#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AMPD3	272	genome.wustl.edu	37	11	10500146	10500146	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr11:10500146C>T	ENST00000396554.3	+	3	663	c.322C>T	c.(322-324)Ccc>Tcc	p.P108S	AMPD3_ENST00000444303.2_Intron	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	99					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		TTGGAAGGGCCCCCCGGCAGC	0.582																																						dbGAP											0													102.0	122.0	115.0					11																	10500146		2201	4294	6495	-	-	-	SO:0001583	missense	0			M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.322C>T	11.37:g.10500146C>T	ENSP00000379802:p.Pro108Ser		A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.P99S	ENST00000396554.3	37	c.295	CCDS7802.1	11	.	.	.	.	.	.	.	.	.	.	C	10.65	1.408659	0.25378	.	.	ENSG00000133805	ENST00000532250;ENST00000396554;ENST00000524866;ENST00000396553;ENST00000528723;ENST00000529507	T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33	5.71	1.49	0.22878	.	0.344649	0.29987	N	0.010688	T	0.16128	0.0388	N	0.22421	0.69	0.09310	N	0.99999	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.08055	0.0;0.003;0.0	T	0.30327	-0.9982	10	0.02654	T	1	-2.7842	4.8405	0.13487	0.2672:0.529:0.1296:0.0742	.	106;99;108	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	S	99;108;99;99;106;99	ENSP00000432707:P99S;ENSP00000379802:P108S;ENSP00000433284:P99S;ENSP00000379801:P99S;ENSP00000436987:P106S;ENSP00000431648:P99S	ENSP00000379801:P99S	P	+	1	0	AMPD3	10456722	0.006000	0.16342	0.028000	0.17463	0.911000	0.54048	0.228000	0.17814	0.331000	0.23511	-0.196000	0.12772	CCC	AMPD3	-	pirsf_AMP_deaminase	ENSG00000133805		0.582	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	AMPD3	HGNC	protein_coding	OTTHUMT00000385783.2	36	0.00	0	C	NM_000480		10500146	10500146	+1	no_errors	ENST00000396553	ensembl	human	known	69_37n	missense	74	37.29	44	SNP	0.005	T
AQP8	343	genome.wustl.edu	37	16	25228619	25228619	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr16:25228619G>T	ENST00000219660.5	+	2	238	c.113G>T	c.(112-114)tGt>tTt	p.C38F	AQP8_ENST00000566125.1_Missense_Mutation_p.C32F	NM_001169.2	NP_001160.2	O94778	AQP8_HUMAN	aquaporin 8	38					canalicular bile acid transport (GO:0015722)|cellular response to cAMP (GO:0071320)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)|intracellular canaliculus (GO:0046691)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	water channel activity (GO:0015250)			NS(1)|breast(1)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	16				GBM - Glioblastoma multiforme(48;0.044)		GTGCAGCCATGTCTGGTCGAA	0.602																																						dbGAP											0													222.0	209.0	213.0					16																	25228619		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC040630	CCDS10626.1	16p12	2008-02-05			ENSG00000103375	ENSG00000103375		"""Ion channels / Aquaporins"""	642	protein-coding gene	gene with protein product		603750				9806845, 10393433	Standard	NM_001169		Approved		uc002doc.3	O94778	OTTHUMG00000097013	ENST00000219660.5:c.113G>T	16.37:g.25228619G>T	ENSP00000219660:p.Cys38Phe		Q8IUU3|Q9UIA4	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_Aquaporin_8,prints_MIP	p.C38F	ENST00000219660.5	37	c.113	CCDS10626.1	16	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677884	0.47886	.	.	ENSG00000103375	ENST00000219660	D	0.92199	-2.99	5.52	5.52	0.82312	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	D	0.94394	0.8197	L	0.48362	1.52	0.80722	D	1	D	0.67145	0.996	D	0.73380	0.98	D	0.93574	0.6906	10	0.39692	T	0.17	-15.6811	18.0064	0.89211	0.0:0.0:1.0:0.0	.	38	O94778	AQP8_HUMAN	F	38	ENSP00000219660:C38F	ENSP00000219660:C38F	C	+	2	0	AQP8	25136120	1.000000	0.71417	0.435000	0.26784	0.029000	0.11900	7.288000	0.78691	2.595000	0.87683	0.555000	0.69702	TGT	AQP8	-	pfam_MIP,superfamily_Aquaporin-like,prints_Aquaporin_8,prints_MIP	ENSG00000103375		0.602	AQP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP8	HGNC	protein_coding	OTTHUMT00000214102.2	76	0.00	0	G	NM_001169		25228619	25228619	+1	no_errors	ENST00000219660	ensembl	human	known	69_37n	missense	161	40.59	110	SNP	0.997	T
ARHGEF9	23229	genome.wustl.edu	37	X	62917053	62917053	+	Silent	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chrX:62917053G>A	ENST00000253401.6	-	4	1313	c.513C>T	c.(511-513)aaC>aaT	p.N171N	ARHGEF9_ENST00000374878.1_Silent_p.N169N|ARHGEF9_ENST00000437457.2_Silent_p.N118N|ARHGEF9_ENST00000374870.4_Silent_p.N69N|ARHGEF9_ENST00000374872.1_Silent_p.N150N|ARHGEF9_ENST00000495564.1_5'UTR	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	171	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						GGTCATCATTGTTATACTGTT	0.443																																						dbGAP											0													132.0	95.0	108.0					X																	62917053		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.513C>T	X.37:g.62917053G>A			A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Silent	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.N171	ENST00000253401.6	37	c.513	CCDS35315.1	X																																																																																			ARHGEF9	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000131089		0.443	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	HGNC	protein_coding	OTTHUMT00000056937.1	87	0.00	0	G			62917053	62917053	-1	no_errors	ENST00000253401	ensembl	human	known	69_37n	silent	293	17.00	60	SNP	1.000	A
B3GALT5	10317	genome.wustl.edu	37	21	41032794	41032794	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr21:41032794C>T	ENST00000380620.4	+	5	900	c.308C>T	c.(307-309)gCa>gTa	p.A103V	B3GALT5_ENST00000398714.2_Missense_Mutation_p.A103V|B3GALT5_ENST00000380618.1_Missense_Mutation_p.A103V|AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000343118.4_Missense_Mutation_p.A103V			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	103					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				ACCAGCAGTGCAGCGGAAACG	0.552																																						dbGAP											0													66.0	67.0	67.0					21																	41032794		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.308C>T	21.37:g.41032794C>T	ENSP00000369994:p.Ala103Val		A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.A103V	ENST00000380620.4	37	c.308	CCDS13667.1	21	.	.	.	.	.	.	.	.	.	.	C	10.55	1.382705	0.25031	.	.	ENSG00000183778	ENST00000380620;ENST00000380618;ENST00000343118;ENST00000398714	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.46	-2.14	0.07123	.	1.077600	0.07549	U	0.915092	T	0.26340	0.0643	N	0.17674	0.51	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.26326	-1.0106	10	0.34782	T	0.22	.	9.6203	0.39716	0.3087:0.4982:0.0:0.1931	.	103	Q9Y2C3	B3GT5_HUMAN	V	103	ENSP00000369994:A103V;ENSP00000369992:A103V;ENSP00000343318:A103V;ENSP00000381699:A103V	ENSP00000343318:A103V	A	+	2	0	B3GALT5	39954664	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.341000	0.07811	-0.253000	0.09514	-2.451000	0.00208	GCA	B3GALT5	-	pfam_Glyco_trans_31	ENSG00000183778		0.552	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT5	HGNC	protein_coding	OTTHUMT00000195008.2	31	0.00	0	C	NM_033170		41032794	41032794	+1	no_errors	ENST00000343118	ensembl	human	known	69_37n	missense	41	31.67	19	SNP	0.000	T
BAI2	576	genome.wustl.edu	37	1	32202284	32202286	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr1:32202284_32202286delAAG	ENST00000373658.3	-	21	3359_3361	c.3018_3020delCTT	c.(3016-3021)ttcttt>ttt	p.1006_1007FF>F	BAI2_ENST00000398556.3_In_Frame_Del_p.954_955FF>F|BAI2_ENST00000257070.4_In_Frame_Del_p.1006_1007FF>F|BAI2_ENST00000398547.1_In_Frame_Del_p.939_940FF>F|BAI2_ENST00000373655.2_In_Frame_Del_p.1006_1007FF>F|BAI2_ENST00000398538.1_In_Frame_Del_p.994_995FF>F|BAI2_ENST00000465256.1_5'Flank|BAI2_ENST00000527361.1_In_Frame_Del_p.1006_1007FF>F|BAI2_ENST00000440175.2_In_Frame_Del_p.648_649FF>F|BAI2_ENST00000398542.1_In_Frame_Del_p.939_940FF>F	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1006					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGAGGAGAGAAAGAAGAAGTGCA	0.655																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.3018_3020delCTT	1.37:g.32202290_32202292delAAG	ENSP00000362762:p.Phe1007del		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	In_Frame_Del	DEL	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.F1007in_frame_del	ENST00000373658.3	37	c.3020_3018	CCDS346.2	1																																																																																			BAI2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000121753		0.655	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	27	0.00	0	AAG	NM_001703		32202284	32202286	-1	no_errors	ENST00000373658	ensembl	human	known	69_37n	in_frame_del	56	23.29	17	DEL	1.000:1.000:1.000	-
BCAT1	586	genome.wustl.edu	37	12	24989509	24989509	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr12:24989509G>A	ENST00000261192.7	-	8	1365	c.839C>T	c.(838-840)cCa>cTa	p.P280L	BCAT1_ENST00000539780.1_Missense_Mutation_p.P243L|BCAT1_ENST00000538118.1_Missense_Mutation_p.P279L|BCAT1_ENST00000544418.1_5'UTR|BCAT1_ENST00000539282.1_Missense_Mutation_p.P292L|RP11-625L16.3_ENST00000545410.1_RNA|BCAT1_ENST00000342945.5_Missense_Mutation_p.P219L	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic	280					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	GCCATCTAGTGGAGGAGTTGC	0.418																																						dbGAP											0													70.0	67.0	68.0					12																	24989509		1913	4121	6034	-	-	-	SO:0001583	missense	0				CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.839C>T	12.37:g.24989509G>A	ENSP00000261192:p.Pro280Leu		B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Missense_Mutation	SNP	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.P280L	ENST00000261192.7	37	c.839	CCDS44845.1	12	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928260	0.92389	.	.	ENSG00000060982	ENST00000261192;ENST00000538118;ENST00000342945;ENST00000539282;ENST00000539780	T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72	5.11	4.22	0.49857	Aminotransferase, class IV, conserved site (1);	0.119294	0.56097	D	0.000021	T	0.58807	0.2148	M	0.90870	3.155	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.996;0.998;0.992;0.997;0.994	T	0.69822	-0.5041	10	0.87932	D	0	-13.3683	14.0828	0.64937	0.0729:0.0:0.9271:0.0	.	243;292;219;280;279	B7Z5L0;F5H5E4;B3KY27;P54687;Q68DQ7	.;.;.;BCAT1_HUMAN;.	L	280;279;219;292;243	ENSP00000261192:P280L;ENSP00000440817:P279L;ENSP00000339805:P219L;ENSP00000443459:P292L;ENSP00000440827:P243L	ENSP00000261192:P280L	P	-	2	0	BCAT1	24880776	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.291000	0.89927	1.284000	0.44531	0.650000	0.86243	CCA	BCAT1	-	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	ENSG00000060982		0.418	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BCAT1	HGNC	protein_coding	OTTHUMT00000402080.1	44	0.00	0	G	NM_005504		24989509	24989509	-1	no_errors	ENST00000261192	ensembl	human	known	69_37n	missense	104	37.72	63	SNP	1.000	A
BCORL1	63035	genome.wustl.edu	37	X	129155089	129155089	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chrX:129155089C>A	ENST00000218147.7	+	5	3768	c.3571C>A	c.(3571-3573)Cag>Aag	p.Q1191K	BCORL1_ENST00000303743.5_Missense_Mutation_p.Q1191K|BCORL1_ENST00000540052.1_Missense_Mutation_p.Q1191K|BCORL1_ENST00000359304.2_Missense_Mutation_p.Q1191K			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1191					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Q1191K(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GCCGGAGTCCCAGTCTCCAGG	0.622																																						dbGAP											1	Substitution - Missense(1)	prostate(1)											34.0	35.0	35.0					X																	129155089		2200	4299	6499	-	-	-	SO:0001583	missense	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.3571C>A	X.37:g.129155089C>A	ENSP00000218147:p.Gln1191Lys		B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q1191K	ENST00000218147.7	37	c.3571	CCDS14616.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.24|19.24	3.789600|3.789600	0.70337|0.70337	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000441294|ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	.|T;T;T;T;T	.|0.39592	.|1.07;1.43;1.07;1.07;1.5	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.239409	.|0.21703	.|N	.|0.070381	T|T	0.36386|0.36386	0.0965|0.0965	L|L	0.27053|0.27053	0.805|0.805	0.28758|0.28758	N|N	0.901059|0.901059	.|P;B	.|0.52692	.|0.955;0.41	.|P;B	.|0.47162	.|0.54;0.096	T|T	0.20472|0.20472	-1.0274|-1.0274	5|10	.|0.10111	.|T	.|0.7	-6.6112|-6.6112	16.7455|16.7455	0.85470|0.85470	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1191;1191	.|Q5H9F3-2;Q5H9F3	.|.;BCORL_HUMAN	Q|K	626|1191;1191;1191;1191;791	.|ENSP00000218147:Q1191K;ENSP00000307541:Q1191K;ENSP00000352253:Q1191K;ENSP00000437775:Q1191K;ENSP00000399483:Q791K	.|ENSP00000218147:Q1191K	P|Q	+|+	2|1	0|0	BCORL1|BCORL1	128982770|128982770	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.168000|2.168000	0.42424|0.42424	2.618000|2.618000	0.88619|0.88619	0.600000|0.600000	0.82982|0.82982	CCA|CAG	BCORL1	-	NULL	ENSG00000085185		0.622	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	31	0.00	0	C	NM_021946		129155089	129155089	+1	no_errors	ENST00000303743	ensembl	human	known	69_37n	missense	41	35.94	23	SNP	1.000	A
BRPF1	7862	genome.wustl.edu	37	3	9783057	9783057	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr3:9783057T>G	ENST00000457855.1	+	4	1799	c.1788T>G	c.(1786-1788)caT>caG	p.H596Q	BRPF1_ENST00000383829.2_Missense_Mutation_p.H596Q|BRPF1_ENST00000424362.1_Missense_Mutation_p.H596Q|BRPF1_ENST00000302054.3_Missense_Mutation_p.H596Q|BRPF1_ENST00000433861.2_Missense_Mutation_p.H596Q			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	596	Interaction with MEAF6 and ING5.|Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					GGCTCCGGCATGACTTGGAGC	0.512																																						dbGAP											0													65.0	73.0	70.0					3																	9783057		2203	4300	6503	-	-	-	SO:0001583	missense	0			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.1788T>G	3.37:g.9783057T>G	ENSP00000410210:p.His596Gln		B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,prints_Bromodomain,pfscan_PWWP,pfscan_Znf_PHD-finger,pfscan_Znf_C2H2,pfscan_Bromodomain	p.H596Q	ENST00000457855.1	37	c.1788	CCDS2575.1	3	.	.	.	.	.	.	.	.	.	.	T	16.94	3.259542	0.59321	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.15372	2.44;2.44;3.83;2.43;2.43	5.72	-3.81	0.04294	.	0.000000	0.85682	D	0.000000	T	0.15089	0.0364	L	0.31476	0.935	0.58432	D	0.999994	P;B;B;B	0.36183	0.542;0.189;0.094;0.407	P;B;B;B	0.48524	0.58;0.396;0.237;0.376	T	0.14615	-1.0466	10	0.06625	T	0.88	.	14.4594	0.67438	0.0:0.5268:0.0:0.4732	.	596;596;596;596	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	Q	596	ENSP00000402485:H596Q;ENSP00000398863:H596Q;ENSP00000373340:H596Q;ENSP00000306297:H596Q;ENSP00000410210:H596Q	ENSP00000306297:H596Q	H	+	3	2	BRPF1	9758057	0.120000	0.22244	0.990000	0.47175	0.941000	0.58515	-0.597000	0.05713	-0.407000	0.07576	0.533000	0.62120	CAT	BRPF1	-	NULL	ENSG00000156983		0.512	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRPF1	HGNC	protein_coding	OTTHUMT00000338485.1	40	0.00	0	T	NM_001003694		9783057	9783057	+1	no_errors	ENST00000383829	ensembl	human	known	69_37n	missense	56	13.85	9	SNP	0.640	G
C11orf24	53838	genome.wustl.edu	37	11	68030078	68030078	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr11:68030078C>T	ENST00000304271.6	-	4	787	c.385G>A	c.(385-387)Gcc>Acc	p.A129T	C11orf24_ENST00000533310.1_Intron|C11orf24_ENST00000530166.1_5'UTR	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	129						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						GCACTGGAGGCCACAGTCATA	0.617																																					NSCLC(21;855 905 4198 36694)	dbGAP											0													60.0	48.0	52.0					11																	68030078		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.385G>A	11.37:g.68030078C>T	ENSP00000307264:p.Ala129Thr		Q9H2K4	Missense_Mutation	SNP	NULL	p.A129T	ENST00000304271.6	37	c.385	CCDS8180.1	11	.	.	.	.	.	.	.	.	.	.	C	4.864	0.160551	0.09287	.	.	ENSG00000171067	ENST00000304271	T	0.30714	1.52	1.63	0.464	0.16706	.	.	.	.	.	T	0.26448	0.0646	L	0.36672	1.1	0.09310	N	0.999998	D	0.58620	0.983	P	0.51170	0.661	T	0.16660	-1.0395	9	0.08179	T	0.78	.	8.1395	0.31076	0.0:0.7479:0.2521:0.0	.	129	Q96F05	CK024_HUMAN	T	129	ENSP00000307264:A129T	ENSP00000307264:A129T	A	-	1	0	C11orf24	67786654	0.408000	0.25360	0.002000	0.10522	0.009000	0.06853	0.550000	0.23345	-0.464000	0.06963	0.298000	0.19748	GCC	C11orf24	-	NULL	ENSG00000171067		0.617	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf24	HGNC	protein_coding	OTTHUMT00000394750.1	26	0.00	0	C	NM_022338		68030078	68030078	-1	no_errors	ENST00000304271	ensembl	human	known	69_37n	missense	53	21.74	15	SNP	0.006	T
C17orf75	64149	genome.wustl.edu	37	17	30665245	30665245	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr17:30665245G>A	ENST00000577809.1	-	4	522	c.473C>T	c.(472-474)tCt>tTt	p.S158F	C17orf75_ENST00000225805.4_Missense_Mutation_p.S158F|RP11-227G15.3_ENST00000581915.1_RNA	NM_022344.3	NP_071739.2	Q9HAS0	NJMU_HUMAN	chromosome 17 open reading frame 75	158										ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TCCTTTTTCAGACCCTCCTAA	0.388																																						dbGAP											0													161.0	156.0	158.0					17																	30665245		1850	4101	5951	-	-	-	SO:0001583	missense	0			AB062437	CCDS58537.1	17q11.2	2013-01-21			ENSG00000108666	ENSG00000108666			30173	protein-coding gene	gene with protein product							Standard	NM_022344		Approved	NJMU-R1	uc002hhg.3	Q9HAS0		ENST00000577809.1:c.473C>T	17.37:g.30665245G>A	ENSP00000464275:p.Ser158Phe		Q7Z2H4	Missense_Mutation	SNP	NULL	p.S158F	ENST00000577809.1	37	c.473	CCDS58537.1	17	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840197	0.51057	.	.	ENSG00000108666	ENST00000225805	.	.	.	5.68	5.68	0.88126	.	0.060628	0.85682	D	0.000000	T	0.76076	0.3937	L	0.55481	1.735	0.80722	D	1	D	0.67145	0.996	D	0.65874	0.939	T	0.76942	-0.2772	9	0.72032	D	0.01	-12.642	19.7873	0.96444	0.0:0.0:1.0:0.0	.	158	Q9HAS0	NJMU_HUMAN	F	158	.	ENSP00000225805:S158F	S	-	2	0	C17orf75	27689358	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.323000	0.96364	2.693000	0.91896	0.561000	0.74099	TCT	C17orf75	-	NULL	ENSG00000108666		0.388	C17orf75-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	C17orf75	HGNC	protein_coding	OTTHUMT00000447204.1	44	0.00	0	G	NM_022344		30665245	30665245	-1	no_errors	ENST00000225805	ensembl	human	known	69_37n	missense	189	18.88	44	SNP	1.000	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43853546	43853546	+	Silent	SNP	C	C	T	rs200740249		TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr9:43853546C>T	ENST00000377564.3	+	12	2199	c.1806C>T	c.(1804-1806)tcC>tcT	p.S602S		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	602	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						GGAACCCATCCGGGCTTTACT	0.463																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1806C>T	9.37:g.43853546C>T			B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.P651L	ENST00000377564.3	37	c.1952	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	C	0.341	-0.950353	0.02285	.	.	ENSG00000154529	ENST00000377561	.	.	.	3.24	-6.01	0.02199	.	.	.	.	.	T	0.36358	0.0964	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42310	-0.9459	4	.	.	.	.	2.353	0.04288	0.2578:0.1026:0.1006:0.539	.	.	.	.	L	651	.	.	P	+	2	0	CNTNAP3B	43793542	0.050000	0.20438	0.236000	0.24074	0.133000	0.20885	-0.869000	0.04232	-0.650000	0.05423	-1.621000	0.00791	CCG	CNTNAP3B	-	superfamily_Fibrinogen_a/b/g_C	ENSG00000154529		0.463	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	10	0.00	0	C			43853546	43853546	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000377561	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.790	T
CUBN	8029	genome.wustl.edu	37	10	16916414	16916414	+	Silent	SNP	C	C	G			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr10:16916414C>G	ENST00000377833.4	-	58	9260	c.9195G>C	c.(9193-9195)ctG>ctC	p.L3065L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3065	CUB 23. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGATGGTATACAGACAGTGCA	0.418																																						dbGAP											0													221.0	179.0	193.0					10																	16916414		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9195G>C	10.37:g.16916414C>G			B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.L3065	ENST00000377833.4	37	c.9195	CCDS7113.1	10																																																																																			CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.418	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	69	0.00	0	C	NM_001081		16916414	16916414	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	silent	107	51.80	115	SNP	0.045	G
CYP4V2	285440	genome.wustl.edu	37	4	187130348	187130348	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr4:187130348C>T	ENST00000378802.4	+	10	1631	c.1327C>T	c.(1327-1329)Cgg>Tgg	p.R443W	CYP4V2_ENST00000502665.1_3'UTR	NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2	443			R -> Q (in dbSNP:rs72646291). {ECO:0000269|Ref.3}.		fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		CCAGCCTGAGCGGTTCTTCCC	0.522																																						dbGAP											0													119.0	107.0	111.0					4																	187130348		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379	ENST00000378802.4:c.1327C>T	4.37:g.187130348C>T	ENSP00000368079:p.Arg443Trp		B7U6W2|Q6ZTM4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R443W	ENST00000378802.4	37	c.1327	CCDS34119.1	4	.	.	.	.	.	.	.	.	.	.	C	13.69	2.310976	0.40895	.	.	ENSG00000145476	ENST00000378802;ENST00000274118	D	0.94280	-3.39	5.39	1.19	0.21007	.	0.000000	0.85682	D	0.000000	D	0.98018	0.9347	H	0.98466	4.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98971	1.0801	10	0.87932	D	0	.	17.1486	0.86772	0.7442:0.2558:0.0:0.0	.	443	Q6ZWL3	CP4V2_HUMAN	W	443;421	ENSP00000368079:R443W	ENSP00000274118:R421W	R	+	1	2	CYP4V2	187367342	0.758000	0.28405	0.113000	0.21522	0.150000	0.21749	0.047000	0.14056	-0.013000	0.14199	0.655000	0.94253	CGG	CYP4V2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000145476		0.522	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4V2	HGNC	protein_coding	OTTHUMT00000360398.1	18	0.00	0	C	XM_209612		187130348	187130348	+1	no_errors	ENST00000378802	ensembl	human	known	69_37n	missense	63	45.69	53	SNP	0.696	T
DENND2D	79961	genome.wustl.edu	37	1	111739850	111739850	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr1:111739850G>A	ENST00000357640.4	-	5	681	c.452C>T	c.(451-453)cCc>cTc	p.P151L	DENND2D_ENST00000473682.1_5'UTR|DENND2D_ENST00000369752.5_Missense_Mutation_p.P148L	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	151	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		GTACACTTTGGGAAGGCGAGG	0.602																																						dbGAP											0													46.0	41.0	43.0					1																	111739850		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.452C>T	1.37:g.111739850G>A	ENSP00000350266:p.Pro151Leu		Q5T5V6|Q9BSU0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.P151L	ENST00000357640.4	37	c.452	CCDS831.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.242236	0.95272	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.13420	2.59;2.59	5.59	5.59	0.84812	DENN (3);	0.000000	0.85682	D	0.000000	T	0.32556	0.0833	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.01925	-1.1246	10	0.54805	T	0.06	-17.8126	17.4288	0.87533	0.0:0.0:1.0:0.0	.	148;151	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	L	151;148	ENSP00000350266:P151L;ENSP00000358767:P148L	ENSP00000350266:P151L	P	-	2	0	DENND2D	111541373	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	9.370000	0.97159	2.789000	0.95967	0.655000	0.94253	CCC	DENND2D	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000162777		0.602	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	HGNC	protein_coding	OTTHUMT00000034456.1	32	0.00	0	G	NM_024901		111739850	111739850	-1	no_errors	ENST00000357640	ensembl	human	known	69_37n	missense	21	58.00	29	SNP	1.000	A
RIPPLY3	53820	genome.wustl.edu	37	21	38390212	38390212	+	Missense_Mutation	SNP	G	G	A	rs533700142		TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr21:38390212G>A	ENST00000329553.2	+	4	488	c.278G>A	c.(277-279)cGg>cAg	p.R93Q	RIPPLY3_ENST00000485272.1_3'UTR	NM_018962.2	NP_061835.1	P57055	DSCR6_HUMAN	ripply transcriptional repressor 3	93	Ripply homology domain.				heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pharyngeal system development (GO:0060037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											GAATACCTGCGGAGTTCCGGG	0.448																																						dbGAP											0													41.0	40.0	40.0					21																	38390212		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037158	CCDS13648.1	21q22.2	2013-07-23	2013-07-23	2013-06-04	ENSG00000183145	ENSG00000183145			3047	protein-coding gene	gene with protein product		609892	"""Down syndrome critical region gene 6"", ""ripply3 homolog (zebrafish)"""	DSCR6		10814524, 22354841	Standard	NM_018962		Approved			P57055	OTTHUMG00000086639	ENST00000329553.2:c.278G>A	21.37:g.38390212G>A	ENSP00000331734:p.Arg93Gln			Missense_Mutation	SNP	NULL	p.R93Q	ENST00000329553.2	37	c.278	CCDS13648.1	21	.	.	.	.	.	.	.	.	.	.	G	0.993	-0.693457	0.03303	.	.	ENSG00000183145	ENST00000329553	.	.	.	4.77	2.39	0.29439	.	0.470179	0.21603	N	0.071901	T	0.05960	0.0155	N	0.00170	-1.935	0.21878	N	0.999499	B	0.02656	0.0	B	0.01281	0.0	T	0.37103	-0.9720	9	0.17369	T	0.5	-18.2667	6.8157	0.23829	0.8073:0.0:0.1927:0.0	.	93	P57055	DSCR6_HUMAN	Q	93	.	ENSP00000331734:R93Q	R	+	2	0	DSCR6	37312082	0.999000	0.42202	0.990000	0.47175	0.408000	0.30992	0.574000	0.23714	0.389000	0.25086	-0.415000	0.06103	CGG	DSCR6	-	NULL	ENSG00000183145		0.448	RIPPLY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR6	HGNC	protein_coding	OTTHUMT00000194703.1	14	0.00	0	G			38390212	38390212	+1	no_errors	ENST00000329553	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	0.995	A
GALNT18	374378	genome.wustl.edu	37	11	11394113	11394113	+	Silent	SNP	C	C	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr11:11394113C>T	ENST00000227756.4	-	6	1452	c.1041G>A	c.(1039-1041)ctG>ctA	p.L347L		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	347	Catalytic subdomain B.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										TGCCTTCGTCCAGCAGGCCGA	0.612																																						dbGAP											0													94.0	74.0	81.0					11																	11394113		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.1041G>A	11.37:g.11394113C>T			O95903|Q8NDY9	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.L347	ENST00000227756.4	37	c.1041	CCDS7807.1	11																																																																																			GALNTL4	-	NULL	ENSG00000110328		0.612	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL4	HGNC	protein_coding	OTTHUMT00000385848.1	29	0.00	0	C	NM_198516		11394113	11394113	-1	no_errors	ENST00000227756	ensembl	human	known	69_37n	silent	74	29.52	31	SNP	1.000	T
HSPH1	10808	genome.wustl.edu	37	13	31714438	31714438	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr13:31714438C>A	ENST00000320027.5	-	14	2207	c.1863G>T	c.(1861-1863)atG>atT	p.M621I	HSPH1_ENST00000429785.2_Missense_Mutation_p.M440I|HSPH1_ENST00000445273.2_Missense_Mutation_p.M623I|HSPH1_ENST00000380405.4_Missense_Mutation_p.M577I|HSPH1_ENST00000380406.5_Missense_Mutation_p.M580I	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	621					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		CTTGCATTATCATCTTACCCT	0.338																																						dbGAP											0													186.0	153.0	164.0					13																	31714438		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.1863G>T	13.37:g.31714438C>A	ENSP00000318687:p.Met621Ile		B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.M623I	ENST00000320027.5	37	c.1869	CCDS9340.1	13	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890972	0.91889	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000429785	T;T;T;T;T	0.04234	3.67;3.67;3.67;3.67;3.67	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.28366	0.0701	M	0.86502	2.82	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.996;0.995;0.998;0.995	D;D;D;D;D	0.75020	0.985;0.966;0.968;0.966;0.968	T	0.01118	-1.1446	10	0.62326	D	0.03	-27.3774	20.3473	0.98799	0.0:1.0:0.0:0.0	.	440;580;623;577;621	B4DY72;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	I	621;577;580;623;440	ENSP00000318687:M621I;ENSP00000369768:M577I;ENSP00000369769:M580I;ENSP00000396090:M623I;ENSP00000388778:M440I	ENSP00000318687:M621I	M	-	3	0	HSPH1	30612438	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.445000	0.80570	2.884000	0.98904	0.655000	0.94253	ATG	HSPH1	-	pfam_Hsp_70_fam	ENSG00000120694		0.338	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPH1	HGNC	protein_coding	OTTHUMT00000044384.1	102	0.00	0	C			31714438	31714438	-1	no_errors	ENST00000445273	ensembl	human	known	69_37n	missense	228	33.43	115	SNP	1.000	A
KIAA1715	80856	genome.wustl.edu	37	2	176812363	176812363	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr2:176812363T>A	ENST00000272748.4	-	9	798	c.551A>T	c.(550-552)aAc>aTc	p.N184I	KIAA1715_ENST00000544803.1_Missense_Mutation_p.N184I|KIAA1715_ENST00000535310.1_Missense_Mutation_p.N109I	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	184	Pro-rich.				blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			AGGGCCCTGGTTAGGGCTTGC	0.498																																						dbGAP											0													136.0	125.0	129.0					2																	176812363		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.551A>T	2.37:g.176812363T>A	ENSP00000272748:p.Asn184Ile		B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	pfam_DUF2296	p.N184I	ENST00000272748.4	37	c.551	CCDS33332.1	2	.	.	.	.	.	.	.	.	.	.	T	10.34	1.324286	0.24080	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803;ENST00000535310	.	.	.	6.02	2.53	0.30540	.	0.468618	0.28343	N	0.015700	T	0.29783	0.0744	L	0.36672	1.1	0.29443	N	0.858997	D;B;B;B	0.53151	0.958;0.164;0.061;0.043	P;B;B;B	0.47981	0.563;0.081;0.01;0.032	T	0.24083	-1.0170	9	0.87932	D	0	-0.4242	4.1439	0.10207	0.0:0.3025:0.1746:0.5229	.	186;184;181;184	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	I	184;186;61;184;109	.	ENSP00000272748:N184I	N	-	2	0	KIAA1715	176520609	0.997000	0.39634	0.838000	0.33150	0.733000	0.41908	0.532000	0.23067	0.229000	0.21039	-0.313000	0.08912	AAC	KIAA1715	-	NULL	ENSG00000144320		0.498	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1715	HGNC	protein_coding	OTTHUMT00000333949.3	58	0.00	0	T	XM_042834		176812363	176812363	-1	no_errors	ENST00000544803	ensembl	human	known	69_37n	missense	116	21.85	33	SNP	0.940	A
KRTAP4-7	100132476	genome.wustl.edu	37	17	39240627	39240627	+	Missense_Mutation	SNP	T	T	C	rs189343211		TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr17:39240627T>C	ENST00000391417.4	+	1	169	c.169T>C	c.(169-171)Tct>Cct	p.S57P		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	57	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S57P(4)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						GTGCTGCCAGTCTGTGTGCTG	0.667																																						dbGAP											4	Substitution - Missense(4)	urinary_tract(2)|kidney(2)											18.0	28.0	25.0					17																	39240627		691	1590	2281	-	-	-	SO:0001583	missense	0			AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.169T>C	17.37:g.39240627T>C	ENSP00000375236:p.Ser57Pro		A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	pfam_Keratin-assoc	p.S57P	ENST00000391417.4	37	c.169	CCDS45673.1	17	.	.	.	.	.	.	.	.	.	.	.	0.387	-0.925721	0.02377	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.01272	5.07	3.6	-0.386	0.12466	.	1.254490	0.05892	N	0.628448	T	0.00695	0.0023	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.43572	-0.9383	9	0.02654	T	1	.	4.4551	0.11639	0.0:0.4346:0.1731:0.3923	.	57	Q9BYR0	KRA47_HUMAN	P	57	ENSP00000375236:S57P	ENSP00000375236:S57P	S	+	1	0	KRTAP4-9;KRTAP4-7	36494153	0.000000	0.05858	0.033000	0.17914	0.157000	0.22087	-0.806000	0.04525	0.004000	0.14682	0.374000	0.22700	TCT	KRTAP4-7	-	pfam_Keratin-assoc	ENSG00000240871		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-7	HGNC	protein_coding	OTTHUMT00000257686.1	33	0.00	0	T			39240627	39240627	+1	no_errors	ENST00000391417	ensembl	human	known	69_37n	missense	196	10.09	22	SNP	0.032	C
KRTAP4-9	100132386	genome.wustl.edu	37	17	39261786	39261786	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr17:39261786G>A	ENST00000391415.1	+	1	203	c.146G>A	c.(145-147)tGc>tAc	p.C49Y		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	49	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						GTATCCAGCTGCTGCAGGCCC	0.657																																						dbGAP											0													15.0	22.0	20.0					17																	39261786		686	1591	2277	-	-	-	SO:0001583	missense	0			AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.146G>A	17.37:g.39261786G>A	ENSP00000375234:p.Cys49Tyr			Missense_Mutation	SNP	pfam_Keratin-assoc	p.C49Y	ENST00000391415.1	37	c.146	CCDS54124.1	17	.	.	.	.	.	.	.	.	.	.	.	11.48	1.651692	0.29336	.	.	ENSG00000212722	ENST00000391415;ENST00000333994	T	0.42131	0.98	3.38	3.38	0.38709	.	0.280082	0.18970	U	0.126152	T	0.64811	0.2632	H	0.94345	3.525	0.40109	D	0.976467	P	0.47484	0.896	P	0.51415	0.669	T	0.76906	-0.2786	10	0.87932	D	0	.	12.6519	0.56766	0.0:0.0:1.0:0.0	.	49	Q9BYQ8	KRA49_HUMAN	Y	49	ENSP00000375234:C49Y	ENSP00000334461:C49Y	C	+	2	0	KRTAP4-9	36515312	1.000000	0.71417	0.987000	0.45799	0.600000	0.36913	2.796000	0.47869	1.612000	0.50221	0.306000	0.20318	TGC	KRTAP4-9	-	pfam_Keratin-assoc	ENSG00000212722		0.657	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-9	HGNC	protein_coding	OTTHUMT00000257688.1	30	0.00	0	G	NM_001146041		39261786	39261786	+1	no_errors	ENST00000391415	ensembl	human	known	69_37n	missense	152	10.53	18	SNP	1.000	A
L1CAM	3897	genome.wustl.edu	37	X	153130895	153130895	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chrX:153130895G>A	ENST00000370060.1	-	21	2797	c.2608C>T	c.(2608-2610)Cat>Tat	p.H870Y	L1CAM_ENST00000543994.1_Missense_Mutation_p.H872Y|L1CAM_ENST00000370055.1_Missense_Mutation_p.H865Y|L1CAM_ENST00000370057.3_Missense_Mutation_p.H870Y|L1CAM_ENST00000361699.4_Missense_Mutation_p.H870Y|L1CAM_ENST00000538883.1_Missense_Mutation_p.H872Y|L1CAM_ENST00000361981.3_Missense_Mutation_p.H865Y	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	870	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCACCACATGGTCTTTGTGG	0.592																																						dbGAP											0													197.0	147.0	164.0					X																	153130895		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2608C>T	X.37:g.153130895G>A	ENSP00000359077:p.His870Tyr		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.H872Y	ENST00000370060.1	37	c.2614	CCDS14733.1	X	.	.	.	.	.	.	.	.	.	.	G	0.054	-1.240503	0.01493	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.07	3.17	0.36434	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.374017	0.21691	N	0.070565	T	0.43411	0.1246	L	0.36672	1.1	0.09310	N	1	P;P;B	0.39443	0.588;0.674;0.034	P;P;B	0.49799	0.622;0.491;0.021	T	0.43048	-0.9415	10	0.02654	T	1	.	5.7908	0.18359	0.1014:0.0:0.5781:0.3205	.	865;870;870	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	Y	870;872;870;872;865;865;870	ENSP00000359077:H870Y;ENSP00000438430:H872Y;ENSP00000359074:H870Y;ENSP00000439645:H872Y;ENSP00000354712:H865Y;ENSP00000359072:H865Y;ENSP00000355380:H870Y	ENSP00000355380:H870Y	H	-	1	0	L1CAM	152784089	0.002000	0.14202	0.137000	0.22149	0.223000	0.24884	1.182000	0.32029	2.101000	0.63845	0.529000	0.55759	CAT	L1CAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000198910		0.592	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	26	0.00	0	G	NM_024003		153130895	153130895	-1	no_errors	ENST00000543994	ensembl	human	known	69_37n	missense	139	18.60	32	SNP	0.000	A
LRP1	4035	genome.wustl.edu	37	12	57604136	57604136	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr12:57604136C>A	ENST00000243077.3	+	82	13093	c.12627C>A	c.(12625-12627)agC>agA	p.S4209R		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4209	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ACGGTGGCAGCTGTTTCCTCA	0.622																																						dbGAP											0													52.0	52.0	52.0					12																	57604136		2203	4300	6503	-	-	-	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.12627C>A	12.37:g.57604136C>A	ENSP00000243077:p.Ser4209Arg		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S4209R	ENST00000243077.3	37	c.12627	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	13.91	2.379140	0.42207	.	.	ENSG00000123384	ENST00000243077	D	0.90444	-2.67	4.44	2.56	0.30785	Growth factor, receptor (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.81616	0.4860	L	0.39020	1.185	0.80722	D	1	B	0.32573	0.376	B	0.32864	0.154	T	0.72530	-0.4265	10	0.12103	T	0.63	.	6.3895	0.21579	0.0:0.6653:0.1549:0.1798	.	4209	Q07954	LRP1_HUMAN	R	4209	ENSP00000243077:S4209R	ENSP00000243077:S4209R	S	+	3	2	LRP1	55890403	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.696000	0.37773	1.218000	0.43458	0.455000	0.32223	AGC	LRP1	-	superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom	ENSG00000123384		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	15	0.00	0	C	NM_002332		57604136	57604136	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	1.000	A
LRRC37A4P	55073	genome.wustl.edu	37	17	43592301	43592301	+	RNA	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr17:43592301G>A	ENST00000579913.1	-	0	221				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		CTGGACTCCCGAGCCTTTTTT	0.577																																						dbGAP											0																																										-	-	-			0			AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43592301G>A				RNA	SNP	-	NULL	ENST00000579913.1	37	NULL		17																																																																																			LRRC37A4P	-	-	ENSG00000214425		0.577	LRRC37A4P-002	KNOWN	basic	processed_transcript	LRRC37A4P	HGNC	pseudogene	OTTHUMT00000445300.1	14	0.00	0	G	NR_002940		43592301	43592301	-1	no_errors	ENST00000579913	ensembl	human	known	69_37n	rna	25	28.57	10	SNP	0.000	A
MKRN3	7681	genome.wustl.edu	37	15	23811029	23811029	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr15:23811029G>A	ENST00000314520.3	+	1	576	c.100G>A	c.(100-102)Gtc>Atc	p.V34I	MKRN3_ENST00000568252.1_Missense_Mutation_p.V34I|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Missense_Mutation_p.V34I	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	34					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GGACCTTCCCGTCTGTGAGCC	0.677																																						dbGAP											0													32.0	39.0	37.0					15																	23811029		2202	4299	6501	-	-	-	SO:0001583	missense	0			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.100G>A	15.37:g.23811029G>A	ENSP00000313881:p.Val34Ile			Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.V34I	ENST00000314520.3	37	c.100	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	g	12.76	2.034847	0.35893	.	.	ENSG00000179455	ENST00000314520	T	0.30448	1.53	3.24	-1.2	0.09554	.	0.347490	0.24130	U	0.041268	T	0.10380	0.0254	N	0.08118	0	0.09310	N	1	B;B	0.30211	0.049;0.273	B;B	0.17722	0.011;0.019	T	0.14309	-1.0477	10	0.36615	T	0.2	.	4.2233	0.10568	0.2427:0.3969:0.3603:0.0	.	34;34	Q6NSB6;Q13064	.;MKRN3_HUMAN	I	34	ENSP00000313881:V34I	ENSP00000313881:V34I	V	+	1	0	MKRN3	21362122	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.346000	0.07760	-0.228000	0.09869	0.467000	0.42956	GTC	MKRN3	-	NULL	ENSG00000179455		0.677	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	11	0.00	0	G	NM_005664		23811029	23811029	+1	no_errors	ENST00000314520	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.000	A
MEF2A	4205	genome.wustl.edu	37	15	100252738	100252738	+	Missense_Mutation	SNP	A	A	C	rs560400205|rs201861701	byFrequency	TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr15:100252738A>C	ENST00000557785.1	+	11	1605	c.1256A>C	c.(1255-1257)cAg>cCg	p.Q419P	MEF2A_ENST00000453228.2_Missense_Mutation_p.Q419P|MEF2A_ENST00000354410.5_Missense_Mutation_p.Q421P|MEF2A_ENST00000558812.1_Missense_Mutation_p.Q359P|MEF2A_ENST00000338042.6_Missense_Mutation_p.Q428P|MEF2A_ENST00000449277.2_Missense_Mutation_p.Q351P|MEF2A_ENST00000557942.1_Missense_Mutation_p.Q427P	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	429					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			cagcagcagcagcagcCGCCG	0.637																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1256A>C	15.37:g.100252738A>C	ENSP00000453441:p.Gln419Pro		B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.Q428P	ENST00000557785.1	37	c.1283	CCDS53978.1	15	.	.	.	.	.	.	.	.	.	.	a	0	-2.790689	0.00077	.	.	ENSG00000068305	ENST00000453228;ENST00000354410;ENST00000338042;ENST00000449277	T;T;T	0.07800	3.16;3.16;3.16	0.337	0.337	0.15966	.	.	.	.	.	T	0.08802	0.0218	N	0.08118	0	0.18873	N	0.999989	B;B;B;D;B;D	0.53462	0.0;0.0;0.0;0.96;0.001;0.96	B;B;B;D;B;D	0.64237	0.0;0.0;0.0;0.923;0.0;0.923	T	0.40776	-0.9545	8	0.23891	T	0.37	.	.	.	.	.	429;359;340;419;421;427	Q02078;B4DFQ7;Q7Z6C9;Q02078-6;Q02078-5;Q02078-2	MEF2A_HUMAN;.;.;.;.;.	P	419;421;428;359	ENSP00000404110:Q419P;ENSP00000346389:Q421P;ENSP00000337202:Q428P	ENSP00000337202:Q428P	Q	+	2	0	MEF2A	98070261	0.962000	0.33011	0.021000	0.16686	0.081000	0.17604	-0.272000	0.08560	0.353000	0.24079	0.342000	0.21767	CAG	MEF2A	-	NULL	ENSG00000068305		0.637	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MEF2A	HGNC	protein_coding	OTTHUMT00000415985.1	14	0.00	0	A			100252738	100252738	+1	no_errors	ENST00000338042	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.928	C
MLC1	23209	genome.wustl.edu	37	22	50512644	50512644	+	Splice_Site	SNP	C	C	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr22:50512644C>T	ENST00000311597.5	-	8	1321		c.e8+1		MLC1_ENST00000483836.1_5'Flank|MLC1_ENST00000538737.1_Splice_Site|MLC1_ENST00000431262.2_Splice_Site|MLC1_ENST00000395876.2_Splice_Site|MLC1_ENST00000450140.2_Splice_Site|MLC1_ENST00000535444.1_Splice_Site	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1						caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		GGGTTACTCACGGCCACTAGG	0.617																																						dbGAP											0			GRCh37	CS063337	MLC1	S							72.0	57.0	62.0					22																	50512644		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.714+1G>A	22.37:g.50512644C>T			B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Splice_Site	SNP	-	e7+1	ENST00000311597.5	37	c.714+1	CCDS14083.1	22	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987694	0.35036	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140;ENST00000442311	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4479	0.75248	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MLC1	48854771	1.000000	0.71417	0.980000	0.43619	0.053000	0.15095	6.517000	0.73759	2.431000	0.82371	0.655000	0.94253	.	MLC1	-	-	ENSG00000100427		0.617	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	HGNC	protein_coding	OTTHUMT00000316979.2	26	0.00	0	C	NM_015166	Intron	50512644	50512644	-1	no_errors	ENST00000311597	ensembl	human	known	69_37n	splice_site	15	60.53	23	SNP	1.000	T
MMAA	166785	genome.wustl.edu	37	4	146576496	146576496	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr4:146576496T>G	ENST00000281317.5	+	7	2377	c.1167T>G	c.(1165-1167)atT>atG	p.I389M	MMAA_ENST00000541599.1_Missense_Mutation_p.I108M	NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type	389					cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGGAACAGATTCCACTTCTGG	0.453																																						dbGAP											0													79.0	78.0	78.0					4																	146576496		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.1167T>G	4.37:g.146576496T>G	ENSP00000281317:p.Ile389Met		B3KX40|Q495G7	Missense_Mutation	SNP	pfam_ArgK,pfam_Cbl_biosynth_CobW-like,tigrfam_ArgK	p.I389M	ENST00000281317.5	37	c.1167	CCDS3766.1	4	.	.	.	.	.	.	.	.	.	.	T	14.14	2.446176	0.43429	.	.	ENSG00000151611	ENST00000281317;ENST00000537246;ENST00000541599	D;D	0.91631	-2.88;-2.88	5.67	1.53	0.23141	.	0.104298	0.64402	D	0.000004	D	0.93291	0.7862	M	0.77616	2.38	0.50813	D	0.999893	D	0.54601	0.967	P	0.55577	0.779	D	0.90191	0.4250	10	0.36615	T	0.2	-12.2007	9.9098	0.41399	0.0:0.3956:0.0:0.6044	.	389	Q8IVH4	MMAA_HUMAN	M	389;389;108	ENSP00000281317:I389M;ENSP00000442284:I108M	ENSP00000281317:I389M	I	+	3	3	MMAA	146795946	0.897000	0.30589	0.994000	0.49952	0.217000	0.24651	-0.065000	0.11617	0.028000	0.15324	0.533000	0.62120	ATT	MMAA	-	tigrfam_ArgK	ENSG00000151611		0.453	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMAA	HGNC	protein_coding	OTTHUMT00000364668.2	16	0.00	0	T			146576496	146576496	+1	no_errors	ENST00000281317	ensembl	human	known	69_37n	missense	46	34.29	24	SNP	0.998	G
MTERF4	130916	genome.wustl.edu	37	2	242038987	242038987	+	Missense_Mutation	SNP	A	A	C			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr2:242038987A>C	ENST00000391980.2	-	2	402	c.344T>G	c.(343-345)gTa>gGa	p.V115G	MTERFD2_ENST00000407095.3_Missense_Mutation_p.V115G|MTERFD2_ENST00000495694.1_Missense_Mutation_p.V115G|MTERFD2_ENST00000406593.1_Intron|MTERFD2_ENST00000464344.2_Intron	NM_182501.3	NP_872307.2	Q7Z6M4	MTEF4_HUMAN		115					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	rRNA binding (GO:0019843)			endometrium(3)|large_intestine(6)|lung(5)|ovary(1)|skin(2)|urinary_tract(3)	20		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		ACCTCGCCGTACACTGAGCAA	0.483																																						dbGAP											0													121.0	120.0	120.0					2																	242038987		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000391980.2:c.344T>G	2.37:g.242038987A>C	ENSP00000375840:p.Val115Gly		A8K6K0|Q9P0E0	Missense_Mutation	SNP	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	p.V115G	ENST00000391980.2	37	c.344	CCDS2544.1	2	.	.	.	.	.	.	.	.	.	.	A	12.99	2.102994	0.37145	.	.	ENSG00000122085	ENST00000495694;ENST00000401626;ENST00000391980;ENST00000424798;ENST00000407095;ENST00000434791	T;T;T;T;T;T	0.50277	0.75;0.8;2.78;2.78;2.78;0.81	5.03	2.63	0.31362	.	1.677320	0.03209	N	0.175872	T	0.40839	0.1133	L	0.29908	0.895	0.09310	N	1	B;B	0.27316	0.022;0.175	B;B	0.33254	0.071;0.16	T	0.31998	-0.9923	10	0.27082	T	0.32	-3.0516	7.6704	0.28455	0.8231:0.0:0.1769:0.0	.	115;115	B4DKD5;Q7Z6M4	.;MTER2_HUMAN	G	115;115;115;108;115;94	ENSP00000419315:V115G;ENSP00000385183:V115G;ENSP00000375840:V115G;ENSP00000409023:V108G;ENSP00000385630:V115G;ENSP00000393063:V94G	ENSP00000241527:V115G	V	-	2	0	MTERFD2	241687660	0.001000	0.12720	0.001000	0.08648	0.220000	0.24768	1.228000	0.32588	0.776000	0.33473	0.482000	0.46254	GTA	MTERFD2	-	pfam_Mit_transcrip_term-rel	ENSG00000122085		0.483	MTERFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTERFD2	HGNC	protein_coding	OTTHUMT00000323798.4	33	0.00	0	A			242038987	242038987	-1	no_errors	ENST00000241527	ensembl	human	known	69_37n	missense	113	21.53	31	SNP	0.001	C
MUC17	140453	genome.wustl.edu	37	7	100679631	100679631	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr7:100679631G>A	ENST00000306151.4	+	3	4998	c.4934G>A	c.(4933-4935)aGt>aAt	p.S1645N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1645	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCGGTGGCCAGTCCTGAGGCT	0.493																																						dbGAP											0													236.0	246.0	243.0					7																	100679631		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4934G>A	7.37:g.100679631G>A	ENSP00000302716:p.Ser1645Asn		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S1645N	ENST00000306151.4	37	c.4934	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	1.128	-0.653205	0.03480	.	.	ENSG00000169876	ENST00000306151	T	0.02301	4.35	0.932	-1.86	0.07760	.	.	.	.	.	T	0.00845	0.0028	N	0.03608	-0.345	0.09310	N	1	P	0.42993	0.797	B	0.31686	0.134	T	0.50816	-0.8783	9	0.18276	T	0.48	.	6.4998	0.22162	0.0:0.4172:0.5828:0.0	.	1645	Q685J3	MUC17_HUMAN	N	1645	ENSP00000302716:S1645N	ENSP00000302716:S1645N	S	+	2	0	MUC17	100466351	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.769000	0.01792	-0.958000	0.03622	0.134000	0.15878	AGT	MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	99	0.00	0	G	NM_001040105		100679631	100679631	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	366	15.86	69	SNP	0.000	A
NOL12	79159	genome.wustl.edu	37	22	38083918	38083918	+	Splice_Site	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr22:38083918G>A	ENST00000359114.4	+	2	155	c.85G>A	c.(85-87)Gag>Aag	p.E29K	NOL12_ENST00000493862.1_3'UTR	NM_024313.2	NP_077289.1	Q9UGY1	NOL12_HUMAN	nucleolar protein 12	29						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	8	Melanoma(58;0.0574)					TTCCTGTAGGGAGTACCTGAC	0.537																																						dbGAP											0													23.0	21.0	22.0					22																	38083918		2195	4286	6481	-	-	-	SO:0001630	splice_region_variant	0			Z83844	CCDS13955.1	22q13.1	2012-05-02			ENSG00000256872	ENSG00000273899			28585	protein-coding gene	gene with protein product						12477932	Standard	NM_024313		Approved	MGC3731, Nop25, RRP17	uc003atp.3	Q9UGY1	OTTHUMG00000150660	ENST00000359114.4:c.84-1G>A	22.37:g.38083918G>A				Missense_Mutation	SNP	pfam_Nucleolar_protein_12	p.E29K	ENST00000359114.4	37	c.85	CCDS13955.1	22	.	.	.	.	.	.	.	.	.	.	G	35	5.468490	0.96274	.	.	ENSG00000256872	ENST00000359114	D	0.83250	-1.7	5.42	5.42	0.78866	.	0.189759	0.53938	D	0.000041	D	0.88955	0.6578	M	0.87097	2.86	0.58432	D	0.999998	P	0.47484	0.896	P	0.48952	0.596	D	0.90913	0.4777	10	0.72032	D	0.01	-5.8981	16.9919	0.86356	0.0:0.0:1.0:0.0	.	29	Q9UGY1	NOL12_HUMAN	K	29	ENSP00000352021:E29K	ENSP00000352021:E29K	E	+	1	0	Z83844.2	36413864	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	8.763000	0.91715	2.534000	0.85438	0.643000	0.83706	GAG	NOL12	-	pfam_Nucleolar_protein_12	ENSG00000256872		0.537	NOL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL12	HGNC	protein_coding	OTTHUMT00000319476.1	19	0.00	0	G	NM_024313	Missense_Mutation	38083918	38083918	+1	no_errors	ENST00000359114	ensembl	human	known	69_37n	missense	12	58.62	17	SNP	1.000	A
NOTO	344022	genome.wustl.edu	37	2	73438003	73438003	+	Missense_Mutation	SNP	C	C	A	rs541008172		TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr2:73438003C>A	ENST00000398468.3	+	3	1111	c.702C>A	c.(700-702)agC>agA	p.S234R		NM_001134462.1	NP_001127934.1	A8MTQ0	NOTO_HUMAN	notochord homeobox	234					cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|notochord development (GO:0030903)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)	2						AGCCTTCCAGCAGCTCCATCG	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		20982	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													58.0	54.0	55.0					2																	73438003		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46335.1	2p13.2	2011-06-20	2007-02-15		ENSG00000214513	ENSG00000214513		"""Homeoboxes / ANTP class : NKL subclass"""	31839	protein-coding gene	gene with protein product			"""notochord homolog (Xenopus laevis)"""			15231714	Standard	NM_001134462		Approved		uc010yrd.2	A8MTQ0	OTTHUMG00000164128	ENST00000398468.3:c.702C>A	2.37:g.73438003C>A	ENSP00000381486:p.Ser234Arg		B4DJ59|B7ZAU5	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.S234R	ENST00000398468.3	37	c.702	CCDS46335.1	2	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393459	0.62066	.	.	ENSG00000214513	ENST00000398468	D	0.92752	-3.1	5.03	3.2	0.36748	.	.	.	.	.	D	0.86297	0.5899	L	0.29908	0.895	0.30214	N	0.797408	P	0.41978	0.767	B	0.40940	0.344	T	0.81850	-0.0743	9	0.39692	T	0.17	-15.3802	9.0356	0.36284	0.0:0.8184:0.0:0.1816	.	234	A8MTQ0	NOTO_HUMAN	R	234	ENSP00000381486:S234R	ENSP00000381486:S234R	S	+	3	2	NOTO	73291511	0.998000	0.40836	1.000000	0.80357	0.805000	0.45488	0.714000	0.25808	1.258000	0.44101	0.650000	0.86243	AGC	NOTO	-	NULL	ENSG00000214513		0.587	NOTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTO	HGNC	protein_coding	OTTHUMT00000377385.2	21	0.00	0	C	XM_292889		73438003	73438003	+1	no_errors	ENST00000398468	ensembl	human	known	69_37n	missense	58	18.31	13	SNP	1.000	A
NT5E	4907	genome.wustl.edu	37	6	86181085	86181085	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr6:86181085G>T	ENST00000257770.3	+	3	742	c.693G>T	c.(691-693)caG>caT	p.Q231H	NT5E_ENST00000369651.3_Missense_Mutation_p.Q231H|NT5E_ENST00000369646.3_Missense_Mutation_p.Q231H	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	231					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	TCATCGCTCAGAAAGTGAGGG	0.418																																					Melanoma(140;797 1765 2035 2752 18208)	dbGAP											0													110.0	108.0	109.0					6																	86181085		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.693G>T	6.37:g.86181085G>T	ENSP00000257770:p.Gln231His		B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	pfam_5'-Nucleotdase_C,pfam_Metallo_PEstase_dom,superfamily_5'-Nucleotdase_C,prints_5_nucleotidase/apyrase	p.Q231H	ENST00000257770.3	37	c.693	CCDS5002.1	6	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063539	0.55432	.	.	ENSG00000135318	ENST00000369647;ENST00000257770;ENST00000369646;ENST00000369651	D;D;D	0.84944	-1.92;-1.92;-1.92	4.89	3.07	0.35406	Metallophosphoesterase domain (1);	0.185073	0.49305	D	0.000156	D	0.85969	0.5821	M	0.69358	2.11	0.46954	D	0.999261	D;D;D	0.64830	0.99;0.99;0.994	D;D;P	0.66196	0.925;0.942;0.885	D	0.85964	0.1472	10	0.54805	T	0.06	-21.0177	8.5604	0.33507	0.3159:0.0:0.6841:0.0	.	231;231;231	B3KQI8;P21589;Q96B60	.;5NTD_HUMAN;.	H	7;231;231;231	ENSP00000257770:Q231H;ENSP00000358660:Q231H;ENSP00000358665:Q231H	ENSP00000257770:Q231H	Q	+	3	2	NT5E	86237804	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.683000	0.37638	1.195000	0.43115	0.561000	0.74099	CAG	NT5E	-	pfam_Metallo_PEstase_dom,prints_5_nucleotidase/apyrase	ENSG00000135318		0.418	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5E	HGNC	protein_coding	OTTHUMT00000041388.1	33	0.00	0	G			86181085	86181085	+1	no_errors	ENST00000257770	ensembl	human	known	69_37n	missense	58	22.67	17	SNP	1.000	T
NUAK2	81788	genome.wustl.edu	37	1	205275345	205275345	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr1:205275345C>A	ENST00000367157.3	-	5	787	c.661G>T	c.(661-663)Gtc>Ttc	p.V221F		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TTCCCATTGACAATCTCTGGC	0.537																																						dbGAP											0													100.0	99.0	99.0					1																	205275345		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.661G>T	1.37:g.205275345C>A	ENSP00000356125:p.Val221Phe			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V221F	ENST00000367157.3	37	c.661	CCDS1453.1	1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.097879	0.37048	.	.	ENSG00000163545	ENST00000367157	T	0.67171	-0.25	5.74	2.87	0.33458	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40640	N	0.001044	T	0.61677	0.2366	N	0.13272	0.32	0.58432	D	0.999991	D	0.71674	0.998	D	0.71656	0.974	T	0.53774	-0.8391	10	0.12430	T	0.62	.	10.1853	0.42993	0.0:0.724:0.0:0.276	.	221	Q9H093	NUAK2_HUMAN	F	221	ENSP00000356125:V221F	ENSP00000356125:V221F	V	-	1	0	NUAK2	203541968	0.989000	0.36119	0.984000	0.44739	0.135000	0.20990	2.185000	0.42584	0.357000	0.24183	0.655000	0.94253	GTC	NUAK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000163545		0.537	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK2	HGNC	protein_coding	OTTHUMT00000090390.1	48	0.00	0	C	NM_030952		205275345	205275345	-1	no_errors	ENST00000367157	ensembl	human	known	69_37n	missense	133	10.14	15	SNP	0.995	A
OLFM2	93145	genome.wustl.edu	37	19	9967532	9967532	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr19:9967532C>T	ENST00000264833.4	-	5	823	c.638G>A	c.(637-639)cGc>cAc	p.R213H	OLFM2_ENST00000590841.1_Missense_Mutation_p.R135H	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	213	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)		p.R213H(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GGAGCCGAAGCGGGACCCCAT	0.652																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											31.0	29.0	30.0					19																	9967532		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.638G>A	19.37:g.9967532C>T	ENSP00000264833:p.Arg213His		Q6IMJ3|Q96FC2	Missense_Mutation	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quinonprotein_ADH-like,smart_Olfac-like,pfscan_Olfac-like	p.R213H	ENST00000264833.4	37	c.638	CCDS12221.1	19	.	.	.	.	.	.	.	.	.	.	C	31	5.089666	0.94149	.	.	ENSG00000105088	ENST00000264833	D	0.89050	-2.46	4.31	4.31	0.51392	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.92789	0.7707	M	0.63169	1.94	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.92398	0.5927	9	.	.	.	.	14.3171	0.66460	0.0:1.0:0.0:0.0	.	213	O95897	NOE2_HUMAN	H	213	ENSP00000264833:R213H	.	R	-	2	0	OLFM2	9828532	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.536000	0.82023	2.225000	0.72522	0.563000	0.77884	CGC	OLFM2	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000105088		0.652	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM2	HGNC	protein_coding	OTTHUMT00000451119.1	11	0.00	0	C			9967532	9967532	-1	no_errors	ENST00000264833	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	1.000	T
PCDHB8	56128	genome.wustl.edu	37	5	140559523	140559523	+	Silent	SNP	G	G	A	rs17844502	byFrequency	TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr5:140559523G>A	ENST00000239444.2	+	1	2153	c.1908G>A	c.(1906-1908)gcG>gcA	p.A636A	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	636	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A636A(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCGCGACGCGGCCAAGCAGA	0.687																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											23.0	27.0	26.0					5																	140559523		2081	4117	6198	-	-	-	SO:0001819	synonymous_variant	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1908G>A	5.37:g.140559523G>A			B9EGV1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A636	ENST00000239444.2	37	c.1908	CCDS4250.1	5																																																																																			PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120322		0.687	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	13	0.00	0	G	NM_019120		140559523	140559523	+1	no_errors	ENST00000239444	ensembl	human	known	69_37n	silent	26	27.78	10	SNP	0.008	A
PPEF1	5475	genome.wustl.edu	37	X	18824526	18824526	+	Silent	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chrX:18824526G>A	ENST00000361511.4	+	15	1751	c.1257G>A	c.(1255-1257)gtG>gtA	p.V419V	PPEF1_ENST00000543630.1_Intron|PPEF1_ENST00000349874.5_Silent_p.V357V|PPEF1_ENST00000359763.6_Silent_p.V366V|PPEF1_ENST00000544635.1_Silent_p.V354V	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	419	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					ACCAGGTGGTGACTATATTTT	0.363																																						dbGAP											0													132.0	131.0	131.0					X																	18824526		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1257G>A	X.37:g.18824526G>A			A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Silent	SNP	pfam_Metallo_PEstase_dom,pfam_EF-hand,pfam_PPP_dom,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_EF_HAND_2,pfscan_IQ_motif_EF-hand-BS,prints_Ser/Thr-sp_prot-phosphatase	p.V419	ENST00000361511.4	37	c.1257	CCDS14188.1	X																																																																																			PPEF1	-	smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr-Pase_EF-hand_contain,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000086717		0.363	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF1	HGNC	protein_coding	OTTHUMT00000055953.3	45	0.00	0	G	NM_006240		18824526	18824526	+1	no_errors	ENST00000361511	ensembl	human	known	69_37n	silent	88	29.03	36	SNP	1.000	A
PPP1R3A	5506	genome.wustl.edu	37	7	113558745	113558745	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr7:113558745C>A	ENST00000284601.3	-	1	375	c.307G>T	c.(307-309)Gaa>Taa	p.E103*		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	103					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						AAAACATATTCTTCTGTGTGG	0.393																																						dbGAP											0													100.0	96.0	97.0					7																	113558745		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.307G>T	7.37:g.113558745C>A	ENSP00000284601:p.Glu103*		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Nonsense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.E103*	ENST00000284601.3	37	c.307	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	C	37	6.420254	0.97550	.	.	ENSG00000154415	ENST00000284601	.	.	.	5.82	5.82	0.92795	.	0.055819	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-0.1135	20.093	0.97828	0.0:1.0:0.0:0.0	.	.	.	.	X	103	.	ENSP00000284601:E103X	E	-	1	0	PPP1R3A	113345981	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.206000	0.77891	2.756000	0.94617	0.561000	0.74099	GAA	PPP1R3A	-	NULL	ENSG00000154415		0.393	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	41	0.00	0	C	NM_002711		113558745	113558745	-1	no_errors	ENST00000284601	ensembl	human	known	69_37n	nonsense	79	26.17	28	SNP	1.000	A
PRKDC	5591	genome.wustl.edu	37	8	48697854	48697855	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr8:48697854_48697855insT	ENST00000314191.2	-	78	10979_10980	c.10923_10924insA	c.(10921-10926)aaacatfs	p.H3642fs	PRKDC_ENST00000338368.3_Frame_Shift_Ins_p.H3642fs|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3643					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TTCCCAAAATGTTTATCAAATT	0.327								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10924dupA	8.37:g.48697857_48697857dupT	ENSP00000313420:p.His3642fs		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Frame_Shift_Ins	INS	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.H3641fs	ENST00000314191.2	37	c.10924_10923		8																																																																																			PRKDC	-	NULL	ENSG00000253729		0.327	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		58	0.00	0	-	NM_001081640		48697854	48697855	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	frame_shift_ins	117	27.33	44	INS	0.979:0.107	T
PRSS53	339105	genome.wustl.edu	37	16	31097783	31097783	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr16:31097783G>A	ENST00000280606.6	-	5	691	c.538C>T	c.(538-540)Cgt>Tgt	p.R180C		NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	180	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						CTGATGAGACGCAGGCGCAGA	0.622																																						dbGAP											0													38.0	44.0	42.0					16																	31097783		2075	4222	6297	-	-	-	SO:0001583	missense	0				CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.538C>T	16.37:g.31097783G>A	ENSP00000280606:p.Arg180Cys			Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R180C	ENST00000280606.6	37	c.538	CCDS42153.1	16	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724636	0.68959	.	.	ENSG00000151006	ENST00000280606	D	0.89270	-2.49	5.66	5.66	0.87406	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37178	U	0.002216	D	0.94023	0.8085	M	0.73319	2.225	0.54753	D	0.999988	D	0.89917	1.0	D	0.85130	0.997	D	0.94231	0.7476	10	0.72032	D	0.01	.	17.2498	0.87039	0.0:0.0:1.0:0.0	.	180	Q2L4Q9	PRS53_HUMAN	C	180	ENSP00000280606:R180C	ENSP00000280606:R180C	R	-	1	0	PRSS53	31005284	1.000000	0.71417	1.000000	0.80357	0.319000	0.28217	5.996000	0.70639	2.665000	0.90641	0.655000	0.94253	CGT	PRSS53	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000151006		0.622	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS53	HGNC	protein_coding	OTTHUMT00000108580.4	41	0.00	0	G	NM_001081268		31097783	31097783	-1	no_errors	ENST00000280606	ensembl	human	known	69_37n	missense	48	40.00	32	SNP	1.000	A
SASS6	163786	genome.wustl.edu	37	1	100573002	100573002	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr1:100573002C>A	ENST00000287482.5	-	11	1394	c.1254G>T	c.(1252-1254)aaG>aaT	p.K418N	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Missense_Mutation_p.K251N	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	418					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		ATTTTTCCTCCTTCTCAGCCA	0.308																																						dbGAP											0													76.0	73.0	74.0					1																	100573002		2201	4291	6492	-	-	-	SO:0001583	missense	0			AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1254G>T	1.37:g.100573002C>A	ENSP00000287482:p.Lys418Asn		D3DT55|Q8N3K0	Missense_Mutation	SNP	NULL	p.K418N	ENST00000287482.5	37	c.1254	CCDS764.1	1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092132	0.55968	.	.	ENSG00000156876	ENST00000287482;ENST00000539329;ENST00000535161	T;T	0.30714	1.52;1.52	5.49	1.5	0.22942	.	0.095223	0.64402	D	0.000001	T	0.23766	0.0575	L	0.56769	1.78	0.36416	D	0.864015	D	0.59357	0.985	P	0.56434	0.798	T	0.04041	-1.0982	10	0.31617	T	0.26	-17.3728	7.1547	0.25630	0.0:0.4051:0.0:0.5949	.	418	Q6UVJ0	SAS6_HUMAN	N	418;391;251	ENSP00000287482:K418N;ENSP00000440169:K251N	ENSP00000287482:K418N	K	-	3	2	SASS6	100345590	0.995000	0.38212	1.000000	0.80357	0.969000	0.65631	0.203000	0.17315	0.267000	0.21916	0.585000	0.79938	AAG	SASS6	-	NULL	ENSG00000156876		0.308	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASS6	HGNC	protein_coding	OTTHUMT00000029656.2	65	0.00	0	C	NM_194292		100573002	100573002	-1	no_errors	ENST00000287482	ensembl	human	known	69_37n	missense	63	32.98	31	SNP	1.000	A
RIT1	6016	genome.wustl.edu	37	1	155874570	155874570	+	Silent	SNP	A	A	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr1:155874570A>T	ENST00000368323.3	-	4	393	c.189T>A	c.(187-189)cgT>cgA	p.R63R	RIT1_ENST00000539040.1_Silent_p.R27R|RIT1_ENST00000368322.3_Silent_p.R80R	NM_006912.5	NP_008843.1	Q92963	RIT1_HUMAN	Ras-like without CAAX 1	63					GTP catabolic process (GO:0006184)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|skin(1)|urinary_tract(1)	19	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			CATCATCAATACGGATCCTGA	0.388																																						dbGAP											0													99.0	92.0	95.0					1																	155874570		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF084462	CCDS1123.1, CCDS58037.1, CCDS58036.1	1q21.2	2014-05-09	2002-09-11	2002-09-13	ENSG00000143622	ENSG00000143622			10023	protein-coding gene	gene with protein product	"""Ric-like, expressed in many tissues"", ""GTP-binding protein Roc1"""	609591	"""Ric (Drosophila)-like, expressed in many tissues"""	RIT		8824319, 8918462	Standard	NM_006912		Approved	RIBB, ROC1, MGC125864, MGC125865	uc031pqc.1	Q92963	OTTHUMG00000014104	ENST00000368323.3:c.189T>A	1.37:g.155874570A>T			B4DQE8|O00646|O00720|Q5VY89|Q5VY90	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R63	ENST00000368323.3	37	c.189	CCDS1123.1	1																																																																																			RIT1	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000143622		0.388	RIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIT1	HGNC	protein_coding	OTTHUMT00000039593.1	71	0.00	0	A	NM_006912		155874570	155874570	-1	no_errors	ENST00000368323	ensembl	human	known	69_37n	silent	85	51.69	92	SNP	0.964	T
SCYL2	55681	genome.wustl.edu	37	12	100732846	100732846	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr12:100732846A>T	ENST00000360820.2	+	18	3123	c.2686A>T	c.(2686-2688)Atg>Ttg	p.M896L		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	896	Necessary for interaction with AP2 complex and clathrin, interaction with clathrin is necessary for its targeting to the TGN and endosomal membranes.				endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						TGCTTTTGGTATGCAGGGTAA	0.423																																						dbGAP											0													161.0	155.0	157.0					12																	100732846		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.2686A>T	12.37:g.100732846A>T	ENSP00000354061:p.Met896Leu		A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.M896L	ENST00000360820.2	37	c.2686	CCDS9076.1	12	.	.	.	.	.	.	.	.	.	.	A	11.46	1.644157	0.29246	.	.	ENSG00000136021	ENST00000360820	T	0.28069	1.63	5.86	-1.19	0.09585	.	0.226724	0.64402	D	0.000009	T	0.12305	0.0299	N	0.14661	0.345	0.38703	D	0.95304	B	0.02656	0.0	B	0.01281	0.0	T	0.08973	-1.0696	10	0.28530	T	0.3	-2.2531	2.97	0.05919	0.5545:0.1029:0.2428:0.0998	.	896	Q6P3W7	SCYL2_HUMAN	L	896	ENSP00000354061:M896L	ENSP00000354061:M896L	M	+	1	0	SCYL2	99256977	0.998000	0.40836	0.983000	0.44433	0.981000	0.71138	1.905000	0.39878	-0.043000	0.13513	0.528000	0.53228	ATG	SCYL2	-	NULL	ENSG00000136021		0.423	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL2	HGNC	protein_coding	OTTHUMT00000408493.2	50	0.00	0	A	NM_017988		100732846	100732846	+1	no_errors	ENST00000360820	ensembl	human	known	69_37n	missense	134	18.79	31	SNP	0.993	T
SHROOM4	57477	genome.wustl.edu	37	X	50377358	50377358	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chrX:50377358C>T	ENST00000289292.7	-	4	1998	c.1715G>A	c.(1714-1716)gGa>gAa	p.G572E	SHROOM4_ENST00000376020.2_Missense_Mutation_p.G572E|SHROOM4_ENST00000460112.3_Missense_Mutation_p.G456E			Q9ULL8	SHRM4_HUMAN	shroom family member 4	572					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					CCGGGTCCCTCCACTTCGCCT	0.572																																						dbGAP											0													35.0	31.0	33.0					X																	50377358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.1715G>A	X.37:g.50377358C>T	ENSP00000289292:p.Gly572Glu		A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G572E	ENST00000289292.7	37	c.1715	CCDS35277.1	X	.	.	.	.	.	.	.	.	.	.	C	4.579	0.107504	0.08780	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.14893	2.79;2.79;2.47	4.99	4.99	0.66335	.	0.571394	0.17306	N	0.179073	T	0.18964	0.0455	L	0.57536	1.79	0.09310	N	1	P	0.46706	0.883	B	0.41571	0.36	T	0.24225	-1.0166	10	0.08837	T	0.75	.	16.0407	0.80680	0.0:1.0:0.0:0.0	.	572	Q9ULL8	SHRM4_HUMAN	E	572;572;456	ENSP00000289292:G572E;ENSP00000365188:G572E;ENSP00000421450:G456E	ENSP00000289292:G572E	G	-	2	0	SHROOM4	50394098	0.008000	0.16893	0.323000	0.25347	0.155000	0.21991	2.053000	0.41326	2.302000	0.77476	0.600000	0.82982	GGA	SHROOM4	-	NULL	ENSG00000158352		0.572	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	32	0.00	0	C	NM_020717		50377358	50377358	-1	no_errors	ENST00000289292	ensembl	human	known	69_37n	missense	68	16.05	13	SNP	0.024	T
STAT4	6775	genome.wustl.edu	37	2	191895699	191895700	+	Splice_Site	DEL	GC	GC	-			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	GC	GC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr2:191895699_191895700delGC	ENST00000392320.2	-	23	2532_2533	c.2218_2219delGC	c.(2218-2220)gca>a	p.A740fs	AC067945.4_ENST00000456176.1_RNA|STAT4_ENST00000358470.4_Splice_Site_p.A740fs	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	740					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			GGAACATACTGCAGTTTCAATT	0.46																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.2220+1GC>-	2.37:g.191895699_191895700delGC			Q96NZ6	Frame_Shift_Del	DEL	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.A740fs	ENST00000392320.2	37	c.2219_2218	CCDS2310.1	2																																																																																			STAT4	-	NULL	ENSG00000138378		0.460	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	51	0.00	0	GC	NM_003151	Frame_Shift_Del	191895699	191895700	-1	no_errors	ENST00000358470	ensembl	human	known	69_37n	frame_shift_del	140	19.77	35	DEL	1.000:1.000	-
SYT11	23208	genome.wustl.edu	37	1	155851077	155851077	+	Silent	SNP	C	C	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr1:155851077C>A	ENST00000368324.4	+	4	1327	c.1074C>A	c.(1072-1074)atC>atA	p.I358I	SYT11_ENST00000539162.1_Silent_p.I51I	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	358	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			TGAACCCCATCTTCAATGAAT	0.493																																						dbGAP											0													301.0	316.0	311.0					1																	155851077		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.1074C>A	1.37:g.155851077C>A			Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.I358	ENST00000368324.4	37	c.1074	CCDS1122.1	1																																																																																			SYT11	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000132718		0.493	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT11	HGNC	protein_coding	OTTHUMT00000039597.1	53	0.00	0	C	NM_152280		155851077	155851077	+1	no_errors	ENST00000368324	ensembl	human	known	69_37n	silent	201	17.96	44	SNP	1.000	A
TAS2R42	353164	genome.wustl.edu	37	12	11338943	11338943	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr12:11338943G>T	ENST00000334266.1	-	1	600	c.601C>A	c.(601-603)Ctt>Att	p.L201I		NM_181429.1	NP_852094.1	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	201					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(2)|lung(4)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			AATAAAAAAAGCAAGGAGGTC	0.398																																					Melanoma(15;352 722 10077 19546 48810)	dbGAP											0													47.0	51.0	50.0					12																	11338943		2201	4296	6497	-	-	-	SO:0001583	missense	0			AX097739, AB199241	CCDS31747.1	12p13	2012-08-22			ENSG00000186136	ENSG00000186136		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18888	protein-coding gene	gene with protein product		613966				12679530	Standard	NM_181429		Approved	T2R24, T2R55, hT2R55, TAS2R55	uc001qzr.1	Q7RTR8	OTTHUMG00000168567	ENST00000334266.1:c.601C>A	12.37:g.11338943G>T	ENSP00000334050:p.Leu201Ile		A2RRP4|Q645X0	Missense_Mutation	SNP	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.L201I	ENST00000334266.1	37	c.601	CCDS31747.1	12	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066071	0.36470	.	.	ENSG00000186136	ENST00000334266	T	0.36520	1.25	3.46	-3.27	0.05048	GPCR, rhodopsin-like superfamily (1);	1.085760	0.07233	N	0.862944	T	0.48352	0.1495	M	0.76002	2.32	0.09310	N	1	P	0.50943	0.94	P	0.58391	0.838	T	0.47509	-0.9112	10	0.49607	T	0.09	.	4.4998	0.11858	0.4306:0.3201:0.2493:0.0	.	201	Q7RTR8	T2R42_HUMAN	I	201	ENSP00000334050:L201I	ENSP00000334050:L201I	L	-	1	0	TAS2R42	11230210	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.534000	0.02212	-0.610000	0.05716	-1.080000	0.02220	CTT	TAS2R42	-	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186136		0.398	TAS2R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R42	HGNC	protein_coding	OTTHUMT00000400243.1	13	0.00	0	G	NM_181429		11338943	11338943	-1	no_errors	ENST00000334266	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.000	T
TBC1D1	23216	genome.wustl.edu	37	4	38029467	38029467	+	Silent	SNP	T	T	C			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr4:38029467T>C	ENST00000261439.4	+	7	1624	c.1269T>C	c.(1267-1269)aaT>aaC	p.N423N	TBC1D1_ENST00000508802.1_Silent_p.N423N	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	423					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CATTAACCAATCAGGAGCAGG	0.373																																						dbGAP											0													70.0	70.0	70.0					4																	38029467		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.1269T>C	4.37:g.38029467T>C			B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S71P	ENST00000261439.4	37	c.211	CCDS33972.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.821|9.821	1.185658|1.185658	0.21870|0.21870	.|.	.|.	ENSG00000065882|ENSG00000065882	ENST00000513936|ENST00000510573	.|.	.|.	.|.	4.99|4.99	-1.9|-1.9	0.07665|0.07665	.|.	.|.	.|.	.|.	.|.	T|T	0.57814|0.57814	0.2079|0.2079	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.55717|0.55717	-0.8097|-0.8097	4|4	.|.	.|.	.|.	-23.7044|-23.7044	11.678|11.678	0.51440|0.51440	0.0:0.5375:0.0:0.4625|0.0:0.5375:0.0:0.4625	.|.	.|.	.|.	.|.	T|P	20|71	.|.	.|.	I|S	+|+	2|1	0|0	TBC1D1|TBC1D1	37705862|37705862	0.540000|0.540000	0.26410|0.26410	0.820000|0.820000	0.32676|0.32676	0.940000|0.940000	0.58332|0.58332	-0.280000|-0.280000	0.08468|0.08468	-0.276000|-0.276000	0.09206|0.09206	0.383000|0.383000	0.25322|0.25322	ATC|TCA	TBC1D1	-	NULL	ENSG00000065882		0.373	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	45	0.00	0	T	NM_015173		38029467	38029467	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000510573	ensembl	human	novel	69_37n	missense	85	20.37	22	SNP	0.992	C
TBC1D4	9882	genome.wustl.edu	37	13	75880582	75880582	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr13:75880582T>G	ENST00000377636.3	-	15	2965	c.2619A>C	c.(2617-2619)agA>agC	p.R873S	TBC1D4_ENST00000377625.2_Missense_Mutation_p.R810S|TBC1D4_ENST00000431480.2_Missense_Mutation_p.R865S|TBC1D4_ENST00000425511.1_Intron	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	873					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		ATTTAACTTTTCTGGACTGGA	0.333																																						dbGAP											0													111.0	112.0	112.0					13																	75880582		1838	4080	5918	-	-	-	SO:0001583	missense	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.2619A>C	13.37:g.75880582T>G	ENSP00000366863:p.Arg873Ser		A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.R873S	ENST00000377636.3	37	c.2619	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	T	22.2	4.252890	0.80135	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625	T;T;T	0.03635	3.86;3.86;3.99	5.91	3.43	0.39272	.	0.000000	0.85682	D	0.000000	T	0.12347	0.0300	M	0.64997	1.995	0.80722	D	1	D;D;D	0.69078	0.984;0.997;0.997	P;D;D	0.70935	0.852;0.971;0.954	T	0.00555	-1.1673	10	0.51188	T	0.08	-22.331	8.7587	0.34661	0.0:0.2043:0.0:0.7957	.	810;865;873	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	S	873;865;810	ENSP00000366863:R873S;ENSP00000395986:R865S;ENSP00000366852:R810S	ENSP00000366852:R810S	R	-	3	2	TBC1D4	74778583	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.501000	0.22578	0.474000	0.27392	0.533000	0.62120	AGA	TBC1D4	-	NULL	ENSG00000136111		0.333	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1	57	0.00	0	T	NM_014832		75880582	75880582	-1	no_errors	ENST00000377636	ensembl	human	known	69_37n	missense	42	72.19	109	SNP	1.000	G
TMCO6	55374	genome.wustl.edu	37	5	140022616	140022616	+	Missense_Mutation	SNP	A	A	C			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr5:140022616A>C	ENST00000394671.3	+	7	897	c.796A>C	c.(796-798)Atc>Ctc	p.I266L	TMCO6_ENST00000252100.6_Missense_Mutation_p.I272L|TMCO6_ENST00000537378.1_Missense_Mutation_p.I26L|NDUFA2_ENST00000510680.1_Intron	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	266					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTCATTACATCATCTGCAG	0.512																																						dbGAP											0													86.0	84.0	85.0					5																	140022616		1965	4145	6110	-	-	-	SO:0001583	missense	0			BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.796A>C	5.37:g.140022616A>C	ENSP00000378166:p.Ile266Leu		Q9BUU0|Q9P198	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Importin-a_IBB	p.I272L	ENST00000394671.3	37	c.814	CCDS4233.2	5	.	.	.	.	.	.	.	.	.	.	A	6.316	0.426373	0.11987	.	.	ENSG00000113119	ENST00000394671;ENST00000537378;ENST00000252100	T;T;T	0.35789	2.03;1.29;2.03	5.26	1.36	0.22044	Armadillo-like helical (1);Armadillo-type fold (1);	0.438594	0.24796	N	0.035537	T	0.17492	0.0420	N	0.20986	0.625	0.36071	D	0.84212	B;B	0.10296	0.003;0.0	B;B	0.06405	0.002;0.002	T	0.33240	-0.9876	10	0.02654	T	1	-2.6083	7.8064	0.29204	0.5806:0.2939:0.0:0.1255	.	272;266	Q96DC7-2;Q96DC7	.;TMCO6_HUMAN	L	266;26;272	ENSP00000378166:I266L;ENSP00000444474:I26L;ENSP00000252100:I272L	ENSP00000252100:I272L	I	+	1	0	TMCO6	140002800	1.000000	0.71417	0.994000	0.49952	0.928000	0.56348	2.362000	0.44169	0.079000	0.16929	0.454000	0.30748	ATC	TMCO6	-	superfamily_ARM-type_fold	ENSG00000113119		0.512	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	HGNC	protein_coding	OTTHUMT00000251666.2	59	0.00	0	A	NM_018502		140022616	140022616	+1	no_errors	ENST00000252100	ensembl	human	known	69_37n	missense	131	39.17	85	SNP	1.000	C
POR	5447	genome.wustl.edu	37	7	75617758	75617758	+	IGR	SNP	G	G	A			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr7:75617758G>A	ENST00000461988.1	+	0	2522				TMEM120A_ENST00000493111.2_RNA|TMEM120A_ENST00000338761.4_RNA	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase						carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	AGCAGGAAGCGGCAAGTGAAG	0.632																																						dbGAP											0													126.0	136.0	133.0					7																	75617758		2078	4199	6277	-	-	-	SO:0001628	intergenic_variant	0			AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413		7.37:g.75617758G>A			Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	RNA	SNP	-	NULL	ENST00000461988.1	37	NULL	CCDS5579.1	7																																																																																			TMEM120A	-	-	ENSG00000189077		0.632	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM120A	HGNC	protein_coding	OTTHUMT00000252796.7	25	0.00	0	G	NM_000941		75617758	75617758	-1	no_errors	ENST00000338761	ensembl	human	known	69_37n	rna	81	28.95	33	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577144	7577144	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr17:7577144A>G	ENST00000269305.4	-	8	983	c.794T>C	c.(793-795)cTg>cCg	p.L265P	TP53_ENST00000420246.2_Missense_Mutation_p.L265P|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.L265P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.L265P|TP53_ENST00000445888.2_Missense_Mutation_p.L265P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	265	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> M (in sporadic cancers; somatic mutation).|L -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|L -> Q (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L265P(15)|p.0?(8)|p.L265R(5)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262_S269delGNLLGRNS(2)|p.N263fs*5(1)|p.L265del(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.L265Q(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTCCGTCCCAGTAGATTACC	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	42	Substitution - Missense(21)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(3)|Deletion - Frameshift(3)	large_intestine(6)|lung(5)|oesophagus(5)|breast(4)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|upper_aerodigestive_tract(2)|stomach(2)|urinary_tract(2)|small_intestine(1)|skin(1)|eye(1)	GRCh37	CD004355|CM971505	TP53	D|M							46.0	41.0	43.0					17																	7577144		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.794T>C	17.37:g.7577144A>G	ENSP00000269305:p.Leu265Pro		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L265P	ENST00000269305.4	37	c.794	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	18.92	3.724991	0.68959	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99878	-7.42;-7.42;-7.42;-7.42;-7.42;-7.42	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.64402	D	0.000001	D	0.99849	0.9930	M	0.87827	2.91	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.96469	0.9347	10	0.87932	D	0	-15.8832	12.9367	0.58319	1.0:0.0:0.0:0.0	.	265;265;265;265	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	P	265;265;265;265;265;254;133	ENSP00000352610:L265P;ENSP00000269305:L265P;ENSP00000398846:L265P;ENSP00000391127:L265P;ENSP00000391478:L265P;ENSP00000425104:L133P	ENSP00000269305:L265P	L	-	2	0	TP53	7517869	1.000000	0.71417	0.999000	0.59377	0.528000	0.34623	9.060000	0.93907	2.154000	0.67381	0.379000	0.24179	CTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	32	0.00	0	A	NM_000546		7577144	7577144	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	35	59.77	52	SNP	1.000	G
UBAC2	337867	genome.wustl.edu	37	13	99890758	99890758	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr13:99890758T>C	ENST00000403766.3	+	2	244	c.109T>C	c.(109-111)Tgc>Cgc	p.C37R	UBAC2_ENST00000376440.2_Silent_p.T78T	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2	37					protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCTGCCTCACTGCCAGAAGCT	0.557																																						dbGAP											0													215.0	213.0	214.0					13																	99890758		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267	ENST00000403766.3:c.109T>C	13.37:g.99890758T>C	ENSP00000383911:p.Cys37Arg		B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	Missense_Mutation	SNP	pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.C37R	ENST00000403766.3	37	c.109	CCDS45064.1	13	.	.	.	.	.	.	.	.	.	.	T	15.63	2.888993	0.52014	.	.	ENSG00000134882	ENST00000403766;ENST00000355700;ENST00000457666	T;T;T	0.51574	0.7;0.7;0.7	5.72	5.72	0.89469	.	0.103892	0.64402	D	0.000002	T	0.35422	0.0931	.	.	.	0.80722	D	1	P	0.34909	0.475	B	0.29267	0.1	T	0.14783	-1.0460	8	.	.	.	-18.6104	14.5668	0.68182	0.0:0.0:0.0:1.0	.	37	Q8NBM4	UBAC2_HUMAN	R	37;37;43	ENSP00000383911:C37R;ENSP00000347928:C37R;ENSP00000402249:C43R	.	C	+	1	0	UBAC2	98688759	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.396000	0.66297	2.172000	0.68678	0.482000	0.46254	TGC	UBAC2	-	NULL	ENSG00000134882		0.557	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	UBAC2	HGNC	protein_coding	OTTHUMT00000045588.1	44	0.00	0	T	NM_177967		99890758	99890758	+1	no_errors	ENST00000403766	ensembl	human	novel	69_37n	missense	82	34.92	44	SNP	1.000	C
VCPIP1	80124	genome.wustl.edu	37	8	67578547	67578547	+	Missense_Mutation	SNP	T	T	G			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr8:67578547T>G	ENST00000310421.4	-	1	905	c.647A>C	c.(646-648)gAt>gCt	p.D216A	C8orf44-SGK3_ENST00000519289.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank|C8orf44_ENST00000521889.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	216	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GCAGTGTCCATCCCCGTCCAC	0.527																																					NSCLC(179;265 2915 6144 43644)	dbGAP											0													91.0	89.0	90.0					8																	67578547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.647A>C	8.37:g.67578547T>G	ENSP00000309031:p.Asp216Ala		Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.D216A	ENST00000310421.4	37	c.647	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	T	20.3	3.959602	0.74016	.	.	ENSG00000175073	ENST00000310421	T	0.66638	-0.22	6.16	6.16	0.99307	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	T	0.81564	0.4849	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.82690	-0.0332	10	0.62326	D	0.03	-18.58	16.8061	0.85666	0.0:0.0:0.0:1.0	.	216	Q96JH7	VCIP1_HUMAN	A	216	ENSP00000309031:D216A	ENSP00000309031:D216A	D	-	2	0	VCPIP1	67741101	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.367000	0.80283	0.528000	0.53228	GAT	VCPIP1	-	pfam_OTU,pfscan_OTU	ENSG00000175073		0.527	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	HGNC	protein_coding	OTTHUMT00000379227.1	20	0.00	0	T			67578547	67578547	-1	no_errors	ENST00000310421	ensembl	human	known	69_37n	missense	75	14.61	13	SNP	1.000	G
ZBTB11	27107	genome.wustl.edu	37	3	101375072	101375072	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr3:101375072G>C	ENST00000312938.4	-	7	2647	c.2067C>G	c.(2065-2067)atC>atG	p.I689M		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	689					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CATGCTTATAGATAAAAGTCT	0.358																																						dbGAP											0													80.0	78.0	79.0					3																	101375072		2203	4299	6502	-	-	-	SO:0001583	missense	0			U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2067C>G	3.37:g.101375072G>C	ENSP00000326200:p.Ile689Met		Q2NKP9	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.I689M	ENST00000312938.4	37	c.2067	CCDS2943.1	3	.	.	.	.	.	.	.	.	.	.	G	12.81	2.048092	0.36085	.	.	ENSG00000066422	ENST00000312938	T	0.10288	2.89	6.05	2.82	0.32997	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.122017	0.64402	D	0.000013	T	0.10852	0.0265	N	0.24115	0.695	0.80722	D	1	D	0.56287	0.975	P	0.58077	0.832	T	0.33059	-0.9883	10	0.38643	T	0.18	-11.1827	1.125	0.01732	0.2305:0.1294:0.3764:0.2636	.	689	O95625	ZBT11_HUMAN	M	689	ENSP00000326200:I689M	ENSP00000326200:I689M	I	-	3	3	ZBTB11	102857762	0.999000	0.42202	0.998000	0.56505	0.091000	0.18340	0.538000	0.23160	0.860000	0.35481	0.650000	0.86243	ATC	ZBTB11	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000066422		0.358	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB11	HGNC	protein_coding	OTTHUMT00000353441.2	34	0.00	0	G	NM_014415		101375072	101375072	-1	no_errors	ENST00000312938	ensembl	human	known	69_37n	missense	78	38.58	49	SNP	0.999	C
ZNF366	167465	genome.wustl.edu	37	5	71739680	71739680	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr5:71739680G>T	ENST00000318442.5	-	5	2628	c.2138C>A	c.(2137-2139)tCt>tAt	p.S713Y	RP11-389C8.2_ENST00000564956.1_RNA	NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	713	Interaction with CTBP1.|Interaction with NRIP1.				negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		ATCAGAAAAAGAGGGGCCCCG	0.493																																						dbGAP											0													61.0	72.0	68.0					5																	71739680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.2138C>A	5.37:g.71739680G>T	ENSP00000313158:p.Ser713Tyr		Q5HYI9|Q7RTV4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S713Y	ENST00000318442.5	37	c.2138	CCDS4015.1	5	.	.	.	.	.	.	.	.	.	.	G	24.5	4.539776	0.85917	.	.	ENSG00000178175	ENST00000318442	T	0.13538	2.58	5.87	5.87	0.94306	.	0.175855	0.41194	D	0.000926	T	0.22820	0.0551	L	0.29908	0.895	0.46678	D	0.999152	D	0.57257	0.979	P	0.53722	0.733	T	0.00155	-1.1979	10	0.87932	D	0	-14.1321	20.5827	0.99408	0.0:0.0:1.0:0.0	.	713	Q8N895	ZN366_HUMAN	Y	713	ENSP00000313158:S713Y	ENSP00000313158:S713Y	S	-	2	0	ZNF366	71775436	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.028000	0.64115	2.941000	0.99782	0.655000	0.94253	TCT	ZNF366	-	NULL	ENSG00000178175		0.493	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF366	HGNC	protein_coding	OTTHUMT00000218574.3	37	0.00	0	G			71739680	71739680	-1	no_errors	ENST00000318442	ensembl	human	known	69_37n	missense	78	20.41	20	SNP	1.000	T
ZNF562	54811	genome.wustl.edu	37	19	9770066	9770066	+	Missense_Mutation	SNP	T	T	C			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr19:9770066T>C	ENST00000448622.1	-	3	265	c.103A>G	c.(103-105)Aat>Gat	p.N35D	ZNF562_ENST00000541032.1_Intron|ZNF562_ENST00000453792.2_Intron|ZNF562_ENST00000587392.1_Missense_Mutation_p.N35D|ZNF562_ENST00000453372.2_Missense_Mutation_p.N35D|ZNF562_ENST00000293648.4_Intron|ZNF562_ENST00000590155.1_Missense_Mutation_p.N35D|ZNF562_ENST00000537617.1_5'UTR	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	Q6V9R5	ZN562_HUMAN	zinc finger protein 562	35					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	17						TGGTAAGAATTTGACCGGTGG	0.403																																						dbGAP											0													93.0	84.0	86.0					19																	9770066		692	1591	2283	-	-	-	SO:0001583	missense	0			AK000086	CCDS12217.1, CCDS45956.1, CCDS74280.1	19p13.2	2013-09-20			ENSG00000171466	ENSG00000171466		"""Zinc fingers, C2H2-type"", ""-"""	25950	protein-coding gene	gene with protein product							Standard	NM_001130031		Approved	FLJ20079	uc010xks.2	Q6V9R5	OTTHUMG00000180205	ENST00000448622.1:c.103A>G	19.37:g.9770066T>C	ENSP00000411784:p.Asn35Asp		Q32MN2|Q9NXS5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N35D	ENST00000448622.1	37	c.103	CCDS45956.1	19	.	.	.	.	.	.	.	.	.	.	T	3.176	-0.168873	0.06461	.	.	ENSG00000171466	ENST00000453372;ENST00000448622	T;T	0.07021	3.23;3.23	1.67	-0.542	0.11854	Krueppel-associated box (1);	.	.	.	.	T	0.04227	0.0117	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.28760	0.062;0.221	B;B	0.29176	0.037;0.099	T	0.46665	-0.9175	9	0.11485	T	0.65	.	4.1799	0.10370	0.0:0.4346:0.0:0.5654	.	35;35	B4DMG0;Q6V9R5	.;ZN562_HUMAN	D	35	ENSP00000410734:N35D;ENSP00000411784:N35D	ENSP00000411784:N35D	N	-	1	0	ZNF562	9631066	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.191000	0.01246	-0.234000	0.09782	0.260000	0.18958	AAT	ZNF562	-	superfamily_Krueppel-associated_box	ENSG00000171466		0.403	ZNF562-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF562	HGNC	protein_coding	OTTHUMT00000450239.1	55	0.00	0	T	NM_017656		9770066	9770066	-1	no_errors	ENST00000448622	ensembl	human	known	69_37n	missense	45	61.86	73	SNP	0.000	C
ZNF607	84775	genome.wustl.edu	37	19	38189031	38189031	+	Silent	SNP	A	A	G			TCGA-B6-A1KN-01A-11D-A13L-09	TCGA-B6-A1KN-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c1ad09c8-4237-48f0-b04c-7ee8ccaf8cf1	2a8d9494-2d88-4577-bb21-05a62a07d8f9	g.chr19:38189031A>G	ENST00000355202.4	-	5	2596	c.2001T>C	c.(1999-2001)caT>caC	p.H667H	CTD-2528L19.4_ENST00000586606.2_Intron|ZNF607_ENST00000395835.3_Silent_p.H666H	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	667					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			TCTCACCAGTATGAACTCTAT	0.363																																						dbGAP											0													115.0	115.0	115.0					19																	38189031		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.2001T>C	19.37:g.38189031A>G			F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H667	ENST00000355202.4	37	c.2001	CCDS33006.1	19																																																																																			ZNF607	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198182		0.363	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF607	HGNC	protein_coding	OTTHUMT00000459502.2	44	0.00	0	A	NM_032689		38189031	38189031	-1	no_errors	ENST00000355202	ensembl	human	known	69_37n	silent	106	25.87	37	SNP	1.000	G
