#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABI3BP	25890	genome.wustl.edu	37	3	100515255	100515255	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr3:100515255G>A	ENST00000284322.5	-	21	1914	c.1805C>T	c.(1804-1806)cCt>cTt	p.P602L	ABI3BP_ENST00000383691.4_Missense_Mutation_p.P556L|ABI3BP_ENST00000471714.1_Missense_Mutation_p.P1279L	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	602	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TAATTTACCAGGTTCGCTCTG	0.313																																						dbGAP											0													65.0	61.0	62.0					3																	100515255		1793	4065	5858	-	-	-	SO:0001583	missense	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1805C>T	3.37:g.100515255G>A	ENSP00000284322:p.Pro602Leu		B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P602L	ENST00000284322.5	37	c.1805	CCDS46880.1	3	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751950	0.69533	.	.	ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000383692;ENST00000383691;ENST00000486770	T;T;T	0.57595	2.11;0.39;1.49	5.49	4.6	0.57074	.	0.341793	0.26875	N	0.022052	T	0.61400	0.2344	L	0.50333	1.59	0.39801	D	0.972571	D;D;D;D	0.63880	0.993;0.972;0.979;0.989	P;P;P;P	0.58520	0.84;0.476;0.758;0.67	T	0.65717	-0.6100	10	0.66056	D	0.02	-6.7762	12.209	0.54369	0.0:0.1716:0.8284:0.0	.	556;602;1279;286	B4DSV9;Q7Z7G0;D3YTG3;D3YTD6	.;TARSH_HUMAN;.;.	L	1279;602;286;556;40	ENSP00000420524:P1279L;ENSP00000284322:P602L;ENSP00000373189:P556L	ENSP00000284322:P602L	P	-	2	0	ABI3BP	101997945	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.249000	0.51437	1.273000	0.44346	0.585000	0.79938	CCT	ABI3BP	-	NULL	ENSG00000154175		0.313	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	62	0.00	0	G			100515255	100515255	-1	no_errors	ENST00000284322	ensembl	human	known	69_37n	missense	65	39.81	43	SNP	1.000	A
ARHGEF2	9181	genome.wustl.edu	37	1	155921720	155921720	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr1:155921720G>C	ENST00000361247.4	-	17	2261	c.2162C>G	c.(2161-2163)tCt>tGt	p.S721C	ARHGEF2_ENST00000462460.2_Missense_Mutation_p.S766C|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.S693C|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.S720C|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.S693C|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.S722C	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	721					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCTCTGGCTAGAGTCTGAGTC	0.557																																					Melanoma(178;35 2768 6610 28839)	dbGAP											0													58.0	58.0	58.0					1																	155921720		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.2162C>G	1.37:g.155921720G>C	ENSP00000354837:p.Ser721Cys		D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.S722C	ENST00000361247.4	37	c.2165	CCDS53376.1	1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.800380	0.50315	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.67698	-0.28;-0.16;-0.16;-0.28;-0.28	5.13	5.13	0.70059	.	0.000000	0.42420	D	0.000709	T	0.67776	0.2929	L	0.61218	1.895	0.32582	N	0.528354	P;D;B	0.61080	0.613;0.989;0.216	B;P;B	0.55965	0.179;0.788;0.112	T	0.71639	-0.4532	10	0.72032	D	0.01	-25.8885	13.9541	0.64137	0.0:0.0:1.0:0.0	.	765;721;720	D3DVA5;Q92974;Q92974-2	.;ARHG2_HUMAN;.	C	693;721;722;693;720	ENSP00000315325:S693C;ENSP00000354837:S721C;ENSP00000357298:S722C;ENSP00000357299:S693C;ENSP00000314787:S720C	ENSP00000314787:S720C	S	-	2	0	ARHGEF2	154188344	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	3.783000	0.55409	2.655000	0.90218	0.655000	0.94253	TCT	ARHGEF2	-	NULL	ENSG00000116584		0.557	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	38	0.00	0	G	NM_004723		155921720	155921720	-1	no_errors	ENST00000368315	ensembl	human	known	69_37n	missense	255	29.95	109	SNP	1.000	C
ARHGEF40	55701	genome.wustl.edu	37	14	21552965	21552965	+	Silent	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr14:21552965C>T	ENST00000298694.4	+	18	3970	c.3843C>T	c.(3841-3843)atC>atT	p.I1281I	ARHGEF40_ENST00000298693.3_Silent_p.I1281I			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	1281	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TCACTGTCATCTGTGGCCGAA	0.522																																						dbGAP											0													150.0	137.0	142.0					14																	21552965		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.3843C>T	14.37:g.21552965C>T			A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.I1281	ENST00000298694.4	37	c.3843	CCDS32041.1	14																																																																																			ARHGEF40	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000165801		0.522	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	HGNC	protein_coding	OTTHUMT00000413122.1	19	0.00	0	C			21552965	21552965	+1	no_errors	ENST00000298694	ensembl	human	known	69_37n	silent	56	44.00	44	SNP	1.000	T
ARHGEF5	7984	genome.wustl.edu	37	7	144062632	144062632	+	Nonsense_Mutation	SNP	C	C	G	rs202036368		TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr7:144062632C>G	ENST00000056217.5	+	2	3044	c.2870C>G	c.(2869-2871)tCa>tGa	p.S957*	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	957					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GCAGGGGTCTCAGAACACCCT	0.597																																						dbGAP											0													2.0	2.0	2.0					7																	144062632		723	1763	2486	-	-	-	SO:0001587	stop_gained	0			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.2870C>G	7.37:g.144062632C>G	ENSP00000056217:p.Ser957*		A6NNJ2|Q6ZML7	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.S957*	ENST00000056217.5	37	c.2870	CCDS34771.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.577225|6.577225	0.97676|0.97676	.|.	.|.	ENSG00000050327|ENSG00000050327	ENST00000474817|ENST00000056217	.|.	.|.	.|.	4.06|4.06	2.22|2.22	0.28083|0.28083	.|.	.|0.258318	.|0.20430	.|N	.|0.092497	T|.	0.37237|.	0.0996|.	.|.	.|.	.|.	0.21020|0.21020	N|N	0.99981|0.99981	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.20940|.	-1.0260|.	4|.	.|0.48119	.|T	.|0.1	-0.0888|-0.0888	6.3968|6.3968	0.21616|0.21616	0.0:0.7685:0.0:0.2315|0.0:0.7685:0.0:0.2315	.|.	.|.	.|.	.|.	E|X	211|957	.|.	.|ENSP00000056217:S957X	Q|S	+|+	1|2	0|0	ARHGEF5|ARHGEF5	143693565|143693565	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.014000|0.014000	0.08584|0.08584	0.795000|0.795000	0.26972|0.26972	0.369000|0.369000	0.24510|0.24510	0.555000|0.555000	0.69702|0.69702	CAG|TCA	ARHGEF5	-	NULL	ENSG00000050327		0.597	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	8	0.00	0	C	NM_005435		144062632	144062632	+1	no_errors	ENST00000056217	ensembl	human	known	69_37n	nonsense	1	66.67	2	SNP	0.005	G
ARRDC3	57561	genome.wustl.edu	37	5	90670942	90670943	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr5:90670942_90670943insCA	ENST00000265138.3	-	5	932_933	c.666_667insTG	c.(664-669)gtggtgfs	p.V223fs	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	223					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		GCCTTTGGCACCACCATTCGGG	0.406																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.665_666dupTG	5.37:g.90670943_90670944dupCA	ENSP00000265138:p.Val223fs		A8K6T8|Q9P2H1	Frame_Shift_Ins	INS	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.V222fs	ENST00000265138.3	37	c.667_666	CCDS34202.1	5																																																																																			ARRDC3	-	pfam_Arrestin_C-like,superfamily_Ig_E-set	ENSG00000113369		0.406	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC3	HGNC	protein_coding	OTTHUMT00000369763.2	29	0.00	0	-	NM_020801		90670942	90670943	-1	no_errors	ENST00000265138	ensembl	human	known	69_37n	frame_shift_ins	15	75.41	46	INS	1.000:1.000	CA
BAZ2B	29994	genome.wustl.edu	37	2	160335202	160335202	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr2:160335202G>A	ENST00000392783.2	-	3	524	c.29C>T	c.(28-30)tCa>tTa	p.S10L	BAZ2B_ENST00000483316.1_5'UTR|BAZ2B_ENST00000392782.1_Missense_Mutation_p.S10L|BAZ2B_ENST00000355831.2_Missense_Mutation_p.S10L|BAZ2B_ENST00000343439.5_Missense_Mutation_p.S10L	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	10					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GGAGGCTGCTGAGGATGGTAA	0.398																																						dbGAP											0													139.0	135.0	136.0					2																	160335202		1927	4131	6058	-	-	-	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.29C>T	2.37:g.160335202G>A	ENSP00000376534:p.Ser10Leu		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.S10L	ENST00000392783.2	37	c.29	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692573	0.68271	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335;ENST00000541068;ENST00000437839	T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36	5.78	5.78	0.91487	.	0.000000	0.27100	U	0.020935	T	0.39462	0.1079	L	0.51422	1.61	0.41988	D	0.990837	B;P;B;B;B	0.38827	0.288;0.649;0.419;0.137;0.084	B;B;B;B;B	0.38428	0.202;0.273;0.202;0.133;0.063	T	0.33471	-0.9867	10	0.87932	D	0	-7.1871	19.1458	0.93467	0.0:0.0:1.0:0.0	.	10;10;10;10;10	Q6MZK7;F5H6H2;Q9UIF8-3;Q9UIF8-5;Q9UIF8	.;.;.;.;BAZ2B_HUMAN	L	10	ENSP00000376533:S10L;ENSP00000376534:S10L;ENSP00000348087:S10L;ENSP00000339670:S10L;ENSP00000441341:S10L;ENSP00000415613:S10L	ENSP00000339670:S10L	S	-	2	0	BAZ2B	160043448	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.595000	0.74109	2.894000	0.99253	0.591000	0.81541	TCA	BAZ2B	-	NULL	ENSG00000123636		0.398	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	95	0.00	0	G			160335202	160335202	-1	no_errors	ENST00000392783	ensembl	human	known	69_37n	missense	102	20.93	27	SNP	1.000	A
C16orf93	90835	genome.wustl.edu	37	16	30768802	30768802	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr16:30768802T>C	ENST00000543610.1	-	9	1952	c.991A>G	c.(991-993)Aag>Gag	p.K331E	PHKG2_ENST00000424889.3_Intron|PHKG2_ENST00000563588.1_3'UTR|C16orf93_ENST00000541260.1_Missense_Mutation_p.K396E	NM_001014979.2	NP_001014979.2	A1A4V9	CP093_HUMAN	chromosome 16 open reading frame 93	331										breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)	11						GGGGGTCACTTGGTCTTGCTC	0.587																																						dbGAP											0													214.0	220.0	218.0					16																	30768802		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC042548	CCDS32434.1, CCDS32434.2, CCDS55993.1	16p11.2	2012-10-10			ENSG00000196118	ENSG00000196118			28078	protein-coding gene	gene with protein product							Standard	NM_001195620		Approved	MGC104706	uc002dzm.3	A1A4V9	OTTHUMG00000167926	ENST00000543610.1:c.991A>G	16.37:g.30768802T>C	ENSP00000437532:p.Lys331Glu		A1A4V8|F5GX13|Q569G2	Missense_Mutation	SNP	NULL	p.K331E	ENST00000543610.1	37	c.991	CCDS32434.2	16	.	.	.	.	.	.	.	.	.	.	T	19.17	3.775455	0.70107	.	.	ENSG00000196118	ENST00000354963;ENST00000543610	.	.	.	5.87	4.77	0.60923	.	0.000000	0.56097	D	0.000022	T	0.64000	0.2559	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.83275	0.996;0.996;0.996	T	0.65664	-0.6113	9	0.87932	D	0	.	9.4648	0.38806	0.1573:0.0:0.0:0.8427	.	294;103;331	A1A4V9-2;A1A4V9-3;A1A4V9	.;.;CP093_HUMAN	E	294;331	.	ENSP00000347050:K294E	K	-	1	0	C16orf93	30676303	1.000000	0.71417	0.993000	0.49108	0.762000	0.43233	2.679000	0.46909	1.027000	0.39758	0.533000	0.62120	AAG	C16orf93	-	NULL	ENSG00000196118		0.587	C16orf93-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf93	HGNC	protein_coding	OTTHUMT00000397089.1	46	0.00	0	T	NM_001014979		30768802	30768802	-1	no_errors	ENST00000543610	ensembl	human	known	69_37n	missense	166	20.57	43	SNP	1.000	C
C19orf66	55337	genome.wustl.edu	37	19	10200684	10200684	+	Silent	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr19:10200684C>T	ENST00000253110.11	+	5	643	c.345C>T	c.(343-345)tgC>tgT	p.C115C	C19orf66_ENST00000397881.3_Silent_p.C64C|C19orf66_ENST00000591813.1_Silent_p.C115C|CTD-2240E14.4_ENST00000589622.1_RNA	NM_018381.2	NP_060851.2	Q9NUL5	CS066_HUMAN	chromosome 19 open reading frame 66	115										large_intestine(3)|skin(1)	4						GCTCCTCCTGCGACCACGTCT	0.592																																						dbGAP											0													41.0	43.0	43.0					19																	10200684		2154	4258	6412	-	-	-	SO:0001819	synonymous_variant	0				CCDS45957.1	19p13.2	2012-10-26			ENSG00000130813	ENSG00000130813			25649	protein-coding gene	gene with protein product						12477932	Standard	NM_018381		Approved	FLJ11286	uc002mmu.4	Q9NUL5		ENST00000253110.11:c.345C>T	19.37:g.10200684C>T			A8MQT9|Q4G188|Q8IYH6|Q8N8V1	Missense_Mutation	SNP	NULL	p.A40V	ENST00000253110.11	37	c.119	CCDS45957.1	19																																																																																			C19orf66	-	NULL	ENSG00000130813		0.592	C19orf66-001	KNOWN	basic|CCDS	protein_coding	C19orf66	HGNC	protein_coding	OTTHUMT00000451129.1	71	0.00	0	C	NM_018381		10200684	10200684	+1	no_start_codon	ENST00000593131	ensembl	human	putative	69_37n	missense	33	43.10	25	SNP	0.928	T
CFAP61	26074	genome.wustl.edu	37	20	20051511	20051511	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr20:20051511C>T	ENST00000245957.5	+	3	233	c.157C>T	c.(157-159)Ctt>Ttt	p.L53F	C20orf26_ENST00000377306.1_Missense_Mutation_p.L53F|C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000451767.2_Missense_Mutation_p.L53F	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		53										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		AAAGGCCAACCTTGCTGTTAC	0.473																																						dbGAP											0													88.0	74.0	79.0					20																	20051511		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000245957.5:c.157C>T	20.37:g.20051511C>T	ENSP00000245957:p.Leu53Phe		A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.L53F	ENST00000245957.5	37	c.157	CCDS33447.1	20	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642648	0.47153	.	.	ENSG00000089101	ENST00000340348;ENST00000343997;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000377303;ENST00000475466;ENST00000451767	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	5.72	5.72	0.89469	.	0.081471	0.52532	D	0.000070	T	0.57242	0.2040	L	0.45051	1.395	0.80722	D	1	D;D;D;D	0.89917	1.0;0.991;0.989;1.0	D;P;P;D	0.91635	0.999;0.802;0.766;0.999	T	0.55496	-0.8132	10	0.54805	T	0.06	.	15.3966	0.74798	0.0:1.0:0.0:0.0	.	53;53;7;53	Q8NHU2-3;F8W6K4;F8W6E2;Q8NHU2	.;.;.;CT026_HUMAN	F	7;53;53;53;53;53;53;53	ENSP00000345553:L7F;ENSP00000245957:L53F;ENSP00000366521:L53F;ENSP00000366518:L53F;ENSP00000417086:L53F;ENSP00000414537:L53F	ENSP00000245957:L53F	L	+	1	0	C20orf26	19999511	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	3.240000	0.51368	2.717000	0.92951	0.655000	0.94253	CTT	C20orf26	-	NULL	ENSG00000089101		0.473	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	47	0.00	0	C			20051511	20051511	+1	no_errors	ENST00000245957	ensembl	human	known	69_37n	missense	68	22.73	20	SNP	1.000	T
RTFDC1	51507	genome.wustl.edu	37	20	55092227	55092227	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr20:55092227A>G	ENST00000023939.4	+	8	819	c.712A>G	c.(712-714)Aag>Gag	p.K238E	GCNT7_ENST00000243913.4_Intron|RTFDC1_ENST00000357348.5_Missense_Mutation_p.K268E|RTFDC1_ENST00000395881.3_Silent_p.R219R	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1	238																	TTCTAGAGAGAAGAAAACCAA	0.488																																						dbGAP											0													46.0	43.0	44.0					20																	55092227		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.712A>G	20.37:g.55092227A>G	ENSP00000023939:p.Lys238Glu		E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	Missense_Mutation	SNP	NULL	p.K268E	ENST00000023939.4	37	c.802	CCDS13453.1	20	.	.	.	.	.	.	.	.	.	.	A	13.62	2.290325	0.40494	.	.	ENSG00000022277	ENST00000023939;ENST00000357348;ENST00000449062	T;T;T	0.34275	1.41;1.37;1.49	5.55	5.55	0.83447	.	0.742820	0.13832	N	0.359679	T	0.24314	0.0589	N	0.19112	0.55	0.80722	D	1	B;B;B	0.31351	0.16;0.32;0.03	B;B;B	0.30716	0.026;0.119;0.011	T	0.05419	-1.0886	10	0.11485	T	0.65	-23.3854	13.6509	0.62310	1.0:0.0:0.0:0.0	.	268;238;238	A8MSH5;B2RB99;Q9BY42	.;.;CT043_HUMAN	E	238;268;268	ENSP00000023939:K238E;ENSP00000349906:K268E;ENSP00000400322:K268E	ENSP00000023939:K238E	K	+	1	0	C20orf43	54525634	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.147000	0.64851	2.111000	0.64477	0.533000	0.62120	AAG	C20orf43	-	NULL	ENSG00000022277		0.488	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf43	HGNC	protein_coding	OTTHUMT00000079817.2	54	0.00	0	A	NM_016407		55092227	55092227	+1	no_errors	ENST00000357348	ensembl	human	known	69_37n	missense	72	29.41	30	SNP	1.000	G
CACNA1F	778	genome.wustl.edu	37	X	49066793	49066793	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chrX:49066793A>T	ENST00000376265.2	-	39	4650	c.4589T>A	c.(4588-4590)cTg>cAg	p.L1530Q	CACNA1F_ENST00000323022.5_Missense_Mutation_p.L1519Q|CACNA1F_ENST00000376251.1_Missense_Mutation_p.L1465Q	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1530					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	TGTCCGGACCAGGGCAAAGAG	0.532																																						dbGAP											0													140.0	114.0	122.0					X																	49066793		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4589T>A	X.37:g.49066793A>T	ENSP00000365441:p.Leu1530Gln		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.L1530Q	ENST00000376265.2	37	c.4589	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	A	26.7	4.761683	0.89932	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.91351	-2.83;-2.83;-2.83	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000001	D	0.96103	0.8730	M	0.91510	3.215	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96833	0.9612	10	0.87932	D	0	.	13.6679	0.62407	1.0:0.0:0.0:0.0	.	1519;1530	F5CIQ9;O60840	.;CAC1F_HUMAN	Q	1465;1519;1530	ENSP00000365427:L1465Q;ENSP00000321618:L1519Q;ENSP00000365441:L1530Q	ENSP00000321618:L1519Q	L	-	2	0	CACNA1F	48953737	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.196000	0.94978	1.872000	0.54250	0.486000	0.48141	CTG	CACNA1F	-	NULL	ENSG00000102001		0.532	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	14	0.00	0	A	NM_005183		49066793	49066793	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	60	21.05	16	SNP	1.000	T
CHAMP1	283489	genome.wustl.edu	37	13	115090953	115090953	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr13:115090953C>T	ENST00000361283.1	+	3	1945	c.1636C>T	c.(1636-1638)Cgc>Tgc	p.R546C		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	546	Mediates localization to the spindle and the kinetochore and is required for the attachment of spindle microtubules to the kinetochore.|Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TCCAGAAGCACGCAAACGTGC	0.522																																						dbGAP											0													196.0	225.0	215.0					13																	115090953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.1636C>T	13.37:g.115090953C>T	ENSP00000354730:p.Arg546Cys		B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R546C	ENST00000361283.1	37	c.1636	CCDS9545.1	13	.	.	.	.	.	.	.	.	.	.	C	15.72	2.915669	0.52546	.	.	ENSG00000198824	ENST00000361283	T	0.01388	4.95	5.59	2.87	0.33458	.	0.130264	0.35067	N	0.003477	T	0.04182	0.0116	M	0.61703	1.905	0.38940	D	0.958137	D	0.76494	0.999	P	0.57960	0.83	T	0.49818	-0.8899	9	.	.	.	-9.4259	8.7422	0.34564	0.2635:0.667:0.0:0.0695	.	546	Q96JM3	ZN828_HUMAN	C	546	ENSP00000354730:R546C	.	R	+	1	0	ZNF828	114109055	0.006000	0.16342	0.998000	0.56505	0.951000	0.60555	1.560000	0.36331	0.704000	0.31869	0.650000	0.86243	CGC	CHAMP1	-	NULL	ENSG00000198824		0.522	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	HGNC	protein_coding	OTTHUMT00000045977.2	55	0.00	0	C	NM_032436		115090953	115090953	+1	no_errors	ENST00000361283	ensembl	human	known	69_37n	missense	33	46.77	29	SNP	0.800	T
CNKSR2	22866	genome.wustl.edu	37	X	21450738	21450739	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chrX:21450738_21450739insT	ENST00000379510.3	+	3	273_274	c.237_238insT	c.(238-240)ttgfs	p.L80fs	CNKSR2_ENST00000279451.4_Frame_Shift_Ins_p.L80fs|CNKSR2_ENST00000425654.2_Frame_Shift_Ins_p.L80fs|CNKSR2_ENST00000543067.1_Frame_Shift_Ins_p.L80fs	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	80					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						AGAATTATGGCTTGGAAACAGA	0.307																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.239dupT	X.37:g.21450740_21450740dupT	ENSP00000368824:p.Leu80fs		B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Frame_Shift_Ins	INS	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.L79fs	ENST00000379510.3	37	c.237_238	CCDS14198.1	X																																																																																			CNKSR2	-	superfamily_SAM/pointed	ENSG00000149970		0.307	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	52	0.00	0	-	NM_014927		21450738	21450739	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	frame_shift_ins	44	12.00	6	INS	1.000:1.000	T
CREBBP	1387	genome.wustl.edu	37	16	3781889	3781889	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr16:3781889G>T	ENST00000262367.5	-	29	5587	c.4778C>A	c.(4777-4779)aCc>aAc	p.T1593N	CREBBP_ENST00000382070.3_Missense_Mutation_p.T1555N	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1593	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		gttcttgttggttttcttgtt	0.537			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															dbGAP		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													534.0	421.0	459.0					16																	3781889		2197	4300	6497	-	-	-	SO:0001583	missense	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4778C>A	16.37:g.3781889G>T	ENSP00000262367:p.Thr1593Asn		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.T1593N	ENST00000262367.5	37	c.4778	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	g	15.17	2.753412	0.49362	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.93488	-3.23;-3.23	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.95236	0.8455	L	0.45051	1.395	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	D	0.93886	0.7175	10	0.31617	T	0.26	-24.2413	19.4189	0.94712	0.0:0.0:1.0:0.0	.	1623;1593	Q4LE28;Q92793	.;CBP_HUMAN	N	1593;1623;1555	ENSP00000262367:T1593N;ENSP00000371502:T1555N	ENSP00000262367:T1593N	T	-	2	0	CREBBP	3721890	1.000000	0.71417	1.000000	0.80357	0.564000	0.35744	9.869000	0.99810	2.587000	0.87381	0.561000	0.74099	ACC	CREBBP	-	pfam_Histone_H3-K56_AcTrfase_RTT109	ENSG00000005339		0.537	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	490	0.20	1	G	NM_004380		3781889	3781889	-1	no_errors	ENST00000262367	ensembl	human	known	69_37n	missense	568	42.11	416	SNP	1.000	T
DNM1	1759	genome.wustl.edu	37	9	131010934	131010934	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr9:131010934G>C	ENST00000372923.3	+	19	2070	c.1978G>C	c.(1978-1980)Gag>Cag	p.E660Q	DNM1_ENST00000393594.3_Missense_Mutation_p.E660Q|DNM1_ENST00000341179.7_Missense_Mutation_p.E660Q|DNM1_ENST00000475805.1_Missense_Mutation_p.E660Q|DNM1_ENST00000486160.1_Missense_Mutation_p.E660Q	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	660	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						ACGGCAAGTGGAGACCATCCG	0.537																																					GBM(113;146 1575 2722 28670 29921)	dbGAP											0													185.0	149.0	161.0					9																	131010934		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1978G>C	9.37:g.131010934G>C	ENSP00000362014:p.Glu660Gln		A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.E660Q	ENST00000372923.3	37	c.1978	CCDS6895.1	9	.	.	.	.	.	.	.	.	.	.	G	17.20	3.328943	0.60743	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393594;ENST00000486160;ENST00000543158	T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47	4.67	3.77	0.43336	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.149851	0.51477	D	0.000098	T	0.71871	0.3391	M	0.80847	2.515	0.80722	D	1	D;D;D	0.69078	0.991;0.989;0.997	D;D;D	0.79108	0.988;0.979;0.992	T	0.76377	-0.2981	10	0.87932	D	0	-19.2117	12.8318	0.57750	0.0786:0.0:0.9214:0.0	.	660;660;599	Q05193;Q05193-3;B4DHH5	DYN1_HUMAN;.;.	Q	660;660;660;660;660;205	ENSP00000419225:E660Q;ENSP00000345680:E660Q;ENSP00000362014:E660Q;ENSP00000377219:E660Q;ENSP00000420045:E660Q	ENSP00000345680:E660Q	E	+	1	0	DNM1	130050755	1.000000	0.71417	1.000000	0.80357	0.230000	0.25150	9.549000	0.98106	1.209000	0.43321	-0.142000	0.14014	GAG	DNM1	-	pfam_GED,smart_GED	ENSG00000106976		0.537	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNM1	HGNC	protein_coding	OTTHUMT00000054367.1	54	0.00	0	G	NM_004408		131010934	131010934	+1	no_errors	ENST00000372923	ensembl	human	known	69_37n	missense	92	23.33	28	SNP	1.000	C
EPC1	80314	genome.wustl.edu	37	10	32581994	32581995	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr10:32581994_32581995delTT	ENST00000263062.8	-	4	856_857	c.587_588delAA	c.(586-588)caafs	p.Q196fs	EPC1_ENST00000319778.6_Frame_Shift_Del_p.Q196fs|EPC1_ENST00000375110.2_Frame_Shift_Del_p.Q146fs	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	196					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				CTCGCTTCTCTTGTTTTACTGA	0.347																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.587_588delAA	10.37:g.32581994_32581995delTT	ENSP00000263062:p.Gln196fs		B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Frame_Shift_Del	DEL	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.Q196fs	ENST00000263062.8	37	c.588_587	CCDS7172.1	10																																																																																			EPC1	-	NULL	ENSG00000120616		0.347	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	HGNC	protein_coding	OTTHUMT00000047484.1	71	0.00	0	TT			32581994	32581995	-1	no_errors	ENST00000263062	ensembl	human	known	69_37n	frame_shift_del	208	17.19	44	DEL	1.000:1.000	-
FBN3	84467	genome.wustl.edu	37	19	8155008	8155008	+	Silent	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr19:8155008G>A	ENST00000600128.1	-	49	6573	c.6159C>T	c.(6157-6159)tgC>tgT	p.C2053C	FBN3_ENST00000601739.1_Silent_p.C2053C|FBN3_ENST00000270509.2_Silent_p.C2053C			Q75N90	FBN3_HUMAN	fibrillin 3	2053	TB 8.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GACACAGTTCGCAGGGGTCTC	0.612																																						dbGAP											0													38.0	38.0	38.0					19																	8155008		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6159C>T	19.37:g.8155008G>A			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.C2053	ENST00000600128.1	37	c.6159	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	G	2.533	-0.307973	0.05458	.	.	ENSG00000142449	ENST00000341066	.	.	.	4.13	-5.44	0.02624	.	.	.	.	.	T	0.57621	0.2066	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55108	-0.8192	5	0.16420	T	0.52	.	17.0445	0.86498	0.3427:0.0:0.6573:0.0	.	.	.	.	V	173	.	ENSP00000341317:A173V	A	-	2	0	FBN3	8061008	0.006000	0.16342	0.654000	0.29608	0.330000	0.28571	-0.883000	0.04170	-1.622000	0.01560	-1.587000	0.00848	GCG	FBN3	-	pfam_TB_dom,superfamily_TB_dom,pirsf_Fibrillin	ENSG00000142449		0.612	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	41	0.00	0	G	NM_032447		8155008	8155008	-1	no_errors	ENST00000270509	ensembl	human	known	69_37n	silent	27	28.95	11	SNP	0.658	A
GLCE	26035	genome.wustl.edu	37	15	69560895	69560895	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr15:69560895G>C	ENST00000261858.2	+	5	1394	c.1166G>C	c.(1165-1167)gGa>gCa	p.G389A	GLCE_ENST00000559500.1_3'UTR|GLCE_ENST00000559420.2_Missense_Mutation_p.G325A	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	389					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AAAGGTAAGGGATTCCTCGAC	0.463																																						dbGAP											0													77.0	72.0	74.0					15																	69560895		2200	4298	6498	-	-	-	SO:0001583	missense	0			AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.1166G>C	15.37:g.69560895G>C	ENSP00000261858:p.Gly389Ala		Q6GUQ2	Missense_Mutation	SNP	pfam_C5-epim	p.G389A	ENST00000261858.2	37	c.1166	CCDS32277.1	15	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739688	0.69304	.	.	ENSG00000138604	ENST00000261858	T	0.38077	1.16	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.63616	0.2526	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66834	-0.5823	10	0.54805	T	0.06	-26.8766	17.4529	0.87597	0.0:0.0:1.0:0.0	.	389	O94923	GLCE_HUMAN	A	389	ENSP00000261858:G389A	ENSP00000261858:G389A	G	+	2	0	GLCE	67347949	1.000000	0.71417	0.987000	0.45799	0.752000	0.42762	9.722000	0.98770	2.470000	0.83445	0.557000	0.71058	GGA	GLCE	-	NULL	ENSG00000138604		0.463	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCE	HGNC	protein_coding		55	0.00	0	G	NM_015554		69560895	69560895	+1	no_errors	ENST00000261858	ensembl	human	known	69_37n	missense	51	38.55	32	SNP	1.000	C
GPC2	221914	genome.wustl.edu	37	7	99769764	99769764	+	Silent	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr7:99769764C>T	ENST00000292377.2	-	6	1136	c.969G>A	c.(967-969)aaG>aaA	p.K323K	GPC2_ENST00000471050.1_5'UTR	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	323					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCTCCGAGATCTTCACCCCAA	0.587																																						dbGAP											0													90.0	82.0	84.0					7																	99769764		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.969G>A	7.37:g.99769764C>T			A4D2A7	Silent	SNP	pfam_Glypican	p.K323	ENST00000292377.2	37	c.969	CCDS5689.1	7																																																																																			GPC2	-	pfam_Glypican	ENSG00000213420		0.587	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC2	HGNC	protein_coding	OTTHUMT00000337556.1	34	0.00	0	C	NM_152742		99769764	99769764	-1	no_errors	ENST00000292377	ensembl	human	known	69_37n	silent	66	32.65	32	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112701998	112701998	+	Missense_Mutation	SNP	G	G	T	rs199923734		TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr12:112701998G>T	ENST00000430131.2	-	16	2487	c.1342C>A	c.(1342-1344)Cgc>Agc	p.R448S	HECTD4_ENST00000550722.1_Missense_Mutation_p.R736S|RN7SKP71_ENST00000364558.1_RNA|HECTD4_ENST00000377560.5_Missense_Mutation_p.R698S			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	448					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										ATCAGATAGCGCAGGCAGGAG	0.388																																						dbGAP											0													75.0	61.0	66.0					12																	112701998		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.1342C>A	12.37:g.112701998G>T	ENSP00000404379:p.Arg448Ser		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.R698S	ENST00000430131.2	37	c.2092		12	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567305	0.65651	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.52057	0.68;0.68;0.68	5.64	5.64	0.86602	.	0.058140	0.64402	D	0.000001	T	0.30854	0.0778	N	0.19112	0.55	0.41800	D	0.98991	P;B;P	0.35226	0.491;0.358;0.491	B;B;B	0.25759	0.063;0.042;0.063	T	0.27536	-1.0071	10	0.87932	D	0	.	12.9657	0.58483	0.0737:0.0:0.9263:0.0	.	448;448;448	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	S	698;448;736	ENSP00000366783:R698S;ENSP00000404379:R448S;ENSP00000449784:R736S	ENSP00000366783:R698S	R	-	1	0	C12orf51	111186381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.346000	0.65992	2.637000	0.89404	0.563000	0.77884	CGC	HECTD4	-	NULL	ENSG00000173064		0.388	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		45	0.00	0	G	NM_173813		112701998	112701998	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	missense	64	37.86	39	SNP	1.000	T
HIP1	3092	genome.wustl.edu	37	7	75197549	75197549	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr7:75197549C>T	ENST00000336926.6	-	9	783	c.757G>A	c.(757-759)Gac>Aac	p.D253N	HIP1_ENST00000434438.2_Missense_Mutation_p.D253N	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	253					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGCAGGGTGTCAGCTGGGAGG	0.567			T	PDGFRB	CMML																																	dbGAP		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0													78.0	75.0	76.0					7																	75197549		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.757G>A	7.37:g.75197549C>T	ENSP00000336747:p.Asp253Asn		B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	pfam_ANTH,pfam_ILWEQ,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ,pfscan_Epsin-like_N,pfscan_ILWEQ	p.D253N	ENST00000336926.6	37	c.757	CCDS34669.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.232555	0.95207	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.28666	1.6;1.6	4.79	4.79	0.61399	ANTH (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58977	0.2160	M	0.80332	2.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.65598	-0.6129	10	0.87932	D	0	-36.4692	16.7751	0.85549	0.0:1.0:0.0:0.0	.	253;253	E7ES17;O00291	.;HIP1_HUMAN	N	253	ENSP00000336747:D253N;ENSP00000410300:D253N	ENSP00000336747:D253N	D	-	1	0	HIP1	75035485	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	7.629000	0.83207	2.362000	0.80069	0.655000	0.94253	GAC	HIP1	-	pfam_ANTH,superfamily_ARM-type_fold	ENSG00000127946		0.567	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	HGNC	protein_coding	OTTHUMT00000342863.2	62	0.00	0	C	NM_005338		75197549	75197549	-1	no_errors	ENST00000336926	ensembl	human	known	69_37n	missense	120	26.67	44	SNP	1.000	T
IKBKB	3551	genome.wustl.edu	37	8	42174288	42174288	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr8:42174288G>T	ENST00000520810.1	+	11	1177	c.991G>T	c.(991-993)Gag>Tag	p.E331*	IKBKB_ENST00000379708.3_Nonsense_Mutation_p.E108*|IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000520835.1_Nonsense_Mutation_p.E329*|IKBKB_ENST00000416505.2_Nonsense_Mutation_p.E272*	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	331					B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	GACAGAGGATGAGAGTCTGCA	0.552																																						dbGAP											0													82.0	72.0	75.0					8																	42174288		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.991G>T	8.37:g.42174288G>T	ENSP00000430684:p.Glu331*		B4DZ30|B4E0U4|O75327	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ubiquitin_supergroup,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E331*	ENST00000520810.1	37	c.991	CCDS6128.1	8	.	.	.	.	.	.	.	.	.	.	G	43	10.498991	0.99416	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	19.282	0.94055	0.0:0.0:1.0:0.0	.	.	.	.	X	331;272;329;108	.	ENSP00000369030:E108X	E	+	1	0	IKBKB	42293445	1.000000	0.71417	0.953000	0.39169	0.878000	0.50629	7.930000	0.87610	2.723000	0.93209	0.655000	0.94253	GAG	IKBKB	-	superfamily_Kinase-like_dom,pfscan_Ubiquitin_supergroup	ENSG00000104365		0.552	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKB	HGNC	protein_coding	OTTHUMT00000377214.1	64	0.00	0	G			42174288	42174288	+1	no_errors	ENST00000520810	ensembl	human	known	69_37n	nonsense	121	20.92	32	SNP	1.000	T
IQGAP3	128239	genome.wustl.edu	37	1	156507048	156507048	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr1:156507048T>C	ENST00000361170.2	-	27	3357	c.3347A>G	c.(3346-3348)gAc>gGc	p.D1116G	IQGAP3_ENST00000498755.1_5'UTR	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1116	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TAGGGCGATGTCCAGTCGTCT	0.562																																						dbGAP											0													148.0	120.0	130.0					1																	156507048		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3347A>G	1.37:g.156507048T>C	ENSP00000354451:p.Asp1116Gly		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.D1116G	ENST00000361170.2	37	c.3347	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	T	19.05	3.752301	0.69533	.	.	ENSG00000183856	ENST00000361170	T	0.80480	-1.38	4.93	4.93	0.64822	Rho GTPase activation protein (1);Ras GTPase-activating protein (3);	0.058118	0.64402	D	0.000002	D	0.85097	0.5619	M	0.65498	2.005	0.58432	D	0.999995	D	0.71674	0.998	D	0.87578	0.998	D	0.85799	0.1372	10	0.48119	T	0.1	-31.7859	13.5508	0.61730	0.0:0.0:0.0:1.0	.	1116	Q86VI3	IQGA3_HUMAN	G	1116	ENSP00000354451:D1116G	ENSP00000354451:D1116G	D	-	2	0	IQGAP3	154773672	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.851000	0.86920	2.074000	0.62210	0.459000	0.35465	GAC	IQGAP3	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000183856		0.562	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	133	0.00	0	T	NM_178229		156507048	156507048	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	missense	348	10.74	42	SNP	1.000	C
IST1	9798	genome.wustl.edu	37	16	71961713	71961713	+	Silent	SNP	A	A	G			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr16:71961713A>G	ENST00000378799.6	+	10	1454	c.1098A>G	c.(1096-1098)acA>acG	p.T366T	IST1_ENST00000544564.1_Silent_p.T366T|IST1_ENST00000538850.1_Silent_p.T218T|IST1_ENST00000378798.5_Silent_p.T335T|RP11-498D10.5_ENST00000567146.1_RNA|PKD1L3_ENST00000534738.1_RNA|IST1_ENST00000329908.8_3'UTR|IST1_ENST00000606369.1_Silent_p.T218T|IST1_ENST00000541571.2_Silent_p.T366T|IST1_ENST00000538565.1_3'UTR|RP11-498D10.6_ENST00000573861.1_RNA|IST1_ENST00000535424.1_Silent_p.T379T			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	364					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										AAAAGAAAACATAGGTCTCTT	0.418																																						dbGAP											0													96.0	101.0	100.0					16																	71961713		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.1098A>G	16.37:g.71961713A>G			A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Silent	SNP	pfam_DUF292_euk	p.T379	ENST00000378799.6	37	c.1137	CCDS59272.1	16																																																																																			IST1	-	NULL	ENSG00000182149		0.418	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IST1	HGNC	protein_coding	OTTHUMT00000269005.2	18	0.00	0	A	NM_014761		71961713	71961713	+1	no_errors	ENST00000535424	ensembl	human	known	69_37n	silent	30	54.55	36	SNP	1.000	G
KIAA0922	23240	genome.wustl.edu	37	4	154478218	154478218	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr4:154478218G>C	ENST00000409663.3	+	6	585	c.533G>C	c.(532-534)gGa>gCa	p.G178A	KIAA0922_ENST00000409959.3_Missense_Mutation_p.G178A|KIAA0922_ENST00000440693.1_Missense_Mutation_p.G178A	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	178						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TCTTCGTATGGAGTCCTTTCC	0.348																																						dbGAP											0													83.0	84.0	84.0					4																	154478218		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.533G>C	4.37:g.154478218G>C	ENSP00000386574:p.Gly178Ala		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.G178A	ENST00000409663.3	37	c.533	CCDS3783.2	4	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495141	0.85069	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.70869	-0.36;-0.52;-0.35;-0.08	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.83894	0.5353	M	0.68952	2.095	0.36609	D	0.875093	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.86594	0.1862	10	0.66056	D	0.02	-16.6526	19.7025	0.96060	0.0:0.0:1.0:0.0	.	178;178;178	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	A	178;178;178;39	ENSP00000386574:G178A;ENSP00000409663:G178A;ENSP00000386787:G178A;ENSP00000240487:G39A	ENSP00000240487:G39A	G	+	2	0	KIAA0922	154697668	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.124000	0.77185	2.674000	0.91012	0.650000	0.86243	GGA	KIAA0922	-	pfam_DUF3651_TMEM131	ENSG00000121210		0.348	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	HGNC	protein_coding	OTTHUMT00000330370.1	130	0.00	0	G	NM_015196		154478218	154478218	+1	no_errors	ENST00000409959	ensembl	human	known	69_37n	missense	53	51.82	57	SNP	1.000	C
KRT77	374454	genome.wustl.edu	37	12	53086216	53086216	+	Silent	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr12:53086216G>A	ENST00000341809.3	-	7	1444	c.1416C>T	c.(1414-1416)ggC>ggT	p.G472G	KRT77_ENST00000537195.1_Silent_p.G239G|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	472	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TGCTCTCCTCGCCCTCCAGCA	0.612																																						dbGAP											0													46.0	40.0	42.0					12																	53086216		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1416C>T	12.37:g.53086216G>A			Q7RTS8	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G472	ENST00000341809.3	37	c.1416	CCDS8837.1	12																																																																																			KRT77	-	pfam_F	ENSG00000189182		0.612	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	HGNC	protein_coding	OTTHUMT00000404111.1	26	0.00	0	G	NM_175078		53086216	53086216	-1	no_errors	ENST00000341809	ensembl	human	known	69_37n	silent	21	32.26	10	SNP	0.841	A
LGALS9B	284194	genome.wustl.edu	37	17	20356907	20356907	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr17:20356907C>T	ENST00000423676.3	-	6	617	c.554G>A	c.(553-555)cGg>cAg	p.R185Q	LGALS9B_ENST00000324290.5_Missense_Mutation_p.R185Q			Q3B8N2	LEG9B_HUMAN	lectin, galactoside-binding, soluble, 9B	185				R -> Q (in Ref. 1; BAF82952). {ECO:0000305}.			carbohydrate binding (GO:0030246)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	10						GTTGGCAGGCCGCACGCTGGG	0.567																																						dbGAP											0													1.0	1.0	1.0					17																	20356907		567	1110	1677	-	-	-	SO:0001583	missense	0				CCDS42283.1	17p11.2	2011-08-04			ENSG00000170298	ENSG00000170298		"""Lectins, galactoside-binding"""	24842	protein-coding gene	gene with protein product						11997339	Standard	NM_001042685		Approved		uc002gwz.1	Q3B8N2	OTTHUMG00000130730	ENST00000423676.3:c.554G>A	17.37:g.20356907C>T	ENSP00000388841:p.Arg185Gln		A6NLF8|A8K2J8	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.R185Q	ENST00000423676.3	37	c.554		17	.	.	.	.	.	.	.	.	.	.	C	4.026	0.002332	0.07819	.	.	ENSG00000170298	ENST00000423676;ENST00000324290	T;T	0.03212	4.01;4.02	1.97	-1.6	0.08426	.	5.074620	0.00508	N	0.000173	T	0.02610	0.0079	N	0.14661	0.345	0.09310	N	1	B;B	0.18610	0.029;0.002	B;B	0.08055	0.003;0.002	T	0.42413	-0.9453	10	0.23891	T	0.37	.	5.3346	0.15951	0.0:0.5128:0.0:0.4872	.	185;185	Q3B8N2;Q3B8N2-2	LEG9B_HUMAN;.	Q	185	ENSP00000388841:R185Q;ENSP00000315564:R185Q	ENSP00000315564:R185Q	R	-	2	0	LGALS9B	20297499	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.524000	0.22940	-0.342000	0.08363	-1.038000	0.02383	CGG	LGALS9B	-	NULL	ENSG00000170298		0.567	LGALS9B-001	KNOWN	basic|appris_candidate_longest	protein_coding	LGALS9B	HGNC	protein_coding	OTTHUMT00000253230.2	10	0.00	0	C	NM_001042685		20356907	20356907	-1	no_errors	ENST00000423676	ensembl	human	known	69_37n	missense	14	41.67	10	SNP	0.000	T
KRTAP4-11	653240	genome.wustl.edu	37	17	39274157	39274157	+	Silent	SNP	G	G	A	rs145503152		TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr17:39274157G>A	ENST00000391413.2	-	1	449	c.411C>T	c.(409-411)ccC>ccT	p.P137P		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	137	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.P137P(3)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tgctgcagctggggtggcagc	0.672																																						dbGAP											3	Substitution - coding silent(3)	prostate(1)|lung(1)|endometrium(1)											8.0	13.0	12.0					17																	39274157		684	1586	2270	-	-	-	SO:0001819	synonymous_variant	0			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.411C>T	17.37:g.39274157G>A			A0AUY2	Silent	SNP	pfam_Keratin-assoc	p.P137	ENST00000391413.2	37	c.411	CCDS45675.1	17																																																																																			KRTAP4-11	-	NULL	ENSG00000212721		0.672	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-11	HGNC	protein_coding	OTTHUMT00000257690.1	14	0.00	0	G			39274157	39274157	-1	no_errors	ENST00000391413	ensembl	human	known	69_37n	silent	262	22.71	77	SNP	0.329	A
LIFR	3977	genome.wustl.edu	37	5	38481792	38481792	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr5:38481792G>T	ENST00000263409.4	-	20	3361	c.3199C>A	c.(3199-3201)Caa>Aaa	p.Q1067K	LIFR_ENST00000453190.2_Missense_Mutation_p.Q1067K	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	1067					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					ATCAAAAATTGTCGGGAATTA	0.388			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													129.0	129.0	129.0					5																	38481792		2203	4300	6503	-	-	-	SO:0001583	missense	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.3199C>A	5.37:g.38481792G>T	ENSP00000263409:p.Gln1067Lys		Q6LCD9	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q1067K	ENST00000263409.4	37	c.3199	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509653	0.85282	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.64618	-0.11;-0.11	5.94	5.94	0.96194	.	0.256842	0.46145	D	0.000306	T	0.71195	0.3311	L	0.56769	1.78	0.46028	D	0.998824	D	0.57257	0.979	P	0.51777	0.679	T	0.71358	-0.4617	10	0.54805	T	0.06	-17.8155	20.3552	0.98837	0.0:0.0:1.0:0.0	.	1067	P42702	LIFR_HUMAN	K	1067	ENSP00000263409:Q1067K;ENSP00000398368:Q1067K	ENSP00000263409:Q1067K	Q	-	1	0	LIFR	38517549	1.000000	0.71417	0.518000	0.27811	0.975000	0.68041	6.473000	0.73572	2.812000	0.96745	0.557000	0.71058	CAA	LIFR	-	NULL	ENSG00000113594		0.388	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	86	0.00	0	G	NM_002310		38481792	38481792	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	missense	144	17.71	31	SNP	0.998	T
METTL3	56339	genome.wustl.edu	37	14	21967278	21967278	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr14:21967278G>C	ENST00000298717.4	-	10	1673	c.1522C>G	c.(1522-1524)Cgt>Ggt	p.R508G	TOX4_ENST00000262709.3_3'UTR|TOX4_ENST00000405508.1_3'UTR	NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	508					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		CTGGTGGAACGAACCTAGGAA	0.373																																						dbGAP											0													117.0	100.0	105.0					14																	21967278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1522C>G	14.37:g.21967278G>C	ENSP00000298717:p.Arg508Gly		O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	pfam_MT-A70-like,pfscan_MT-A70-like	p.R508G	ENST00000298717.4	37	c.1522	CCDS32044.1	14	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684732	0.88639	.	.	ENSG00000165819	ENST00000298717	T	0.45668	0.89	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.68412	0.2998	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72030	-0.4413	10	0.87932	D	0	-9.1826	18.412	0.90555	0.0:0.0:1.0:0.0	.	508	Q86U44	MTA70_HUMAN	G	508	ENSP00000298717:R508G	ENSP00000298717:R508G	R	-	1	0	METTL3	21037118	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.138000	0.94501	2.651000	0.90000	0.591000	0.81541	CGT	METTL3	-	pfam_MT-A70-like,pfscan_MT-A70-like	ENSG00000165819		0.373	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL3	HGNC	protein_coding	OTTHUMT00000401227.1	106	0.00	0	G	NM_019852		21967278	21967278	-1	no_errors	ENST00000298717	ensembl	human	known	69_37n	missense	24	78.95	90	SNP	1.000	C
MYBPH	4608	genome.wustl.edu	37	1	203144796	203144796	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr1:203144796G>A	ENST00000255416.4	-	1	145	c.88C>T	c.(88-90)Ccc>Tcc	p.P30S		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	30					cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		ACTTCTCCGGGAGGCTCTGCT	0.617																																					NSCLC(32;174 1025 14462 23899 42933)	dbGAP											0													98.0	115.0	109.0					1																	203144796		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.88C>T	1.37:g.203144796G>A	ENSP00000255416:p.Pro30Ser		Q16886|Q86YC5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P30S	ENST00000255416.4	37	c.88	CCDS30975.1	1	.	.	.	.	.	.	.	.	.	.	G	5.084	0.201131	0.09652	.	.	ENSG00000133055	ENST00000255416	T	0.44482	0.92	5.2	-5.38	0.02673	.	1.560180	0.04034	N	0.301912	T	0.13970	0.0338	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30650	-0.9971	10	0.02654	T	1	.	4.3629	0.11211	0.2049:0.0:0.3529:0.4422	.	30	Q13203	MYBPH_HUMAN	S	30	ENSP00000255416:P30S	ENSP00000255416:P30S	P	-	1	0	MYBPH	201411419	0.001000	0.12720	0.006000	0.13384	0.529000	0.34654	-0.085000	0.11250	-0.373000	0.07979	0.462000	0.41574	CCC	MYBPH	-	NULL	ENSG00000133055		0.617	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPH	HGNC	protein_coding	OTTHUMT00000100264.1	36	0.00	0	G	NM_004997		203144796	203144796	-1	no_errors	ENST00000255416	ensembl	human	known	69_37n	missense	127	41.74	91	SNP	0.000	A
MYO18A	399687	genome.wustl.edu	37	17	27434125	27434125	+	Silent	SNP	A	A	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr17:27434125A>C	ENST00000527372.1	-	20	3594	c.3414T>G	c.(3412-3414)cgT>cgG	p.R1138R	MYO18A_ENST00000533112.1_Silent_p.R1138R|MYO18A_ENST00000354329.4_Silent_p.R1138R|MYO18A_ENST00000531253.1_Silent_p.R1138R	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1138	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CGATGTAGTTACGCCCGTGTT	0.607																																					Esophageal Squamous(182;472 2015 7001 15270 22562)	dbGAP											0													129.0	136.0	134.0					17																	27434125		2044	4185	6229	-	-	-	SO:0001819	synonymous_variant	0			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.3414T>G	17.37:g.27434125A>C			Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.R1138	ENST00000527372.1	37	c.3414	CCDS45642.1	17																																																																																			MYO18A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000196535		0.607	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000389396.1	122	0.81	1	A	NM_078471		27434125	27434125	-1	no_errors	ENST00000354329	ensembl	human	known	69_37n	silent	330	14.29	55	SNP	0.995	C
NFASC	23114	genome.wustl.edu	37	1	204942492	204942492	+	Silent	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr1:204942492C>T	ENST00000401399.1	+	11	1423	c.1224C>T	c.(1222-1224)tgC>tgT	p.C408C	NFASC_ENST00000404907.1_Silent_p.C419C|NFASC_ENST00000403080.1_Silent_p.C408C|NFASC_ENST00000404076.1_Silent_p.C402C|NFASC_ENST00000367171.4_Silent_p.C408C|NFASC_ENST00000339876.6_Silent_p.C408C|NFASC_ENST00000338586.6_Silent_p.C408C|NFASC_ENST00000367172.4_Silent_p.C408C|NFASC_ENST00000367169.4_Silent_p.C408C|NFASC_ENST00000513543.1_Silent_p.C419C|NFASC_ENST00000338515.6_Silent_p.C408C|NFASC_ENST00000539706.1_Silent_p.C419C|NFASC_ENST00000360049.4_Silent_p.C419C|NFASC_ENST00000367170.4_Silent_p.C408C			O94856	NFASC_HUMAN	neurofascin	408	Ig-like C2-type 4.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TGTACCAGTGCAACACCTCCA	0.592																																						dbGAP											0													245.0	171.0	196.0					1																	204942492		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1224C>T	1.37:g.204942492C>T			B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A378V	ENST00000401399.1	37	c.1133	CCDS53460.1	1	.	.	.	.	.	.	.	.	.	.	C	10.70	1.424324	0.25639	.	.	ENSG00000163531	ENST00000367173	.	.	.	5.28	1.87	0.25490	.	.	.	.	.	T	0.59473	0.2196	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55341	-0.8156	4	.	.	.	.	10.879	0.46927	0.0:0.7472:0.0:0.2528	.	.	.	.	V	378	.	.	A	+	2	0	NFASC	203209115	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	0.648000	0.24828	0.598000	0.29829	0.655000	0.94253	GCA	NFASC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000163531		0.592	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	116	0.00	0	C	NM_001005388		204942492	204942492	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000367173	ensembl	human	novel	69_37n	missense	472	21.07	126	SNP	1.000	T
NME8	51314	genome.wustl.edu	37	7	37916509	37916509	+	Silent	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr7:37916509G>A	ENST00000199447.4	+	12	1266	c.894G>A	c.(892-894)aaG>aaA	p.K298K	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Silent_p.K298K	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	298					cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										ATGTTGCTAAGTTCATGGATG	0.333																																						dbGAP											0													68.0	70.0	69.0					7																	37916509		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.894G>A	7.37:g.37916509G>A			Q9NZH1	Silent	SNP	pfam_Nucleoside_diP_kinase,pfam_Thioredoxin_domain,superfamily_Nucleoside_diP_kinase,superfamily_Thioredoxin-like_fold,smart_Nucleoside_diP_kinase	p.K298	ENST00000199447.4	37	c.894	CCDS5452.1	7																																																																																			NME8	-	superfamily_Nucleoside_diP_kinase	ENSG00000086288		0.333	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME8	HGNC	protein_coding	OTTHUMT00000219946.1	93	0.00	0	G	NM_016616		37916509	37916509	+1	no_errors	ENST00000199447	ensembl	human	known	69_37n	silent	83	29.06	34	SNP	0.001	A
OR2A42	402317	genome.wustl.edu	37	7	143929735	143929735	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr7:143929735C>T	ENST00000391496.1	-	1	201	c.202G>A	c.(202-204)Gtc>Atc	p.V68I	RP4-545C24.1_ENST00000477797.1_RNA|RP4-545C24.1_ENST00000498693.1_RNA|RP4-545C24.1_ENST00000493248.1_RNA|ARHGEF35_ENST00000543357.1_Intron|RP4-545C24.1_ENST00000489077.1_RNA|RP4-545C24.1_ENST00000464929.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA|RP4-545C24.1_ENST00000480074.1_RNA	NM_001001802.2	NP_001001802.2	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A, member 42	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|skin(1)	4	Melanoma(164;0.14)					GCGATGTCGACGACAGCCAGG	0.597																																						dbGAP											0													15.0	17.0	16.0					7																	143929735		1414	3523	4937	-	-	-	SO:0001583	missense	0				CCDS56515.1	7q35	2013-09-20			ENSG00000212807	ENSG00000212807		"""GPCR / Class A : Olfactory receptors"""	31230	protein-coding gene	gene with protein product							Standard	NM_001001802		Approved			Q8NGT9	OTTHUMG00000157995	ENST00000391496.1:c.202G>A	7.37:g.143929735C>T	ENSP00000375334:p.Val68Ile		Q6IF44|Q96R46	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V68I	ENST00000391496.1	37	c.202	CCDS56515.1	7	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.401651	0.01165	.	.	ENSG00000212807	ENST00000391496	T	0.02916	4.11	2.77	0.882	0.19172	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02304	0.0071	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.15052	0.012	T	0.45279	-0.9272	8	0.39692	T	0.17	.	5.176	0.15135	0.0:0.5808:0.0:0.4192	.	68	Q8NGT9	OR2A1_HUMAN	I	68	ENSP00000375334:V68I	ENSP00000375334:V68I	V	-	1	0	OR2A42	143560668	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-3.865000	0.00347	0.223000	0.20920	0.398000	0.26397	GTC	OR2A42	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000212807		0.597	OR2A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A42	HGNC	protein_coding	OTTHUMT00000349968.1	12	0.00	0	C			143929735	143929735	-1	no_errors	ENST00000391496	ensembl	human	known	69_37n	missense	25	41.86	18	SNP	0.001	T
PCK1	5105	genome.wustl.edu	37	20	56137929	56137929	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr20:56137929C>T	ENST00000319441.4	+	4	748	c.584C>T	c.(583-585)tCt>tTt	p.S195F	PCK1_ENST00000543666.1_Intron|PCK1_ENST00000535860.1_Missense_Mutation_p.S63F	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	195					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			TGCCTCCATTCTGTGGGGTGC	0.512																																						dbGAP											0													55.0	55.0	55.0					20																	56137929		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.584C>T	20.37:g.56137929C>T	ENSP00000319814:p.Ser195Phe		A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	p.S195F	ENST00000319441.4	37	c.584	CCDS13460.1	20	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812361	0.70912	.	.	ENSG00000124253	ENST00000319441;ENST00000535860	T;T	0.09255	3.0;3.0	5.13	5.13	0.70059	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.52125	0.1715	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72384	-0.4310	10	0.87932	D	0	-38.0517	18.9476	0.92627	0.0:1.0:0.0:0.0	.	195	P35558	PCKGC_HUMAN	F	195;63	ENSP00000319814:S195F;ENSP00000444342:S63F	ENSP00000319814:S195F	S	+	2	0	PCK1	55571335	1.000000	0.71417	0.541000	0.28102	0.390000	0.30446	7.128000	0.77217	2.543000	0.85770	0.655000	0.94253	TCT	PCK1	-	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	ENSG00000124253		0.512	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK1	HGNC	protein_coding	OTTHUMT00000079851.2	23	0.00	0	C			56137929	56137929	+1	no_errors	ENST00000319441	ensembl	human	known	69_37n	missense	38	36.67	22	SNP	0.999	T
PGM5	5239	genome.wustl.edu	37	9	71006498	71006498	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr9:71006498C>T	ENST00000396396.1	+	5	975	c.746C>T	c.(745-747)cCa>cTa	p.P249L	PGM5_ENST00000604870.2_3'UTR|PGM5_ENST00000396392.1_Missense_Mutation_p.P249L	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	249					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						CTGGGGGCCCCAGCCAATTCT	0.448																																						dbGAP											0													5.0	5.0	5.0					9																	71006498		1812	3805	5617	-	-	-	SO:0001583	missense	0			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.746C>T	9.37:g.71006498C>T	ENSP00000379678:p.Pro249Leu		B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.P249L	ENST00000396396.1	37	c.746	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	.	26.3	4.727703	0.89390	.	.	ENSG00000154330	ENST00000396396;ENST00000396392;ENST00000377314;ENST00000431583	T;T;T	0.64618	-0.11;-0.11;-0.11	4.92	4.92	0.64577	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (1);Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (1);	0.000000	0.85682	D	0.000000	T	0.81484	0.4832	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85146	0.0983	10	0.87932	D	0	.	16.8751	0.86050	0.0:1.0:0.0:0.0	.	249	Q15124	PGM5_HUMAN	L	249;249;200;166	ENSP00000379678:P249L;ENSP00000379674:P249L;ENSP00000394864:P166L	ENSP00000366531:P200L	P	+	2	0	PGM5	70196318	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.716000	0.84723	2.274000	0.75844	0.555000	0.69702	CCA	PGM5	-	pfam_A-D-PHexomutase_a/b/a-II	ENSG00000154330		0.448	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	82	0.00	0	C	NM_021965		71006498	71006498	+1	no_errors	ENST00000396396	ensembl	human	known	69_37n	missense	42	57.14	56	SNP	1.000	T
PHLDA1	22822	genome.wustl.edu	37	12	76424952	76424952	+	Missense_Mutation	SNP	C	C	G	rs200070422		TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr12:76424952C>G	ENST00000266671.5	-	1	2760	c.570G>C	c.(568-570)caG>caC	p.Q190H	RP11-290L1.3_ENST00000552367.1_RNA|PHLDA1_ENST00000602540.1_Missense_Mutation_p.Q49H|RP11-290L1.2_ENST00000547721.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	190	PH.|Poly-Gln.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				gctgctgctgctggtgttgca	0.647																																						dbGAP											0													15.0	16.0	16.0					12																	76424952		2187	4269	6456	-	-	-	SO:0001583	missense	0			Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.570G>C	12.37:g.76424952C>G	ENSP00000266671:p.Gln190His		A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.Q190H	ENST00000266671.5	37	c.570	CCDS31861.1	12	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847435	0.32606	.	.	ENSG00000139289	ENST00000266671;ENST00000421361	T	0.25749	1.78	3.66	2.74	0.32292	Pleckstrin homology domain (1);	.	.	.	.	T	0.15478	0.0373	N	0.14661	0.345	0.26866	N	0.967856	B	0.06786	0.001	B	0.04013	0.001	T	0.19549	-1.0302	9	0.87932	D	0	.	8.7699	0.34726	0.0:0.767:0.233:0.0	.	190	Q8WV24	PHLA1_HUMAN	H	190;49	ENSP00000266671:Q190H	ENSP00000266671:Q190H	Q	-	3	2	PHLDA1	74711219	0.991000	0.36638	0.886000	0.34754	0.865000	0.49528	0.349000	0.20055	0.710000	0.31997	0.561000	0.74099	CAG	PHLDA1	-	smart_Pleckstrin_homology	ENSG00000139289		0.647	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHLDA1	HGNC	protein_coding	OTTHUMT00000405846.2	8	0.00	0	C	NM_007350		76424952	76424952	-1	no_errors	ENST00000266671	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.996	G
RANBP6	26953	genome.wustl.edu	37	9	6012355	6012355	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr9:6012355C>G	ENST00000259569.5	-	1	3263	c.3253G>C	c.(3253-3255)Gaa>Caa	p.E1085Q	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	1085					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GATACACATTCCAACCATAAA	0.358																																						dbGAP											0													79.0	74.0	75.0					9																	6012355		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.3253G>C	9.37:g.6012355C>G	ENSP00000259569:p.Glu1085Gln		Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.E1085Q	ENST00000259569.5	37	c.3253	CCDS6467.1	9	.	.	.	.	.	.	.	.	.	.	C	8.891	0.953949	0.18431	.	.	ENSG00000137040	ENST00000259569	T	0.09630	2.96	4.52	4.52	0.55395	Armadillo-like helical (1);Armadillo-type fold (1);	0.113080	0.64402	D	0.000014	T	0.05731	0.0150	N	0.05124	-0.11	0.38114	D	0.937662	B;B;B	0.12630	0.006;0.006;0.006	B;B;B	0.14023	0.01;0.005;0.005	T	0.38779	-0.9645	10	0.13470	T	0.59	-11.4703	15.5697	0.76323	0.0:1.0:0.0:0.0	.	252;673;1085	B4E340;B4DTX6;O60518	.;.;RNBP6_HUMAN	Q	1085	ENSP00000259569:E1085Q	ENSP00000259569:E1085Q	E	-	1	0	RANBP6	6002355	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.583000	0.36579	2.813000	0.96785	0.655000	0.94253	GAA	RANBP6	-	superfamily_ARM-type_fold	ENSG00000137040		0.358	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP6	HGNC	protein_coding	OTTHUMT00000051650.1	29	0.00	0	C	NM_012416		6012355	6012355	-1	no_errors	ENST00000259569	ensembl	human	known	69_37n	missense	59	36.84	35	SNP	1.000	G
RNF169	254225	genome.wustl.edu	37	11	74547205	74547207	+	In_Frame_Del	DEL	AAG	AAG	-	rs373500327		TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr11:74547205_74547207delAAG	ENST00000299563.4	+	6	1570_1572	c.1557_1559delAAG	c.(1555-1560)aaaagt>aat	p.519_520KS>N		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	519					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						GTGATAATAAAAGTAGCACTGAG	0.502																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1557_1559delAAG	11.37:g.74547205_74547207delAAG	ENSP00000299563:p.Lys519_Ser520delinsAsn		Q6N015	In_Frame_Del	DEL	smart_Znf_RING,pfscan_Znf_RING	p.KS519in_frame_delN	ENST00000299563.4	37	c.1557_1559	CCDS41691.1	11																																																																																			RNF169	-	NULL	ENSG00000166439		0.502	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	HGNC	protein_coding	OTTHUMT00000384741.1	25	0.00	0	AAG	XM_495886		74547205	74547207	+1	no_errors	ENST00000299563	ensembl	human	known	69_37n	in_frame_del	21	45.00	18	DEL	0.182:0.212:0.209	-
RYR2	6262	genome.wustl.edu	37	1	237777445	237777446	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr1:237777445_237777446GC>TT	ENST00000366574.2	+	37	5334_5335	c.5017_5018GC>TT	c.(5017-5019)GCc>TTc	p.A1673F	RYR2_ENST00000542537.1_Missense_Mutation_p.A1657F|RYR2_ENST00000360064.6_Missense_Mutation_p.A1671F	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1673	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCACCGGGTGGCCCATGCCCTG	0.53																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	Exception_encountered	1.37:g.237777445_237777446delinsTT	ENSP00000355533:p.Ala1673Phe		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.A1671S|p.A1671V	ENST00000366574.2	37	c.5011|c.5012	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.530	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	66|65	0.00	0	G|C	NM_001035		237777445|237777446	237777445|237777446	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	37|39	83.48|82.74	187	SNP	1.000	T
SLC12A5	57468	genome.wustl.edu	37	20	44664069	44664069	+	Silent	SNP	G	G	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr20:44664069G>T	ENST00000454036.2	+	3	292	c.243G>T	c.(241-243)gtG>gtT	p.V81V	SLC12A5_ENST00000243964.3_Silent_p.V58V|SLC12A5_ENST00000372315.1_Silent_p.V58V|SLC12A5_ENST00000608944.1_Silent_p.V7V	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	81					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCCCTATGGTGTCCTCCTTGC	0.587																																						dbGAP											0													119.0	128.0	125.0					20																	44664069		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.243G>T	20.37:g.44664069G>T			A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.V81	ENST00000454036.2	37	c.243	CCDS46610.1	20																																																																																			SLC12A5	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.587	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	19	0.00	0	G			44664069	44664069	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	silent	37	45.59	31	SNP	0.999	T
SPAM1	6677	genome.wustl.edu	37	7	123599783	123599783	+	Silent	SNP	T	T	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr7:123599783T>A	ENST00000439500.1	+	6	1903	c.1290T>A	c.(1288-1290)tcT>tcA	p.S430S	SPAM1_ENST00000223028.7_Silent_p.S430S|SPAM1_ENST00000460182.1_Silent_p.S430S|SPAM1_ENST00000340011.5_Silent_p.S430S|SPAM1_ENST00000402183.2_Silent_p.S430S	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	430					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AGCAATTTTCTGAAAAATTTT	0.393																																						dbGAP											0													97.0	97.0	97.0					7																	123599783		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1290T>A	7.37:g.123599783T>A			Q8TC30	Silent	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Glyco_hydro_56_PH20,prints_Hyaluronidase	p.S430	ENST00000439500.1	37	c.1290	CCDS5791.1	7																																																																																			SPAM1	-	pirsf_Hyaluronidase,prints_Glyco_hydro_56_PH20	ENSG00000106304		0.393	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPAM1	HGNC	protein_coding	OTTHUMT00000348309.1	100	0.00	0	T			123599783	123599783	+1	no_errors	ENST00000340011	ensembl	human	known	69_37n	silent	145	27.36	55	SNP	0.002	A
TECR	9524	genome.wustl.edu	37	19	14674030	14674030	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr19:14674030G>A	ENST00000215567.5	+	3	216	c.79G>A	c.(79-81)Gcc>Acc	p.A27T	TECR_ENST00000436007.2_Missense_Mutation_p.A42T|TECR_ENST00000596164.1_3'UTR|TECR_ENST00000600083.1_5'UTR|TECR_ENST00000596073.1_5'UTR	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	27					cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|large_intestine(1)|ovary(1)	3						GGAGCCCCACGCCACCATTGC	0.632																																						dbGAP											0													99.0	80.0	87.0					19																	14674030		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.79G>A	19.37:g.14674030G>A	ENSP00000215567:p.Ala27Thr		B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	Missense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.A42T	ENST00000215567.5	37	c.124	CCDS12313.1	19	.	.	.	.	.	.	.	.	.	.	G	14.64	2.597038	0.46318	.	.	ENSG00000099797	ENST00000215567;ENST00000436007	T;T	0.40476	1.03;1.03	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.32971	0.0847	L	0.38733	1.17	0.80722	D	1	B;B;B	0.26902	0.056;0.163;0.056	B;B;B	0.16289	0.015;0.015;0.015	T	0.07966	-1.0745	10	0.22109	T	0.4	-20.0169	16.2111	0.82164	0.0:0.0:1.0:0.0	.	27;42;27	B3KM97;B3KSQ1;Q9NZ01	.;.;TECR_HUMAN	T	27;42	ENSP00000215567:A27T;ENSP00000397206:A42T	ENSP00000215567:A27T	A	+	1	0	TECR	14535030	1.000000	0.71417	0.998000	0.56505	0.600000	0.36913	6.766000	0.74970	2.440000	0.82611	0.436000	0.28706	GCC	TECR	-	NULL	ENSG00000099797		0.632	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECR	HGNC	protein_coding	OTTHUMT00000466000.1	25	0.00	0	G	NM_138501		14674030	14674030	+1	no_errors	ENST00000436007	ensembl	human	known	69_37n	missense	7	88.52	54	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7579311	7579311	+	Splice_Site	DEL	C	C	-			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr17:7579311delC	ENST00000269305.4	-	4	565		c.e4+1		TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(26)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAACTGACCGTGCAAGTC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(12)|breast(5)|upper_aerodigestive_tract(4)|bone(4)|ovary(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	GRCh37	CS951538	TP53	S							66.0	61.0	63.0					17																	7579311		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>-	17.37:g.7579311delC			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	DEL	-	e3+1	ENST00000269305.4	37	c.375+1	CCDS11118.1	17																																																																																			TP53	-	-	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	16	0.00	0	C	NM_000546	Intron	7579311	7579311	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site_del	2	89.66	26	DEL	1.000	-
TREML3P	340206	genome.wustl.edu	37	6	41185606	41185606	+	RNA	SNP	G	G	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr6:41185606G>C	ENST00000564680.1	-	0	79									triggering receptor expressed on myeloid cells-like 3, pseudogene																		CCGACTTGGCGATGTCTGCTG	0.502																																						dbGAP											0																																										-	-	-			0			AF534825		6p21.1	2012-04-20	2012-04-20	2012-04-20	ENSG00000184106	ENSG00000184106			30806	pseudogene	pseudogene	"""TREM like transcript 3"""	609716	"""triggering receptor expressed on myeloid cells-like 3"""	TREML3		12645956	Standard	NR_027256		Approved	TLT3	uc003oqb.3		OTTHUMG00000177313		6.37:g.41185606G>C				RNA	SNP	-	NULL	ENST00000564680.1	37	NULL		6																																																																																			TREML3P	-	-	ENSG00000184106		0.502	TREML3P-002	KNOWN	basic	processed_transcript	TREML3P	HGNC	pseudogene	OTTHUMT00000436224.1	27	0.00	0	G			41185606	41185606	-1	no_errors	ENST00000564680	ensembl	human	known	69_37n	rna	40	74.53	120	SNP	0.000	C
USP32	84669	genome.wustl.edu	37	17	58260771	58260771	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr17:58260771A>G	ENST00000300896.4	-	31	4072	c.3878T>C	c.(3877-3879)aTa>aCa	p.I1293T	USP32_ENST00000592339.1_Missense_Mutation_p.I963T	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1293	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CTGTGATTTTATCCACCGACC	0.378																																						dbGAP											0													66.0	72.0	70.0					17																	58260771		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3878T>C	17.37:g.58260771A>G	ENSP00000300896:p.Ile1293Thr		Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_EF_hand_Ca-bd,smart_Pept_C19_DUSP,pfscan_EF_HAND_2,pfscan_Peptidase_C19,prints_Recoverin	p.I1293T	ENST00000300896.4	37	c.3878	CCDS32697.1	17	.	.	.	.	.	.	.	.	.	.	A	25.7	4.665455	0.88251	.	.	ENSG00000170832	ENST00000300896	T	0.31247	1.5	5.71	5.71	0.89125	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.30634	0.0771	N	0.21282	0.65	0.80722	D	1	D	0.57257	0.979	P	0.52343	0.696	T	0.03587	-1.1022	10	0.12430	T	0.62	.	15.9868	0.80160	1.0:0.0:0.0:0.0	.	1293	Q8NFA0	UBP32_HUMAN	T	1293	ENSP00000300896:I1293T	ENSP00000300896:I1293T	I	-	2	0	USP32	55615553	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.803000	0.91915	2.171000	0.68590	0.528000	0.53228	ATA	USP32	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000170832		0.378	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP32	HGNC	protein_coding	OTTHUMT00000449235.2	41	0.00	0	A	NM_032582		58260771	58260771	-1	no_errors	ENST00000300896	ensembl	human	known	69_37n	missense	51	42.05	37	SNP	1.000	G
UTP14A	10813	genome.wustl.edu	37	X	129058938	129058938	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chrX:129058938G>A	ENST00000394422.3	+	12	1544	c.1516G>A	c.(1516-1518)Gag>Aag	p.E506K	UTP14A_ENST00000371051.5_Missense_Mutation_p.E452K|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000425117.2_Missense_Mutation_p.E454K|UTP14A_ENST00000371042.3_Missense_Mutation_p.E338K	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	506					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						ACAGAGACCAGAGAGAGTACA	0.507																																						dbGAP											0													108.0	118.0	115.0					X																	129058938		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1516G>A	X.37:g.129058938G>A	ENSP00000377944:p.Glu506Lys		A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Missense_Mutation	SNP	pfam_SSU_processome_Utp14	p.E506K	ENST00000394422.3	37	c.1516	CCDS14615.1	X	.	.	.	.	.	.	.	.	.	.	G	9.145	1.014775	0.19355	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000371042	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	6.08	3.27	0.37495	.	0.301307	0.36665	N	0.002462	T	0.13798	0.0334	L	0.52011	1.625	0.20821	N	0.999846	B;B;B	0.25351	0.102;0.124;0.124	B;B;B	0.28465	0.059;0.09;0.09	T	0.25257	-1.0137	10	0.22109	T	0.4	-12.2173	4.9429	0.13975	0.1385:0.1148:0.6263:0.1204	.	452;454;506	F8WD00;E9PEL7;Q9BVJ6	.;.;UT14A_HUMAN	K	454;506;452;338	ENSP00000388669:E454K;ENSP00000377944:E506K;ENSP00000360090:E452K;ENSP00000360081:E338K	ENSP00000360081:E338K	E	+	1	0	UTP14A	128886619	0.123000	0.22298	0.244000	0.24202	0.048000	0.14542	0.864000	0.27926	0.672000	0.31204	-0.191000	0.12829	GAG	UTP14A	-	pfam_SSU_processome_Utp14	ENSG00000156697		0.507	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UTP14A	HGNC	protein_coding	OTTHUMT00000058221.1	44	0.00	0	G	NM_006649		129058938	129058938	+1	no_errors	ENST00000394422	ensembl	human	known	69_37n	missense	53	34.57	28	SNP	0.324	A
UVSSA	57654	genome.wustl.edu	37	4	1343483	1343483	+	Silent	SNP	G	G	A			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr4:1343483G>A	ENST00000389851.4	+	3	717	c.270G>A	c.(268-270)acG>acA	p.T90T	UVSSA_ENST00000507531.1_Silent_p.T90T|UVSSA_ENST00000511216.1_Silent_p.T90T	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	90	VHS-like.				protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										TGGAGCTCACGCTGGGCACAG	0.627																																						dbGAP											0													55.0	53.0	53.0					4																	1343483		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.270G>A	4.37:g.1343483G>A			A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Silent	SNP	pfam_DUF2043,superfamily_ENTH_VHS	p.T90	ENST00000389851.4	37	c.270	CCDS33938.1	4																																																																																			UVSSA	-	superfamily_ENTH_VHS	ENSG00000163945		0.627	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVSSA	HGNC	protein_coding	OTTHUMT00000359480.1	9	0.00	0	G	NM_020894		1343483	1343483	+1	no_errors	ENST00000389851	ensembl	human	known	69_37n	silent	48	27.27	18	SNP	0.002	A
WWP1	11059	genome.wustl.edu	37	8	87460602	87460602	+	Splice_Site	SNP	A	A	G			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr8:87460602A>G	ENST00000517970.1	+	20	2440	c.2133A>G	c.(2131-2133)agA>agG	p.R711R	WWP1_ENST00000265428.4_Splice_Site_p.R711R|WWP1_ENST00000349423.2_Splice_Site_p.R493R|WWP1_ENST00000341922.2_Splice_Site_p.R581R	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	711	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						TTTCACCCAGAGATAACAACA	0.318																																						dbGAP											0													62.0	59.0	60.0					8																	87460602		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.2133-1A>G	8.37:g.87460602A>G			O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.R212G	ENST00000517970.1	37	c.634	CCDS6242.1	8	.	.	.	.	.	.	.	.	.	.	A	11.38	1.620854	0.28889	.	.	ENSG00000123124	ENST00000520453	T	0.58652	0.32	5.37	4.21	0.49690	.	0.045706	0.85682	D	0.000000	T	0.55401	0.1918	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51371	-0.8714	6	.	.	.	.	6.065	0.19858	0.6881:0.0:0.3119:0.0	.	.	.	.	G	212	ENSP00000429076:R212G	.	R	+	1	2	WWP1	87529718	1.000000	0.71417	0.999000	0.59377	0.779000	0.44077	3.701000	0.54793	0.889000	0.36185	0.460000	0.39030	AGA	WWP1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000123124		0.318	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP1	HGNC	protein_coding	OTTHUMT00000374755.1	112	0.00	0	A	NM_007013	Silent	87460602	87460602	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000520453	ensembl	human	novel	69_37n	missense	254	12.63	37	SNP	1.000	G
XRN1	54464	genome.wustl.edu	37	3	142031572	142031572	+	Silent	SNP	G	G	T			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr3:142031572G>T	ENST00000264951.4	-	41	4803	c.4686C>A	c.(4684-4686)ctC>ctA	p.L1562L	XRN1_ENST00000392981.2_Silent_p.L1550L	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1562					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TTGAGCCAAAGAGATGAGACG	0.438																																						dbGAP											0													122.0	127.0	125.0					3																	142031572		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.4686C>A	3.37:g.142031572G>T			Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	NULL	p.L1016I	ENST00000264951.4	37	c.3046	CCDS3123.1	3																																																																																			XRN1	-	NULL	ENSG00000114127		0.438	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	32	0.00	0	G	NM_019001		142031572	142031572	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000498077	ensembl	human	known	69_37n	missense	42	45.45	35	SNP	1.000	T
ZMYM6NB	100506144	genome.wustl.edu	37	1	35449532	35449532	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr1:35449532T>C	ENST00000373337.3	-	2	172	c.125A>G	c.(124-126)cAg>cGg	p.Q42R	ZMYM6_ENST00000493328.1_5'Flank|RP11-244H3.1_ENST00000417456.1_RNA|ZMYM6_ENST00000373340.2_Silent_p.A721A|ZMYM6_ENST00000487874.1_Silent_p.A721A	NM_001195156.1	NP_001182085.1	Q8NCS4	ZMYNB_HUMAN	ZMYM6 neighbor	42						integral component of membrane (GO:0016021)											CTCAGCAAACTGCACGAACAG	0.527																																						dbGAP											0													91.0	86.0	87.0					1																	35449532		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53296.1	1p34.3	2011-05-23			ENSG00000243749	ENSG00000243749			40021	protein-coding gene	gene with protein product							Standard	NM_001195156		Approved		uc001bye.3	Q8NCS4	OTTHUMG00000004158	ENST00000373337.3:c.125A>G	1.37:g.35449532T>C	ENSP00000362435:p.Gln42Arg			Missense_Mutation	SNP	pfam_Uncharacterised_YphA	p.Q42R	ENST00000373337.3	37	c.125	CCDS53296.1	1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059702	0.36373	.	.	ENSG00000243749	ENST00000373337	.	.	.	5.05	3.91	0.45181	.	.	.	.	.	T	0.38453	0.1041	L	0.46614	1.455	0.22541	N	0.999004	B	0.14438	0.01	B	0.16289	0.015	T	0.25745	-1.0123	8	0.27082	T	0.32	-27.4406	7.8322	0.29349	0.0:0.1978:0.0:0.8022	.	42	Q8NCS4	ZMYNB_HUMAN	R	42	.	ENSP00000362435:Q42R	Q	-	2	0	ZMYM6NB	35222119	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	2.696000	0.47052	0.770000	0.33336	0.454000	0.30748	CAG	ZMYM6NB	-	pfam_Uncharacterised_YphA	ENSG00000243749		0.527	ZMYM6NB-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZMYM6NB	HGNC	protein_coding	OTTHUMT00000011985.1	22	0.00	0	T			35449532	35449532	-1	no_errors	ENST00000373337	ensembl	human	novel	69_37n	missense	32	47.54	29	SNP	1.000	C
ZNF749	388567	genome.wustl.edu	37	19	57955449	57955449	+	Silent	SNP	T	T	G			TCGA-B6-A1KF-01A-11D-A13L-09	TCGA-B6-A1KF-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fbfbcb76-0524-4772-b918-1e8599a09d7f	74b38ebd-6e55-4bfa-93c5-29185138cb6e	g.chr19:57955449T>G	ENST00000334181.4	+	3	1183	c.933T>G	c.(931-933)gcT>gcG	p.A311A	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		TTACACAGGCTCATCTGGTTG	0.438																																						dbGAP											0													67.0	66.0	66.0					19																	57955449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.933T>G	19.37:g.57955449T>G				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A311	ENST00000334181.4	37	c.933	CCDS33132.2	19																																																																																			ZNF749	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186230		0.438	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF749	HGNC	protein_coding	OTTHUMT00000317879.1	81	0.00	0	T	NM_001023561		57955449	57955449	+1	no_errors	ENST00000334181	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	0.000	G
