#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB7	22	genome.wustl.edu	37	X	74318816	74318816	+	Silent	SNP	A	A	G			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chrX:74318816A>G	ENST00000373394.3	-	4	421	c.414T>C	c.(412-414)gcT>gcC	p.A138A	ABCB7_ENST00000339447.4_Intron|ABCB7_ENST00000253577.3_Silent_p.A139A			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	138					cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						TGGCAACTCTAGCTCGTAGAT	0.368																																						dbGAP											0													120.0	101.0	107.0					X																	74318816		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.414T>C	X.37:g.74318816A>G			G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.A139	ENST00000373394.3	37	c.417		X																																																																																			ABCB7	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000131269		0.368	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	ABCB7	HGNC	protein_coding	OTTHUMT00000057274.1	59	0.00	0	A	NM_004299		74318816	74318816	-1	no_errors	ENST00000253577	ensembl	human	known	69_37n	silent	43	15.69	8	SNP	0.888	G
ABCC9	10060	genome.wustl.edu	37	12	21970180	21970180	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr12:21970180G>A	ENST00000261201.4	-	31	3832	c.3833C>T	c.(3832-3834)gCa>gTa	p.A1278V	ABCC9_ENST00000345162.2_Missense_Mutation_p.A1242V|ABCC9_ENST00000261200.4_Missense_Mutation_p.A1278V	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1278					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CTTCTTCACTGCACCCATCTG	0.358																																						dbGAP											0													139.0	144.0	142.0					12																	21970180		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.3833C>T	12.37:g.21970180G>A	ENSP00000261201:p.Ala1278Val		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.A1278V	ENST00000261201.4	37	c.3833	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993638	0.93167	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.79	4.52	4.52	0.55395	ABC transporter, transmembrane domain, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.97235	0.9096	M	0.66506	2.035	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.76575	0.881;0.988	D	0.97891	1.0297	10	0.87932	D	0	-17.8198	17.7929	0.88561	0.0:0.0:1.0:0.0	.	1278;1278	O60706;O60706-2	ABCC9_HUMAN;.	V	1278;905;1278;1242	ENSP00000261200:A1278V;ENSP00000440521:A905V;ENSP00000261201:A1278V;ENSP00000261202:A1242V	ENSP00000261200:A1278V	A	-	2	0	ABCC9	21861447	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	9.435000	0.97529	2.525000	0.85131	0.650000	0.86243	GCA	ABCC9	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000069431		0.358	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	45	0.00	0	G	NM_005691		21970180	21970180	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	A
ACTL9	284382	genome.wustl.edu	37	19	8808020	8808020	+	Silent	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr19:8808020G>A	ENST00000324436.3	-	1	1152	c.1032C>T	c.(1030-1032)tcC>tcT	p.S344S		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	344						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TGAAGAGCGAGGACCCACCGC	0.657																																						dbGAP											0													32.0	33.0	33.0					19																	8808020		2198	4296	6494	-	-	-	SO:0001819	synonymous_variant	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1032C>T	19.37:g.8808020G>A			A8K893|Q6X960	Silent	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.S344	ENST00000324436.3	37	c.1032	CCDS12207.1	19																																																																																			ACTL9	-	pfam_Actin-like,smart_Actin-like	ENSG00000181786		0.657	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	45	0.00	0	G	NM_178525		8808020	8808020	-1	no_errors	ENST00000324436	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	1.000	A
ALDH4A1	8659	genome.wustl.edu	37	1	19201887	19201887	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:19201887G>T	ENST00000375341.3	-	13	1706	c.1449C>A	c.(1447-1449)ttC>ttA	p.F483L	RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000538309.1_Missense_Mutation_p.F423L|ALDH4A1_ENST00000290597.5_Missense_Mutation_p.F483L|ALDH4A1_ENST00000538839.1_Missense_Mutation_p.F432L	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	483					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TATCCTGGGAGAACACTGCCC	0.612											OREG0013164	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													120.0	113.0	115.0					1																	19201887		2203	4300	6503	-	-	-	SO:0001583	missense	0			U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.1449C>A	1.37:g.19201887G>T	ENSP00000364490:p.Phe483Leu	731	A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_Delta1-pyrroline-5-COlate_DH-1	p.F483L	ENST00000375341.3	37	c.1449	CCDS188.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.039472	0.75617	.	.	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000538309	T;T;T;T	0.77877	-1.13;-1.13;1.35;-1.13	5.08	-1.17	0.09648	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.045706	0.85682	D	0.000000	D	0.86205	0.5877	M	0.87617	2.895	0.58432	D	0.999999	D	0.71674	0.998	D	0.71414	0.973	D	0.85261	0.1050	10	0.62326	D	0.03	-19.9784	10.5082	0.44847	0.5326:0.0:0.4674:0.0	.	483	P30038	AL4A1_HUMAN	L	483;483;432;423	ENSP00000290597:F483L;ENSP00000364490:F483L;ENSP00000446071:F432L;ENSP00000442988:F423L	ENSP00000290597:F483L	F	-	3	2	ALDH4A1	19074474	0.979000	0.34478	0.997000	0.53966	0.940000	0.58332	0.155000	0.16362	-0.100000	0.12241	0.313000	0.20887	TTC	ALDH4A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_Delta1-pyrroline-5-COlate_DH-1	ENSG00000159423		0.612	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH4A1	HGNC	protein_coding	OTTHUMT00000006954.1	66	0.00	0	G			19201887	19201887	-1	no_errors	ENST00000290597	ensembl	human	known	69_37n	missense	61	14.08	10	SNP	0.999	T
AHCYL1	10768	genome.wustl.edu	37	1	110561019	110561019	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:110561019A>T	ENST00000369799.5	+	12	1515	c.1148A>T	c.(1147-1149)gAg>gTg	p.E383V	AHCYL1_ENST00000359172.3_Missense_Mutation_p.E336V|AHCYL1_ENST00000393614.4_Missense_Mutation_p.E336V	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	383	NAD binding. {ECO:0000250}.				mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		GTGACACGGGAGCACTTGGAT	0.438																																						dbGAP											0													96.0	81.0	86.0					1																	110561019		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.1148A>T	1.37:g.110561019A>T	ENSP00000358814:p.Glu383Val		B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_IlvN,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	p.E383V	ENST00000369799.5	37	c.1148	CCDS818.1	1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.996555	0.74818	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	T;T;T	0.79845	-1.31;-1.29;-1.29	5.62	5.62	0.85841	S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	0.092161	0.85682	D	0.000000	T	0.80053	0.4553	M	0.90309	3.105	0.80722	D	1	B	0.14012	0.009	B	0.22753	0.041	T	0.80596	-0.1312	10	0.59425	D	0.04	-15.3458	15.8317	0.78757	1.0:0.0:0.0:0.0	.	383	O43865	SAHH2_HUMAN	V	383;336;336	ENSP00000358814:E383V;ENSP00000352092:E336V;ENSP00000377238:E336V	ENSP00000352092:E336V	E	+	2	0	AHCYL1	110362542	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.136000	0.66102	0.533000	0.62120	GAG	AHCYL1	-	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000168710		0.438	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCYL1	HGNC	protein_coding	OTTHUMT00000032243.1	73	0.00	0	A			110561019	110561019	+1	no_errors	ENST00000369799	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	T
AHCTF1	25909	genome.wustl.edu	37	1	247076643	247076643	+	Silent	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:247076643C>T	ENST00000391829.2	-	4	570	c.447G>A	c.(445-447)ctG>ctA	p.L149L	AHCTF1_ENST00000366508.1_Silent_p.L184L|AHCTF1_ENST00000326225.3_Silent_p.L158L			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	149	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AAAGCCATCGCAGACTTGGAT	0.408																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											0													70.0	72.0	72.0					1																	247076643		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.447G>A	1.37:g.247076643C>T			A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	superfamily_Quinonprotein_ADH-like	p.L158	ENST00000391829.2	37	c.474		1																																																																																			AHCTF1	-	superfamily_Quinonprotein_ADH-like	ENSG00000153207		0.408	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		63	0.00	0	C	NM_015446		247076643	247076643	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	silent	44	13.73	7	SNP	0.937	T
API5	8539	genome.wustl.edu	37	11	43349344	43349344	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr11:43349344G>C	ENST00000531273.1	+	8	1000	c.861G>C	c.(859-861)ttG>ttC	p.L287F	API5_ENST00000534600.1_Missense_Mutation_p.L287F|RP11-484D2.2_ENST00000526220.1_RNA|API5_ENST00000455725.2_Missense_Mutation_p.L276F|API5_ENST00000534695.1_Intron|API5_ENST00000378852.3_Missense_Mutation_p.L287F|API5_ENST00000420461.2_Missense_Mutation_p.L233F			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	287	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						TTTAGGTATTGAAATTGTTGG	0.289																																					Pancreas(1;98 122 5625 20895 49453)	dbGAP											0													140.0	137.0	138.0					11																	43349344		2203	4299	6502	-	-	-	SO:0001583	missense	0			U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.861G>C	11.37:g.43349344G>C	ENSP00000431391:p.Leu287Phe		B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Missense_Mutation	SNP	pfam_API5,superfamily_ARM-type_fold	p.L287F	ENST00000531273.1	37	c.861	CCDS44572.1	11	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445142	0.63178	.	.	ENSG00000166181	ENST00000455725;ENST00000531273;ENST00000420461;ENST00000378852;ENST00000534600;ENST00000526394	T;T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07;1.07	5.17	2.02	0.26589	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.56848	0.2013	M	0.68317	2.08	0.48901	D	0.999722	D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.982	T	0.51888	-0.8648	10	0.48119	T	0.1	-18.5752	8.5297	0.33326	0.2836:0.0:0.7164:0.0	.	233;287;276;287;287	B4DGR0;Q9BZZ5;B4E283;G3V1C3;Q9BZZ5-2	.;API5_HUMAN;.;.;.	F	276;287;233;287;287;102	ENSP00000399341:L276F;ENSP00000431391:L287F;ENSP00000402540:L233F;ENSP00000368129:L287F;ENSP00000434462:L287F;ENSP00000436436:L102F	ENSP00000368129:L287F	L	+	3	2	API5	43305920	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.823000	0.55715	0.178000	0.19917	-0.373000	0.07131	TTG	API5	-	pfam_API5,superfamily_ARM-type_fold	ENSG00000166181		0.289	API5-002	KNOWN	basic|CCDS	protein_coding	API5	HGNC	protein_coding	OTTHUMT00000389545.1	65	0.00	0	G	NM_006595		43349344	43349344	+1	no_errors	ENST00000531273	ensembl	human	known	69_37n	missense	59	19.18	14	SNP	1.000	C
ATP1A2	477	genome.wustl.edu	37	1	160106729	160106729	+	Silent	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:160106729C>T	ENST00000361216.3	+	20	2837	c.2748C>T	c.(2746-2748)caC>caT	p.H916H	ATP1A2_ENST00000392233.3_Silent_p.H916H	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	916					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TCACGTGCCACACGGCATTCT	0.582																																						dbGAP											0													229.0	175.0	193.0					1																	160106729		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2748C>T	1.37:g.160106729C>T			D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.T610I	ENST00000361216.3	37	c.1829	CCDS1196.1	1	.	.	.	.	.	.	.	.	.	.	c	9.589	1.125722	0.20959	.	.	ENSG00000018625	ENST00000447527	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	T	0.47488	0.1448	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46331	-0.9199	4	.	.	.	.	8.7352	0.34523	0.0:0.8989:0.0:0.1011	.	.	.	.	I	610	.	.	T	+	2	0	ATP1A2	158373353	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.228000	0.32588	2.514000	0.84764	0.651000	0.88453	ACA	ATP1A2	-	pfam_ATPase_P-typ_cation-transptr_C,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000018625		0.582	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	HGNC	protein_coding	OTTHUMT00000060642.2	48	0.00	0	C	NM_000702		160106729	160106729	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000447527	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	T
CARD6	84674	genome.wustl.edu	37	5	40852755	40852756	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr5:40852755_40852756insA	ENST00000254691.5	+	3	1520_1521	c.1321_1322insA	c.(1321-1323)gagfs	p.E441fs	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	441					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						GGGGCCTACAGAGGATACAGAA	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.1322dupA	5.37:g.40852756_40852756dupA	ENSP00000254691:p.Glu441fs		Q52LR2	Frame_Shift_Ins	INS	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.D442fs	ENST00000254691.5	37	c.1321_1322	CCDS3935.1	5																																																																																			CARD6	-	NULL	ENSG00000132357		0.446	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	HGNC	protein_coding	OTTHUMT00000211584.3	34	0.00	0	-			40852755	40852756	+1	no_errors	ENST00000254691	ensembl	human	known	69_37n	frame_shift_ins	39	17.02	8	INS	0.000:0.000	A
CATSPER4	378807	genome.wustl.edu	37	1	26517279	26517279	+	Missense_Mutation	SNP	G	G	T	rs371908011		TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:26517279G>T	ENST00000456354.2	+	1	228	c.161G>T	c.(160-162)gGt>gTt	p.G54V		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	54					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		GAGTCCTACGGTCGGCCAGAG	0.617																																						dbGAP											0													39.0	42.0	41.0					1																	26517279		2203	4300	6503	-	-	-	SO:0001583	missense	0			BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.161G>T	1.37:g.26517279G>T	ENSP00000390423:p.Gly54Val		A1A4W6|Q5VY71	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.G54V	ENST00000456354.2	37	c.161	CCDS30645.1	1	.	.	.	.	.	.	.	.	.	.	G	8.050	0.765692	0.15983	.	.	ENSG00000188782	ENST00000338855;ENST00000456354	D;D	0.97505	-4.41;-4.4	5.29	-10.6	0.00265	.	3.036110	0.01588	N	0.021399	D	0.91503	0.7317	L	0.36672	1.1	0.09310	N	0.999993	B	0.12630	0.006	B	0.08055	0.003	T	0.82548	-0.0402	10	0.24483	T	0.36	6.8275	3.0078	0.06034	0.1387:0.2365:0.5176:0.1072	.	54	Q7RTX7	CTSR4_HUMAN	V	54	ENSP00000341006:G54V;ENSP00000390423:G54V	ENSP00000341006:G54V	G	+	2	0	CATSPER4	26389866	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.497000	0.02289	-3.252000	0.00204	-1.098000	0.02139	GGT	CATSPER4	-	NULL	ENSG00000188782		0.617	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER4	HGNC	protein_coding	OTTHUMT00000019849.2	35	0.00	0	G	NM_198137		26517279	26517279	+1	no_errors	ENST00000456354	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.000	T
CCDC171	203238	genome.wustl.edu	37	9	15874580	15874580	+	Silent	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr9:15874580C>T	ENST00000380701.3	+	24	3847	c.3519C>T	c.(3517-3519)ttC>ttT	p.F1173F	CCDC171_ENST00000297641.3_Silent_p.F1173F|CCDC171_ENST00000486641.2_3'UTR	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	1173																	GGAATGACTTCACCCTACAGC	0.488																																						dbGAP											0													144.0	129.0	134.0					9																	15874580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.3519C>T	9.37:g.15874580C>T			B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	NULL	p.S413L	ENST00000380701.3	37	c.1238	CCDS6481.1	9	.	.	.	.	.	.	.	.	.	.	C	7.709	0.694815	0.15039	.	.	ENSG00000164989	ENST00000449575;ENST00000432954	.	.	.	5.74	4.85	0.62838	.	.	.	.	.	T	0.62696	0.2449	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61178	-0.7115	4	.	.	.	-9.2266	11.1014	0.48177	0.0:0.8588:0.0:0.1412	.	.	.	.	L	413;227	.	.	S	+	2	0	C9orf93	15864580	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.319000	0.65835	1.446000	0.47643	0.644000	0.83932	TCA	CCDC171	-	NULL	ENSG00000164989		0.488	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4	42	0.00	0	C	NM_173550		15874580	15874580	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000449575	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	1.000	T
CD200	4345	genome.wustl.edu	37	3	112052068	112052068	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr3:112052068G>T	ENST00000315711.8	+	1	66	c.9G>T	c.(7-9)agG>agT	p.R3S	CD200_ENST00000607516.1_3'UTR|RP11-90K6.1_ENST00000498032.1_lincRNA|CD200_ENST00000473539.1_Missense_Mutation_p.R3S|CD200_ENST00000383681.3_5'UTR	NM_005944.5	NP_005935.4	P41217	OX2G_HUMAN	CD200 molecule	3					regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				GGATGGAGAGGCTGGTGAGCG	0.726																																						dbGAP											0													6.0	9.0	8.0					3																	112052068		1804	3504	5308	-	-	-	SO:0001583	missense	0				CCDS2965.1, CCDS33818.1	3q13.2	2013-09-20	2006-03-28	2004-09-01	ENSG00000091972	ENSG00000091972		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7203	protein-coding gene	gene with protein product		155970	"""antigen identified by monoclonal antibody MRC OX-2"", ""CD200 antigen"""	MOX1, MOX2			Standard	XM_005247482		Approved	MRC, OX-2	uc003dyw.3	P41217	OTTHUMG00000159248	ENST00000315711.8:c.9G>T	3.37:g.112052068G>T	ENSP00000312766:p.Arg3Ser		B3KQI1|B4DLW9|D3DN65|Q6J2Q6|Q6PIQ4|Q8TB85|Q9H3J3	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R3S	ENST00000315711.8	37	c.9	CCDS2965.1	3	.	.	.	.	.	.	.	.	.	.	g	6.072	0.381559	0.11524	.	.	ENSG00000091972	ENST00000315711;ENST00000473539	T;T	0.72167	1.21;-0.63	2.98	-2.56	0.06268	.	.	.	.	.	T	0.34424	0.0897	N	0.04508	-0.205	0.34789	D	0.73556	B;B	0.13145	0.001;0.007	B;B	0.10450	0.001;0.005	T	0.45041	-0.9288	9	0.02654	T	1	.	2.6889	0.05115	0.363:0.0:0.2658:0.3712	.	3;3	P41217-2;P41217-3	.;.	S	3	ENSP00000312766:R3S;ENSP00000420298:R3S	ENSP00000312766:R3S	R	+	3	2	CD200	113534758	0.343000	0.24818	0.002000	0.10522	0.043000	0.13939	0.138000	0.16016	-0.668000	0.05296	0.580000	0.79431	AGG	CD200	-	NULL	ENSG00000091972		0.726	CD200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD200	HGNC	protein_coding	OTTHUMT00000354078.1	8	0.00	0	G			112052068	112052068	+1	no_errors	ENST00000473539	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.003	T
CEP95	90799	genome.wustl.edu	37	17	62530781	62530781	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:62530781G>A	ENST00000556440.2	+	17	2506	c.1996G>A	c.(1996-1998)Gct>Act	p.A666T	CEP95_ENST00000553412.1_Missense_Mutation_p.A502T	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	666						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						AATCGTTCGTGCTCGAAAATA	0.423																																						dbGAP											0													101.0	98.0	99.0					17																	62530781		1872	4102	5974	-	-	-	SO:0001583	missense	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1996G>A	17.37:g.62530781G>A	ENSP00000450461:p.Ala666Thr		B4DMD2|Q96M81	Missense_Mutation	SNP	superfamily_CH-domain	p.A666T	ENST00000556440.2	37	c.1996	CCDS45763.1	17	.	.	.	.	.	.	.	.	.	.	G	18.87	3.714536	0.68730	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.38077	1.16;1.19	5.75	5.75	0.90469	.	0.115663	0.56097	D	0.000022	T	0.63896	0.2550	M	0.73598	2.24	0.49051	D	0.999746	D;D	0.89917	1.0;1.0	D;D	0.83275	0.979;0.996	T	0.64385	-0.6420	10	0.72032	D	0.01	-10.255	20.312	0.98644	0.0:0.0:1.0:0.0	.	666;666	A8K3H2;Q96GE4	.;CEP95_HUMAN	T	601;666;502	ENSP00000450461:A666T;ENSP00000450906:A502T	ENSP00000438458:A601T	A	+	1	0	CEP95	59961243	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	6.479000	0.73600	2.866000	0.98385	0.650000	0.86243	GCT	CEP95	-	NULL	ENSG00000258890		0.423	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	54	0.00	0	G	NM_138363		62530781	62530781	+1	no_errors	ENST00000556440	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	1.000	A
CYLC2	1539	genome.wustl.edu	37	9	105767034	105767034	+	Missense_Mutation	SNP	T	T	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr9:105767034T>A	ENST00000374798.3	+	4	308	c.238T>A	c.(238-240)Tct>Act	p.S80T	CYLC2_ENST00000487798.1_Missense_Mutation_p.S80T	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	80	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				GATGTACCGTTCTTTAATGAG	0.398																																						dbGAP											0													87.0	83.0	85.0					9																	105767034		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.238T>A	9.37:g.105767034T>A	ENSP00000420256:p.Ser80Thr		B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NULL	p.S80T	ENST00000374798.3	37	c.238	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	T	19.49	3.836593	0.71373	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.36520	1.25;1.25	4.53	4.53	0.55603	.	0.000000	0.42821	D	0.000645	T	0.58337	0.2115	M	0.78637	2.42	0.29011	N	0.886896	D	0.89917	1.0	D	0.85130	0.997	T	0.57820	-0.7745	10	0.87932	D	0	-12.0095	10.4457	0.44493	0.0:0.0:0.0:1.0	.	80	Q14093	CYLC2_HUMAN	T	80	ENSP00000420256:S80T;ENSP00000417674:S80T	ENSP00000420256:S80T	S	+	1	0	CYLC2	104806855	1.000000	0.71417	0.999000	0.59377	0.885000	0.51271	3.303000	0.51858	2.031000	0.59945	0.482000	0.46254	TCT	CYLC2	-	NULL	ENSG00000155833		0.398	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	65	0.00	0	T	NM_001340		105767034	105767034	+1	no_errors	ENST00000374798	ensembl	human	putative	69_37n	missense	35	12.50	5	SNP	1.000	A
E2F4	1874	genome.wustl.edu	37	16	67226205	67226205	+	Silent	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr16:67226205C>T	ENST00000379378.3	+	1	134	c.75C>T	c.(73-75)ctC>ctT	p.L25L	EXOC3L1_ENST00000562887.1_5'Flank|EXOC3L1_ENST00000314586.6_5'Flank	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	25					blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TGGGACTGCTCACCACCAAGT	0.706																																						dbGAP											0													29.0	24.0	26.0					16																	67226205		2195	4296	6491	-	-	-	SO:0001819	synonymous_variant	0			BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.75C>T	16.37:g.67226205C>T			A6NGR8|B5BU56|Q12991|Q15328	Silent	SNP	pfam_E2F_TDP	p.L25	ENST00000379378.3	37	c.75	CCDS32464.1	16																																																																																			E2F4	-	pfam_E2F_TDP	ENSG00000205250		0.706	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	E2F4	HGNC	protein_coding	OTTHUMT00000421565.1	32	0.00	0	C	NM_001950		67226205	67226205	+1	no_errors	ENST00000379378	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	1.000	T
EEA1	8411	genome.wustl.edu	37	12	93244971	93244971	+	Silent	SNP	A	A	G			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr12:93244971A>G	ENST00000322349.8	-	9	978	c.714T>C	c.(712-714)gaT>gaC	p.D238D		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	238					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						AGGTCATGTTATCCATTAGTG	0.368																																						dbGAP											0													123.0	103.0	110.0					12																	93244971		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.714T>C	12.37:g.93244971A>G			Q14221	Silent	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.D238	ENST00000322349.8	37	c.714	CCDS31874.1	12																																																																																			EEA1	-	NULL	ENSG00000102189		0.368	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	HGNC	protein_coding	OTTHUMT00000407304.1	105	0.00	0	A	NM_003566		93244971	93244971	-1	no_errors	ENST00000322349	ensembl	human	known	69_37n	silent	97	10.19	11	SNP	1.000	G
FAM138B	654412	genome.wustl.edu	37	2	114336058	114336058	+	lincRNA	SNP	C	C	T	rs372812385		TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr2:114336058C>T	ENST00000432583.2	+	0	861									family with sequence similarity 138, member B																		TGTCTATTCCCACTCCCTGCC	0.542																																						dbGAP											0																																										-	-	-			0					2q13	2013-01-30			ENSG00000226516	ENSG00000226516		"""Long non-coding RNAs"""	33582	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026821		Approved	F379	uc002tjz.3		OTTHUMG00000047820		2.37:g.114336058C>T				RNA	SNP	-	NULL	ENST00000432583.2	37	NULL		2																																																																																			FAM138B	-	-	ENSG00000226516		0.542	FAM138B-002	KNOWN	basic	lincRNA	FAM138B	HGNC	lincRNA	OTTHUMT00000109027.3	17	0.00	0	C	NR_026821		114336058	114336058	+1	no_errors	ENST00000446648	ensembl	human	known	69_37n	rna	9	18.18	2	SNP	0.022	T
FLJ42102	399923	genome.wustl.edu	37	11	71117644	71117644	+	RNA	SNP	A	A	G	rs1557465	byFrequency	TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr11:71117644A>G	ENST00000331301.4	-	0	1309					NR_038862.1																						AGTGATCGCCATGAGGTCCTG	0.507													A|||	1470	0.29353	0.3275	0.2464	5008	,	,		23568	0.2113		0.2793	False		,,,				2504	0.3804					dbGAP											0																																										-	-	-			0																															11.37:g.71117644A>G				RNA	SNP	-	NULL	ENST00000331301.4	37	NULL		11																																																																																			AP002387.1	-	-	ENSG00000172900		0.507	AP002387.1-002	KNOWN	basic	processed_transcript	FLJ42102	Clone_based_vega_gene	pseudogene	OTTHUMT00000342268.1	34	0.00	0	A			71117644	71117644	-1	no_errors	ENST00000331301	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	0.003	G
GGNBP2	79893	genome.wustl.edu	37	17	34942557	34942557	+	Nonsense_Mutation	SNP	G	G	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:34942557G>T	ENST00000304718.4	+	12	1886	c.1570G>T	c.(1570-1572)Gaa>Taa	p.E524*		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	524					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.E524*(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GGCAAATTCTGAAGAGAACGA	0.343																																						dbGAP											1	Substitution - Nonsense(1)	prostate(1)											119.0	123.0	122.0					17																	34942557		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1570G>T	17.37:g.34942557G>T	ENSP00000307617:p.Glu524*		B2RPK7|Q96T90|Q9GZR8|Q9H767	Nonsense_Mutation	SNP	NULL	p.E524*	ENST00000304718.4	37	c.1570	CCDS11314.1	17	.	.	.	.	.	.	.	.	.	.	G	38	6.743434	0.97805	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.6	5.6	0.85130	.	0.152089	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-16.1193	12.8979	0.58109	0.0743:0.0:0.9257:0.0	.	.	.	.	X	524	.	ENSP00000307617:E524X	E	+	1	0	GGNBP2	32016670	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	7.091000	0.76923	2.640000	0.89533	0.561000	0.74099	GAA	GGNBP2	-	NULL	ENSG00000005955		0.343	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGNBP2	HGNC	protein_coding	OTTHUMT00000256684.2	37	0.00	0	G	NM_024835		34942557	34942557	+1	no_errors	ENST00000304718	ensembl	human	known	69_37n	nonsense	18	14.29	3	SNP	1.000	T
GPKOW	27238	genome.wustl.edu	37	X	48980041	48980041	+	Missense_Mutation	SNP	A	A	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chrX:48980041A>T	ENST00000156109.5	-	1	110	c.32T>A	c.(31-33)cTg>cAg	p.L11Q		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	11						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						AGCAGCCGTCAGCGGCAAAAC	0.627																																						dbGAP											0													31.0	26.0	28.0					X																	48980041		2198	4300	6498	-	-	-	SO:0001583	missense	0			U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.32T>A	X.37:g.48980041A>T	ENSP00000156109:p.Leu11Gln		Q59EK5|Q9BQA8	Missense_Mutation	SNP	pfam_KOW,pfam_G_patch_dom,superfamily_Translation_prot_SH3-like,smart_G_patch_dom,smart_KOW,pfscan_G_patch_dom	p.L11Q	ENST00000156109.5	37	c.32	CCDS35251.1	X	.	.	.	.	.	.	.	.	.	.	A	0.284	-0.984469	0.02180	.	.	ENSG00000068394	ENST00000156109	.	.	.	5.09	3.31	0.37934	.	0.523300	0.20764	N	0.086108	T	0.20495	0.0493	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20009	-1.0288	9	0.19147	T	0.46	-0.1686	9.071	0.36493	0.151:0.0:0.849:0.0	.	11	Q92917	GPKOW_HUMAN	Q	11	.	ENSP00000156109:L11Q	L	-	2	0	GPKOW	48866985	0.001000	0.12720	0.014000	0.15608	0.003000	0.03518	0.417000	0.21214	0.461000	0.27071	-0.476000	0.04901	CTG	GPKOW	-	NULL	ENSG00000068394		0.627	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPKOW	HGNC	protein_coding	OTTHUMT00000056535.2	88	0.00	0	A	NM_015698		48980041	48980041	-1	no_errors	ENST00000156109	ensembl	human	known	69_37n	missense	69	16.87	14	SNP	0.044	T
GYS1	2997	genome.wustl.edu	37	19	49490506	49490506	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr19:49490506C>T	ENST00000323798.3	-	3	633	c.437G>A	c.(436-438)cGc>cAc	p.R146H	GYS1_ENST00000544287.1_Intron|GYS1_ENST00000263276.6_Intron|GYS1_ENST00000541188.1_Missense_Mutation_p.R66H|GYS1_ENST00000540532.1_Missense_Mutation_p.R66H|GYS1_ENST00000457974.1_5'UTR	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	146					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		GTTGGCCTCGCGGTCGTACCA	0.607																																						dbGAP											0													88.0	65.0	73.0					19																	49490506		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.437G>A	19.37:g.49490506C>T	ENSP00000317904:p.Arg146His		Q9BTT9	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.R146H	ENST00000323798.3	37	c.437	CCDS12747.1	19	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259057	0.80246	.	.	ENSG00000104812	ENST00000323798;ENST00000541188;ENST00000540532;ENST00000457974	T;T;T	0.64085	-0.08;-0.08;-0.08	3.82	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.66470	0.2792	L	0.31752	0.955	0.54753	D	0.999986	D;D	0.76494	0.999;0.996	D;D	0.68192	0.931;0.956	T	0.66052	-0.6019	10	0.37606	T	0.19	-12.2516	14.0486	0.64719	0.0:1.0:0.0:0.0	.	66;146	B7Z806;P13807	.;GYS1_HUMAN	H	146;66;66;145	ENSP00000317904:R146H;ENSP00000437922:R66H;ENSP00000445197:R66H	ENSP00000317904:R146H	R	-	2	0	GYS1	54182318	1.000000	0.71417	0.978000	0.43139	0.987000	0.75469	5.608000	0.67654	2.088000	0.63022	0.557000	0.71058	CGC	GYS1	-	pfam_Glycogen_synth	ENSG00000104812		0.607	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	HGNC	protein_coding	OTTHUMT00000319791.1	79	0.00	0	C	NM_002103		49490506	49490506	-1	no_errors	ENST00000323798	ensembl	human	known	69_37n	missense	67	12.99	10	SNP	0.997	T
HLA-DMA	3108	genome.wustl.edu	37	6	32917497	32917497	+	Silent	SNP	T	T	C			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr6:32917497T>C	ENST00000374843.4	-	3	628	c.543A>G	c.(541-543)ggA>ggG	p.G181G	HLA-DMA_ENST00000395305.3_Silent_p.G86G|HLA-DMA_ENST00000464392.1_5'UTR|XXbac-BPG181M17.5_ENST00000429234.1_Intron|HLA-DMA_ENST00000395303.3_Silent_p.G147G	NM_006120.3	NP_006111.2	P28067	DMA_HUMAN	major histocompatibility complex, class II, DM alpha	181	Alpha-2.|Ig-like C1-type.		G -> A (in allele DMA*01:03; dbSNP:rs6926628).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|chaperone mediated protein folding requiring cofactor (GO:0051085)|immunoglobulin mediated immune response (GO:0016064)|inner ear development (GO:0048839)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of immune response (GO:0050778)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein transport (GO:0015031)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)	MHC class II protein complex binding (GO:0023026)			kidney(1)|large_intestine(2)|lung(8)	11						GGAAGCTGAGTCCATCGACAG	0.473																																						dbGAP											0													76.0	69.0	72.0					6																	32917497		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0				CCDS4761.1	6p21.3	2013-01-11			ENSG00000204257	ENSG00000204257		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4934	protein-coding gene	gene with protein product		142855				1922385	Standard	NM_006120		Approved	D6S222E, RING6	uc003ocm.2	P28067	OTTHUMG00000031173	ENST00000374843.4:c.543A>G	6.37:g.32917497T>C			Q29639|Q29640	Silent	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like	p.G181	ENST00000374843.4	37	c.543	CCDS4761.1	6																																																																																			HLA-DMA	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000204257		0.473	HLA-DMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMA	HGNC	protein_coding	OTTHUMT00000076325.2	37	0.00	0	T	NM_006120		32917497	32917497	-1	no_errors	ENST00000374843	ensembl	human	known	69_37n	silent	31	13.89	5	SNP	0.999	C
HOXA7	3204	genome.wustl.edu	37	7	27191035	27191035	+	IGR	SNP	G	G	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr7:27191035G>T	ENST00000242159.3	-	0	2020				HOXA-AS3_ENST00000524304.1_RNA|HOXA-AS3_ENST00000518848.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA6_ENST00000521478.1_5'Flank	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7						angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						TTGCGCCAAGGTGGATTGGGG	0.657																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217		7.37:g.27191035G>T			A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	RNA	SNP	-	NULL	ENST00000242159.3	37	NULL	CCDS5408.1	7																																																																																			HOXA-AS3	-	-	ENSG00000254369		0.657	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA-AS3	HGNC	protein_coding	OTTHUMT00000358695.1	8	0.00	0	G			27191035	27191035	+1	no_errors	ENST00000524304	ensembl	human	known	69_37n	rna	5	50.00	5	SNP	0.000	T
HOXA10	3206	genome.wustl.edu	37	7	27213491	27213491	+	Silent	SNP	C	C	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr7:27213491C>A	ENST00000283921.4	-	1	434	c.435G>T	c.(433-435)ccG>ccT	p.P145P	RP1-170O19.20_ENST00000470747.4_Intron|HOXA-AS4_ENST00000519935.1_RNA|HOXA10_ENST00000521421.1_5'Flank|HOXA-AS4_ENST00000523790.1_RNA|HOXA-AS4_ENST00000519694.1_RNA|HOXA10_ENST00000396344.4_Intron|RP1-170O19.20_ENST00000465941.1_Intron	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	145	Poly-Pro.				anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						GGGGTGGTTgcggcgggggcg	0.701																																						dbGAP											0													8.0	9.0	8.0					7																	27213491		2099	4190	6289	-	-	-	SO:0001819	synonymous_variant	0				CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.435G>T	7.37:g.27213491C>A			O43370|O43605|Q15949|Q504T1	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.P145	ENST00000283921.4	37	c.435	CCDS5410.2	7																																																																																			HOXA10	-	NULL	ENSG00000253293		0.701	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HOXA10	HGNC	protein_coding	OTTHUMT00000358724.2	12	0.00	0	C			27213491	27213491	-1	no_errors	ENST00000283921	ensembl	human	known	69_37n	silent	10	41.18	7	SNP	1.000	A
LRRC10	376132	genome.wustl.edu	37	12	70004049	70004049	+	Silent	SNP	G	G	T	rs547157948	byFrequency	TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr12:70004049G>T	ENST00000361484.3	-	1	893	c.570C>A	c.(568-570)ccC>ccA	p.P190P		NM_201550.2	NP_963844.2	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	190					cardiac muscle cell development (GO:0055013)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sarcomere (GO:0030017)				large_intestine(2)|lung(6)	8	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			CCTCCAGGAAGGGCATGTGAA	0.577																																						dbGAP											0													91.0	81.0	84.0					12																	70004049		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095935	CCDS31856.1	12q15	2009-09-08				ENSG00000198812			20264	protein-coding gene	gene with protein product		610846				14751244	Standard	NM_201550		Approved	HRLRRP, LRRC10A	uc001svc.3	Q5BKY1		ENST00000361484.3:c.570C>A	12.37:g.70004049G>T			Q6ZVY4	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P190	ENST00000361484.3	37	c.570	CCDS31856.1	12																																																																																			LRRC10	-	NULL	ENSG00000198812		0.577	LRRC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC10	HGNC	protein_coding	OTTHUMT00000403834.1	28	0.00	0	G	NM_201550		70004049	70004049	-1	no_errors	ENST00000361484	ensembl	human	known	69_37n	silent	24	14.29	4	SNP	0.131	T
LRRC37BP1	147172	genome.wustl.edu	37	17	28964071	28964071	+	RNA	SNP	G	G	C	rs2530837	byFrequency	TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:28964071G>C	ENST00000417404.1	+	0	4329									leucine rich repeat containing 37B pseudogene 1																		agaaccagtcgtctgcaaggt	0.428													C|||	205	0.0409345	0.1256	0.0086	5008	,	,		20053	0.0		0.0089	False		,,,				2504	0.0245					dbGAP											0																																										-	-	-			0			BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28964071G>C				RNA	SNP	-	NULL	ENST00000417404.1	37	NULL		17																																																																																			LRRC37BP1	-	-	ENSG00000214719		0.428	LRRC37BP1-003	KNOWN	basic	processed_transcript	LRRC37BP1	HGNC	pseudogene	OTTHUMT00000256203.1	11	0.00	0	G	NR_015341		28964071	28964071	+1	no_errors	ENST00000417404	ensembl	human	known	69_37n	rna	13	31.58	6	SNP	0.001	C
LRRC37A3	374819	genome.wustl.edu	37	17	62892271	62892271	+	Missense_Mutation	SNP	A	A	T	rs62071406		TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:62892271A>T	ENST00000584306.1	-	3	1635	c.1105T>A	c.(1105-1107)Tct>Act	p.S369T	LRRC37A3_ENST00000577487.1_5'Flank|RP11-927P21.1_ENST00000577938.1_RNA|RP11-927P21.1_ENST00000584131.1_RNA|LRRC37A3_ENST00000319651.5_Missense_Mutation_p.S369T|RP11-927P21.1_ENST00000584959.1_RNA|LRRC37A3_ENST00000339474.5_Intron|LRRC37A3_ENST00000400877.3_Intron	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	369						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TCCCTAGAAGACTCAGAAGGC	0.537																																						dbGAP											0													25.0	32.0	30.0					17																	62892271		1973	4078	6051	-	-	-	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.1105T>A	17.37:g.62892271A>T	ENSP00000464535:p.Ser369Thr		Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S369T	ENST00000584306.1	37	c.1105	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	3.342	-0.134342	0.06711	.	.	ENSG00000176809	ENST00000319651	T	0.58506	0.33	2.69	-3.39	0.04868	.	.	.	.	.	T	0.43010	0.1228	L	0.31294	0.92	0.09310	N	1	P	0.52061	0.95	P	0.46718	0.525	T	0.36890	-0.9729	9	0.56958	D	0.05	.	3.9507	0.09368	0.5048:0.1903:0.3049:0.0	.	369	O60309	L37A3_HUMAN	T	369	ENSP00000325713:S369T	ENSP00000325713:S369T	S	-	1	0	LRRC37A3	60322733	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.093000	0.03362	-0.631000	0.05560	0.234000	0.17832	TCT	LRRC37A3	-	NULL	ENSG00000176809		0.537	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	69	0.00	0	A	NM_199340		62892271	62892271	-1	no_errors	ENST00000319651	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	0.000	T
MCAM	4162	genome.wustl.edu	37	11	119182273	119182273	+	Silent	SNP	G	G	C	rs371378440		TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr11:119182273G>C	ENST00000264036.4	-	11	1388	c.1374C>G	c.(1372-1374)ccC>ccG	p.P458P	MCAM_ENST00000392814.1_Silent_p.P407P	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	458	Ig-like C2-type 3.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		TGGTGGGCCGGGGGTGCCCTG	0.582																																						dbGAP											0													99.0	85.0	90.0					11																	119182273		2199	4295	6494	-	-	-	SO:0001819	synonymous_variant	0			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1374C>G	11.37:g.119182273G>C			O95812|Q59E86|Q6PHR3|Q6ZTR2	Silent	SNP	pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P458	ENST00000264036.4	37	c.1374	CCDS31690.1	11																																																																																			MCAM	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000076706		0.582	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCAM	HGNC	protein_coding	OTTHUMT00000388332.2	29	0.00	0	G			119182273	119182273	-1	no_errors	ENST00000264036	ensembl	human	known	69_37n	silent	15	34.78	8	SNP	0.076	C
USMG5	84833	genome.wustl.edu	37	10	105154106	105154106	+	5'UTR	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr10:105154106G>A	ENST00000369825.1	-	0	323				USMG5_ENST00000369815.1_Intron|USMG5_ENST00000309579.3_Intron|USMG5_ENST00000369811.1_Intron|USMG5_ENST00000337003.4_5'UTR|PDCD11_ENST00000369797.3_5'Flank|MIR1307_ENST00000408840.1_RNA			Q96IX5	USMG5_HUMAN	up-regulated during skeletal muscle growth 5 homolog (mouse)							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)				breast(1)	1		Colorectal(252;0.142)		Epithelial(162;3.94e-09)|all cancers(201;2.76e-08)|BRCA - Breast invasive adenocarcinoma(275;0.197)		CGAGCCGGTCGAGGTCCGGTC	0.522																																						dbGAP											0													122.0	115.0	117.0					10																	105154106		1568	3582	5150	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC007087	CCDS7548.1	10q24.33	2011-04-13	2008-06-05		ENSG00000173915	ENSG00000173915			30889	protein-coding gene	gene with protein product		615204	"""upregulated during skeletal muscle growth 5"", ""upregulated during skeletal muscle growth 5 homolog (mouse)"""			12477932	Standard	NM_032747		Approved	MGC14697, bA792D24.4, DAPIT	uc001kwx.2	Q96IX5	OTTHUMG00000018984	ENST00000369825.1:c.-160C>T	10.37:g.105154106G>A			B2R4N2|D3DR92	RNA	SNP	-	NULL	ENST00000369825.1	37	NULL	CCDS7548.1	10																																																																																			MIR1307	-	-	ENSG00000221767		0.522	USMG5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1307	HGNC	protein_coding	OTTHUMT00000050142.1	56	0.00	0	G	NM_032747		105154106	105154106	-1	no_errors	ENST00000408840	ensembl	human	known	69_37n	rna	42	19.23	10	SNP	0.975	A
MYO10	4651	genome.wustl.edu	37	5	16764477	16764477	+	Missense_Mutation	SNP	A	A	G			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr5:16764477A>G	ENST00000513610.1	-	12	1662	c.1208T>C	c.(1207-1209)aTg>aCg	p.M403T		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	403	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						ATACAGAGCCATGGCCAGGGA	0.542																																						dbGAP											0													111.0	107.0	109.0					5																	16764477		2102	4240	6342	-	-	-	SO:0001583	missense	0			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.1208T>C	5.37:g.16764477A>G	ENSP00000421280:p.Met403Thr		A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.M403T	ENST00000513610.1	37	c.1208	CCDS54834.1	5	.	.	.	.	.	.	.	.	.	.	A	22.0	4.233464	0.79688	.	.	ENSG00000145555	ENST00000513610;ENST00000513882	T;T	0.70986	-0.53;-0.53	5.56	5.56	0.83823	Myosin head, motor domain (2);	.	.	.	.	D	0.84862	0.5566	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.79784	0.985;0.993	D	0.86279	0.1666	9	0.51188	T	0.08	.	15.7266	0.77766	1.0:0.0:0.0:0.0	.	44;403	Q69YP8;Q9HD67	.;MYO10_HUMAN	T	403;414	ENSP00000421280:M403T;ENSP00000421309:M414T	ENSP00000421280:M403T	M	-	2	0	MYO10	16817477	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.319000	0.96338	2.110000	0.64415	0.528000	0.53228	ATG	MYO10	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000145555		0.542	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	HGNC	protein_coding	OTTHUMT00000366167.1	53	0.00	0	A	NM_012334		16764477	16764477	-1	no_errors	ENST00000513610	ensembl	human	known	69_37n	missense	54	14.29	9	SNP	1.000	G
NOTCH2	4853	genome.wustl.edu	37	1	120458941	120458942	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:120458941_120458942delAG	ENST00000256646.2	-	34	6622_6623	c.6403_6404delCT	c.(6403-6405)ctgfs	p.L2135fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2135					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTCTCACTCAGAGACTTCTTC	0.505			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6403_6404delCT	1.37:g.120458943_120458944delAG	ENSP00000256646:p.Leu2135fs		Q5T3X7|Q99734|Q9H240	Frame_Shift_Del	DEL	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.L2135fs	ENST00000256646.2	37	c.6404_6403	CCDS908.1	1																																																																																			NOTCH2	-	pirsf_Notch	ENSG00000134250		0.505	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	42	0.00	0	AG	NM_024408		120458941	120458942	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	frame_shift_del	24	21.21	7	DEL	0.769:0.670	-
OTOG	340990	genome.wustl.edu	37	11	17580085	17580085	+	Splice_Site	SNP	G	G	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr11:17580085G>T	ENST00000399391.2	+	9	1033	c.1033G>T	c.(1033-1035)Ggc>Tgc	p.G345C	OTOG_ENST00000399397.1_Splice_Site_p.G272C	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	345	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						CTTGCTCTAGGGCGTGTACGA	0.627																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.1033-1G>T	11.37:g.17580085G>T			A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.G345C	ENST00000399391.2	37	c.1033	CCDS59225.1	11	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550906	0.45383	.	.	ENSG00000188162	ENST00000399391;ENST00000399397	T;T	0.17528	2.27;2.38	4.89	4.89	0.63831	.	0.230380	0.29133	U	0.013056	T	0.27241	0.0668	M	0.64404	1.975	0.50313	D	0.999866	.	.	.	.	.	.	T	0.00964	-1.1498	8	0.48119	T	0.1	.	7.5088	0.27562	0.1451:0.0:0.8549:0.0	.	.	.	.	C	345;272	ENSP00000382323:G345C;ENSP00000382329:G272C	ENSP00000382323:G345C	G	+	1	0	OTOG	17536661	1.000000	0.71417	0.999000	0.59377	0.060000	0.15804	4.036000	0.57304	2.543000	0.85770	0.591000	0.81541	GGC	OTOG	-	smart_Unchr_dom_Cys-rich	ENSG00000188162		0.627	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		38	0.00	0	G		Missense_Mutation	17580085	17580085	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	1.000	T
OTOP2	92736	genome.wustl.edu	37	17	72923826	72923826	+	Silent	SNP	T	T	G			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:72923826T>G	ENST00000580223.1	+	4	606	c.576T>G	c.(574-576)tcT>tcG	p.S192S	OTOP2_ENST00000331427.4_Silent_p.S192S			Q7RTS6	OTOP2_HUMAN	otopetrin 2	192						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					TGGATGAATCTGTGCACCAAT	0.577																																						dbGAP											0													107.0	79.0	88.0					17																	72923826		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.576T>G	17.37:g.72923826T>G				Silent	SNP	pfam_Otopetrin	p.S192	ENST00000580223.1	37	c.576	CCDS11708.1	17																																																																																			OTOP2	-	pfam_Otopetrin	ENSG00000183034		0.577	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	HGNC	protein_coding	OTTHUMT00000445306.1	93	0.00	0	T	NM_178160		72923826	72923826	+1	no_errors	ENST00000331427	ensembl	human	known	69_37n	silent	64	21.95	18	SNP	0.004	G
PASK	23178	genome.wustl.edu	37	2	242080104	242080104	+	Silent	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr2:242080104C>T	ENST00000405260.1	-	3	959	c.261G>A	c.(259-261)ctG>ctA	p.L87L	PASK_ENST00000403638.3_Silent_p.L87L|PASK_ENST00000544142.1_Intron|PASK_ENST00000539818.1_Intron|PASK_ENST00000358649.4_Silent_p.L87L|PASK_ENST00000234040.4_Silent_p.L87L	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	87					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CAGGGCAGTGCAGTTTACTTG	0.562																																						dbGAP											0													75.0	74.0	75.0					2																	242080104		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.261G>A	2.37:g.242080104C>T			G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_cat_dom,tigrfam_PAS	p.L87	ENST00000405260.1	37	c.261	CCDS2545.1	2																																																																																			PASK	-	NULL	ENSG00000115687		0.562	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	38	0.00	0	C	NM_015148		242080104	242080104	-1	no_errors	ENST00000358649	ensembl	human	known	69_37n	silent	29	14.71	5	SNP	0.000	T
PER1	5187	genome.wustl.edu	37	17	8053091	8053091	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:8053091C>A	ENST00000317276.4	-	5	870	c.633G>T	c.(631-633)gaG>gaT	p.E211D	PER1_ENST00000581082.1_Missense_Mutation_p.E211D|PER1_ENST00000354903.5_Missense_Mutation_p.E195D	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	211	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GAAGTGTGTACTCAGACGTGA	0.597			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																														dbGAP		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0													198.0	191.0	194.0					17																	8053091		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.633G>T	17.37:g.8053091C>A	ENSP00000314420:p.Glu211Asp		B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.E211D	ENST00000317276.4	37	c.633	CCDS11131.1	17	.	.	.	.	.	.	.	.	.	.	C	15.64	2.894375	0.52121	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.55052	1.78;0.54	5.55	1.96	0.26148	PAS (1);	0.000000	0.85682	D	0.000000	T	0.69433	0.3110	M	0.84082	2.675	0.39265	D	0.964276	D;D;D	0.71674	0.996;0.998;0.982	D;D;D	0.77557	0.987;0.99;0.952	T	0.69420	-0.5150	10	0.62326	D	0.03	-21.9259	8.2202	0.31537	0.0:0.6958:0.0:0.3042	.	211;195;211	Q6IN51;B4DI49;O15534	.;.;PER1_HUMAN	D	211;195	ENSP00000314420:E211D;ENSP00000346979:E195D	ENSP00000314420:E211D	E	-	3	2	PER1	7993816	0.998000	0.40836	1.000000	0.80357	0.715000	0.41141	0.540000	0.23191	0.143000	0.18926	-0.251000	0.11542	GAG	PER1	-	smart_PAS	ENSG00000179094		0.597	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2	42	0.00	0	C			8053091	8053091	-1	no_errors	ENST00000317276	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	1.000	A
PIGM	93183	genome.wustl.edu	37	1	160001318	160001318	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:160001318C>G	ENST00000368090.2	-	1	465	c.212G>C	c.(211-213)aGa>aCa	p.R71T		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	71					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GTACGTGGCTCTCAGGTAAGG	0.602																																						dbGAP											0													75.0	66.0	69.0					1																	160001318		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.212G>C	1.37:g.160001318C>G	ENSP00000357069:p.Arg71Thr			Missense_Mutation	SNP	pfam_Mannosyltransferase_DXD	p.R71T	ENST00000368090.2	37	c.212	CCDS1192.1	1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531417	0.64972	.	.	ENSG00000143315	ENST00000368090	T	0.66280	-0.2	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.82903	0.5138	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.86855	0.2026	9	.	.	.	-7.4259	16.7038	0.85366	0.0:1.0:0.0:0.0	.	71	Q9H3S5	PIGM_HUMAN	T	71	ENSP00000357069:R71T	.	R	-	2	0	PIGM	158267942	0.989000	0.36119	0.662000	0.29724	0.021000	0.10359	6.982000	0.76173	2.813000	0.96785	0.561000	0.74099	AGA	PIGM	-	NULL	ENSG00000143315		0.602	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGM	HGNC	protein_coding	OTTHUMT00000060643.2	30	0.00	0	C	NM_145167		160001318	160001318	-1	no_errors	ENST00000368090	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	0.935	G
PIGT	51604	genome.wustl.edu	37	20	44044826	44044826	+	Silent	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr20:44044826C>T	ENST00000279036.6	+	1	110	c.30C>T	c.(28-30)ctC>ctT	p.L10L	PIGT_ENST00000535404.1_5'UTR|PIGT_ENST00000372689.5_Silent_p.L10L|PIGT_ENST00000279035.9_Silent_p.L10L|PIGT_ENST00000341555.5_Silent_p.L10L|PIGT_ENST00000545755.1_5'UTR|PIGT_ENST00000543458.2_Silent_p.L10L	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	10					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				TTGCTCTGCTCGTCCTGTTGC	0.667																																						dbGAP											0													7.0	9.0	8.0					20																	44044826		2176	4254	6430	-	-	-	SO:0001819	synonymous_variant	0				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.30C>T	20.37:g.44044826C>T			B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Missense_Mutation	SNP	NULL	p.R2C	ENST00000279036.6	37	c.4	CCDS13353.1	20	.	.	.	.	.	.	.	.	.	.	C	6.594	0.477923	0.12521	.	.	ENSG00000124155	ENST00000432270	.	.	.	5.65	-11.3	0.00108	.	.	.	.	.	T	0.13670	0.0331	.	.	.	0.20196	N	0.999928	.	.	.	.	.	.	T	0.08166	-1.0735	4	.	.	.	0.8897	1.2747	0.02028	0.2031:0.2797:0.1623:0.3549	.	.	.	.	C	2	.	.	R	+	1	0	PIGT	43478240	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.902000	0.00338	-3.504000	0.00151	-3.056000	0.00068	CGT	PIGT	-	NULL	ENSG00000124155		0.667	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGT	HGNC	protein_coding	OTTHUMT00000079434.2	34	0.00	0	C	NM_015937		44044826	44044826	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000432270	ensembl	human	putative	69_37n	missense	39	13.33	6	SNP	0.000	T
PLAGL1	5325	genome.wustl.edu	37	6	144262571	144262571	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr6:144262571G>T	ENST00000360537.2	-	5	3295	c.1382C>A	c.(1381-1383)gCa>gAa	p.A461E	PLAGL1_ENST00000354765.2_Missense_Mutation_p.A461E|PLAGL1_ENST00000429150.1_Missense_Mutation_p.A461E|PLAGL1_ENST00000367571.1_Missense_Mutation_p.A461E|PLAGL1_ENST00000437412.1_Missense_Mutation_p.A409E|PLAGL1_ENST00000416623.1_Missense_Mutation_p.A461E|PLAGL1_ENST00000392307.1_Missense_Mutation_p.A409E|PLAGL1_ENST00000367572.1_Missense_Mutation_p.A409E|PLAGL1_ENST00000444202.1_Missense_Mutation_p.A461E|PLAGL1_ENST00000392309.1_Missense_Mutation_p.A461E			Q9UM63	PLAL1_HUMAN	pleiomorphic adenoma gene-like 1	461					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(1)|large_intestine(4)|lung(2)|prostate(1)|skin(3)|stomach(2)	13				OV - Ovarian serous cystadenocarcinoma(155;5.74e-07)|GBM - Glioblastoma multiforme(68;0.0885)		TTATCTGAATGCATGATGGAA	0.443																																						dbGAP											0													20.0	23.0	22.0					6																	144262571		2191	4275	6466	-	-	-	SO:0001583	missense	0			U81992	CCDS5202.1, CCDS5203.1	6q24-q25	2013-01-08			ENSG00000118495	ENSG00000118495		"""Zinc fingers, C2H2-type"""	9046	protein-coding gene	gene with protein product		603044				9722527, 9671765	Standard	NM_006718		Approved	ZAC, LOT1	uc003qkf.3	Q9UM63	OTTHUMG00000015738	ENST00000360537.2:c.1382C>A	6.37:g.144262571G>T	ENSP00000353734:p.Ala461Glu		B2RBA4|B2RCM8|E1P595|E1P597|O76019|Q7Z3V8|Q92981|Q96JR9|Q9UIZ0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A461E	ENST00000360537.2	37	c.1382	CCDS5202.1	6	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883649	0.72410	.	.	ENSG00000118495	ENST00000360537;ENST00000354765;ENST00000444202;ENST00000429150;ENST00000392309;ENST00000416623;ENST00000437412;ENST00000392307;ENST00000451709;ENST00000367572;ENST00000367571	T;T;T;T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;2.84;2.84;2.84;1.92	5.54	4.66	0.58398	.	0.092092	0.47455	N	0.000232	T	0.28034	0.0691	L	0.27053	0.805	0.44927	D	0.997949	D	0.89917	1.0	D	0.81914	0.995	T	0.05370	-1.0889	10	0.87932	D	0	-15.4479	13.8876	0.63717	0.0747:0.0:0.9253:0.0	.	461	Q9UM63	PLAL1_HUMAN	E	461;461;461;461;461;461;409;409;250;409;461	ENSP00000353734:A461E;ENSP00000346810:A461E;ENSP00000400929:A461E;ENSP00000398409:A461E;ENSP00000376125:A461E;ENSP00000400060:A461E;ENSP00000392418:A409E;ENSP00000376124:A409E;ENSP00000356544:A409E;ENSP00000356543:A461E	ENSP00000346810:A461E	A	-	2	0	PLAGL1	144304264	1.000000	0.71417	0.995000	0.50966	0.885000	0.51271	9.203000	0.95033	2.617000	0.88574	0.655000	0.94253	GCA	PLAGL1	-	NULL	ENSG00000118495		0.443	PLAGL1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAGL1	HGNC	protein_coding	OTTHUMT00000042541.1	27	0.00	0	G			144262571	144262571	-1	no_errors	ENST00000354765	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	T
PLEKHA8P1	51054	genome.wustl.edu	37	12	45568343	45568343	+	RNA	SNP	C	C	G			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr12:45568343C>G	ENST00000256692.5	-	0	342					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GAATGAACTTCAATTTCACAG	0.443																																						dbGAP											0																																										-	-	-			0			AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45568343C>G				RNA	SNP	-	NULL	ENST00000256692.5	37	NULL		12																																																																																			PLEKHA8P1	-	-	ENSG00000134297		0.443	PLEKHA8P1-002	KNOWN	basic	processed_transcript	PLEKHA8P1	HGNC	pseudogene	OTTHUMT00000404814.1	58	0.00	0	C	NR_037144		45568343	45568343	-1	no_errors	ENST00000256692	ensembl	human	known	69_37n	rna	41	12.77	6	SNP	1.000	G
PRICKLE2	166336	genome.wustl.edu	37	3	64184686	64184686	+	Intron	DEL	T	T	-			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr3:64184686delT	ENST00000295902.6	-	2	546				PRICKLE2_ENST00000564377.1_Intron|PRICKLE2-AS3_ENST00000473434.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)						establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GGAAAAAACCTTTTTTTTTTT	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.40-43A>-	3.37:g.64184686delT			Q0VF44	RNA	DEL	-	NULL	ENST00000295902.6	37	NULL	CCDS2902.1	3																																																																																			PRICKLE2-AS3	-	-	ENSG00000226017		0.517	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2-AS3	HGNC	protein_coding	OTTHUMT00000352219.1	14	0.00	0	T	NM_198859		64184686	64184686	+1	no_errors	ENST00000473434	ensembl	human	known	69_37n	rna	7	27.27	3	DEL	0.222	-
PTCD3	55037	genome.wustl.edu	37	2	86364662	86364662	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr2:86364662G>A	ENST00000254630.7	+	24	2116	c.2050G>A	c.(2050-2052)Gac>Aac	p.D684N	SNORD94_ENST00000386037.1_RNA	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	684					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						CAGCGACAGTGACACCAGTGA	0.443																																						dbGAP											0													89.0	77.0	81.0					2																	86364662		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.2050G>A	2.37:g.86364662G>A	ENSP00000254630:p.Asp684Asn		A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	NULL	p.D684N	ENST00000254630.7	37	c.2050	CCDS33235.1	2	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543704	0.65198	.	.	ENSG00000132300	ENST00000254630	T	0.39787	1.06	4.35	4.35	0.52113	.	2.160190	0.02303	N	0.071402	T	0.49983	0.1589	L	0.41824	1.3	0.80722	D	1	P;P	0.50272	0.933;0.89	P;B	0.49853	0.624;0.346	T	0.43442	-0.9391	10	0.19590	T	0.45	-5.3713	15.9238	0.79597	0.0:0.0:1.0:0.0	.	275;684	Q96EY7-2;Q96EY7	.;PTCD3_HUMAN	N	684	ENSP00000254630:D684N	ENSP00000254630:D684N	D	+	1	0	PTCD3	86218173	0.000000	0.05858	0.824000	0.32777	0.826000	0.46750	0.432000	0.21461	2.379000	0.81126	0.561000	0.74099	GAC	PTCD3	-	NULL	ENSG00000132300		0.443	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCD3	HGNC	protein_coding	OTTHUMT00000329854.1	72	0.00	0	G	NM_017952		86364662	86364662	+1	no_errors	ENST00000254630	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	0.998	A
PTPRU	10076	genome.wustl.edu	37	1	29630448	29630448	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:29630448C>T	ENST00000345512.3	+	17	2717	c.2588C>T	c.(2587-2589)tCc>tTc	p.S863F	PTPRU_ENST00000460170.2_Missense_Mutation_p.S853F|PTPRU_ENST00000323874.8_Missense_Mutation_p.S853F|PTPRU_ENST00000356870.3_Missense_Mutation_p.S853F|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000373779.3_Missense_Mutation_p.S853F|PTPRU_ENST00000428026.2_Missense_Mutation_p.S853F	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	863	Mediates interaction with CTNNB1. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CGGAAGGGCTCCCCATACCAC	0.657																																						dbGAP											0													43.0	48.0	46.0					1																	29630448		2203	4300	6503	-	-	-	SO:0001583	missense	0			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2588C>T	1.37:g.29630448C>T	ENSP00000334941:p.Ser863Phe		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S863F	ENST00000345512.3	37	c.2588	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	C	19.86	3.906287	0.72868	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.33438	1.45;1.47;1.46;1.46;1.41;1.46	4.13	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.38188	0.1031	N	0.22421	0.69	0.80722	D	1	D;D;D;D;D	0.69078	0.995;0.995;0.995;0.991;0.997	D;D;D;P;P	0.63957	0.92;0.92;0.92;0.835;0.822	T	0.10019	-1.0648	9	.	.	.	.	16.6429	0.85134	0.0:1.0:0.0:0.0	.	853;853;853;853;863	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	F	863;853;853;853;853;853	ENSP00000334941:S863F;ENSP00000362884:S853F;ENSP00000349333:S853F;ENSP00000314987:S853F;ENSP00000392332:S853F;ENSP00000432906:S853F	.	S	+	2	0	PTPRU	29503035	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.535000	0.82014	2.592000	0.87571	0.561000	0.74099	TCC	PTPRU	-	NULL	ENSG00000060656		0.657	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	34	0.00	0	C			29630448	29630448	+1	no_errors	ENST00000345512	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
R3HCC1L	27291	genome.wustl.edu	37	10	99968730	99968730	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr10:99968730G>A	ENST00000298999.3	+	5	1162	c.859G>A	c.(859-861)Gag>Aag	p.E287K	R3HCC1L_ENST00000370584.3_Missense_Mutation_p.E287K|R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370586.2_Intron	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	287							nucleotide binding (GO:0000166)										TTTTGAAGTTGAGAGTGTAGG	0.428																																						dbGAP											0													112.0	106.0	108.0					10																	99968730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.859G>A	10.37:g.99968730G>A	ENSP00000298999:p.Glu287Lys		O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	NULL	p.E287K	ENST00000298999.3	37	c.859	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	G	4.020	0.001240	0.07819	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.07567	3.18;3.18	5.42	2.01	0.26516	.	0.436922	0.21602	N	0.071921	T	0.07999	0.0200	L	0.56769	1.78	0.21386	N	0.999706	P;P	0.35628	0.513;0.513	B;B	0.34093	0.175;0.175	T	0.22034	-1.0228	9	.	.	.	-2.9563	5.7507	0.18144	0.2126:0.19:0.5974:0.0	.	287;287	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	K	287	ENSP00000359616:E287K;ENSP00000298999:E287K	.	E	+	1	0	C10orf28	99958720	0.929000	0.31497	0.157000	0.22605	0.118000	0.20060	1.224000	0.32539	0.645000	0.30675	0.655000	0.94253	GAG	R3HCC1L	-	NULL	ENSG00000166024		0.428	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	HGNC	protein_coding	OTTHUMT00000049764.1	23	0.00	0	G	NM_014472		99968730	99968730	+1	no_errors	ENST00000298999	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.080	A
RCOR3	55758	genome.wustl.edu	37	1	211452614	211452614	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:211452614G>A	ENST00000367005.4	+	6	643	c.502G>A	c.(502-504)Ggg>Agg	p.G168R	RCOR3_ENST00000367006.4_Missense_Mutation_p.G226R|RCOR3_ENST00000452621.2_Missense_Mutation_p.G226R|RCOR3_ENST00000419091.2_Missense_Mutation_p.G226R	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		TCCAATGGATGGGAATGATAG	0.318																																						dbGAP											0													129.0	117.0	121.0					1																	211452614		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.502G>A	1.37:g.211452614G>A	ENSP00000355972:p.Gly168Arg		B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Nonsense_Mutation	SNP	NULL	p.W12*	ENST00000367005.4	37	c.35	CCDS31016.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.32|17.32	3.359395|3.359395	0.61403|0.61403	.|.	.|.	ENSG00000117625|ENSG00000117625	ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005|ENST00000534460	T;T;T;T|.	0.37915|.	1.17;1.17;1.17;1.17|.	5.69|5.69	4.78|4.78	0.61160|0.61160	.|.	0.047692|.	0.85682|.	D|.	0.000000|.	T|.	0.61400|.	0.2344|.	L|L	0.46157|0.46157	1.445|1.445	0.54753|0.54753	D|D	0.99998|0.99998	P;B;P;B|.	0.46512|.	0.879;0.008;0.766;0.05|.	P;B;B;B|.	0.45829|.	0.494;0.007;0.374;0.061|.	T|.	0.58691|.	-0.7592|.	10|.	0.20519|.	T|.	0.43|.	-12.5164|-12.5164	14.6803|14.6803	0.69012|0.69012	0.0701:0.0:0.9299:0.0|0.0701:0.0:0.9299:0.0	.|.	226;168;226;226|.	Q9P2K3-3;Q9P2K3;Q9P2K3-2;Q9P2K3-4|.	.;RCOR3_HUMAN;.;.|.	R|X	226;226;226;168|12	ENSP00000355973:G226R;ENSP00000398558:G226R;ENSP00000413929:G226R;ENSP00000355972:G168R|.	ENSP00000355972:G168R|.	G|W	+|+	1|2	0|0	RCOR3|RCOR3	209519237|209519237	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.002000|0.002000	0.02628|0.02628	9.573000|9.573000	0.98181|0.98181	1.411000|1.411000	0.46957|0.46957	-0.266000|-0.266000	0.10368|0.10368	GGG|TGG	RCOR3	-	NULL	ENSG00000117625		0.318	RCOR3-001	KNOWN	basic|CCDS	protein_coding	RCOR3	HGNC	protein_coding	OTTHUMT00000089821.1	38	0.00	0	G	NM_018254		211452614	211452614	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000534460	ensembl	human	novel	69_37n	nonsense	24	14.29	4	SNP	1.000	A
SAMD9	54809	genome.wustl.edu	37	7	92732838	92732838	+	Missense_Mutation	SNP	G	G	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr7:92732838G>T	ENST00000379958.2	-	3	2842	c.2573C>A	c.(2572-2574)tCt>tAt	p.S858Y		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	858						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TTCTTTGGGAGAGAGTTGCTG	0.338																																						dbGAP											0													60.0	59.0	59.0					7																	92732838		2203	4295	6498	-	-	-	SO:0001583	missense	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2573C>A	7.37:g.92732838G>T	ENSP00000369292:p.Ser858Tyr		A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S858Y	ENST00000379958.2	37	c.2573	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	G	13.04	2.119822	0.37436	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	D;D	0.83419	-1.72;-1.72	4.47	4.47	0.54385	.	0.091573	0.45361	U	0.000361	D	0.91036	0.7180	M	0.80183	2.485	0.44890	D	0.997909	D	0.89917	1.0	D	0.85130	0.997	D	0.92439	0.5960	10	0.87932	D	0	-6.3343	15.8342	0.78787	0.0:0.0:1.0:0.0	.	858	Q5K651	SAMD9_HUMAN	Y	858	ENSP00000369292:S858Y;ENSP00000414529:S858Y	ENSP00000369292:S858Y	S	-	2	0	SAMD9	92570774	1.000000	0.71417	0.524000	0.27887	0.238000	0.25445	7.303000	0.78871	2.324000	0.78689	0.609000	0.83330	TCT	SAMD9	-	NULL	ENSG00000205413		0.338	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	40	0.00	0	G	NM_017654		92732838	92732838	-1	no_errors	ENST00000379958	ensembl	human	known	69_37n	missense	17	15.00	3	SNP	0.994	T
SETDB1	9869	genome.wustl.edu	37	1	150913841	150913841	+	Missense_Mutation	SNP	C	C	G			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr1:150913841C>G	ENST00000271640.5	+	5	674	c.484C>G	c.(484-486)Caa>Gaa	p.Q162E	SETDB1_ENST00000368962.2_Missense_Mutation_p.Q162E|SETDB1_ENST00000459773.1_Intron|SETDB1_ENST00000368969.4_Missense_Mutation_p.Q162E|SETDB1_ENST00000368963.1_Missense_Mutation_p.Q162E	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	162					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			AAAGTCAGCTCAAGATGTTCA	0.438																																						dbGAP											0													101.0	86.0	91.0					1																	150913841		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.484C>G	1.37:g.150913841C>G	ENSP00000271640:p.Gln162Glu		A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Tudor,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.Q162E	ENST00000271640.5	37	c.484	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031803	0.75504	.	.	ENSG00000143379	ENST00000525956;ENST00000271640;ENST00000368962;ENST00000534805;ENST00000368969;ENST00000368963;ENST00000498193	D;T;T;D;T	0.89123	-2.47;0.72;1.3;-2.47;1.02	5.26	4.35	0.52113	.	0.164288	0.56097	D	0.000037	D	0.86748	0.6007	N	0.24115	0.695	0.40492	D	0.980555	D;D;D;P;P	0.61697	0.982;0.99;0.974;0.597;0.924	D;D;D;B;P	0.73380	0.952;0.98;0.969;0.328;0.9	D	0.88110	0.2825	10	0.44086	T	0.13	.	14.1401	0.65313	0.0:0.9279:0.0:0.0721	.	162;162;162;162;162	E9PRF4;E9PQM8;Q15047-2;Q15047-3;Q15047	.;.;.;.;SETB1_HUMAN	E	162	ENSP00000271640:Q162E;ENSP00000357958:Q162E;ENSP00000436148:Q162E;ENSP00000357965:Q162E;ENSP00000432348:Q162E	ENSP00000271640:Q162E	Q	+	1	0	SETDB1	149180465	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.733000	0.68571	1.452000	0.47756	0.655000	0.94253	CAA	SETDB1	-	NULL	ENSG00000143379		0.438	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	83	0.00	0	C			150913841	150913841	+1	no_errors	ENST00000271640	ensembl	human	known	69_37n	missense	68	13.92	11	SNP	1.000	G
SFRP2	6423	genome.wustl.edu	37	4	154702642	154702642	+	Missense_Mutation	SNP	G	G	C			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr4:154702642G>C	ENST00000274063.4	-	3	1133	c.849C>G	c.(847-849)ttC>ttG	p.F283L		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	283	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				AGATGCGCTTGAACTCTCTCT	0.607																																						dbGAP											0													116.0	93.0	100.0					4																	154702642		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.849C>G	4.37:g.154702642G>C	ENSP00000274063:p.Phe283Leu		B3KQR2|O14778|Q9HAP5	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.F283L	ENST00000274063.4	37	c.849	CCDS34082.1	4	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268990	0.40095	.	.	ENSG00000145423	ENST00000274063	T	0.18657	2.2	5.95	5.0	0.66597	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.000000	0.85682	D	0.000000	T	0.20941	0.0504	L	0.49640	1.575	0.80722	D	1	P	0.35700	0.516	B	0.39904	0.313	T	0.01424	-1.1358	10	0.23891	T	0.37	.	9.5398	0.39244	0.2173:0.0:0.7827:0.0	.	283	Q96HF1	SFRP2_HUMAN	L	283	ENSP00000274063:F283L	ENSP00000274063:F283L	F	-	3	2	SFRP2	154922092	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.509000	0.35780	2.811000	0.96726	0.655000	0.94253	TTC	SFRP2	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain	ENSG00000145423		0.607	SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP2	HGNC	protein_coding	OTTHUMT00000365296.1	73	0.00	0	G			154702642	154702642	-1	no_errors	ENST00000274063	ensembl	human	known	69_37n	missense	48	22.58	14	SNP	1.000	C
SKIV2L	6499	genome.wustl.edu	37	6	31927109	31927109	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr6:31927109C>T	ENST00000375394.2	+	2	171	c.58C>T	c.(58-60)Cgg>Tgg	p.R20W	SKIV2L_ENST00000544581.1_5'UTR|NELFE_ENST00000375425.5_5'Flank|MIR1236_ENST00000408340.1_RNA|SKIV2L_ENST00000488648.1_3'UTR|NELFE_ENST00000375429.3_5'Flank|NELFE_ENST00000444811.2_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	20					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CCTACCCCTTCGGGCCGTGGA	0.572																																						dbGAP											0													262.0	303.0	289.0					6																	31927109		1511	2709	4220	-	-	-	SO:0001583	missense	0				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.58C>T	6.37:g.31927109C>T	ENSP00000364543:p.Arg20Trp		O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R20W	ENST00000375394.2	37	c.58	CCDS4731.1	6	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511487	0.64522	.	.	ENSG00000204351	ENST00000375394	T	0.45668	0.89	5.18	4.24	0.50183	.	0.145674	0.49916	D	0.000121	T	0.11922	0.0290	N	0.22421	0.69	0.80722	D	1	P	0.51537	0.946	B	0.34346	0.18	T	0.08289	-1.0729	10	0.72032	D	0.01	-25.1523	6.3389	0.21312	0.0:0.8307:0.0:0.1693	.	20	Q15477	SKIV2_HUMAN	W	20	ENSP00000364543:R20W	ENSP00000364543:R20W	R	+	1	2	SKIV2L	32035088	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.380000	0.34351	2.697000	0.92050	0.655000	0.94253	CGG	SKIV2L	-	pirsf_RNA_helicase_ATP-dep_SK12/DOB1	ENSG00000204351		0.572	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L	HGNC	protein_coding	OTTHUMT00000076264.3	29	0.00	0	C			31927109	31927109	+1	no_errors	ENST00000375394	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	T
SNX17	9784	genome.wustl.edu	37	2	27598552	27598552	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr2:27598552G>A	ENST00000233575.2	+	10	1176	c.954G>A	c.(952-954)atG>atA	p.M318I	ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000542478.1_Missense_Mutation_p.M104I|SNX17_ENST00000543024.1_Missense_Mutation_p.M104I|SNX17_ENST00000537606.1_Missense_Mutation_p.M293I	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	318	FERM-like.|PTB-like F3 module.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCACCCGCATGCGATGCTGGC	0.667																																						dbGAP											0													46.0	48.0	47.0					2																	27598552		2202	4300	6502	-	-	-	SO:0001583	missense	0			D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.954G>A	2.37:g.27598552G>A	ENSP00000233575:p.Met318Ile		B4DQM7|Q53HN7|Q6IAS3	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,superfamily_FERM_central,smart_Phox,pfscan_Phox,pfscan_Ras-assoc	p.M318I	ENST00000233575.2	37	c.954	CCDS1750.1	2	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907445	0.52333	.	.	ENSG00000115234	ENST00000233575;ENST00000543024;ENST00000537606;ENST00000542478	T;T;T;T	0.33654	1.87;1.4;1.46;1.4	5.94	5.94	0.96194	.	0.065835	0.85682	D	0.000000	T	0.28001	0.0690	L	0.37897	1.145	0.80722	D	1	B;B;B;P	0.39391	0.15;0.064;0.064;0.671	B;B;B;B	0.31686	0.041;0.028;0.028;0.134	T	0.04400	-1.0954	10	0.16896	T	0.51	-19.1813	18.9271	0.92549	0.0:0.0:1.0:0.0	.	293;306;298;318	B4DQM7;B4DTB8;B4DQ37;Q15036	.;.;.;SNX17_HUMAN	I	318;104;293;104	ENSP00000233575:M318I;ENSP00000441779:M104I;ENSP00000439208:M293I;ENSP00000442567:M104I	ENSP00000233575:M318I	M	+	3	0	SNX17	27452056	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.204000	0.95041	2.826000	0.97356	0.561000	0.74099	ATG	SNX17	-	NULL	ENSG00000115234		0.667	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX17	HGNC	protein_coding	OTTHUMT00000215024.1	28	0.00	0	G	NM_014748		27598552	27598552	+1	no_errors	ENST00000233575	ensembl	human	known	69_37n	missense	37	30.19	16	SNP	1.000	A
SPAG5	10615	genome.wustl.edu	37	17	26905539	26905539	+	Missense_Mutation	SNP	C	C	T	rs200191186		TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:26905539C>T	ENST00000321765.5	-	21	3538	c.3206G>A	c.(3205-3207)aGa>aAa	p.R1069K	ALDOC_ENST00000395321.2_5'Flank|ALDOC_ENST00000395319.3_5'Flank|ALDOC_ENST00000226253.4_5'Flank	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	1069					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CACCTCCTCTCTAAGGCTCTG	0.537													c|||	1	0.000199681	0.0	0.0	5008	,	,		22147	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													69.0	70.0	70.0					17																	26905539		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.3206G>A	17.37:g.26905539C>T	ENSP00000323300:p.Arg1069Lys		O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	NULL	p.R1069K	ENST00000321765.5	37	c.3206	CCDS32594.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	9.898	1.205959	0.22205	.	.	ENSG00000076382	ENST00000321765	T	0.29655	1.56	5.45	2.36	0.29203	.	0.211174	0.33127	N	0.005254	T	0.19327	0.0464	L	0.34521	1.04	0.22317	N	0.999205	B	0.17268	0.021	B	0.15484	0.013	T	0.20042	-1.0287	10	0.19147	T	0.46	-3.5767	8.2868	0.31932	0.0:0.7463:0.0:0.2537	.	1069	Q96R06	SPAG5_HUMAN	K	1069	ENSP00000323300:R1069K	ENSP00000323300:R1069K	R	-	2	0	SPAG5	23929666	0.170000	0.23016	0.967000	0.41034	0.971000	0.66376	0.609000	0.24238	0.669000	0.31146	-0.141000	0.14075	AGA	SPAG5	-	NULL	ENSG00000076382		0.537	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG5	HGNC	protein_coding	OTTHUMT00000390564.2	40	0.00	0	C	NM_006461		26905539	26905539	-1	no_errors	ENST00000321765	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.731	T
SYN2	6854	genome.wustl.edu	37	3	12226673	12226673	+	RNA	SNP	G	G	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr3:12226673G>T	ENST00000432424.2	+	0	3342							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						TTCCAGATGGGTTGCATAAGA	0.348																																						dbGAP											0																																										-	-	-			0				CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12226673G>T			A8MY98	RNA	SNP	-	NULL	ENST00000432424.2	37	NULL		3																																																																																			SYN2	-	-	ENSG00000157152		0.348	SYN2-002	KNOWN	basic	processed_transcript	SYN2	HGNC	processed_transcript	OTTHUMT00000339528.3	23	0.00	0	G	NM_133625		12226673	12226673	+1	no_errors	ENST00000425297	ensembl	human	known	69_37n	rna	16	15.79	3	SNP	0.009	T
TAF1L	138474	genome.wustl.edu	37	9	32634453	32634453	+	Silent	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr9:32634453G>A	ENST00000242310.4	-	1	1214	c.1125C>T	c.(1123-1125)tcC>tcT	p.S375S	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	375					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.S375S(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGCCATCTTCGGAGACACCCA	0.448																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											252.0	229.0	237.0					9																	32634453		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1125C>T	9.37:g.32634453G>A			Q0VG57	Silent	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.S375	ENST00000242310.4	37	c.1125	CCDS35003.1	9																																																																																			TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.448	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	148	0.00	0	G			32634453	32634453	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	silent	105	14.63	18	SNP	0.998	A
TP53	7157	genome.wustl.edu	37	17	7578203	7578203	+	Missense_Mutation	SNP	C	C	T			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:7578203C>T	ENST00000269305.4	-	6	835	c.646G>A	c.(646-648)Gtg>Atg	p.V216M	TP53_ENST00000413465.2_Missense_Mutation_p.V216M|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V216M|TP53_ENST00000445888.2_Missense_Mutation_p.V216M|TP53_ENST00000455263.2_Missense_Mutation_p.V216M|TP53_ENST00000359597.4_Missense_Mutation_p.V216M	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	216	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V216M(61)|p.V216del(8)|p.0?(8)|p.V216L(7)|p.?(5)|p.V84M(3)|p.V123M(3)|p.V216fs*6(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V216fs*5(1)|p.V216_Y220delVVVPY(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACCACCACACTATGTCGA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	113	Substitution - Missense(74)|Deletion - In frame(11)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Complex - deletion inframe(2)|Insertion - In frame(1)	breast(17)|lung(14)|haematopoietic_and_lymphoid_tissue(12)|ovary(12)|upper_aerodigestive_tract(10)|large_intestine(9)|oesophagus(9)|biliary_tract(5)|central_nervous_system(5)|bone(5)|stomach(4)|liver(4)|pancreas(3)|soft_tissue(2)|urinary_tract(1)|skin(1)	GRCh37	CX952222	TP53	X							123.0	111.0	115.0					17																	7578203		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.646G>A	17.37:g.7578203C>T	ENSP00000269305:p.Val216Met		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V216M	ENST00000269305.4	37	c.646	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958421	0.92726	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99889	0.9947	M	0.92169	3.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.996;1.0;1.0;1.0;1.0	D	0.96411	0.9304	10	0.87932	D	0	-12.2832	16.7921	0.85592	0.0:1.0:0.0:0.0	.	177;216;216;123;216;216;216	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	M	216;216;216;216;216;216;205;123;84;123;84	ENSP00000410739:V216M;ENSP00000352610:V216M;ENSP00000269305:V216M;ENSP00000398846:V216M;ENSP00000391127:V216M;ENSP00000391478:V216M;ENSP00000425104:V84M;ENSP00000423862:V123M	ENSP00000269305:V216M	V	-	1	0	TP53	7518928	1.000000	0.71417	0.978000	0.43139	0.971000	0.66376	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	56	0.00	0	C	NM_000546		7578203	7578203	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	T
TBC1D3	729873	genome.wustl.edu	37	17	36339584	36339584	+	Missense_Mutation	SNP	G	G	T	rs370901010		TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr17:36339584G>T	ENST00000354664.4	-	13	1229	c.1073C>A	c.(1072-1074)cCa>cAa	p.P358Q	TBC1D3_ENST00000519532.1_Missense_Mutation_p.P336Q|TBC1D3_ENST00000537432.1_Missense_Mutation_p.P358Q|TBC1D3_ENST00000339023.4_3'UTR	NM_001123391.2	NP_001116863.2	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3	358				P -> Q (in Ref. 3; BAF82061). {ECO:0000305}.		plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACCTGGGGGTGGCAGGTCCCC	0.597																																						dbGAP											0													5.0	6.0	6.0					17																	36339584		790	1683	2473	-	-	-	SO:0001583	missense	0				CCDS45658.1	17q12	2014-09-16			ENSG00000274611	ENSG00000274419			19031	protein-coding gene	gene with protein product	"""prostate cancer gene 17"""	607741				12604796, 12359748, 16863688	Standard	NM_001123391		Approved	TBC1D3A, DKFZp434P2235, PRC17	uc002hoo.2	Q8IZP1	OTTHUMG00000188487	ENST00000354664.4:c.1073C>A	17.37:g.36339584G>T	ENSP00000346691:p.Pro358Gln		A6NGX2|A8K007|Q6DCB4|Q9H0B9|Q9UDD4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.P358Q	ENST00000354664.4	37	c.1073	CCDS45658.1	17	.	.	.	.	.	.	.	.	.	.	-	11.91	1.779522	0.31502	.	.	ENSG00000197681	ENST00000518551;ENST00000354664;ENST00000431880;ENST00000519532;ENST00000537432	T;T;T;T	0.33438	2.47;2.39;1.41;2.39	0.109	0.109	0.14578	.	0.000000	0.85682	U	0.000000	T	0.40272	0.1110	L	0.59436	1.845	0.80722	D	1	D;D	0.58620	0.983;0.973	P;P	0.56823	0.747;0.807	T	0.27606	-1.0069	9	0.59425	D	0.04	.	.	.	.	.	358;336	Q8IZP1;F6U074	TBC3A_HUMAN;.	Q	402;358;108;336;358	ENSP00000428847:P402Q;ENSP00000346691:P358Q;ENSP00000429926:P336Q;ENSP00000439621:P358Q	ENSP00000346691:P358Q	P	-	2	0	TBC1D3	33593390	0.982000	0.34865	0.156000	0.22583	0.161000	0.22273	0.823000	0.27366	0.181000	0.19994	0.184000	0.17185	CCA	TBC1D3	-	NULL	ENSG00000197681		0.597	TBC1D3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D3	HGNC	protein_coding	OTTHUMT00000378681.1	14	0.00	0	G	NM_001123391		36339584	36339584	-1	no_errors	ENST00000354664	ensembl	human	known	69_37n	missense	6	45.45	5	SNP	1.000	T
WNT8A	7478	genome.wustl.edu	37	5	137426285	137426285	+	Silent	SNP	A	A	G			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr5:137426285A>G	ENST00000398754.1	+	6	584	c.579A>G	c.(577-579)acA>acG	p.T193T	WNT8A_ENST00000506684.1_Silent_p.T211T	NM_058244.2	NP_490645.1	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family, member 8A	193					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|endoderm development (GO:0007492)|establishment of organ orientation (GO:0048561)|neural crest cell fate commitment (GO:0014034)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|polarity specification of anterior/posterior axis (GO:0009949)|polarity specification of proximal/distal axis (GO:0010085)|regulation of protein localization (GO:0032880)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|response to retinoic acid (GO:0032526)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GCATACAGACATGCTGGCTGC	0.502																																						dbGAP											0													48.0	47.0	47.0					5																	137426285		1937	4147	6084	-	-	-	SO:0001819	synonymous_variant	0			AB057725	CCDS43368.1, CCDS75311.1	5q31	2008-07-18			ENSG00000061492	ENSG00000061492		"""Wingless-type MMTV integration sites"""	12788	protein-coding gene	gene with protein product		606360				11408932	Standard	XM_005272076		Approved	WNT8D	uc003lcd.1	Q9H1J5	OTTHUMG00000129196	ENST00000398754.1:c.579A>G	5.37:g.137426285A>G			Q96S51	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt8	p.T193	ENST00000398754.1	37	c.579	CCDS43368.1	5																																																																																			WNT8A	-	pfam_Wnt,smart_Wnt,prints_Wnt	ENSG00000061492		0.502	WNT8A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT8A	HGNC	protein_coding	OTTHUMT00000280395.1	46	0.00	0	A	NM_058244		137426285	137426285	+1	no_errors	ENST00000361560	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	0.214	G
ZNF280D	54816	genome.wustl.edu	37	15	56959000	56959000	+	Missense_Mutation	SNP	G	G	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr15:56959000G>A	ENST00000267807.7	-	15	1946	c.1730C>T	c.(1729-1731)aCa>aTa	p.T577I	ZNF280D_ENST00000396245.1_Missense_Mutation_p.T281I|ZNF280D_ENST00000559000.1_Missense_Mutation_p.T564I|ZNF280D_ENST00000559237.1_Missense_Mutation_p.T564I	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D	577					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		AGGCTTACTTGTATTAGGTTT	0.313																																						dbGAP											0													138.0	142.0	141.0					15																	56959000		2192	4292	6484	-	-	-	SO:0001583	missense	0			AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.1730C>T	15.37:g.56959000G>A	ENSP00000267807:p.Thr577Ile		A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T577I	ENST00000267807.7	37	c.1730	CCDS32245.1	15	.	.	.	.	.	.	.	.	.	.	G	8.329	0.826131	0.16749	.	.	ENSG00000137871	ENST00000267807;ENST00000455329;ENST00000396245	T;T	0.03358	3.96;4.42	3.58	1.61	0.23674	.	2.177620	0.03398	U	0.202859	T	0.04318	0.0119	N	0.19112	0.55	0.22873	N	0.998627	B;B	0.24092	0.097;0.04	B;B	0.30646	0.118;0.046	T	0.44528	-0.9322	10	0.62326	D	0.03	-0.2104	7.5633	0.27864	0.0:0.173:0.6341:0.1929	.	640;577	B4DHL1;Q6N043	.;Z280D_HUMAN	I	577;564;281	ENSP00000267807:T577I;ENSP00000379545:T281I	ENSP00000267807:T577I	T	-	2	0	ZNF280D	54746292	0.674000	0.27549	0.956000	0.39512	0.978000	0.69477	0.642000	0.24735	0.451000	0.26802	0.591000	0.81541	ACA	ZNF280D	-	NULL	ENSG00000137871		0.313	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF280D	HGNC	protein_coding	OTTHUMT00000418891.2	95	0.00	0	G	XM_370867		56959000	56959000	-1	no_errors	ENST00000267807	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	0.996	A
ZNF680	340252	genome.wustl.edu	37	7	64004794	64004794	+	Missense_Mutation	SNP	C	C	A			TCGA-B6-A3ZX-01A-11D-A23C-09	TCGA-B6-A3ZX-10A-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2344f424-f45c-4fa2-b3e0-b67506d40763	37c1e045-e8d8-4ea4-97f7-d2fe776064a4	g.chr7:64004794C>A	ENST00000309683.6	-	2	198	c.47G>T	c.(46-48)aGg>aTg	p.R16M	ZNF680_ENST00000476563.1_Intron|ZNF680_ENST00000447137.2_Missense_Mutation_p.R16M	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	16	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				GGCCACATCCCTAAATGTCAG	0.413																																						dbGAP											0													102.0	106.0	104.0					7																	64004794		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.47G>T	7.37:g.64004794C>A	ENSP00000309330:p.Arg16Met		B3KVJ4|Q6ZNF3|Q8NC79	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R16M	ENST00000309683.6	37	c.47	CCDS34644.1	7	.	.	.	.	.	.	.	.	.	.	N	10.35	1.324906	0.24080	.	.	ENSG00000173041	ENST00000309683;ENST00000447137	T;T	0.01871	4.59;4.59	0.665	0.665	0.17896	Krueppel-associated box (4);	.	.	.	.	T	0.07908	0.0198	L	0.58354	1.805	0.09310	N	1	D;D	0.89917	1.0;0.99	D;P	0.77557	0.99;0.889	T	0.22695	-1.0209	8	0.51188	T	0.08	.	.	.	.	.	16;16	Q6ZNF3;Q8NEM1	.;ZN680_HUMAN	M	16	ENSP00000309330:R16M;ENSP00000393506:R16M	ENSP00000309330:R16M	R	-	2	0	ZNF680	63642229	0.568000	0.26635	0.098000	0.21074	0.180000	0.23129	-0.331000	0.07914	0.629000	0.30376	0.484000	0.47621	AGG	ZNF680	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000173041		0.413	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF680	HGNC	protein_coding	OTTHUMT00000344568.1	34	0.00	0	C	NM_178558		64004794	64004794	-1	no_errors	ENST00000309683	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.141	A
