#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AMPD1	270	genome.wustl.edu	37	1	115223011	115223011	+	Silent	SNP	G	G	A	rs181412206		TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr1:115223011G>A	ENST00000520113.2	-	6	750	c.735C>T	c.(733-735)gaC>gaT	p.D245D	AMPD1_ENST00000353928.6_Silent_p.D212D|AMPD1_ENST00000369538.3_Silent_p.D241D			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	245					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	AAACTACACCGTCCTTCATTT	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		19198	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													169.0	159.0	163.0					1																	115223011		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.735C>T	1.37:g.115223011G>A			A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.D245	ENST00000520113.2	37	c.735	CCDS876.2	1																																																																																			AMPD1	-	pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116748		0.448	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	98	0.00	0	G			115223011	115223011	-1	no_errors	ENST00000520113	ensembl	human	known	69_37n	silent	25	75.49	77	SNP	0.460	A
ANKRD13A	88455	genome.wustl.edu	37	12	110456273	110456273	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr12:110456273G>T	ENST00000261739.4	+	5	690	c.524G>T	c.(523-525)aGt>aTt	p.S175I	ANKRD13A_ENST00000550404.1_3'UTR	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	175						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						GGGAGGCGTAGTTTTATATTT	0.413																																						dbGAP											0													126.0	128.0	127.0					12																	110456273		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.524G>T	12.37:g.110456273G>T	ENSP00000261739:p.Ser175Ile		O60736	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.S175I	ENST00000261739.4	37	c.524	CCDS9140.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.532890|4.532890	0.85812|0.85812	.|.	.|.	ENSG00000076513|ENSG00000076513	ENST00000261739|ENST00000547639	T|.	0.63255|.	-0.03|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83871|0.83871	0.5348|0.5348	M|M	0.89904|0.89904	3.07|3.07	0.80722|0.80722	D|D	1|1	D;D;D|.	0.58268|.	0.982;0.982;0.982|.	P;P;P|.	0.60473|.	0.832;0.832;0.875|.	D|D	0.86599|0.86599	0.1865|0.1865	10|5	0.87932|.	D|.	0|.	-15.0685|-15.0685	15.8179|15.8179	0.78618|0.78618	0.0:0.1356:0.8644:0.0|0.0:0.1356:0.8644:0.0	.|.	175;175;175|.	B4DYP5;Q3ZTS7;Q8IZ07|.	.;.;AN13A_HUMAN|.	I|F	175|29	ENSP00000261739:S175I|.	ENSP00000261739:S175I|.	S|V	+|+	2|1	0|0	ANKRD13A|ANKRD13A	108940656|108940656	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.897000|7.897000	0.87356|0.87356	2.652000|2.652000	0.90054|0.90054	0.655000|0.655000	0.94253|0.94253	AGT|GTT	ANKRD13A	-	pfam_ANKRD13	ENSG00000076513		0.413	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD13A	HGNC	protein_coding	OTTHUMT00000403430.1	118	0.00	0	G	NM_033121		110456273	110456273	+1	no_errors	ENST00000261739	ensembl	human	known	69_37n	missense	43	57.43	58	SNP	1.000	T
ARHGEF40	55701	genome.wustl.edu	37	14	21543885	21543885	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr14:21543885C>T	ENST00000298694.4	+	5	1827	c.1700C>T	c.(1699-1701)aCg>aTg	p.T567M	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.T567M			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	567						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TCCCGAGACACGCTGAACACA	0.597																																						dbGAP											0													85.0	84.0	84.0					14																	21543885		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1700C>T	14.37:g.21543885C>T	ENSP00000298694:p.Thr567Met		A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T567M	ENST00000298694.4	37	c.1700	CCDS32041.1	14	.	.	.	.	.	.	.	.	.	.	C	7.154	0.584366	0.13749	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.02345	4.4;4.33	5.07	-3.05	0.05396	.	1.011400	0.07933	N	0.977845	T	0.02533	0.0077	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.45366	-0.9266	10	0.36615	T	0.2	.	7.1409	0.25556	0.1695:0.5948:0.0:0.2357	.	567	Q8TER5	ARH40_HUMAN	M	567	ENSP00000298694:T567M;ENSP00000298693:T567M	ENSP00000298693:T567M	T	+	2	0	ARHGEF40	20613725	0.010000	0.17322	0.237000	0.24090	0.921000	0.55340	-0.016000	0.12613	-0.617000	0.05664	-1.300000	0.01332	ACG	ARHGEF40	-	NULL	ENSG00000165801		0.597	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	HGNC	protein_coding	OTTHUMT00000413122.1	49	0.00	0	C			21543885	21543885	+1	no_errors	ENST00000298694	ensembl	human	known	69_37n	missense	3	90.32	28	SNP	0.009	T
ARID1A	8289	genome.wustl.edu	37	1	27099031	27099031	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr1:27099031delA	ENST00000324856.7	+	13	3818	c.3447delA	c.(3445-3447)tcafs	p.S1149fs	ARID1A_ENST00000457599.2_Frame_Shift_Del_p.S1149fs|ARID1A_ENST00000540690.1_5'Flank|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.S766fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1149					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTCCCCAGTCAACCAGCAGTT	0.537			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													94.0	87.0	90.0					1																	27099031		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3447delA	1.37:g.27099031delA	ENSP00000320485:p.Ser1149fs		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.T1150fs	ENST00000324856.7	37	c.3447	CCDS285.1	1																																																																																			ARID1A	-	NULL	ENSG00000117713		0.537	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	203	0.00	0	A	NM_139135		27099031	27099031	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	frame_shift_del	17	41.38	12	DEL	1.000	-
ARPP21	10777	genome.wustl.edu	37	3	35770832	35770832	+	Silent	SNP	G	G	A			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr3:35770832G>A	ENST00000187397.4	+	15	1719	c.1263G>A	c.(1261-1263)tcG>tcA	p.S421S	ARPP21_ENST00000444190.1_Silent_p.S367S|ARPP21_ENST00000417925.1_Silent_p.S387S|ARPP21_ENST00000458225.1_Silent_p.S387S|ARPP21_ENST00000337271.5_Silent_p.S367S	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	421	Ser-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						CCTCAGGATCGCTGTCCCGCA	0.542																																						dbGAP											0													62.0	64.0	63.0					3																	35770832		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1263G>A	3.37:g.35770832G>A			B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.A194T	ENST00000187397.4	37	c.580	CCDS2661.1	3	.	.	.	.	.	.	.	.	.	.	G	9.563	1.119076	0.20877	.	.	ENSG00000172995	ENST00000425289	.	.	.	6.06	-10.9	0.00192	.	.	.	.	.	T	0.30634	0.0771	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40365	-0.9567	4	.	.	.	-8.8675	0.6923	0.00893	0.3789:0.1601:0.1568:0.3041	.	.	.	.	T	194	.	.	A	+	1	0	ARPP21	35745836	0.001000	0.12720	0.268000	0.24571	0.990000	0.78478	-1.926000	0.01562	-1.923000	0.01065	-0.355000	0.07637	GCT	ARPP21	-	NULL	ENSG00000172995		0.542	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	29	0.00	0	G	NM_198399		35770832	35770832	+1	no_start_codon:pseudogene:bad_bp_length_for_coding_region	ENST00000425289	ensembl	human	putative	69_37n	missense	5	82.14	23	SNP	0.001	A
SPATA45	149643	genome.wustl.edu	37	1	213009307	213009307	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr1:213009307G>T	ENST00000332912.3	-	2	292	c.185C>A	c.(184-186)aCa>aAa	p.T62K		NM_001024601.2	NP_001019772.1	Q537H7	SPT45_HUMAN		62										kidney(1)|large_intestine(1)|lung(1)	3						CTCTTTGGTTGTGGTATCAGT	0.483																																						dbGAP											0													145.0	136.0	139.0					1																	213009307		2203	4297	6500	-	-	-	SO:0001583	missense	0																														ENST00000332912.3:c.185C>A	1.37:g.213009307G>T	ENSP00000419160:p.Thr62Lys			Missense_Mutation	SNP	NULL	p.T62K	ENST00000332912.3	37	c.185	CCDS31020.1	1	.	.	.	.	.	.	.	.	.	.	G	2.918	-0.223746	0.06061	.	.	ENSG00000185523	ENST00000332912	T	0.40476	1.03	4.45	3.36	0.38483	.	0.600559	0.15047	N	0.283557	T	0.17238	0.0414	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26503	-1.0101	9	0.02654	T	1	-4.855	8.0439	0.30538	0.0:0.0:0.2526:0.7474	.	62	Q537H7	CA227_HUMAN	K	62	ENSP00000419160:T62K	ENSP00000419160:T62K	T	-	2	0	C1orf227	211075930	0.001000	0.12720	0.001000	0.08648	0.009000	0.06853	0.613000	0.24299	1.089000	0.41292	0.650000	0.86243	ACA	C1orf227	-	NULL	ENSG00000185523		0.483	C1orf227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf227	HGNC	protein_coding	OTTHUMT00000089672.2	103	0.00	0	G			213009307	213009307	-1	no_errors	ENST00000332912	ensembl	human	known	69_37n	missense	71	18.39	16	SNP	0.001	T
CEP152	22995	genome.wustl.edu	37	15	49031351	49031351	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr15:49031351C>T	ENST00000380950.2	-	27	4415	c.4228G>A	c.(4228-4230)Gct>Act	p.A1410T	CEP152_ENST00000399334.3_Missense_Mutation_p.A1354T	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1410					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CTCTTGGGAGCTTGTTCGCAC	0.383																																						dbGAP											0													159.0	147.0	151.0					15																	49031351		1888	4117	6005	-	-	-	SO:0001583	missense	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4228G>A	15.37:g.49031351C>T	ENSP00000370337:p.Ala1410Thr		E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	NULL	p.A1410T	ENST00000380950.2	37	c.4228	CCDS58361.1	15	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786905	0.31593	.	.	ENSG00000103995	ENST00000399334	T	0.53206	0.63	5.11	0.91	0.19337	.	1.553650	0.04068	N	0.307573	T	0.29355	0.0731	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.17077	-1.0381	10	0.41790	T	0.15	0.0838	2.7467	0.05268	0.1322:0.461:0.2573:0.1495	.	1354	O94986	CE152_HUMAN	T	1354	ENSP00000382271:A1354T	ENSP00000382271:A1354T	A	-	1	0	CEP152	46818643	0.037000	0.19845	0.000000	0.03702	0.060000	0.15804	0.743000	0.26231	0.082000	0.17018	0.557000	0.71058	GCT	CEP152	-	NULL	ENSG00000103995		0.383	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1	170	0.00	0	C	NM_014985		49031351	49031351	-1	no_errors	ENST00000380950	ensembl	human	known	69_37n	missense	26	62.32	43	SNP	0.000	T
CRP	1401	genome.wustl.edu	37	1	159683855	159683855	+	Silent	SNP	C	C	A			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr1:159683855C>A	ENST00000255030.5	-	2	238	c.135G>T	c.(133-135)acG>acT	p.T45T	CRP_ENST00000368112.1_Silent_p.T45T|CRP_ENST00000437342.1_Intron|CRP_ENST00000343919.2_Silent_p.T45T|CRP_ENST00000368110.1_Silent_p.T45T|CRP_ENST00000368111.1_Silent_p.T45T|CRP_ENST00000473196.1_5'Flank	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	45	Pentaxin.				acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)	p.T45T(2)		breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	TGAGAGGCTTCGTTAACGGTG	0.478																																						dbGAP											2	Substitution - coding silent(2)	endometrium(1)|skin(1)											116.0	118.0	118.0					1																	159683855		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.135G>T	1.37:g.159683855C>A			A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	Silent	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.T45	ENST00000255030.5	37	c.135	CCDS30911.1	1																																																																																			CRP	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin	ENSG00000132693		0.478	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRP	HGNC	protein_coding	OTTHUMT00000085553.1	89	0.00	0	C	NM_000567		159683855	159683855	-1	no_errors	ENST00000255030	ensembl	human	known	69_37n	silent	49	15.52	9	SNP	0.000	A
DOPEY2	9980	genome.wustl.edu	37	21	37665770	37665770	+	Silent	SNP	A	A	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr21:37665770A>T	ENST00000399151.3	+	37	6883	c.6798A>T	c.(6796-6798)ggA>ggT	p.G2266G		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2266					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						ATAGCCCAGGAACTCCATTCT	0.438																																						dbGAP											0													98.0	91.0	93.0					21																	37665770		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6798A>T	21.37:g.37665770A>T			D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	NULL	p.E15V	ENST00000399151.3	37	c.44	CCDS13643.1	21																																																																																			DOPEY2	-	NULL	ENSG00000142197		0.438	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	85	0.00	0	A	NM_005128		37665770	37665770	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000414001	ensembl	human	known	69_37n	missense	13	53.33	16	SNP	0.000	T
EIF4E1B	253314	genome.wustl.edu	37	5	176070219	176070220	+	In_Frame_Ins	INS	-	-	CCG	rs372956251		TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr5:176070219_176070220insCCG	ENST00000318682.6	+	4	736_737	c.152_153insCCG	c.(151-156)acgggg>acCCGgggg	p.51_52TG>TRG	EIF4E1B_ENST00000504597.1_In_Frame_Ins_p.51_52TG>TRG	NM_001099408.1	NP_001092878.1	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E family member 1B	51					regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)	translation initiation factor activity (GO:0003743)	p.T51M(1)		breast(1)|large_intestine(1)|lung(2)|pancreas(1)	5	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGGCCCGGACGGGGGGCCCCA	0.614																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)																																								-	-	-	SO:0001652	inframe_insertion	0				CCDS47345.1	5q35.2	2008-06-12			ENSG00000175766	ENSG00000175766			33179	protein-coding gene	gene with protein product						16191198	Standard	NM_001099408		Approved	FLJ36951	uc010jkf.1	A6NMX2	OTTHUMG00000163227	Exception_encountered	5.37:g.176070219_176070220insCCG	ENSP00000323714:p.Thr51_Gly52insArg			In_Frame_Ins	INS	pfam_TIF_eIF_4E,superfamily_TIF_eIF4e-like_dom	p.52in_frame_insR	ENST00000318682.6	37	c.152_153	CCDS47345.1	5																																																																																			EIF4E1B	-	superfamily_TIF_eIF4e-like_dom	ENSG00000175766		0.614	EIF4E1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4E1B	HGNC	protein_coding	OTTHUMT00000372187.1	21	0.00	0	-	NM_001099408		176070219	176070220	+1	no_errors	ENST00000318682	ensembl	human	known	69_37n	in_frame_ins	6	33.33	3	INS	0.000:0.000	CCG
F8	2157	genome.wustl.edu	37	X	154088864	154088864	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chrX:154088864C>A	ENST00000360256.4	-	25	6943	c.6743G>T	c.(6742-6744)tGg>tTg	p.W2248L	F8_ENST00000330287.6_Missense_Mutation_p.W113L	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2248	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.		W -> C (in HEMA; moderate). {ECO:0000269|PubMed:10404764, ECO:0000269|PubMed:1301932, ECO:0000269|PubMed:9569189}.|W -> S (in HEMA; moderate). {ECO:0000269|PubMed:12614369}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CACTTGCAGCCACTCTTTTGG	0.443																																						dbGAP											0			GRCh37	CM032897	F8	M							110.0	95.0	100.0					X																	154088864		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6743G>T	X.37:g.154088864C>A	ENSP00000353393:p.Trp2248Leu		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.W2248L	ENST00000360256.4	37	c.6743	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	c	21.5	4.162694	0.78226	.	.	ENSG00000185010	ENST00000330287;ENST00000360256	D;D	0.98947	-5.26;-5.26	5.33	5.33	0.75918	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99504	0.9823	H	0.98559	4.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.97960	1.0337	10	0.87932	D	0	-7.2407	15.3953	0.74787	0.0:1.0:0.0:0.0	.	2248;113	P00451;Q14286	FA8_HUMAN;.	L	113;2248	ENSP00000327895:W113L;ENSP00000353393:W2248L	ENSP00000327895:W113L	W	-	2	0	F8	153742058	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.807000	0.69157	2.228000	0.72767	0.544000	0.68410	TGG	F8	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000185010		0.443	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	231	0.00	0	C			154088864	154088864	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	71	18.39	16	SNP	1.000	A
NUTM2G	441457	genome.wustl.edu	37	9	99698810	99698810	+	Silent	SNP	C	C	A			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr9:99698810C>A	ENST00000372322.3	+	4	967	c.946C>A	c.(946-948)Cga>Aga	p.R316R	HIATL2_ENST00000506067.1_Intron|NUTM2G_ENST00000354649.3_Silent_p.R316R	NM_001170741.1	NP_001164212.1	Q5VZR2	NTM2G_HUMAN	NUT family member 2G	316	Pro-rich.																GCTTGAACCTCGAGGACCCCC	0.627																																						dbGAP											0													5.0	8.0	7.0					9																	99698810		1600	3525	5125	-	-	-	SO:0001819	synonymous_variant	0				CCDS43854.1, CCDS55329.1	9q22.33	2013-05-02	2013-03-14	2013-05-02	ENSG00000188152	ENSG00000188152			23449	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member G"""	FAM22G			Standard	NM_001045477		Approved			Q5VZR2	OTTHUMG00000020305	ENST00000372322.3:c.946C>A	9.37:g.99698810C>A			A6NNI5|Q5VZR3	Silent	SNP	NULL	p.R316	ENST00000372322.3	37	c.946	CCDS55329.1	9																																																																																			FAM22G	-	NULL	ENSG00000188152		0.627	NUTM2G-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM22G	HGNC	protein_coding	OTTHUMT00000053291.2	16	0.00	0	C	NM_001170741		99698810	99698810	+1	no_errors	ENST00000372322	ensembl	human	known	69_37n	silent	9	52.63	10	SNP	0.009	A
TMEM255A	55026	genome.wustl.edu	37	X	119418990	119418990	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chrX:119418990G>T	ENST00000309720.5	-	7	699	c.576C>A	c.(574-576)aaC>aaA	p.N192K	TMEM255A_ENST00000371369.4_Missense_Mutation_p.N168K|TMEM255A_ENST00000440464.1_Intron|TMEM255A_ENST00000371352.1_Missense_Mutation_p.N28K	NM_017938.3	NP_060408.3	Q5JRV8	T255A_HUMAN	transmembrane protein 255A	192						integral component of membrane (GO:0016021)											ACTTGCCACAGTTGTAGAGGT	0.512																																						dbGAP											0													212.0	172.0	185.0					X																	119418990		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047054	CCDS14597.1, CCDS43986.1, CCDS48157.1	Xq24	2012-11-30	2012-11-30	2012-11-30	ENSG00000125355	ENSG00000125355			26086	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member A"""	FAM70A		12477932	Standard	NM_017938		Approved	FLJ20716	uc004eso.4	Q5JRV8	OTTHUMG00000022298	ENST00000309720.5:c.576C>A	X.37:g.119418990G>T	ENSP00000310110:p.Asn192Lys		A8K0W9|B1APR4|B3KPI6|E9PAR3|Q86Y72|Q9NWN8	Missense_Mutation	SNP	NULL	p.N192K	ENST00000309720.5	37	c.576	CCDS14597.1	X	.	.	.	.	.	.	.	.	.	.	g	21.9	4.218517	0.79464	.	.	ENSG00000125355	ENST00000309720;ENST00000371369;ENST00000371352	T;T;T	0.48836	0.8;0.8;0.8	5.0	5.0	0.66597	.	0.048341	0.85682	D	0.000000	T	0.63733	0.2536	M	0.76328	2.33	0.80722	D	1	P;D	0.71674	0.728;0.998	B;D	0.63793	0.219;0.918	T	0.67503	-0.5654	10	0.66056	D	0.02	-11.6856	10.1211	0.42621	0.0936:0.0:0.9064:0.0	.	168;192	B1APR4;Q5JRV8	.;FA70A_HUMAN	K	192;168;28	ENSP00000310110:N192K;ENSP00000360420:N168K;ENSP00000360403:N28K	ENSP00000310110:N192K	N	-	3	2	FAM70A	119303018	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.170000	0.64990	2.065000	0.61736	0.431000	0.28591	AAC	FAM70A	-	NULL	ENSG00000125355		0.512	TMEM255A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM70A	HGNC	protein_coding	OTTHUMT00000058091.1	86	0.00	0	G	NM_017938		119418990	119418990	-1	no_errors	ENST00000309720	ensembl	human	known	69_37n	missense	30	63.41	52	SNP	1.000	T
FLI1	2313	genome.wustl.edu	37	11	128680620	128680620	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr11:128680620G>A	ENST00000527786.2	+	9	1585	c.1096G>A	c.(1096-1098)Gcc>Acc	p.A366T	FLI1_ENST00000281428.8_Missense_Mutation_p.A300T|FLI1_ENST00000344954.6_Missense_Mutation_p.A333T|FLI1_ENST00000534087.2_Missense_Mutation_p.A333T|FLI1_ENST00000525560.1_Missense_Mutation_p.A173T	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	366					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		CCACGGCATTGCCCAGGCTCT	0.498			T	EWSR1	Ewing sarcoma																																	dbGAP		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	0													73.0	78.0	76.0					11																	128680620		2164	4277	6441	-	-	-	SO:0001583	missense	0			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.1096G>A	11.37:g.128680620G>A	ENSP00000433488:p.Ala366Thr		B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.A366T	ENST00000527786.2	37	c.1096	CCDS44768.1	11	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570996	0.86542	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49	5.34	5.34	0.76211	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.74966	0.3786	M	0.82323	2.585	0.80722	D	1	P;D;D	0.67145	0.866;0.996;0.958	P;D;P	0.65684	0.688;0.937;0.835	T	0.78393	-0.2221	10	0.87932	D	0	.	19.2344	0.93853	0.0:0.0:1.0:0.0	.	366;173;300	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	T	173;333;366;333;300	ENSP00000437124:A173T;ENSP00000339627:A333T;ENSP00000399985:A366T;ENSP00000432950:A333T;ENSP00000281428:A300T	ENSP00000281428:A300T	A	+	1	0	FLI1	128185830	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.730000	0.84881	2.776000	0.95493	0.650000	0.86243	GCC	FLI1	-	NULL	ENSG00000151702		0.498	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLI1	HGNC	protein_coding	OTTHUMT00000386226.2	69	0.00	0	G	NM_002017		128680620	128680620	+1	no_errors	ENST00000429175	ensembl	human	known	69_37n	missense	5	84.78	39	SNP	1.000	A
GGT3P	2679	genome.wustl.edu	37	22	18769678	18769678	+	RNA	SNP	G	G	A	rs3894040	byFrequency	TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr22:18769678G>A	ENST00000412448.1	-	0	1000							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										GCTCGATGACGGTCCGCTTGT	0.672																																						dbGAP											0																																										-	-	-			0					22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18769678G>A				RNA	SNP	-	NULL	ENST00000412448.1	37	NULL		22																																																																																			GGT3P	-	-	ENSG00000197421		0.672	GGT3P-002	KNOWN	basic	processed_transcript	GGT3P	HGNC	pseudogene	OTTHUMT00000341281.1	76	0.00	0	G	NR_003267		18769678	18769678	-1	no_errors	ENST00000412448	ensembl	human	known	69_37n	rna	9	25.00	3	SNP	0.000	A
HRNR	388697	genome.wustl.edu	37	1	152188526	152188526	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr1:152188526C>T	ENST00000368801.2	-	3	5654	c.5579G>A	c.(5578-5580)cGa>cAa	p.R1860Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1860					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACCCATGTCGGCCACTGCT	0.597																																						dbGAP											0													237.0	393.0	341.0					1																	152188526		2167	4294	6461	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5579G>A	1.37:g.152188526C>T	ENSP00000357791:p.Arg1860Gln		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.R1860Q	ENST00000368801.2	37	c.5579	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031180	0.19590	.	.	ENSG00000197915	ENST00000368801	T	0.02944	4.1	4.14	-0.967	0.10316	.	.	.	.	.	T	0.00608	0.0020	L	0.33189	0.99	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.45440	-0.9261	9	0.13108	T	0.6	.	5.5185	0.16919	0.0:0.4459:0.2277:0.3265	.	1860	Q86YZ3	HORN_HUMAN	Q	1860	ENSP00000357791:R1860Q	ENSP00000357791:R1860Q	R	-	2	0	HRNR	150455150	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.974000	0.01499	-0.396000	0.07703	-3.426000	0.00037	CGA	HRNR	-	NULL	ENSG00000197915		0.597	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	96	0.00	0	C	XM_373868		152188526	152188526	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	359	14.11	59	SNP	0.000	T
HS3ST2	9956	genome.wustl.edu	37	16	22926374	22926374	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr16:22926374A>G	ENST00000261374.3	+	2	1029	c.595A>G	c.(595-597)Aag>Gag	p.K199E		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	199					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		CCGAGACACCAAGCTGATCGT	0.582																																						dbGAP											0													127.0	113.0	118.0					16																	22926374		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.595A>G	16.37:g.22926374A>G	ENSP00000261374:p.Lys199Glu		Q52LZ1	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.K199E	ENST00000261374.3	37	c.595	CCDS10606.1	16	.	.	.	.	.	.	.	.	.	.	A	22.6	4.305312	0.81247	.	.	ENSG00000122254	ENST00000261374;ENST00000540146	T	0.65178	-0.14	5.25	5.25	0.73442	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.86418	0.5928	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.91344	0.5099	10	0.87932	D	0	.	14.3773	0.66886	1.0:0.0:0.0:0.0	.	199	Q9Y278	HS3S2_HUMAN	E	199;207	ENSP00000261374:K199E	ENSP00000261374:K199E	K	+	1	0	HS3ST2	22833875	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.306000	0.78905	1.999000	0.58509	0.459000	0.35465	AAG	HS3ST2	-	pfam_Sulfotransferase_dom	ENSG00000122254		0.582	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST2	HGNC	protein_coding	OTTHUMT00000211598.1	107	0.00	0	A	NM_006043		22926374	22926374	+1	no_errors	ENST00000261374	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	G
KIAA2026	158358	genome.wustl.edu	37	9	5921685	5921685	+	Silent	SNP	A	A	G			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr9:5921685A>G	ENST00000399933.3	-	8	4310	c.4311T>C	c.(4309-4311)acT>acC	p.T1437T	KIAA2026_ENST00000381461.2_Silent_p.T1407T	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1437										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		GTTGCTGTTTAGTTGGAGTAT	0.368																																						dbGAP											0													189.0	175.0	179.0					9																	5921685		1910	4121	6031	-	-	-	SO:0001819	synonymous_variant	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.4311T>C	9.37:g.5921685A>G			A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	superfamily_Bromodomain	p.T1437	ENST00000399933.3	37	c.4311		9																																																																																			KIAA2026	-	NULL	ENSG00000183354		0.368	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	303	0.00	0	A	NM_001017969		5921685	5921685	-1	no_errors	ENST00000399933	ensembl	human	novel	69_37n	silent	136	20.23	35	SNP	0.979	G
MAGEC2	51438	genome.wustl.edu	37	X	141291556	141291556	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chrX:141291556G>C	ENST00000247452.3	-	3	565	c.218C>G	c.(217-219)tCt>tGt	p.S73C		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	73					cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					TATCACACCAGAGGGCACCTC	0.537										HNSCC(46;0.14)																												dbGAP											0													75.0	70.0	72.0					X																	141291556		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.218C>G	X.37:g.141291556G>C	ENSP00000354660:p.Ser73Cys		Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.S73C	ENST00000247452.3	37	c.218	CCDS14678.1	X	.	.	.	.	.	.	.	.	.	.	-	10.51	1.371731	0.24857	.	.	ENSG00000046774	ENST00000247452	T	0.06142	3.34	0.896	0.896	0.19253	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.06917	0.0176	N	0.19112	0.55	0.09310	N	1	D	0.67145	0.996	P	0.51055	0.657	T	0.38112	-0.9676	8	0.62326	D	0.03	.	.	.	.	.	73	Q9UBF1	MAGC2_HUMAN	C	73	ENSP00000354660:S73C	ENSP00000354660:S73C	S	-	2	0	MAGEC2	141119222	0.002000	0.14202	0.003000	0.11579	0.002000	0.02628	0.685000	0.25378	0.707000	0.31934	0.411000	0.27672	TCT	MAGEC2	-	pfam_Melanoma_ass_antigen_N	ENSG00000046774		0.537	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEC2	HGNC	protein_coding	OTTHUMT00000058611.1	155	0.00	0	G	NM_016249		141291556	141291556	-1	no_errors	ENST00000247452	ensembl	human	known	69_37n	missense	53	26.39	19	SNP	0.003	C
DPY19L1	23333	genome.wustl.edu	37	7	34980439	34980439	+	Intron	SNP	A	A	C			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr7:34980439A>C	ENST00000310974.4	-	19	1615				MIR548N_ENST00000408742.1_RNA	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)							integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						ttacttttgcaccaacctaTA	0.438																																						dbGAP											0													29.0	34.0	33.0					7																	34980439		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.1471-500T>G	7.37:g.34980439A>C			O94954|Q4G151	RNA	SNP	-	NULL	ENST00000310974.4	37	NULL	CCDS43567.1	7																																																																																			MIR548N	-	-	ENSG00000221669		0.438	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR548N	HGNC	protein_coding	OTTHUMT00000337506.1	39	0.00	0	A			34980439	34980439	-1	no_errors	ENST00000408742	ensembl	human	known	69_37n	rna	15	31.82	7	SNP	0.002	C
MUC5B	727897	genome.wustl.edu	37	11	1266537	1266537	+	Silent	SNP	G	G	T	rs199659189	byFrequency	TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr11:1266537G>T	ENST00000529681.1	+	31	8485	c.8427G>T	c.(8425-8427)ctG>ctT	p.L2809L	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.L2812L	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2809	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTCCAGCCCTGTCCAGCCCTC	0.682													-|||	290	0.0579073	0.0401	0.1167	5008	,	,		17295	0.0387		0.0706	False		,,,				2504	0.047					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8427G>T	11.37:g.1266537G>T			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.L2812	ENST00000529681.1	37	c.8436	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	11	0.00	0	G	XM_001126093		1266537	1266537	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	3	57.14	4	SNP	0.000	T
PLCH1	23007	genome.wustl.edu	37	3	155201158	155201158	+	Intron	SNP	G	G	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr3:155201158G>T	ENST00000340059.7	-	23	2998				PLCH1_ENST00000447496.2_Silent_p.I1002I|PLCH1_ENST00000334686.6_Intron|PLCH1-AS2_ENST00000472913.1_RNA|PLCH1_ENST00000460012.1_Intron|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000414191.1_Intron	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1						inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTCCTATTCAGATTTGTACTA	0.333																																						dbGAP											0													156.0	135.0	141.0					3																	155201158		692	1586	2278	-	-	-	SO:0001627	intron_variant	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.2999-318C>A	3.37:g.155201158G>T			Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.I1002	ENST00000340059.7	37	c.3006	CCDS46939.1	3																																																																																			PLCH1	-	NULL	ENSG00000114805		0.333	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	75	0.00	0	G	NM_014996		155201158	155201158	-1	no_errors	ENST00000447496	ensembl	human	known	69_37n	silent	69	18.82	16	SNP	1.000	T
RALBP1	10928	genome.wustl.edu	37	18	9525780	9525780	+	Missense_Mutation	SNP	A	A	C			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr18:9525780A>C	ENST00000019317.4	+	6	1501	c.1278A>C	c.(1276-1278)gaA>gaC	p.E426D	RALBP1_ENST00000383432.3_Missense_Mutation_p.E426D			Q15311	RBP1_HUMAN	ralA binding protein 1	426	Interacts with RalA.				ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	TGTCTAAAGAAGAAAGATTAT	0.348																																						dbGAP											0													143.0	141.0	142.0					18																	9525780		2203	4300	6503	-	-	-	SO:0001583	missense	0			L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1278A>C	18.37:g.9525780A>C	ENSP00000019317:p.Glu426Asp		D3DUI0	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E426D	ENST00000019317.4	37	c.1278	CCDS11845.1	18	.	.	.	.	.	.	.	.	.	.	A	19.49	3.836994	0.71373	.	.	ENSG00000017797	ENST00000019317;ENST00000383432	T;T	0.15372	2.43;2.43	5.11	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.17619	0.0423	L	0.53729	1.69	0.80722	D	1	P	0.49559	0.925	B	0.41723	0.365	T	0.01643	-1.1305	10	0.46703	T	0.11	-5.4248	10.8203	0.46601	0.9253:0.0:0.0747:0.0	.	426	Q15311	RBP1_HUMAN	D	426	ENSP00000019317:E426D;ENSP00000372924:E426D	ENSP00000019317:E426D	E	+	3	2	RALBP1	9515780	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.051000	0.64257	0.898000	0.36418	0.533000	0.62120	GAA	RALBP1	-	NULL	ENSG00000017797		0.348	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALBP1	HGNC	protein_coding	OTTHUMT00000254479.1	173	0.00	0	A	NM_006788		9525780	9525780	+1	no_errors	ENST00000019317	ensembl	human	known	69_37n	missense	96	32.17	46	SNP	1.000	C
SEC16A	9919	genome.wustl.edu	37	9	139369234	139369234	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr9:139369234C>T	ENST00000371706.3	-	1	2333	c.2300G>A	c.(2299-2301)cGt>cAt	p.R767H	SEC16A_ENST00000290037.6_Missense_Mutation_p.R767H|SEC16A_ENST00000313050.7_Missense_Mutation_p.R945H|SEC16A_ENST00000431893.2_Missense_Mutation_p.R767H			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	767					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TCCTGCCTTACGATCCTTTTG	0.512																																						dbGAP											0													88.0	87.0	88.0					9																	139369234		1916	4127	6043	-	-	-	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2300G>A	9.37:g.139369234C>T	ENSP00000360771:p.Arg767His		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.R945H	ENST00000371706.3	37	c.2834		9	.	.	.	.	.	.	.	.	.	.	C	9.136	1.012597	0.19277	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.38	-6.21	0.02065	.	1.577220	0.03640	N	0.239339	T	0.05364	0.0142	N	0.00926	-1.1	0.09310	N	0.999998	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.01281	0.0;0.0;0.0	T	0.28490	-1.0042	10	0.12766	T	0.61	-8.0886	5.0283	0.14396	0.1017:0.2343:0.4893:0.1747	.	945;767;767	F1T0I1;O15027-5;O15027-4	.;.;.	H	945;767;767;767	ENSP00000325827:R945H;ENSP00000360771:R767H;ENSP00000290037:R767H;ENSP00000387583:R767H	ENSP00000290037:R767H	R	-	2	0	SEC16A	138489055	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.965000	0.03829	-1.440000	0.01960	-1.242000	0.01536	CGT	SEC16A	-	NULL	ENSG00000148396		0.512	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	10	0.00	0	C	XM_088459		139369234	139369234	-1	no_errors	ENST00000313050	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.000	T
SEPP1	6414	genome.wustl.edu	37	5	42808360	42808361	+	Frame_Shift_Ins	INS	-	-	TACA			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr5:42808360_42808361insTACA	ENST00000514985.1	-	2	351_352	c.95_96insTGTA	c.(94-96)ccafs	p.-32fs	SEPP1_ENST00000511224.1_Frame_Shift_Ins_p.-32fs|SEPP1_ENST00000509276.1_5'UTR|SEPP1_ENST00000506577.1_Frame_Shift_Ins_p.-32fs|CTD-2325A15.5_ENST00000606056.1_RNA|SEPP1_ENST00000507920.1_Frame_Shift_Ins_p.-32fs	NM_005410.2	NP_005401.3	P49908	SEPP1_HUMAN	selenoprotein P, plasma, 1						brain development (GO:0007420)|growth (GO:0040007)|locomotory behavior (GO:0007626)|post-embryonic development (GO:0009791)|response to oxidative stress (GO:0006979)|selenium compound metabolic process (GO:0001887)|sexual reproduction (GO:0019953)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	selenium binding (GO:0008430)			kidney(10)|large_intestine(1)|lung(4)	15						TGCTCCAGGCTGGGGGTTGCTT	0.535																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC040075	CCDS43311.1	5q31	2012-03-01				ENSG00000250722			10751	protein-coding gene	gene with protein product		601484				8421687	Standard	NM_001085486		Approved	SeP	uc011cpu.2	P49908		ENST00000514985.1:c.95_96insTGTA	5.37:g.42808360_42808361insTACA	ENSP00000420939:p.Pro32fs		Q6PD59|Q6PI43|Q6PI87|Q6PJF9	Frame_Shift_Ins	INS	pfam_Selenoprotein-P_N,pfam_SelP_C	p.A33fs	ENST00000514985.1	37	c.96_95	CCDS43311.1	5																																																																																			SEPP1	-	pfam_Selenoprotein-P_N	ENSG00000250722		0.535	SEPP1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	SEPP1	HGNC	protein_coding	OTTHUMT00000367483.1	71	0.00	0	-	NM_005410		42808360	42808361	-1	pseudogene	ENST00000506577	ensembl	human	known	69_37n	frame_shift_ins	23	11.54	3	INS	0.491:0.988	TACA
VCAM1	7412	genome.wustl.edu	37	1	101190339	101190339	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr1:101190339C>A	ENST00000294728.2	+	4	922	c.821C>A	c.(820-822)gCa>gAa	p.A274E	VCAM1_ENST00000370115.1_Missense_Mutation_p.A274E|VCAM1_ENST00000347652.2_Missense_Mutation_p.A274E|VCAM1_ENST00000370119.4_Missense_Mutation_p.A212E	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	274	Ig-like C2-type 3.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	TCTGGAAATGCAACTCTCACC	0.398																																						dbGAP											0													91.0	88.0	89.0					1																	101190339		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.821C>A	1.37:g.101190339C>A	ENSP00000294728:p.Ala274Glu		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like,prints_VCAM-1,prints_ICAM_VCAM_N	p.A274E	ENST00000294728.2	37	c.821	CCDS773.1	1	.	.	.	.	.	.	.	.	.	.	c	19.46	3.832538	0.71258	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728;ENST00000370115	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.38	4.46	0.54185	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.556492	0.20149	N	0.098209	T	0.15176	0.0366	L	0.39514	1.22	0.22330	N	0.999199	D;D;D	0.89917	0.988;1.0;0.999	D;D;D	0.91635	0.93;0.999;0.991	T	0.05273	-1.0895	10	0.52906	T	0.07	-8.4359	11.7094	0.51616	0.177:0.823:0.0:0.0	.	212;274;274	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	E	212;274;274;274	ENSP00000359137:A212E;ENSP00000304611:A274E;ENSP00000294728:A274E;ENSP00000359133:A274E	ENSP00000294728:A274E	A	+	2	0	VCAM1	100962927	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	2.732000	0.47352	1.388000	0.46506	0.651000	0.88453	GCA	VCAM1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like,prints_VCAM-1	ENSG00000162692		0.398	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCAM1	HGNC	protein_coding	OTTHUMT00000030213.1	162	0.00	0	C	NM_001078		101190339	101190339	+1	no_errors	ENST00000294728	ensembl	human	known	69_37n	missense	86	17.31	18	SNP	1.000	A
ZXDC	79364	genome.wustl.edu	37	3	126160731	126160731	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A1KC-01B-11D-A159-09	TCGA-B6-A1KC-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fc3e822f-150d-47a7-a346-10919b42aa8c	1fd8eddb-6c79-4a27-917a-f710225a589d	g.chr3:126160731G>C	ENST00000389709.3	-	8	2324	c.2271C>G	c.(2269-2271)ttC>ttG	p.F757L		NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	757					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		GGCTTGCATGGAAATGGGGAG	0.527																																						dbGAP											0													67.0	68.0	67.0					3																	126160731		1948	4153	6101	-	-	-	SO:0001583	missense	0			AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.2271C>G	3.37:g.126160731G>C	ENSP00000374359:p.Phe757Leu		C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F757L	ENST00000389709.3	37	c.2271	CCDS43145.1	3	.	.	.	.	.	.	.	.	.	.	G	0.554	-0.847987	0.02651	.	.	ENSG00000070476	ENST00000389709	T	0.09163	3.01	5.08	0.977	0.19733	.	1.886340	0.02459	N	0.086379	T	0.07818	0.0196	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40905	-0.9538	10	0.06365	T	0.9	2.2598	15.1265	0.72486	0.0:0.6303:0.3697:0.0	.	757	Q2QGD7	ZXDC_HUMAN	L	757	ENSP00000374359:F757L	ENSP00000374359:F757L	F	-	3	2	ZXDC	127643421	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.272000	0.08560	-0.123000	0.11745	-0.282000	0.10007	TTC	ZXDC	-	NULL	ENSG00000070476		0.527	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZXDC	HGNC	protein_coding	OTTHUMT00000370327.2	23	0.00	0	G	NM_025112		126160731	126160731	-1	no_errors	ENST00000389709	ensembl	human	known	69_37n	missense	15	54.55	18	SNP	0.000	C
