.464000	0.27143	0.692000	0.40212	7.543000	0.82106	2.364000	0.80123	0.563000	0.77884	GGG	CPT1A	-	pfam_Carn_acyl_trans	ENSG00000110090		0.647	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1A	HGNC	protein_coding	OTTHUMT00000397457.2	39	0.00	0	C	NM_001876		68552320	68552320	-1	no_errors	ENST00000265641	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	A
WASH3P	374666	genome.wustl.edu	37	15	102516835	102516835	+	RNA	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr15:102516835C>T	ENST00000557932.1	+	0	1679				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TCAGTGACTGCCTCCTGCCCC	0.547																																						dbGAP											0																																										-	-	-			0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516835C>T				RNA	SNP	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			DDX11L9	-	-	ENSG00000248472		0.547	WASH3P-001	KNOWN	basic	processed_transcript	DDX11L9	HGNC	pseudogene	OTTHUMT00000417608.1	19	0.00	0	C	NM_199163		102516835	102516835	-1	no_errors	ENST00000559159	ensembl	human	known	69_37n	rna	5	37.50	3	SNP	0.030	T
EFCAB5	374786	genome.wustl.edu	37	17	28405362	28405363	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr17:28405362_28405363delGT	ENST00000394835.3	+	15	3059_3060	c.2867_2868delGT	c.(2866-2868)agtfs	p.S956fs	EFCAB5_ENST00000320856.5_Frame_Shift_Del_p.S832fs|EFCAB5_ENST00000394832.2_Intron	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	956							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GTTCTGGAAAGTGTTGTGGAAT	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.2867_2868delGT	17.37:g.28405364_28405365delGT	ENSP00000378312:p.Ser956fs		B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Frame_Shift_Del	DEL	pfscan_EF_HAND_2	p.V957fs	ENST00000394835.3	37	c.2867_2868	CCDS11254.2	17																																																																																			EFCAB5	-	NULL	ENSG00000176927		0.446	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB5	HGNC	protein_coding	OTTHUMT00000256120.4	51	0.00	0	GT	NM_198529		28405362	28405363	+1	no_errors	ENST00000394835	ensembl	human	known	69_37n	frame_shift_del	32	17.95	7	DEL	0.238:0.000	-
EHMT1	79813	genome.wustl.edu	37	9	140728964	140728964	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr9:140728964G>C	ENST00000460843.1	+	26	3731	c.3704G>C	c.(3703-3705)gGc>gCc	p.G1235A		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1235	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ATCGAGGCCGGCGAGCAGCTC	0.692																																						dbGAP											0													37.0	37.0	37.0					9																	140728964		2201	4297	6498	-	-	-	SO:0001583	missense	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3704G>C	9.37:g.140728964G>C	ENSP00000417980:p.Gly1235Ala		B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.G1235A	ENST00000460843.1	37	c.3704	CCDS7050.2	9	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515683	0.64634	.	.	ENSG00000181090	ENST00000460843	D	0.90197	-2.63	5.24	5.24	0.73138	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.96803	0.8956	H	0.96111	3.77	0.80722	D	1	D	0.61697	0.99	D	0.63283	0.913	D	0.97889	1.0296	10	0.87932	D	0	.	19.1699	0.93574	0.0:0.0:1.0:0.0	.	1235	Q9H9B1	EHMT1_HUMAN	A	1235	ENSP00000417980:G1235A	ENSP00000417980:G1235A	G	+	2	0	EHMT1	139848785	1.000000	0.71417	0.615000	0.29064	0.044000	0.14063	9.257000	0.95545	2.612000	0.88384	0.561000	0.74099	GGC	EHMT1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000181090		0.692	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	71	0.00	0	G	NM_024757		140728964	140728964	+1	no_errors	ENST00000460843	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	1.000	C
EML5	161436	genome.wustl.edu	37	14	89163200	89163200	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr14:89163200C>T	ENST00000380664.5	-	15	2334	c.2335G>A	c.(2335-2337)Gat>Aat	p.D779N	EML5_ENST00000352093.5_Missense_Mutation_p.D779N|EML5_ENST00000554922.1_Missense_Mutation_p.D779N			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	779						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCTGAGAAATCAACGGCACTA	0.398																																						dbGAP											0													69.0	71.0	71.0					14																	89163200		1901	4120	6021	-	-	-	SO:0001583	missense	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.2335G>A	14.37:g.89163200C>T	ENSP00000370039:p.Asp779Asn		B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D779N	ENST00000380664.5	37	c.2335	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675835	0.88445	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.61392	0.11;0.11;0.11	5.28	5.28	0.74379	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	L	0.28014	0.82	0.58432	D	0.999997	D	0.60575	0.988	D	0.66979	0.948	T	0.59359	-0.7469	10	0.27785	T	0.31	-20.8431	18.7037	0.91630	0.0:1.0:0.0:0.0	.	779	Q05BV3	EMAL5_HUMAN	N	779	ENSP00000451998:D779N;ENSP00000298315:D779N;ENSP00000370039:D779N	ENSP00000298315:D779N	D	-	1	0	EML5	88232953	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.231000	0.78106	2.756000	0.94617	0.655000	0.94253	GAT	EML5	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000165521		0.398	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	55	0.00	0	C			89163200	89163200	-1	no_errors	ENST00000554922	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	T
FAM72B	653820	genome.wustl.edu	37	1	120854498	120854498	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:120854498A>G	ENST00000369390.3	+	4	1191	c.362A>G	c.(361-363)aAc>aGc	p.N121S	FAM72B_ENST00000355228.4_Missense_Mutation_p.N81S|FAM72B_ENST00000471903.2_3'UTR	NM_001100910.1	NP_001094380.1	Q86X60	FA72B_HUMAN	family with sequence similarity 72, member B	121										large_intestine(1)|lung(2)	3	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		TCAGGTGTAAACATCCTACTT	0.299																																						dbGAP											0													90.0	85.0	86.0					1																	120854498		1789	4054	5843	-	-	-	SO:0001583	missense	0			AL357493	CCDS72848.1	1p12	2014-05-06			ENSG00000188610	ENSG00000188610			24805	protein-coding gene	gene with protein product		614711					Standard	NM_001100910		Approved	RP11-439A17.6	uc009whp.3	Q86X60	OTTHUMG00000185025	ENST00000369390.3:c.362A>G	1.37:g.120854498A>G	ENSP00000358397:p.Asn121Ser		B2RPQ5|Q5QP15	Missense_Mutation	SNP	NULL	p.N121S	ENST00000369390.3	37	c.362	CCDS41374.1	1	.	.	.	.	.	.	.	.	.	.	A	13.20	2.165112	0.38217	.	.	ENSG00000188610	ENST00000369392;ENST00000369390;ENST00000452190;ENST00000355228	T;T;T	0.33865	1.39;1.39;1.39	2.63	2.63	0.31362	.	0.130517	0.49916	U	0.000136	T	0.25680	0.0625	M	0.68317	2.08	0.44432	D	0.997356	P;D	0.55605	0.939;0.972	P;P	0.47673	0.554;0.513	T	0.05632	-1.0873	10	0.51188	T	0.08	.	7.0582	0.25111	1.0:0.0:0.0:0.0	.	121;81	Q86X60;Q86X60-2	FA72B_HUMAN;.	S	92;121;92;81	ENSP00000358397:N121S;ENSP00000392882:N92S;ENSP00000347368:N81S	ENSP00000347368:N81S	N	+	2	0	FAM72B	120656021	1.000000	0.71417	0.639000	0.29394	0.949000	0.60115	7.864000	0.87037	1.219000	0.43474	0.327000	0.21459	AAC	FAM72B	-	NULL	ENSG00000188610		0.299	FAM72B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM72B	HGNC	protein_coding	OTTHUMT00000098437.1	264	0.00	0	A			120854498	120854498	+1	no_errors	ENST00000369390	ensembl	human	known	69_37n	missense	127	14.19	21	SNP	1.000	G
FCGBP	8857	genome.wustl.edu	37	19	40357467	40357467	+	Missense_Mutation	SNP	C	C	G	rs186617149		TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr19:40357467C>G	ENST00000221347.6	-	34	15853	c.15846G>C	c.(15844-15846)caG>caC	p.Q5282H		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5282	VWFD 13. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CATGGCAGATCTGGACTTCGG	0.562																																						dbGAP											0													113.0	105.0	108.0					19																	40357467		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15846G>C	19.37:g.40357467C>G	ENSP00000221347:p.Gln5282His		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.Q5282H	ENST00000221347.6	37	c.15846	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	14.16	2.453835	0.43531	.	.	ENSG00000090920	ENST00000221347	T	0.59772	0.24	4.33	-0.489	0.12052	von Willebrand factor, type D domain (3);	0.877964	0.09262	N	0.826355	T	0.47563	0.1452	M	0.62723	1.935	0.09310	N	1	P	0.36086	0.536	B	0.36464	0.225	T	0.36480	-0.9746	10	0.28530	T	0.3	.	2.6263	0.04930	0.3237:0.4226:0.1579:0.0958	.	5282	Q9Y6R7	FCGBP_HUMAN	H	5282	ENSP00000221347:Q5282H	ENSP00000221347:Q5282H	Q	-	3	2	FCGBP	45049307	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-1.420000	0.02457	0.104000	0.17725	0.563000	0.77884	CAG	FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.562	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	48	0.00	0	C	NM_003890		40357467	40357467	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.000	G
GABRD	2563	genome.wustl.edu	37	1	1956838	1956838	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:1956838A>G	ENST00000378585.4	+	3	330	c.247A>G	c.(247-249)Atg>Gtg	p.M83V		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	83					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGAGGCCAACATGGTAGGTGC	0.657																																						dbGAP											0													56.0	59.0	58.0					1																	1956838		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.247A>G	1.37:g.1956838A>G	ENSP00000367848:p.Met83Val		Q8N4N9	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAd_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.M83V	ENST00000378585.4	37	c.247	CCDS36.1	1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.737779	0.49045	.	.	ENSG00000187730	ENST00000378585	T	0.79033	-1.23	4.1	4.1	0.47936	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.89639	0.6773	M	0.93150	3.385	0.46061	D	0.998846	P	0.50156	0.932	D	0.67103	0.949	D	0.91473	0.5198	10	0.87932	D	0	-18.9161	11.271	0.49138	1.0:0.0:0.0:0.0	.	83	O14764	GBRD_HUMAN	V	83	ENSP00000367848:M83V	ENSP00000367848:M83V	M	+	1	0	GABRD	1946698	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	6.607000	0.74163	1.859000	0.53934	0.459000	0.35465	ATG	GABRD	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000187730		0.657	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	GABRD	HGNC	protein_coding	OTTHUMT00000098493.1	38	0.00	0	A	NM_000815		1956838	1956838	+1	no_errors	ENST00000378585	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	1.000	G
GALNT2	2590	genome.wustl.edu	37	1	230415130	230415130	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:230415130G>A	ENST00000366672.4	+	16	1714	c.1642G>A	c.(1642-1644)Ggg>Agg	p.G548R	GALNT2_ENST00000485438.1_3'UTR|RP5-956O18.3_ENST00000414640.1_RNA|GALNT2_ENST00000543760.1_Missense_Mutation_p.G510R	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	548	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GGCCAAGAGCGGGGGCCTAAG	0.632																																						dbGAP											0													68.0	61.0	64.0					1																	230415130		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.1642G>A	1.37:g.230415130G>A	ENSP00000355632:p.Gly548Arg		A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.G548R	ENST00000366672.4	37	c.1642	CCDS1582.1	1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658522	0.47467	.	.	ENSG00000143641	ENST00000543760;ENST00000366672	T;T	0.36878	1.23;1.23	5.45	5.45	0.79879	Ricin B-related lectin (1);Ricin B lectin (3);	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	N	0.13043	0.29	0.80722	D	1	B;B	0.29571	0.249;0.085	B;B	0.14023	0.01;0.006	T	0.04090	-1.0978	10	0.25106	T	0.35	.	19.2694	0.94003	0.0:0.0:1.0:0.0	.	548;510	Q10471;G3V1S6	GALT2_HUMAN;.	R	510;548	ENSP00000445017:G510R;ENSP00000355632:G548R	ENSP00000355632:G548R	G	+	1	0	GALNT2	228481753	1.000000	0.71417	0.328000	0.25416	0.549000	0.35272	9.809000	0.99208	2.576000	0.86940	0.491000	0.48974	GGG	GALNT2	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000143641		0.632	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT2	HGNC	protein_coding	OTTHUMT00000092158.1	55	0.00	0	G	NM_004481		230415130	230415130	+1	no_errors	ENST00000366672	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	1.000	A
GFPT2	9945	genome.wustl.edu	37	5	179731905	179731905	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr5:179731905C>T	ENST00000253778.8	-	17	1878	c.1709G>A	c.(1708-1710)gGc>gAc	p.G570D		NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	570	SIS 2. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	AGCCAGGATGCCTTCTGAGTG	0.532																																						dbGAP											0													124.0	129.0	127.0					5																	179731905		2011	4188	6199	-	-	-	SO:0001583	missense	0			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.1709G>A	5.37:g.179731905C>T	ENSP00000253778:p.Gly570Asp		Q53XM2|Q9BWS4	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.G570D	ENST00000253778.8	37	c.1709	CCDS43411.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.201248	0.94997	.	.	ENSG00000131459	ENST00000253778	T	0.64991	-0.13	5.65	5.65	0.86999	Sugar isomerase (SIS) (2);	0.000000	0.85682	D	0.000000	D	0.88280	0.6394	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92451	0.5970	9	.	.	.	-31.1592	19.7261	0.96164	0.0:1.0:0.0:0.0	.	570	O94808	GFPT2_HUMAN	D	570	ENSP00000253778:G570D	.	G	-	2	0	GFPT2	179664511	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.711000	0.84669	2.667000	0.90743	0.561000	0.74099	GGC	GFPT2	-	pfam_SIS,tigrfam_GlmS_trans	ENSG00000131459		0.532	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFPT2	HGNC	protein_coding	OTTHUMT00000373444.4	27	0.00	0	C	NM_005110		179731905	179731905	-1	no_errors	ENST00000253778	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	T
GLUL	2752	genome.wustl.edu	37	1	182356328	182356328	+	Missense_Mutation	SNP	A	A	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:182356328A>G	ENST00000331872.6	-	3	806	c.266T>C	c.(265-267)tTc>tCc	p.F89S	GLUL_ENST00000311223.5_Missense_Mutation_p.F89S|GLUL_ENST00000417584.2_Missense_Mutation_p.F89S|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000339526.4_Missense_Mutation_p.F89S	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	89					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	GTCCTTACGGAAGGGGTCCCG	0.488																																						dbGAP											0													114.0	105.0	108.0					1																	182356328		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.266T>C	1.37:g.182356328A>G	ENSP00000356537:p.Phe89Ser		Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.F89S	ENST00000331872.6	37	c.266	CCDS1344.1	1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.911531	0.92178	.	.	ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526;ENST00000435013	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	4.96	4.96	0.65561	Glutamine synthetase, beta-Grasp (3);	0.045801	0.85682	N	0.000000	T	0.73321	0.3572	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79804	-0.1649	10	0.87932	D	0	-15.3164	13.4271	0.61032	1.0:0.0:0.0:0.0	.	89	P15104	GLNA_HUMAN	S	89	ENSP00000356537:F89S;ENSP00000307900:F89S;ENSP00000398320:F89S;ENSP00000344958:F89S	ENSP00000307900:F89S	F	-	2	0	GLUL	180622951	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.881000	0.92415	1.842000	0.53543	0.460000	0.39030	TTC	GLUL	-	pfam_Gln_synt_beta,superfamily_Gln_synt_beta	ENSG00000135821		0.488	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	HGNC	protein_coding	OTTHUMT00000091043.1	40	0.00	0	A	NM_002065		182356328	182356328	-1	no_errors	ENST00000311223	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	1.000	G
GRHL2	79977	genome.wustl.edu	37	8	102611287	102611287	+	Missense_Mutation	SNP	G	G	T	rs145433541		TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr8:102611287G>T	ENST00000251808.3	+	8	1344	c.1006G>T	c.(1006-1008)Gat>Tat	p.D336Y	GRHL2_ENST00000395927.1_Missense_Mutation_p.D320Y	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	336					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			TGTTACAGCCGATTACAAGGA	0.373																																						dbGAP											0													95.0	88.0	91.0					8																	102611287		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.1006G>T	8.37:g.102611287G>T	ENSP00000251808:p.Asp336Tyr		A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	pfam_CP2	p.D336Y	ENST00000251808.3	37	c.1006	CCDS34931.1	8	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903082	0.92035	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.31510	1.49;1.49	5.73	5.73	0.89815	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.64182	0.2575	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67070	-0.5763	10	0.59425	D	0.04	-29.0591	20.2602	0.98440	0.0:0.0:1.0:0.0	.	336	Q6ISB3	GRHL2_HUMAN	Y	336;320;336	ENSP00000251808:D336Y;ENSP00000379260:D320Y	ENSP00000251808:D336Y	D	+	1	0	GRHL2	102680463	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.725000	0.98778	2.861000	0.98227	0.655000	0.94253	GAT	GRHL2	-	pfam_CP2	ENSG00000083307		0.373	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL2	HGNC	protein_coding	OTTHUMT00000313882.1	79	0.00	0	G	NM_024915		102611287	102611287	+1	no_errors	ENST00000251808	ensembl	human	known	69_37n	missense	62	12.68	9	SNP	1.000	T
SMARCA5	8467	genome.wustl.edu	37	4	144481165	144481165	+	IGR	SNP	T	T	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr4:144481165T>G	ENST00000283131.3	+	0	7923				GUSBP5_ENST00000510805.1_RNA	NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5						ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					GGCAACATGCTCATCTCCTCC	0.622																																						dbGAP											0													78.0	74.0	75.0					4																	144481165		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474		4.37:g.144481165T>G				RNA	SNP	-	NULL	ENST00000283131.3	37	NULL	CCDS3761.1	4																																																																																			GUSBP5	-	-	ENSG00000236296		0.622	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUSBP5	HGNC	protein_coding	OTTHUMT00000365077.3	36	0.00	0	T			144481165	144481165	+1	no_errors	ENST00000509369	ensembl	human	known	69_37n	rna	50	13.79	8	SNP	0.999	G
HPS3	84343	genome.wustl.edu	37	3	148877950	148877950	+	Missense_Mutation	SNP	A	A	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr3:148877950A>T	ENST00000296051.2	+	11	2130	c.1990A>T	c.(1990-1992)Agg>Tgg	p.R664W	HPS3_ENST00000460120.1_Missense_Mutation_p.R499W	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	664					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GAGCTATCTAAGGAAGCTGGA	0.418									Hermansky-Pudlak syndrome																													dbGAP											0													134.0	136.0	135.0					3																	148877950		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1990A>T	3.37:g.148877950A>T	ENSP00000296051:p.Arg664Trp		A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	pirsf_BLOC-2_complex_Hps3_subunit	p.R664W	ENST00000296051.2	37	c.1990	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	A	16.36	3.101080	0.56183	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.67345	-0.26;-0.25	5.41	5.41	0.78517	.	0.533031	0.22466	N	0.059692	T	0.68760	0.3036	L	0.44542	1.39	0.09310	N	1	D;D	0.56287	0.975;0.975	P;P	0.58130	0.833;0.694	T	0.63673	-0.6584	10	0.87932	D	0	-2.8913	6.7603	0.23536	0.6444:0.2761:0.0795:0.0	.	499;664	G5E9V4;Q969F9	.;HPS3_HUMAN	W	664;499	ENSP00000296051:R664W;ENSP00000418230:R499W	ENSP00000296051:R664W	R	+	1	2	HPS3	150360640	0.030000	0.19436	0.111000	0.21465	0.801000	0.45260	1.697000	0.37784	2.182000	0.69389	0.460000	0.39030	AGG	HPS3	-	pirsf_BLOC-2_complex_Hps3_subunit	ENSG00000163755		0.418	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	75	0.00	0	A	NM_032383		148877950	148877950	+1	no_errors	ENST00000296051	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.003	T
HRAS	3265	genome.wustl.edu	37	11	534286	534286	+	Missense_Mutation	SNP	C	C	G	rs104894228		TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr11:534286C>G	ENST00000451590.1	-	2	224	c.37G>C	c.(37-39)Ggt>Cgt	p.G13R	HRAS_ENST00000311189.7_Missense_Mutation_p.G13R|HRAS_ENST00000397596.2_Missense_Mutation_p.G13R|HRAS_ENST00000417302.1_Missense_Mutation_p.G13R|HRAS_ENST00000468682.2_5'UTR|HRAS_ENST00000397594.1_Missense_Mutation_p.G13R	NM_001130442.1|NM_005343.2	NP_001123914.1|NP_005334.1	P01112	RASH_HUMAN	Harvey rat sarcoma viral oncogene homolog	13			G -> C (in CSTLO). {ECO:0000269|PubMed:16329078}.|G -> D (in CSTLO). {ECO:0000269|PubMed:16170316}.|G -> R (in SFM; somatic mutation; shows constitutive activation of the MAPK and PI3K-AKT signaling pathways). {ECO:0000269|PubMed:22683711}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway (GO:0097193)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Rho GTPase activity (GO:0034259)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of wound healing (GO:0090303)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein C-terminus binding (GO:0008022)	p.G13R(70)|p.G13S(9)|p.G13C(8)|p.G12_G13insAG(1)		adrenal_gland(1)|bone(3)|breast(7)|cervix(23)|endometrium(4)|haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|oesophagus(2)|penis(2)|pituitary(10)|prostate(31)|salivary_gland(24)|skin(184)|soft_tissue(38)|stomach(14)|testis(5)|thymus(1)|thyroid(173)|upper_aerodigestive_tract(122)|urinary_tract(225)	901		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTGCCCACACCGCCGGCGCCC	0.642		6	Mis		"""infrequent sarcomas, rare other types"""	"""rhadomyosarcoma, ganglioneuroblastoma, bladder"""			Costello syndrome	HNSCC(11;0.0054)																												dbGAP	yes	Dom	yes	Costello syndrome	11	11p15.5	3265	v-Ha-ras Harvey rat sarcoma viral oncogene homolog		"""E, L, M"""	88	Substitution - Missense(87)|Insertion - In frame(1)	skin(26)|thyroid(17)|urinary_tract(13)|upper_aerodigestive_tract(11)|soft_tissue(8)|lung(5)|salivary_gland(3)|prostate(3)|adrenal_gland(1)|bone(1)	GRCh37	CM060018	HRAS	M	rs104894228						85.0	80.0	82.0					11																	534286		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Facio-Cutaneous-Skeletal syndrome	AJ437024	CCDS7698.1, CCDS7699.1	11p15.5	2014-09-17	2013-07-08		ENSG00000174775	ENSG00000174775			5173	protein-coding gene	gene with protein product		190020	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog"""	HRAS1			Standard	NM_176795		Approved		uc010qvx.2	P01112	OTTHUMG00000131919	ENST00000451590.1:c.37G>C	11.37:g.534286C>G	ENSP00000407586:p.Gly13Arg		B5BUA0|Q14080|Q6FHV9|Q9BR65|Q9UCE2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G13R	ENST00000451590.1	37	c.37	CCDS7698.1	11	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589995	0.66105	.	.	ENSG00000174775	ENST00000397594;ENST00000397596;ENST00000451590;ENST00000417302;ENST00000311189	T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76	3.0	3.0	0.34707	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84257	0.5432	M	0.74647	2.275	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.73708	0.967;0.981	D	0.86952	0.2086	10	0.87932	D	0	.	14.1517	0.65389	0.0:1.0:0.0:0.0	.	13;13	P01112-2;P01112	.;RASH_HUMAN	R	13	ENSP00000380722:G13R;ENSP00000380723:G13R;ENSP00000407586:G13R;ENSP00000388246:G13R;ENSP00000309845:G13R	ENSP00000309845:G13R	G	-	1	0	HRAS	524286	1.000000	0.71417	0.446000	0.26920	0.236000	0.25371	7.472000	0.80996	1.986000	0.57962	0.561000	0.74099	GGT	HRAS	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000174775		0.642	HRAS-202	KNOWN	basic|appris_principal|CCDS	protein_coding	HRAS	HGNC	protein_coding	OTTHUMT00000259403.2	59	0.00	0	C	NM_176795		534286	534286	-1	no_errors	ENST00000311189	ensembl	human	known	69_37n	missense	45	40.00	30	SNP	1.000	G
HSPB11	51668	genome.wustl.edu	37	1	54387380	54387380	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:54387380C>A	ENST00000194214.5	-	6	768	c.379G>T	c.(379-381)Gca>Tca	p.A127S	HSPB11_ENST00000489675.1_5'UTR|HSPB11_ENST00000371378.2_Intron	NM_016126.2	NP_057210.2	Q9Y547	IFT25_HUMAN	heat shock protein family B (small), member 11	127					cell adhesion (GO:0007155)|heart development (GO:0007507)|left/right axis specification (GO:0070986)|lung development (GO:0030324)|protein transport (GO:0015031)|response to stress (GO:0006950)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle B (GO:0030992)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	9						TGCACAGATGCAAAATGATCA	0.338																																						dbGAP											0													119.0	111.0	113.0					1																	54387380		1879	4121	6000	-	-	-	SO:0001583	missense	0			AF100747	CCDS41341.1	1p32	2014-02-21	2008-06-24	2008-06-24	ENSG00000081870	ENSG00000081870		"""Intraflagellar transport homologs"", ""Heat shock proteins / HSPB"""	25019	protein-coding gene	gene with protein product	"""intraflagellar transport 25 homolog (Chlamydomonas)"""		"""chromosome 1 open reading frame 41"""	C1orf41		11042152, 19253336	Standard	NM_016126		Approved	HSPCO34, PP25, IFT25	uc001cwh.3	Q9Y547	OTTHUMG00000008408	ENST00000194214.5:c.379G>T	1.37:g.54387380C>A	ENSP00000194214:p.Ala127Ser		A6NG57|D3DQ45|Q9Y684	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like	p.A127S	ENST00000194214.5	37	c.379	CCDS41341.1	1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713424	0.68730	.	.	ENSG00000081870	ENST00000194214;ENST00000371378	D;D	0.98400	-4.91;-4.91	5.46	4.56	0.56223	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.256280	0.36740	N	0.002440	D	0.97745	0.9260	M	0.66939	2.045	0.80722	D	1	B	0.28760	0.221	B	0.43623	0.425	D	0.97285	0.9920	10	0.66056	D	0.02	-9.5449	10.1674	0.42888	0.0:0.908:0.0:0.092	.	127	Q9Y547	HSB11_HUMAN	S	127	ENSP00000194214:A127S;ENSP00000360429:A127S	ENSP00000194214:A127S	A	-	1	0	HSPB11	54159968	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	2.848000	0.48278	1.330000	0.45394	0.655000	0.94253	GCA	HSPB11	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like	ENSG00000081870		0.338	HSPB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB11	HGNC	protein_coding	OTTHUMT00000023114.1	33	0.00	0	C	NM_016126		54387380	54387380	-1	no_errors	ENST00000194214	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	1.000	A
INADL	10207	genome.wustl.edu	37	1	62374109	62374109	+	Silent	SNP	A	A	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:62374109A>G	ENST00000371158.2	+	25	3561	c.3447A>G	c.(3445-3447)ggA>ggG	p.G1149G	INADL_ENST00000316485.6_Silent_p.G1149G	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1149	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AGAATGCAGGAAACCCTGTGG	0.398																																						dbGAP											0													150.0	139.0	143.0					1																	62374109		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3447A>G	1.37:g.62374109A>G			O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.G1149	ENST00000371158.2	37	c.3447	CCDS617.2	1																																																																																			INADL	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000132849		0.398	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	79	0.00	0	A	NM_170605		62374109	62374109	+1	no_errors	ENST00000371158	ensembl	human	known	69_37n	silent	69	18.82	16	SNP	0.953	G
IQCE	23288	genome.wustl.edu	37	7	2617916	2617916	+	Missense_Mutation	SNP	C	C	T	rs555990190		TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr7:2617916C>T	ENST00000402050.2	+	7	690	c.506C>T	c.(505-507)aCg>aTg	p.T169M	IQCE_ENST00000404984.1_Missense_Mutation_p.T118M|IQCE_ENST00000438376.2_Missense_Mutation_p.T153M|IQCE_ENST00000325979.7_Missense_Mutation_p.T104M	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	169						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CTGATGAGAACGAAGCTCCGG	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		13499	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													67.0	76.0	73.0					7																	2617916		2157	4254	6411	-	-	-	SO:0001583	missense	0			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.506C>T	7.37:g.2617916C>T	ENSP00000385597:p.Thr169Met		Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.T169M	ENST00000402050.2	37	c.506	CCDS43542.1	7	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247632	0.39697	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000415271;ENST00000438376;ENST00000325979;ENST00000423395;ENST00000422276	T;T;T;T;T;T	0.53640	2.39;2.37;0.66;2.39;2.4;0.61	5.5	4.61	0.57282	.	0.108096	0.64402	D	0.000007	T	0.67363	0.2885	M	0.71581	2.175	0.31261	N	0.692912	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;0.999;1.0;0.999;0.999;0.999	T	0.73655	-0.3914	10	0.66056	D	0.02	-20.7833	14.6694	0.68932	0.1466:0.8534:0.0:0.0	.	104;153;104;169;169;153	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	M	169;118;205;153;104;104;104	ENSP00000385597:T169M;ENSP00000385945:T118M;ENSP00000404643:T205M;ENSP00000396178:T153M;ENSP00000313772:T104M;ENSP00000413570:T104M	ENSP00000313772:T104M	T	+	2	0	IQCE	2584442	1.000000	0.71417	0.009000	0.14445	0.307000	0.27823	5.356000	0.66052	1.299000	0.44798	0.563000	0.77884	ACG	IQCE	-	NULL	ENSG00000106012		0.607	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	42	0.00	0	C	NM_152558		2617916	2617916	+1	no_errors	ENST00000402050	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	0.955	T
KDM3A	55818	genome.wustl.edu	37	2	86709793	86709793	+	Silent	SNP	T	T	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr2:86709793T>C	ENST00000409556.1	+	19	3263	c.2898T>C	c.(2896-2898)ttT>ttC	p.F966F	KDM3A_ENST00000312912.5_Silent_p.F966F|KDM3A_ENST00000542128.1_Silent_p.F914F|KDM3A_ENST00000409064.1_Silent_p.F966F			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	966					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						GGAATGTGTTTAGGGAGTGCT	0.502																																					NSCLC(96;1150 1523 6936 46253 49736)	dbGAP											0													154.0	144.0	147.0					2																	86709793		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.2898T>C	2.37:g.86709793T>C			D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.F966	ENST00000409556.1	37	c.2898	CCDS1990.1	2																																																																																			KDM3A	-	NULL	ENSG00000115548		0.502	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2	42	0.00	0	T	NM_018433		86709793	86709793	+1	no_errors	ENST00000312912	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	1.000	C
KIAA1210	57481	genome.wustl.edu	37	X	118221920	118221920	+	Silent	SNP	G	G	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chrX:118221920G>T	ENST00000402510.2	-	11	3272	c.3273C>A	c.(3271-3273)acC>acA	p.T1091T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1091										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						CAAATTTAGGGGTCACCCATG	0.498																																						dbGAP											0													115.0	116.0	115.0					X																	118221920		1991	4141	6132	-	-	-	SO:0001819	synonymous_variant	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.3273C>A	X.37:g.118221920G>T			B7ZCI8|Q5JPN4	Silent	SNP	NULL	p.T1091	ENST00000402510.2	37	c.3273	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	G	2.741	-0.262271	0.05791	.	.	ENSG00000248857	ENST00000440399	.	.	.	4.39	0.559	0.17272	.	.	.	.	.	T	0.20333	0.0489	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21895	-1.0232	4	.	.	.	.	0.9733	0.01420	0.2132:0.1777:0.4231:0.186	.	.	.	.	T	498	.	.	P	-	1	0	KIAA1210	118105948	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	0.192000	0.17096	-0.029000	0.13827	-0.191000	0.12829	CCC	KIAA1210	-	NULL	ENSG00000250423		0.498	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	57	0.00	0	G	NM_020721		118221920	118221920	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	0.000	T
LAMA1	284217	genome.wustl.edu	37	18	6943262	6943262	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr18:6943262C>G	ENST00000389658.3	-	62	9077	c.8984G>C	c.(8983-8985)gGg>gCg	p.G2995A		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2995	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AACTGCGTTCCCGTCAACAAT	0.498																																						dbGAP											0													309.0	232.0	258.0					18																	6943262		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8984G>C	18.37:g.6943262C>G	ENSP00000374309:p.Gly2995Ala			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G2995A	ENST00000389658.3	37	c.8984	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	17.64	3.440331	0.63067	.	.	ENSG00000101680	ENST00000389658	T	0.56103	0.48	5.73	5.73	0.89815	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.85682	D	0.000000	T	0.79969	0.4538	M	0.93062	3.375	0.58432	D	0.999998	D;D	0.89917	0.998;1.0	D;D	0.77004	0.954;0.989	T	0.81609	-0.0855	10	0.41790	T	0.15	.	19.8926	0.96935	0.0:1.0:0.0:0.0	.	2995;325	P25391;B3KSD8	LAMA1_HUMAN;.	A	2995	ENSP00000374309:G2995A	ENSP00000374309:G2995A	G	-	2	0	LAMA1	6933262	1.000000	0.71417	0.274000	0.24659	0.201000	0.24016	7.399000	0.79935	2.709000	0.92574	0.563000	0.77884	GGG	LAMA1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000101680		0.498	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	137	0.00	0	C	NM_005559		6943262	6943262	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	91	19.47	22	SNP	0.999	G
MAP4	4134	genome.wustl.edu	37	3	47898938	47898938	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr3:47898938T>C	ENST00000360240.6	-	16	3649	c.3131A>G	c.(3130-3132)aAc>aGc	p.N1044S	MAP4_ENST00000395734.3_Missense_Mutation_p.N1044S|MAP4_ENST00000426837.2_Missense_Mutation_p.N2189S|MAP4_ENST00000383737.4_Missense_Mutation_p.N703S|MAP4_ENST00000420772.2_Missense_Mutation_p.N737S|MAP4_ENST00000264724.11_Missense_Mutation_p.N779S|MAP4_ENST00000441748.2_Missense_Mutation_p.N158S	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	1044					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	GTGCTTGATGTTAGCCTTAGA	0.532																																						dbGAP											0													237.0	188.0	204.0					3																	47898938		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.3131A>G	3.37:g.47898938T>C	ENSP00000353375:p.Asn1044Ser		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	pfam_Tau/MAP_tubulin-bd_rpt	p.N1044S	ENST00000360240.6	37	c.3131	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	T	19.11	3.763262	0.69763	.	.	ENSG00000047849	ENST00000383737;ENST00000264724;ENST00000395734;ENST00000426837;ENST00000360240;ENST00000420772;ENST00000335271;ENST00000441748	D;D;D;D;D;D;D;D	0.99722	-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53;-6.53	4.5	4.5	0.54988	.	.	.	.	.	D	0.99600	0.9855	M	0.83774	2.66	0.31366	N	0.680711	P;D;P;B;D;D	0.71674	0.909;0.964;0.767;0.017;0.998;0.998	P;P;P;B;D;D	0.76575	0.653;0.792;0.641;0.096;0.968;0.988	D	0.97909	1.0307	9	0.66056	D	0.02	-14.3486	9.5346	0.39216	0.0:0.0:0.1772:0.8228	.	737;1044;1044;779;703;2189	F8W9U4;P27816-6;P27816;E9PGM5;B9ZVR1;E7EVA0	.;.;MAP4_HUMAN;.;.;.	S	703;779;1044;2189;1044;737;372;158	ENSP00000373243:N703S;ENSP00000264724:N779S;ENSP00000379083:N1044S;ENSP00000407602:N2189S;ENSP00000353375:N1044S;ENSP00000409731:N737S;ENSP00000334770:N372S;ENSP00000415130:N158S	ENSP00000264724:N779S	N	-	2	0	MAP4	47873942	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.013000	0.70776	1.894000	0.54839	0.449000	0.29647	AAC	MAP4	-	pfam_Tau/MAP_tubulin-bd_rpt	ENSG00000047849		0.532	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1	31	0.00	0	T	NM_002375		47898938	47898938	-1	no_errors	ENST00000360240	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	C
MAVS	57506	genome.wustl.edu	37	20	3845133	3845133	+	Missense_Mutation	SNP	G	G	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr20:3845133G>T	ENST00000428216.2	+	6	984	c.856G>T	c.(856-858)Ggg>Tgg	p.G286W	MAVS_ENST00000358134.6_3'UTR|MAVS_ENST00000416600.2_Missense_Mutation_p.G145W	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	286					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CTGCTCCAGTGGGGCAGAGGC	0.602																																						dbGAP											0													78.0	68.0	71.0					20																	3845133		2203	4300	6503	-	-	-	SO:0001583	missense	0			DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.856G>T	20.37:g.3845133G>T	ENSP00000401980:p.Gly286Trp		A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	NULL	p.G286W	ENST00000428216.2	37	c.856	CCDS33437.1	20	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135605	0.56828	.	.	ENSG00000088888	ENST00000416600;ENST00000428216	T;T	0.34859	1.34;2.36	4.12	-2.39	0.06602	.	2.495090	0.01827	N	0.034438	T	0.50222	0.1603	L	0.48642	1.525	0.09310	N	1	D	0.69078	0.997	D	0.65874	0.939	T	0.50233	-0.8852	10	0.62326	D	0.03	1.0366	8.5637	0.33527	0.6801:0.0:0.3199:0.0	.	286	Q7Z434	MAVS_HUMAN	W	145;286	ENSP00000413749:G145W;ENSP00000401980:G286W	ENSP00000413749:G145W	G	+	1	0	MAVS	3793133	0.000000	0.05858	0.000000	0.03702	0.547000	0.35210	0.202000	0.17295	-0.286000	0.09076	0.491000	0.48974	GGG	MAVS	-	NULL	ENSG00000088888		0.602	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAVS	HGNC	protein_coding	OTTHUMT00000077784.3	42	0.00	0	G	NM_020746		3845133	3845133	+1	no_errors	ENST00000428216	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	0.000	T
MDN1	23195	genome.wustl.edu	37	6	90383931	90383931	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr6:90383931C>A	ENST00000369393.3	-	79	13254	c.13139G>T	c.(13138-13140)tGg>tTg	p.W4380L	RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000428876.1_Missense_Mutation_p.W4380L|MDN1_ENST00000468568.1_5'Flank			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4380					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGACTGTTGCCAAAGGTGATC	0.458																																						dbGAP											0													120.0	108.0	112.0					6																	90383931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13139G>T	6.37:g.90383931C>A	ENSP00000358400:p.Trp4380Leu		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.W4380L	ENST00000369393.3	37	c.13139	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	17.43	3.386813	0.61956	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03889	3.77;3.77	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.07369	0.0186	M	0.72894	2.215	0.54753	D	0.999985	D	0.65815	0.995	P	0.52554	0.702	T	0.35847	-0.9772	10	0.24483	T	0.36	.	14.5539	0.68086	0.0:0.9307:0.0:0.0693	.	4380	Q9NU22	MDN1_HUMAN	L	4380	ENSP00000358400:W4380L;ENSP00000413970:W4380L	ENSP00000358400:W4380L	W	-	2	0	MDN1	90440652	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	4.858000	0.62947	2.832000	0.97577	0.655000	0.94253	TGG	MDN1	-	pirsf_Midasin	ENSG00000112159		0.458	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	34	0.00	0	C			90383931	90383931	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	A
MIR1257	100302168	genome.wustl.edu	37	20	60528653	60528653	+	RNA	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr20:60528653C>T	ENST00000408490.1	-	0	65					NR_031658.1				microRNA 1257																		ccaGTGATGCCAGGGGCCCAC	0.647																																						dbGAP											0													18.0	22.0	21.0					20																	60528653		1514	3474	4988	-	-	-			0					20q13.33	2011-09-12		2008-12-18	ENSG00000221417	ENSG00000221417		"""ncRNAs / Micro RNAs"""	35322	non-coding RNA	RNA, micro				MIRN1257			Standard	NR_031658		Approved	hsa-mir-1257	uc021wfv.1				20.37:g.60528653C>T				RNA	SNP	-	NULL	ENST00000408490.1	37	NULL		20																																																																																			MIR1257	-	-	ENSG00000221417		0.647	MIR1257-201	KNOWN	basic	miRNA	MIR1257	HGNC	miRNA		29	0.00	0	C	NR_031658		60528653	60528653	-1	no_errors	ENST00000408490	ensembl	human	known	69_37n	rna	24	14.29	4	SNP	0.022	T
MTA2	9219	genome.wustl.edu	37	11	62365548	62365548	+	Silent	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr11:62365548C>T	ENST00000278823.2	-	6	827	c.438G>A	c.(436-438)gaG>gaA	p.E146E	MTA2_ENST00000527204.1_5'UTR|MTA2_ENST00000524902.1_5'UTR	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	146	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						CAACTCTAATCTCGCCCTGAT	0.493																																						dbGAP											0													153.0	147.0	149.0					11																	62365548		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.438G>A	11.37:g.62365548C>T			Q68DB1|Q9UQB5	Silent	SNP	pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.E146	ENST00000278823.2	37	c.438	CCDS8022.1	11																																																																																			MTA2	-	pfscan_ELM2_dom	ENSG00000149480		0.493	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTA2	HGNC	protein_coding	OTTHUMT00000395578.1	78	0.00	0	C	NM_004739		62365548	62365548	-1	no_errors	ENST00000278823	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	1.000	T
NALCN	259232	genome.wustl.edu	37	13	101755600	101755600	+	Silent	SNP	G	G	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr13:101755600G>A	ENST00000251127.6	-	26	3061	c.2980C>T	c.(2980-2982)Ctg>Ttg	p.L994L		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	994					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AATATGCGCAGAGGTCTCAGG	0.443																																						dbGAP											0													96.0	96.0	96.0					13																	101755600		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2980C>T	13.37:g.101755600G>A			Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	pfam_Ion_trans_dom	p.L994	ENST00000251127.6	37	c.2980	CCDS9498.1	13																																																																																			NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.443	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	49	0.00	0	G	NM_052867		101755600	101755600	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	1.000	A
TENM1	10178	genome.wustl.edu	37	X	123539064	123539064	+	Silent	SNP	A	A	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chrX:123539064A>C	ENST00000371130.3	-	26	5250	c.5187T>G	c.(5185-5187)acT>acG	p.T1729T	TENM1_ENST00000422452.2_Silent_p.T1736T|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1729					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CGCTGGCAAAAGTGACACGCA	0.552																																						dbGAP											0													82.0	68.0	73.0					X																	123539064		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.5187T>G	X.37:g.123539064A>C			B2RTR5|Q5JZ17	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.T1736	ENST00000371130.3	37	c.5208	CCDS14609.1	X																																																																																			ODZ1	-	NULL	ENSG00000009694		0.552	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	35	0.00	0	A	NM_014253		123539064	123539064	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	silent	34	17.07	7	SNP	0.302	C
OR8K3	219473	genome.wustl.edu	37	11	56086127	56086127	+	Silent	SNP	C	C	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr11:56086127C>A	ENST00000312711.1	+	1	345	c.345C>A	c.(343-345)ctC>ctA	p.L115L		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TTTTTATTCTCTCAGCCATGT	0.383																																						dbGAP											0													101.0	97.0	98.0					11																	56086127		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.345C>A	11.37:g.56086127C>A			Q6IFC4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L115	ENST00000312711.1	37	c.345	CCDS31527.1	11																																																																																			OR8K3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000181689		0.383	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K3	HGNC	protein_coding	OTTHUMT00000391602.1	59	0.00	0	C	NM_001005202		56086127	56086127	+1	no_errors	ENST00000312711	ensembl	human	known	69_37n	silent	36	14.29	6	SNP	0.041	A
PCDHB11	56125	genome.wustl.edu	37	5	140580562	140580563	+	Frame_Shift_Del	DEL	AG	AG	-	rs575924242	byFrequency	TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr5:140580562_140580563delAG	ENST00000354757.3	+	1	1215_1216	c.1215_1216delAG	c.(1213-1218)acagagfs	p.E406fs	PCDHB11_ENST00000536699.1_Frame_Shift_Del_p.E41fs	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	406	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E406Q(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGTTGGAAACAGAGAGACCACT	0.475																																						dbGAP											1	Substitution - Missense(1)	skin(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1215_1216delAG	5.37:g.140580566_140580567delAG	ENSP00000346802:p.Glu406fs		B4DSF7|Q2M223	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R407fs	ENST00000354757.3	37	c.1215_1216	CCDS4253.1	5																																																																																			PCDHB11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197479		0.475	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB11	HGNC	protein_coding	OTTHUMT00000251813.1	89	0.00	0	AG	NM_018931		140580562	140580563	+1	no_errors	ENST00000354757	ensembl	human	known	69_37n	frame_shift_del	63	10.00	7	DEL	0.000:0.000	-
PCDHB7	56129	genome.wustl.edu	37	5	140553974	140553974	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr5:140553974G>C	ENST00000231137.3	+	1	1732	c.1558G>C	c.(1558-1560)Gac>Cac	p.D520H		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	520	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGGTCCCTGGACTACGAGGC	0.701																																						dbGAP											0													76.0	81.0	80.0					5																	140553974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1558G>C	5.37:g.140553974G>C	ENSP00000231137:p.Asp520His		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D520H	ENST00000231137.3	37	c.1558	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	g	16.79	3.220335	0.58560	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.65364	-0.15	4.34	3.44	0.39384	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.85526	0.5717	H	0.97806	4.08	0.42692	D	0.993584	D	0.89917	1.0	D	0.97110	1.0	D	0.90296	0.4326	9	0.87932	D	0	.	12.7964	0.57562	0.0875:0.0:0.9125:0.0	.	520	Q9Y5E2	PCDB7_HUMAN	H	520;303	ENSP00000231137:D520H	ENSP00000231137:D520H	D	+	1	0	PCDHB7	140534158	1.000000	0.71417	0.996000	0.52242	0.588000	0.36517	3.241000	0.51376	2.112000	0.64535	0.552000	0.68991	GAC	PCDHB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000113212		0.701	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	185	0.00	0	G	NM_018940		140553974	140553974	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	missense	145	12.65	21	SNP	1.000	C
PCSK5	5125	genome.wustl.edu	37	9	78722166	78722166	+	Splice_Site	SNP	G	G	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr9:78722166G>C	ENST00000545128.1	+	9	1645		c.e9-1		PCSK5_ENST00000376752.4_Splice_Site|PCSK5_ENST00000376767.3_Splice_Site	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TTGTTTTCCAGATCACTACAG	0.473																																						dbGAP											0													52.0	48.0	49.0					9																	78722166		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1108-1G>C	9.37:g.78722166G>C			F5H2G7|Q13527|Q96EP4	Splice_Site	SNP	-	e9-1	ENST00000545128.1	37	c.1108-1	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	23.7	4.448675	0.84101	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752;ENST00000424854	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4549	0.99139	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCSK5	77911986	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	9.194000	0.94962	2.937000	0.99478	0.650000	0.86243	.	PCSK5	-	-	ENSG00000099139		0.473	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		24	0.00	0	G		Intron	78722166	78722166	+1	no_errors	ENST00000545128	ensembl	human	known	69_37n	splice_site	16	27.27	6	SNP	1.000	C
POGLUT1	56983	genome.wustl.edu	37	3	119198942	119198942	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr3:119198942G>C	ENST00000295588.4	+	5	585	c.501G>C	c.(499-501)tgG>tgC	p.W167C		NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1	167					cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						GGACATTTTGGGAAGGGGGAC	0.448																																						dbGAP											0													135.0	122.0	126.0					3																	119198942		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.501G>C	3.37:g.119198942G>C	ENSP00000295588:p.Trp167Cys		B2RD13|Q53GJ4|Q8N2T1	Missense_Mutation	SNP	pfam_LipoPS_modifying,smart_LipoPS_modifying	p.W167C	ENST00000295588.4	37	c.501	CCDS2988.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.042860|4.042860	0.75732|0.75732	.|.	.|.	ENSG00000163389|ENSG00000163389	ENST00000476573|ENST00000295588	.|T	.|0.33216	.|1.42	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.61924|0.61924	0.2386|0.2386	M|M	0.90759|0.90759	3.145|3.145	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.69621|0.69621	-0.5096|-0.5096	5|10	.|0.87932	.|D	.|0	-8.9649|-8.9649	13.5814|13.5814	0.61905|0.61905	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|167	.|Q8NBL1	.|PGLT1_HUMAN	R|C	154|167	.|ENSP00000295588:W167C	.|ENSP00000295588:W167C	G|W	+|+	1|3	0|0	POGLUT1|POGLUT1	120681632|120681632	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.166000|9.166000	0.94766|0.94766	2.582000|2.582000	0.87167|0.87167	0.655000|0.655000	0.94253|0.94253	GGA|TGG	POGLUT1	-	pfam_LipoPS_modifying,smart_LipoPS_modifying	ENSG00000163389		0.448	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POGLUT1	HGNC	protein_coding	OTTHUMT00000355034.2	89	0.00	0	G	NM_152305		119198942	119198942	+1	no_errors	ENST00000295588	ensembl	human	known	69_37n	missense	78	10.34	9	SNP	1.000	C
POM121C	100101267	genome.wustl.edu	37	7	75051419	75051419	+	Missense_Mutation	SNP	C	C	T	rs201211942		TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr7:75051419C>T	ENST00000257665.5	-	11	2841	c.2842G>A	c.(2842-2844)Gca>Aca	p.A948T	POM121C_ENST00000453279.2_Missense_Mutation_p.A706T|POM121C_ENST00000473168.1_5'Flank			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	948	Pore side. {ECO:0000255}.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GCCCCAAATGCGGGCTGGGGG	0.632																																						dbGAP											0													4.0	6.0	5.0					7																	75051419		1641	3562	5203	-	-	-	SO:0001583	missense	0				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.2842G>A	7.37:g.75051419C>T	ENSP00000257665:p.Ala948Thr		O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.A948T	ENST00000257665.5	37	c.2842		7	308	0.14102564102564102	73	0.1483739837398374	44	0.12154696132596685	72	0.1258741258741259	119	0.15699208443271767	C	0.460	-0.889359	0.02511	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.19669	3.6;2.13	2.84	-5.68	0.02436	.	1.073430	0.07425	N	0.894643	T	0.00039	0.0001	L	0.31526	0.94	0.09310	N	1	B	0.19073	0.033	B	0.10450	0.005	T	0.34304	-0.9834	10	0.18276	T	0.48	.	11.9044	0.52703	0.0:0.2973:0.0:0.7027	.	948	A8CG34	P121C_HUMAN	T	948;706	ENSP00000257665:A948T;ENSP00000414208:A706T	ENSP00000257665:A948T	A	-	1	0	POM121C	74889355	0.000000	0.05858	0.004000	0.12327	0.053000	0.15095	-2.669000	0.00845	-1.861000	0.01153	-1.201000	0.01664	GCA	POM121C	-	NULL	ENSG00000135213		0.632	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	POM121C	HGNC	protein_coding	OTTHUMT00000343919.2	48	0.00	0	C	NM_001099415		75051419	75051419	-1	no_errors	ENST00000257665	ensembl	human	known	69_37n	missense	24	11.11	3	SNP	0.005	T
PPBP	5473	genome.wustl.edu	37	4	74853801	74853801	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr4:74853801G>A	ENST00000296028.3	-	1	113	c.20C>T	c.(19-21)aCc>aTc	p.T7I		NM_002704.3	NP_002695.1	P02775	CXCL7_HUMAN	pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)	7					blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|defense response to bacterium (GO:0042742)|glucose transport (GO:0015758)|immune response (GO:0006955)|leukocyte migration involved in inflammatory response (GO:0002523)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell division (GO:0051781)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)	glucose transmembrane transporter activity (GO:0005355)			breast(1)|central_nervous_system(1)|lung(1)|ovary(2)|skin(2)|stomach(1)|urinary_tract(2)	10	Breast(15;0.00136)		all cancers(17;0.00273)|Lung(101;0.196)			GGAAGGGGTGGTATCAAGTCT	0.532																																						dbGAP											0													157.0	136.0	143.0					4																	74853801		2203	4300	6503	-	-	-	SO:0001583	missense	0			M54995	CCDS3563.1	4q12-q13	2013-02-25	2002-08-22		ENSG00000163736	ENSG00000163736		"""Endogenous ligands"""	9240	protein-coding gene	gene with protein product	"""platelet basic protein"", ""beta-thromboglobulin"", ""connective tissue-activating peptide III"", ""neutrophil-activating peptide-2"""	121010		THBGB1		1826003	Standard	NM_002704		Approved	SCYB7, TGB, NAP-2-L1, LA-PF4, MDGF, LDGF, Beta-TG, CTAP3, CXCL7, PBP, b-TG1, TGB1, CTAPIII, NAP-2	uc003hhj.3	P02775	OTTHUMG00000130008	ENST00000296028.3:c.20C>T	4.37:g.74853801G>A	ENSP00000296028:p.Thr7Ile		B2R5F3|Q6IBJ8	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXCL8/IL8,prints_Chemokine_CXC	p.T7I	ENST00000296028.3	37	c.20	CCDS3563.1	4	.	.	.	.	.	.	.	.	.	.	G	9.068	0.996261	0.19043	.	.	ENSG00000163736	ENST00000296028	T	0.44482	0.92	2.56	2.56	0.30785	.	1.638600	0.04292	U	0.345745	T	0.24547	0.0595	N	0.08118	0	0.09310	N	1	B	0.33694	0.421	B	0.26864	0.074	T	0.21930	-1.0231	10	0.66056	D	0.02	-0.3995	8.703	0.34338	0.0:0.0:1.0:0.0	.	7	P02775	CXCL7_HUMAN	I	7	ENSP00000296028:T7I	ENSP00000296028:T7I	T	-	2	0	PPBP	75072665	0.002000	0.14202	0.002000	0.10522	0.005000	0.04900	0.944000	0.29043	1.745000	0.51790	0.484000	0.47621	ACC	PPBP	-	NULL	ENSG00000163736		0.532	PPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPBP	HGNC	protein_coding	OTTHUMT00000252281.2	47	0.00	0	G	NM_002704		74853801	74853801	-1	no_errors	ENST00000296028	ensembl	human	known	69_37n	missense	55	12.70	8	SNP	0.002	A
RALGAPA1	253959	genome.wustl.edu	37	14	36159078	36159078	+	Missense_Mutation	SNP	C	C	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr14:36159078C>A	ENST00000389698.3	-	17	2788	c.2398G>T	c.(2398-2400)Gac>Tac	p.D800Y	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.D800Y|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.D847Y|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.D800Y	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	800					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCCAAGATGTCAGAAGTGCTG	0.458																																						dbGAP											0													118.0	108.0	111.0					14																	36159078		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.2398G>T	14.37:g.36159078C>A	ENSP00000374348:p.Asp800Tyr		A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.D847Y	ENST00000389698.3	37	c.2539	CCDS32065.1	14	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536882	0.65085	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	D;D;D;D;D	0.97505	-3.79;-3.8;-4.41;-4.07;-4.41	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.98416	0.9473	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.98	D;D;D;D;P	0.97110	0.999;0.998;1.0;0.999;0.809	D	0.99053	1.0828	10	0.87932	D	0	-13.4509	20.2789	0.98501	0.0:1.0:0.0:0.0	.	847;800;847;800;800	Q6GYQ0-6;B9EK38;Q6GYQ0-3;Q6GYQ0-2;Q6GYQ0	.;.;.;.;RGPA1_HUMAN	Y	800;800;800;847;800;847	ENSP00000374348:D800Y;ENSP00000302647:D800Y;ENSP00000258840:D847Y;ENSP00000371803:D800Y;ENSP00000451877:D847Y	ENSP00000258840:D847Y	D	-	1	0	RALGAPA1	35228829	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.788000	0.95919	0.650000	0.86243	GAC	RALGAPA1	-	NULL	ENSG00000174373		0.458	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	RALGAPA1	HGNC	protein_coding	OTTHUMT00000409829.1	49	0.00	0	C	XM_210022		36159078	36159078	-1	no_errors	ENST00000258840	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	1.000	A
PSMC6	5706	genome.wustl.edu	37	14	53184802	53184802	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr14:53184802C>G	ENST00000606149.1	+	8	549	c.533C>G	c.(532-534)aCg>aGg	p.T178R	PSMC6_ENST00000445930.2_Missense_Mutation_p.T192R	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	178					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)	p.T178R(1)|p.T192R(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					TTCTTAGGTACGGGAAAAACA	0.383																																						dbGAP											2	Substitution - Missense(2)	endometrium(2)											95.0	97.0	96.0					14																	53184802		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.533C>G	14.37:g.53184802C>G	ENSP00000475721:p.Thr178Arg		B2R975|P49719|Q6IBU3|Q92524	Nonsense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.Y177*	ENST00000606149.1	37	c.531		14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.48|17.48	3.400107|3.400107	0.62177|0.62177	.|.	.|.	ENSG00000100519|ENSG00000100519	ENST00000445930|ENST00000555339;ENST00000556813	D|.	0.95918|.	-3.85|.	4.91|4.91	4.91|4.91	0.64330|0.64330	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.83376|.	0.5241|.	M|M	0.87758|0.87758	2.905|2.905	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.997|.	D|.	0.85969|.	0.1475|.	10|.	0.87932|.	D|.	0|.	.|.	18.4642|18.4642	0.90749|0.90749	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	178;158|.	P62333;B4DR91|.	PRS10_HUMAN;.|.	R|X	192|138;177	ENSP00000401802:T192R|.	ENSP00000401802:T192R|.	T|Y	+|+	2|3	0|2	PSMC6|PSMC6	52254552|52254552	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.401000|0.401000	0.30781|0.30781	7.456000|7.456000	0.80751|0.80751	2.444000|2.444000	0.82710|0.82710	0.591000|0.591000	0.81541|0.81541	ACG|TAC	PSMC6	-	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	ENSG00000100519		0.383	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	HGNC	protein_coding	OTTHUMT00000470741.1	51	0.00	0	C	NM_002806		53184802	53184802	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000556813	ensembl	human	novel	69_37n	nonsense	30	14.29	5	SNP	1.000	G
RNPC3	55599	genome.wustl.edu	37	1	104093607	104093607	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:104093607C>G	ENST00000533099.1	+	14	1642	c.1406C>G	c.(1405-1407)gCt>gGt	p.A469G	RNPC3_ENST00000524631.1_Missense_Mutation_p.A468G|RNPC3_ENST00000423855.2_Missense_Mutation_p.A469G			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	469	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		AAAGGACAAGCTTTCATTGGA	0.353																																						dbGAP											0													82.0	79.0	80.0					1																	104093607		1838	4084	5922	-	-	-	SO:0001583	missense	0			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.1406C>G	1.37:g.104093607C>G	ENSP00000432886:p.Ala469Gly		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A469G	ENST00000533099.1	37	c.1406	CCDS781.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.7|27.7	4.855804|4.855804	0.91355|0.91355	.|.	.|.	ENSG00000185946|ENSG00000185946	ENST00000524631;ENST00000533099;ENST00000423855|ENST00000531127	T;T;T|.	0.45276|.	0.9;0.9;0.9|.	5.07|5.07	5.07|5.07	0.68467|0.68467	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	.|.	.|.	.|.	.|.	T|T	0.59018|0.59018	0.2163|0.2163	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.993;1.0|.	D;D|.	0.97110|.	0.99;1.0|.	T|T	0.55927|0.55927	-0.8063|-0.8063	9|5	0.66056|.	D|.	0.02|.	-0.3912|-0.3912	18.8117|18.8117	0.92059|0.92059	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	468;469|.	A8K1C9;Q96LT9|.	.;RBM40_HUMAN|.	G|V	468;469;469|80	ENSP00000437278:A468G;ENSP00000432886:A469G;ENSP00000391432:A469G|.	ENSP00000391432:A469G|.	A|L	+|+	2|1	0|0	RNPC3|RNPC3	103895130|103895130	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.445000|7.445000	0.80570|0.80570	2.503000|2.503000	0.84419|0.84419	0.591000|0.591000	0.81541|0.81541	GCT|CTT	RNPC3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000185946		0.353	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1	43	0.00	0	C	NM_017619		104093607	104093607	+1	no_errors	ENST00000423855	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	G
SEMA3B	7869	genome.wustl.edu	37	3	50308521	50308521	+	RNA	SNP	G	G	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr3:50308521G>T	ENST00000418948.1	+	0	687							Q13214	SEM3B_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B						axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			central_nervous_system(2)|kidney(1)|lung(2)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		CCTCCCAGGAGCCCGTCCTCC	0.632																																						dbGAP											0													32.0	40.0	38.0					3																	50308521		2005	4153	6158	-	-	-			0			U28369	CCDS74941.1	3p21.3	2013-01-11			ENSG00000012171	ENSG00000012171		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10724	protein-coding gene	gene with protein product		601281		SEMAA		7748561, 8633026	Standard	NM_004636		Approved	SemA, semaV, LUCA-1, sema5	uc003cyu.3	Q13214	OTTHUMG00000156970		3.37:g.50308521G>T			Q6GU46|Q8TB71|Q8TDV7|Q93018|Q96GX0	RNA	SNP	-	NULL	ENST00000418948.1	37	NULL		3	.	.	.	.	.	.	.	.	.	.	g	5.887	0.347787	0.11126	.	.	ENSG00000012171	ENST00000316347;ENST00000414456	.	.	.	4.95	4.02	0.46733	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.164390	0.52532	D	0.000074	T	0.15912	0.0383	.	.	.	.	.	.	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.09377	0.002;0.002;0.004	T	0.26467	-1.0102	7	0.02654	T	1	.	4.2007	0.10464	0.1447:0.2431:0.6122:0.0	.	151;150;151	Q13214-2;F5H2H7;Q13214	.;.;SEM3B_HUMAN	D	150	.	ENSP00000446262:E150D	E	+	3	2	SEMA3B	50283525	0.001000	0.12720	1.000000	0.80357	0.178000	0.23041	-0.488000	0.06497	1.165000	0.42670	0.586000	0.80456	GAG	SEMA3B	-	-	ENSG00000012171		0.632	SEMA3B-001	KNOWN	sequence_error|basic	processed_transcript	SEMA3B	HGNC	processed_transcript	OTTHUMT00000346890.2	39	0.00	0	G	NM_001005914		50308521	50308521	+1	no_errors	ENST00000316347	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	0.995	T
SLC39A7	7922	genome.wustl.edu	37	6	33168855	33168855	+	5'UTR	SNP	T	T	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr6:33168855T>A	ENST00000374677.3	+	0	206				RXRB_ENST00000374680.3_5'Flank|RXRB_ENST00000544186.1_5'Flank|RXRB_ENST00000374685.4_5'Flank|SLC39A7_ENST00000374675.3_Intron|RXRB_ENST00000413614.2_5'Flank|RNY4P10_ENST00000365571.1_RNA	NM_006979.2	NP_008910.2	Q92504	S39A7_HUMAN	solute carrier family 39 (zinc transporter), member 7						transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						CGGGAGGTGGTTCGGGATAAA	0.532																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF117221	CCDS43453.1	6p21.3	2014-01-28		2003-10-27	ENSG00000112473	ENSG00000112473		"""Solute carriers"""	4927	protein-coding gene	gene with protein product		601416	"""HLA class II region expressed gene KE4"""	HKE4		8812499, 1855816, 19246244, 15705588	Standard	NM_006979		Approved	H2-KE4, D6S2244E, KE4, RING5, ZIP7	uc003odf.3	Q92504	OTTHUMG00000031238	ENST00000374677.3:c.-168T>A	6.37:g.33168855T>A			B0UXF6|Q5STP8|Q9UIQ0	RNA	SNP	-	NULL	ENST00000374677.3	37	NULL	CCDS43453.1	6																																																																																			SLC39A7	-	-	ENSG00000112473		0.532	SLC39A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A7	HGNC	protein_coding	OTTHUMT00000076499.2	49	0.00	0	T	NM_006979		33168855	33168855	+1	no_errors	ENST00000496894	ensembl	human	putative	69_37n	rna	36	10.00	4	SNP	0.000	A
SOHLH1	402381	genome.wustl.edu	37	9	138590846	138590846	+	Missense_Mutation	SNP	C	C	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr9:138590846C>G	ENST00000298466.5	-	2	252	c.192G>C	c.(190-192)gaG>gaC	p.E64D	SOHLH1_ENST00000425225.1_Missense_Mutation_p.E64D	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	64	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CTCACCTGCGCTCCCTCTCGC	0.701																																						dbGAP											0													50.0	47.0	48.0					9																	138590846		2203	4296	6499	-	-	-	SO:0001583	missense	0			BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.192G>C	9.37:g.138590846C>G	ENSP00000298466:p.Glu64Asp		C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.E64D	ENST00000298466.5	37	c.192	CCDS35174.1	9	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875393	0.72180	.	.	ENSG00000165643	ENST00000298466;ENST00000425225	D;D	0.97888	-4.59;-4.59	3.13	-1.3	0.09259	Helix-loop-helix DNA-binding (5);	0.000000	0.33057	N	0.005321	D	0.96423	0.8833	L	0.44542	1.39	0.25036	N	0.991237	D;D	0.71674	0.998;0.998	D;D	0.67548	0.92;0.952	D	0.90507	0.4478	10	0.56958	D	0.05	-17.4684	3.2389	0.06774	0.0:0.3249:0.2237:0.4514	.	64;64	Q5JUK2-2;Q5JUK2	.;SOLH1_HUMAN	D	64	ENSP00000298466:E64D;ENSP00000404438:E64D	ENSP00000298466:E64D	E	-	3	2	SOHLH1	137730667	1.000000	0.71417	0.987000	0.45799	0.947000	0.59692	0.415000	0.21181	-0.158000	0.11040	0.555000	0.69702	GAG	SOHLH1	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000165643		0.701	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SOHLH1	HGNC	protein_coding	OTTHUMT00000055018.2	53	0.00	0	C	NM_001012415		138590846	138590846	-1	no_errors	ENST00000425225	ensembl	human	known	69_37n	missense	62	13.89	10	SNP	0.879	G
SPEF2	79925	genome.wustl.edu	37	5	35694435	35694435	+	Missense_Mutation	SNP	T	T	G			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr5:35694435T>G	ENST00000356031.3	+	13	2099	c.1945T>G	c.(1945-1947)Tta>Gta	p.L649V	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.L649V|SPEF2_ENST00000509059.1_Missense_Mutation_p.L649V	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	649					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGATGAAGTATTACCAGAAAC	0.338																																						dbGAP											0													96.0	90.0	92.0					5																	35694435		1841	4100	5941	-	-	-	SO:0001583	missense	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1945T>G	5.37:g.35694435T>G	ENSP00000348314:p.Leu649Val		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.L649V	ENST00000356031.3	37	c.1945	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	T	7.780	0.709253	0.15239	.	.	ENSG00000152582	ENST00000356031;ENST00000509059;ENST00000440995;ENST00000504054	T;T;T;T	0.32988	3.31;3.22;3.28;1.43	3.33	-2.48	0.06423	.	2.074200	0.02193	N	0.061537	T	0.18800	0.0451	L	0.36672	1.1	0.09310	N	1	B;B;B	0.21225	0.011;0.053;0.017	B;B;B	0.18561	0.006;0.022;0.01	T	0.05937	-1.0855	10	0.12766	T	0.61	.	0.3124	0.00290	0.2029:0.2682:0.1909:0.3379	.	649;649;649	D6REZ4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	V	649;649;649;160	ENSP00000348314:L649V;ENSP00000421593:L649V;ENSP00000412125:L649V;ENSP00000421744:L160V	ENSP00000348314:L649V	L	+	1	2	SPEF2	35730192	0.000000	0.05858	0.000000	0.03702	0.458000	0.32498	-0.780000	0.04654	-0.452000	0.07087	0.383000	0.25322	TTA	SPEF2	-	NULL	ENSG00000152582		0.338	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	98	0.00	0	T	NM_144722		35694435	35694435	+1	no_errors	ENST00000356031	ensembl	human	known	69_37n	missense	52	16.13	10	SNP	0.000	G
SPTLC2	9517	genome.wustl.edu	37	14	78028748	78028748	+	Missense_Mutation	SNP	T	T	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr14:78028748T>C	ENST00000216484.2	-	6	1034	c.841A>G	c.(841-843)Aaa>Gaa	p.K281E		NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	281					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	CTGTTGTGTTTGAAGATTCTA	0.433																																						dbGAP											0													109.0	99.0	102.0					14																	78028748		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.841A>G	14.37:g.78028748T>C	ENSP00000216484:p.Lys281Glu		Q16685	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.K281E	ENST00000216484.2	37	c.841	CCDS9865.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.4|20.4	3.979993|3.979993	0.74360|0.74360	.|.	.|.	ENSG00000100596|ENSG00000100596	ENST00000216484|ENST00000554901	D|.	0.95103|.	-3.61|.	5.5|5.5	5.5|5.5	0.81552|0.81552	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77103|0.77103	0.4081|0.4081	M|M	0.80508|0.80508	2.5|2.5	0.80722|0.80722	D|D	1|1	P|.	0.39737|.	0.685|.	P|.	0.45406|.	0.479|.	T|T	0.78615|0.78615	-0.2135|-0.2135	10|5	0.49607|.	T|.	0.09|.	-26.3392|-26.3392	15.9147|15.9147	0.79503|0.79503	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	281|.	O15270|.	SPTC2_HUMAN|.	E|R	281|217	ENSP00000216484:K281E|.	ENSP00000216484:K281E|.	K|Q	-|-	1|2	0|0	SPTLC2|SPTLC2	77098501|77098501	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	7.767000|7.767000	0.85331|0.85331	2.227000|2.227000	0.72691|0.72691	0.460000|0.460000	0.39030|0.39030	AAA|CAA	SPTLC2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000100596		0.433	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC2	HGNC	protein_coding	OTTHUMT00000414030.1	56	0.00	0	T	NM_004863		78028748	78028748	-1	no_errors	ENST00000216484	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	1.000	C
SUGP2	10147	genome.wustl.edu	37	19	19136590	19136590	+	Silent	SNP	C	C	G	rs374843157		TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr19:19136590C>G	ENST00000601879.1	-	3	864	c.567G>C	c.(565-567)cgG>cgC	p.R189R	SUGP2_ENST00000600377.1_Silent_p.R203R|SUGP2_ENST00000337018.6_Silent_p.R189R|SUGP2_ENST00000452918.2_Silent_p.R189R|SUGP2_ENST00000456085.2_Intron|SUGP2_ENST00000598202.1_5'UTR			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	189					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CGTCATAATCCCGACTCTCCT	0.532																																						dbGAP											0													99.0	85.0	89.0					19																	19136590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.567G>C	19.37:g.19136590C>G			C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Silent	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.R189	ENST00000601879.1	37	c.567	CCDS12392.1	19																																																																																			SUGP2	-	NULL	ENSG00000064607		0.532	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SUGP2	HGNC	protein_coding	OTTHUMT00000464627.1	43	0.00	0	C	NM_001017392		19136590	19136590	-1	no_errors	ENST00000337018	ensembl	human	known	69_37n	silent	19	26.92	7	SNP	0.507	G
TCEA1	6917	genome.wustl.edu	37	8	54879688	54879688	+	3'UTR	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr8:54879688C>T	ENST00000521604.2	-	0	2285				TCEA1_ENST00000521086.2_5'UTR|TCEA1_ENST00000396401.3_3'UTR	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1						DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			TATTTTCTATCAGTCTCCACA	0.333			T	PLAG1	salivary adenoma																																	dbGAP		Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.*976G>A	8.37:g.54879688C>T			A6NF25|A8K339|Q15563|Q6FG87	RNA	SNP	-	NULL	ENST00000521604.2	37	NULL	CCDS47858.1	8																																																																																			TCEA1	-	-	ENSG00000187735		0.333	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA1	HGNC	protein_coding	OTTHUMT00000377975.2	24	0.00	0	C	NM_006756		54879688	54879688	-1	no_errors	ENST00000521086	ensembl	human	known	69_37n	rna	24	22.58	7	SNP	0.094	T
TMCO4	255104	genome.wustl.edu	37	1	20082237	20082237	+	Silent	SNP	T	T	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:20082237T>C	ENST00000294543.6	-	7	646	c.405A>G	c.(403-405)agA>agG	p.R135R	TMCO4_ENST00000375122.2_Silent_p.R135R|TMCO4_ENST00000375127.1_Silent_p.R135R	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	135						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		AAACGAGGACTCTGGCCCGGG	0.483																																						dbGAP											0													96.0	98.0	98.0					1																	20082237		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.405A>G	1.37:g.20082237T>C			Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Silent	SNP	pfam_DUF726,pfam_DUF900_hydrolase	p.R135	ENST00000294543.6	37	c.405	CCDS198.1	1																																																																																			TMCO4	-	NULL	ENSG00000162542		0.483	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO4	HGNC	protein_coding	OTTHUMT00000007658.1	58	0.00	0	T	NM_181719		20082237	20082237	-1	no_errors	ENST00000294543	ensembl	human	known	69_37n	silent	32	17.95	7	SNP	1.000	C
TDRD5	163589	genome.wustl.edu	37	1	179603712	179603712	+	Missense_Mutation	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:179603712C>T	ENST00000367614.1	+	8	1606	c.1247C>T	c.(1246-1248)cCa>cTa	p.P416L	TDRD5_ENST00000444136.1_Missense_Mutation_p.P416L|TDRD5_ENST00000294848.8_Missense_Mutation_p.P416L	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	416					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						CAAAAAGAGCCACAACAGAAG	0.423																																						dbGAP											0													107.0	106.0	106.0					1																	179603712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1247C>T	1.37:g.179603712C>T	ENSP00000356586:p.Pro416Leu		A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.P416L	ENST00000367614.1	37	c.1247	CCDS1332.1	1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989019	0.35131	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.11821	2.74;2.74;2.93	5.24	3.32	0.38043	.	0.813705	0.11447	N	0.563201	T	0.13670	0.0331	L	0.54323	1.7	0.27897	N	0.939122	P;B	0.36789	0.57;0.376	B;B	0.35182	0.197;0.072	T	0.12630	-1.0540	10	0.48119	T	0.1	-26.2416	7.1344	0.25521	0.1734:0.7351:0.0:0.0914	.	416;416	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	L	416	ENSP00000356586:P416L;ENSP00000294848:P416L;ENSP00000406052:P416L	ENSP00000294848:P416L	P	+	2	0	TDRD5	177870335	0.030000	0.19436	0.827000	0.32855	0.796000	0.44982	0.117000	0.15583	1.329000	0.45376	0.655000	0.94253	CCA	TDRD5	-	NULL	ENSG00000162782		0.423	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	HGNC	protein_coding	OTTHUMT00000085295.1	52	0.00	0	C	NM_173533		179603712	179603712	+1	no_errors	ENST00000444136	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	0.550	T
TP53	7157	genome.wustl.edu	37	17	7578222	7578223	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr17:7578222_7578223delTC	ENST00000269305.4	-	6	815_816	c.626_627delGA	c.(625-627)agafs	p.R209fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.R209fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.R209fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	209	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> I (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R209fs*6(38)|p.0?(8)|p.R209K(7)|p.?(5)|p.R209T(3)|p.R77fs*6(2)|p.R209fs*35(2)|p.D207fs*6(2)|p.R209fs*38(2)|p.R116fs*6(2)|p.R77K(1)|p.R116K(1)|p.E204_N210delEYLDDRN(1)|p.R209fs*36(1)|p.D207_R213delDDRNTFR(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.N210fs*7(1)|p.R209S(1)|p.R209I(1)|p.R209_R213delRNTFR(1)|p.D207_V216del10(1)|p.R209fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAAAGTGTTTCTGTCATCCAA	0.535		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	84	Deletion - Frameshift(51)|Substitution - Missense(14)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Insertion - Frameshift(1)	biliary_tract(11)|breast(9)|upper_aerodigestive_tract(8)|oesophagus(7)|large_intestine(6)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|prostate(5)|lung(4)|bone(4)|stomach(3)|soft_tissue(3)|ovary(3)|pancreas(3)|salivary_gland(2)|skin(2)|cervix(1)|urinary_tract(1)|liver(1)|thyroid(1)	GRCh37	CD962734	TP53	D																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.626_627delGA	17.37:g.7578222_7578223delTC	ENSP00000269305:p.Arg209fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R209fs	ENST00000269305.4	37	c.627_626	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.535	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	69	0.00	0	TC	NM_000546		7578222	7578223	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	30	16.67	6	DEL	0.000:0.000	-
TSPAN1	10103	genome.wustl.edu	37	1	46651256	46651256	+	3'UTR	SNP	G	G	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr1:46651256G>T	ENST00000372003.1	+	0	1241					NM_005727.3	NP_005718.2	O60635	TSN1_HUMAN	tetraspanin 1						cell migration (GO:0016477)|cell proliferation (GO:0008283)|positive regulation of endocytosis (GO:0045807)|protein stabilization (GO:0050821)|thiamine transmembrane transport (GO:0071934)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	thiamine uptake transmembrane transporter activity (GO:0015403)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)				CTGTGAAGAGGCACCCTGGCA	0.532																																						dbGAP											0													93.0	82.0	85.0					1																	46651256		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC013404	CCDS530.1	1p33	2013-02-14			ENSG00000117472	ENSG00000117472		"""Tetraspanins"""	20657	protein-coding gene	gene with protein product		613170				9714763, 10719184	Standard	NM_005727		Approved	TSPAN-1, NET-1	uc001cpd.3	O60635	OTTHUMG00000007602	ENST00000372003.1:c.*51G>T	1.37:g.46651256G>T			D3DQ14|O60745|Q5VST0	RNA	SNP	-	NULL	ENST00000372003.1	37	NULL	CCDS530.1	1																																																																																			TSPAN1	-	-	ENSG00000117472		0.532	TSPAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN1	HGNC	protein_coding	OTTHUMT00000020135.1	65	0.00	0	G	NM_005727		46651256	46651256	+1	no_errors	ENST00000470318	ensembl	human	known	69_37n	rna	63	17.11	13	SNP	0.006	T
TSPAN12	23554	genome.wustl.edu	37	7	120496782	120496782	+	Missense_Mutation	SNP	G	G	C			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr7:120496782G>C	ENST00000222747.3	-	2	643	c.36C>G	c.(34-36)tgC>tgG	p.C12W	TSPAN12_ENST00000415871.1_Missense_Mutation_p.C12W	NM_012338.3	NP_036470.1	O95859	TSN12_HUMAN	tetraspanin 12	12					angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|regulation of angiogenesis (GO:0045765)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|kidney(1)|lung(4)|ovary(1)|skin(1)	10	all_neural(327;0.117)					CGTAGAGCAGGCAGCGCAGAC	0.547											OREG0018280	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													118.0	101.0	107.0					7																	120496782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF124522	CCDS5777.1	7q31.31	2013-02-14	2005-03-21	2005-03-21	ENSG00000106025	ENSG00000106025		"""Tetraspanins"""	21641	protein-coding gene	gene with protein product		613138	"""transmembrane 4 superfamily member 12"""	TM4SF12			Standard	NM_012338		Approved	NET-2	uc003vjk.3	O95859	OTTHUMG00000156980	ENST00000222747.3:c.36C>G	7.37:g.120496782G>C	ENSP00000222747:p.Cys12Trp	1504	A4D0V8|B4DRG6|Q549U9|Q8N5Y0	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.C12W	ENST00000222747.3	37	c.36	CCDS5777.1	7	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650355	0.47362	.	.	ENSG00000106025	ENST00000222747;ENST00000415871;ENST00000441017;ENST00000433758;ENST00000424710;ENST00000430985	T;T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28;-1.28	4.95	2.1	0.27182	.	0.099000	0.64402	D	0.000001	T	0.73426	0.3585	L	0.56769	1.78	0.80722	D	1	P	0.35077	0.483	B	0.33339	0.162	T	0.69599	-0.5102	10	0.51188	T	0.08	-7.2348	8.7381	0.34541	0.3074:0.0:0.6926:0.0	.	12	O95859	TSN12_HUMAN	W	12	ENSP00000222747:C12W;ENSP00000397699:C12W;ENSP00000411158:C12W;ENSP00000399059:C12W;ENSP00000404942:C12W;ENSP00000388819:C12W	ENSP00000222747:C12W	C	-	3	2	TSPAN12	120284018	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.207000	0.42788	0.497000	0.27926	0.655000	0.94253	TGC	TSPAN12	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000106025		0.547	TSPAN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN12	HGNC	protein_coding	OTTHUMT00000346951.1	44	0.00	0	G	NM_012338		120496782	120496782	-1	no_errors	ENST00000222747	ensembl	human	known	69_37n	missense	53	15.87	10	SNP	1.000	C
VRTN	55237	genome.wustl.edu	37	14	74824018	74824018	+	Missense_Mutation	SNP	G	G	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr14:74824018G>A	ENST00000256362.4	+	2	773	c.532G>A	c.(532-534)Gct>Act	p.A178T		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	178					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						GCACTTGTATGCTCTCGCCTC	0.617																																						dbGAP											0													121.0	114.0	116.0					14																	74824018		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.532G>A	14.37:g.74824018G>A	ENSP00000256362:p.Ala178Thr		Q9NVC7	Missense_Mutation	SNP	pfam_Transposase_8	p.A178T	ENST00000256362.4	37	c.532	CCDS9830.1	14	.	.	.	.	.	.	.	.	.	.	G	18.23	3.576977	0.65878	.	.	ENSG00000133980	ENST00000256362	T	0.49432	0.78	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.54647	0.1871	L	0.27053	0.805	0.54753	D	0.999981	D	0.76494	0.999	D	0.63381	0.914	T	0.59112	-0.7515	10	0.87932	D	0	0.023	16.7434	0.85465	0.0:0.0:1.0:0.0	.	178	Q9H8Y1	VRTN_HUMAN	T	178	ENSP00000256362:A178T	ENSP00000256362:A178T	A	+	1	0	VRTN	73893771	1.000000	0.71417	0.990000	0.47175	0.151000	0.21798	8.796000	0.91877	2.628000	0.89032	0.561000	0.74099	GCT	VRTN	-	NULL	ENSG00000133980		0.617	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VRTN	HGNC	protein_coding	OTTHUMT00000412339.1	56	0.00	0	G	NM_018228		74824018	74824018	+1	no_errors	ENST00000256362	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	1.000	A
XYLT2	64132	genome.wustl.edu	37	17	48433607	48433607	+	Silent	SNP	C	C	T			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr17:48433607C>T	ENST00000017003.2	+	7	1516	c.1467C>T	c.(1465-1467)gaC>gaT	p.D489D	XYLT2_ENST00000507602.1_Silent_p.D489D	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	489					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					AGCCACAGGACTTCCTCCGGC	0.612																																						dbGAP											0													60.0	57.0	58.0					17																	48433607		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.1467C>T	17.37:g.48433607C>T			Q6UY41|Q86V00	Silent	SNP	pfam_XylT_met,pfam_Glyco_trans_14	p.D489	ENST00000017003.2	37	c.1467	CCDS11563.1	17																																																																																			XYLT2	-	NULL	ENSG00000015532		0.612	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT2	HGNC	protein_coding	OTTHUMT00000367046.1	42	0.00	0	C	NM_022167		48433607	48433607	+1	no_errors	ENST00000017003	ensembl	human	known	69_37n	silent	28	15.15	5	SNP	1.000	T
ZBED5	58486	genome.wustl.edu	37	11	10875493	10875493	+	Missense_Mutation	SNP	C	C	T	rs577272762		TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr11:10875493C>T	ENST00000432999.2	-	3	1498	c.1000G>A	c.(1000-1002)Gaa>Aaa	p.E334K	ZBED5_ENST00000525350.1_Intron|ZBED5_ENST00000413761.2_Missense_Mutation_p.E334K	NM_001143667.1|NM_021211.3	NP_001137139.1|NP_067034.2	Q49AG3	ZBED5_HUMAN	zinc finger, BED-type containing 5	334							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)	4						ttttcccattcaatttcatgt	0.388																																						dbGAP											0													41.0	32.0	35.0					11																	10875493		692	1590	2282	-	-	-	SO:0001583	missense	0			AF205601		11p15.3	2013-05-03			ENSG00000236287	ENSG00000236287		"""Zinc fingers, BED-type"""	30803	protein-coding gene	gene with protein product		615251				10607616, 23533661	Standard	NM_021211		Approved	Buster1	uc009ygh.3	Q49AG3	OTTHUMG00000150341	ENST00000432999.2:c.1000G>A	11.37:g.10875493C>T	ENSP00000398106:p.Glu334Lys		B2RCC1|Q05D82|Q86WW3|Q9NT24|Q9UBJ4	Missense_Mutation	SNP	superfamily_RNaseH-like_dom,pfscan_Znf_BED_prd	p.E334K	ENST00000432999.2	37	c.1000		11	.	.	.	.	.	.	.	.	.	.	C	9.366	1.069212	0.20147	.	.	ENSG00000236287	ENST00000432999;ENST00000413761	T;T	0.22336	1.96;1.96	4.18	4.18	0.49190	Ribonuclease H-like (1);	.	.	.	.	T	0.14098	0.0341	N	0.21448	0.665	0.30713	N	0.749088	B	0.19935	0.04	B	0.19391	0.025	T	0.06110	-1.0845	9	0.14656	T	0.56	.	12.3074	0.54910	0.0:1.0:0.0:0.0	.	334	Q49AG3	ZBED5_HUMAN	K	334	ENSP00000398106:E334K;ENSP00000415939:E334K	ENSP00000415939:E334K	E	-	1	0	ZBED5	10832069	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.406000	0.34646	2.620000	0.88729	0.650000	0.86243	GAA	ZBED5	-	superfamily_RNaseH-like_dom	ENSG00000236287		0.388	ZBED5-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ZBED5	HGNC	protein_coding	OTTHUMT00000317691.1	51	0.00	0	C	NM_021211		10875493	10875493	-1	no_errors	ENST00000413761	ensembl	human	putative	69_37n	missense	23	37.84	14	SNP	1.000	T
ZFP91	80829	genome.wustl.edu	37	11	58347039	58347039	+	Silent	SNP	G	G	A			TCGA-AR-A5QQ-01A-11D-A28B-09	TCGA-AR-A5QQ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	ead4a158-677a-4f8b-99a2-536f0ec76469	b3ee2a63-4fe7-4c96-b0a3-3e9b1c9bf579	g.chr11:58347039G>A	ENST00000316059.6	+	1	456	c.285G>A	c.(283-285)caG>caA	p.Q95Q	LPXN_ENST00000528489.1_5'Flank|ZFP91-CNTF_ENST00000389919.4_Silent_p.Q95Q|LPXN_ENST00000528954.1_5'Flank	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	95					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				CCGGGCAGCAGCCCCAGGCCG	0.706																																						dbGAP											0													12.0	12.0	12.0					11																	58347039		1611	3409	5020	-	-	-	SO:0001819	synonymous_variant	0			AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.285G>A	11.37:g.58347039G>A			A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q95	ENST00000316059.6	37	c.285	CCDS31553.1	11																																																																																			ZFP91	-	NULL	ENSG00000186660		0.706	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP91	HGNC	protein_coding	OTTHUMT00000268674.1	12	0.00	0	G	NM_053023		58347039	58347039	+1	no_errors	ENST00000316059	ensembl	human	known	69_37n	silent	10	28.57	4	SNP	0.959	A
