#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTL6A	86	genome.wustl.edu	37	3	179291212	179291212	+	Silent	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr3:179291212C>G	ENST00000429709.2	+	4	546	c.333C>G	c.(331-333)gtC>gtG	p.V111V	ACTL6A_ENST00000392662.1_Silent_p.V69V|ACTL6A_ENST00000450518.2_Silent_p.V69V	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	111					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			AAATGCATGTCAAATCAGAAG	0.343																																						dbGAP											0													98.0	95.0	96.0					3																	179291212		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.333C>G	3.37:g.179291212C>G			B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Nonsense_Mutation	SNP	pfam_Actin-like,smart_Actin-like	p.S106*	ENST00000429709.2	37	c.317	CCDS3231.1	3																																																																																			ACTL6A	-	pfam_Actin-like,smart_Actin-like	ENSG00000136518		0.343	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6A	HGNC	protein_coding	OTTHUMT00000349599.1	209	0.00	0	C	NM_004301		179291212	179291212	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000487978	ensembl	human	known	69_37n	nonsense	215	17.91	48	SNP	1.000	G
ALOXE3	59344	genome.wustl.edu	37	17	8000125	8000125	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr17:8000125C>G	ENST00000448843.2	-	16	2297		c.e16-1		ALOXE3_ENST00000380149.1_Splice_Site|ALOXE3_ENST00000318227.3_Splice_Site	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3						arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						CCAGGGGCCTCTGGGAGGACA	0.582																																						dbGAP											0													40.0	40.0	40.0					17																	8000125		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.1957-1G>C	17.37:g.8000125C>G			B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Splice_Site	SNP	-	e16-1	ENST00000448843.2	37	c.2353-1	CCDS11130.1	17	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155401	0.78114	.	.	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8681	0.88801	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALOXE3	7940850	1.000000	0.71417	0.999000	0.59377	0.930000	0.56654	5.696000	0.68287	2.827000	0.97445	0.643000	0.83706	.	ALOXE3	-	-	ENSG00000179148		0.582	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOXE3	HGNC	protein_coding	OTTHUMT00000441475.1	436	0.23	1	C		Intron	8000125	8000125	-1	no_errors	ENST00000318227	ensembl	human	known	69_37n	splice_site	47	47.19	42	SNP	1.000	G
ANO2	57101	genome.wustl.edu	37	12	5936967	5936967	+	Missense_Mutation	SNP	C	C	T	rs368783366		TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr12:5936967C>T	ENST00000356134.5	-	8	922	c.851G>A	c.(850-852)cGc>cAc	p.R284H	ANO2_ENST00000327087.8_Missense_Mutation_p.R283H|ANO2_ENST00000546188.1_Missense_Mutation_p.R284H	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	288					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						GCAGGCTGTGCGCTTCAGGAT	0.667																																						dbGAP											0													34.0	39.0	38.0					12																	5936967		2029	4194	6223	-	-	-	SO:0001583	missense	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.851G>A	12.37:g.5936967C>T	ENSP00000348453:p.Arg284His		C4N787|Q9H847	Missense_Mutation	SNP	pfam_Anoctamin	p.R284H	ENST00000356134.5	37	c.851		12	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851506	0.91355	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.71461	-0.57;-0.57;-0.57	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.86793	0.6018	M	0.91196	3.185	0.53005	D	0.999967	D	0.89917	1.0	D	0.97110	1.0	D	0.88986	0.3411	10	0.59425	D	0.04	.	14.4646	0.67475	0.0:1.0:0.0:0.0	.	283	Q9NQ90-3	.	H	283;284;284;288	ENSP00000314048:R283H;ENSP00000348453:R284H;ENSP00000440981:R284H	ENSP00000314048:R283H	R	-	2	0	ANO2	5807228	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.575000	0.53870	2.500000	0.84329	0.561000	0.74099	CGC	ANO2	-	NULL	ENSG00000047617		0.667	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	45	0.00	0	C	NM_020373		5936967	5936967	-1	no_errors	ENST00000356134	ensembl	human	known	69_37n	missense	66	10.81	8	SNP	1.000	T
APEX2	27301	genome.wustl.edu	37	X	55033173	55033173	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chrX:55033173G>A	ENST00000374987.3	+	6	928	c.862G>A	c.(862-864)Gac>Aac	p.D288N	APEX2_ENST00000471758.1_3'UTR|ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	288					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						CCTGGTCATAGACACCTTTCA	0.602								Other BER factors																														dbGAP											0													49.0	44.0	46.0					X																	55033173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.862G>A	X.37:g.55033173G>A	ENSP00000364126:p.Asp288Asn		Q9Y5X7	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Znf_GRF,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	p.D288N	ENST00000374987.3	37	c.862	CCDS14365.1	X	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162345	0.38217	.	.	ENSG00000169188	ENST00000374987	T	0.62639	0.01	4.53	4.53	0.55603	Endonuclease/exonuclease/phosphatase (2);	0.447945	0.27311	N	0.019957	T	0.50446	0.1616	L	0.39020	1.185	0.09310	N	1	B	0.28178	0.202	B	0.23716	0.048	T	0.38243	-0.9670	10	0.25751	T	0.34	-15.0829	14.4407	0.67314	0.0:0.0:1.0:0.0	.	288	Q9UBZ4	APEX2_HUMAN	N	288	ENSP00000364126:D288N	ENSP00000364126:D288N	D	+	1	0	APEX2	55049898	0.981000	0.34729	0.993000	0.49108	0.953000	0.61014	3.990000	0.56965	2.206000	0.71126	0.600000	0.82982	GAC	APEX2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	ENSG00000169188		0.602	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX2	HGNC	protein_coding	OTTHUMT00000056845.1	155	0.64	1	G			55033173	55033173	+1	no_errors	ENST00000374987	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	0.048	A
ATRX	546	genome.wustl.edu	37	X	76890106	76890106	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chrX:76890106C>T	ENST00000373344.5	-	17	5002	c.4788G>A	c.(4786-4788)atG>atA	p.M1596I	ATRX_ENST00000395603.3_Missense_Mutation_p.M1558I|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1596	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TACCAAGGCCCATACAGTGGG	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															dbGAP		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											168.0	163.0	165.0					X																	76890106		2203	4296	6499	-	-	-	SO:0001583	missense	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4788G>A	X.37:g.76890106C>T	ENSP00000362441:p.Met1596Ile		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M1596I	ENST00000373344.5	37	c.4788	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968809	0.74131	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.94497	-3.44;-3.44	5.77	5.77	0.91146	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98695	0.9562	H	0.99273	4.495	0.80722	D	1	D;D	0.65815	0.962;0.995	D;D	0.77004	0.946;0.989	D	0.99609	1.0980	10	0.87932	D	0	-7.5662	18.913	0.92493	0.0:1.0:0.0:0.0	.	1558;1596	P46100-4;P46100	.;ATRX_HUMAN	I	1596;1558	ENSP00000362441:M1596I;ENSP00000378967:M1558I	ENSP00000362441:M1596I	M	-	3	0	ATRX	76776762	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.463000	0.80869	2.414000	0.81942	0.600000	0.82982	ATG	ATRX	-	pfam_SNF2_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000085224		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	231	0.00	0	C	NM_000489		76890106	76890106	-1	no_errors	ENST00000373344	ensembl	human	known	69_37n	missense	332	20.19	84	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76940061	76940061	+	Silent	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chrX:76940061C>T	ENST00000373344.5	-	9	901	c.687G>A	c.(685-687)ttG>ttA	p.L229L	ATRX_ENST00000395603.3_Silent_p.L191L|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	229	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CACAACAAATCAAGTTTCCAC	0.338			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																															dbGAP		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)	GRCh37	CM067980	ATRX	M							91.0	92.0	92.0					X																	76940061		2201	4267	6468	-	-	-	SO:0001819	synonymous_variant	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.687G>A	X.37:g.76940061C>T			D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L229	ENST00000373344.5	37	c.687	CCDS14434.1	X																																																																																			ATRX	-	superfamily_Znf_FYVE_PHD	ENSG00000085224		0.338	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	52	0.00	0	C	NM_000489		76940061	76940061	-1	no_errors	ENST00000373344	ensembl	human	known	69_37n	silent	51	19.05	12	SNP	1.000	T
BBS10	79738	genome.wustl.edu	37	12	76740150	76740150	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr12:76740150G>A	ENST00000393262.3	-	2	1698	c.1615C>T	c.(1615-1617)Cca>Tca	p.P539S		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	539			P -> L (in dbSNP:rs35676114). {ECO:0000269|PubMed:20120035}.		cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						TTGAGTAATGGTTCATAATAA	0.358									Bardet-Biedl syndrome																													dbGAP											0													134.0	129.0	130.0					12																	76740150		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.1615C>T	12.37:g.76740150G>A	ENSP00000376946:p.Pro539Ser		Q96CW2|Q9H5D2	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	p.P539S	ENST00000393262.3	37	c.1615	CCDS9014.2	12	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.279758	0.00254	.	.	ENSG00000179941	ENST00000393262	D	0.84660	-1.88	4.95	1.05	0.20165	.	0.883658	0.09546	N	0.787526	T	0.79185	0.4403	L	0.54323	1.7	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.65890	-0.6058	10	0.52906	T	0.07	-0.7605	4.384	0.11307	0.2924:0.3129:0.3947:0.0	.	539	Q8TAM1	BBS10_HUMAN	S	539	ENSP00000376946:P539S	ENSP00000376946:P539S	P	-	1	0	BBS10	75264281	0.000000	0.05858	0.001000	0.08648	0.038000	0.13279	0.024000	0.13555	0.094000	0.17404	-0.150000	0.13652	CCA	BBS10	-	superfamily_Cpn60/TCP-1	ENSG00000179941		0.358	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS10	HGNC	protein_coding	OTTHUMT00000303983.2	191	0.00	0	G	NM_024685		76740150	76740150	-1	no_errors	ENST00000393262	ensembl	human	known	69_37n	missense	253	47.07	225	SNP	0.001	A
BTK	695	genome.wustl.edu	37	X	100614283	100614283	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chrX:100614283C>T	ENST00000308731.7	-	10	1055	c.892G>A	c.(892-894)Gag>Aag	p.E298K	BTK_ENST00000372880.1_Missense_Mutation_p.E298K	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	298	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						ACACTTACCTCTTGCTTTAGC	0.512									Agammaglobulinemia, X-linked																													dbGAP											0													261.0	188.0	213.0					X																	100614283		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.892G>A	X.37:g.100614283C>T	ENSP00000308176:p.Glu298Lys		B2RAW1|Q32ML5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.E298K	ENST00000308731.7	37	c.892	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	C	17.97	3.518072	0.64634	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	D;D	0.88586	-2.4;-2.4	5.78	5.78	0.91487	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.92496	0.7617	L	0.46670	1.46	0.80722	D	1	P;D;D	0.89917	0.873;0.975;1.0	P;P;D	0.87578	0.841;0.838;0.998	D	0.90819	0.4707	10	0.30078	T	0.28	.	18.5803	0.91168	0.0:1.0:0.0:0.0	.	298;298;298	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	K	298	ENSP00000361971:E298K;ENSP00000308176:E298K	ENSP00000308176:E298K	E	-	1	0	BTK	100500939	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	4.786000	0.62425	2.431000	0.82371	0.594000	0.82650	GAG	BTK	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000010671		0.512	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	198	0.00	0	C	NM_000061		100614283	100614283	-1	no_errors	ENST00000308731	ensembl	human	known	69_37n	missense	120	25.00	40	SNP	1.000	T
C12orf42	374470	genome.wustl.edu	37	12	103695971	103695971	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr12:103695971G>A	ENST00000378113.2	-	6	1223	c.998C>T	c.(997-999)tCa>tTa	p.S333L	C12orf42_ENST00000548048.1_Missense_Mutation_p.S266L|C12orf42_ENST00000548883.1_Missense_Mutation_p.S333L|C12orf42_ENST00000315192.8_Intron	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	333										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						GGGGGGTGCTGAGGAGCAAAC	0.587																																						dbGAP											0													46.0	54.0	52.0					12																	103695971		1864	4089	5953	-	-	-	SO:0001583	missense	0			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.998C>T	12.37:g.103695971G>A	ENSP00000367353:p.Ser333Leu		Q49A64|Q4G0S2	Missense_Mutation	SNP	NULL	p.S333L	ENST00000378113.2	37	c.998	CCDS44963.1	12	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534441	0.45073	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	T;T;T	0.54479	0.57;0.57;0.57	4.99	0.231	0.15377	.	1.182940	0.06562	N	0.746950	T	0.35941	0.0949	L	0.29908	0.895	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.38265	-0.9669	10	0.87932	D	0	0.393	0.0921	0.00040	0.2997:0.1715:0.1844:0.3444	.	333	Q96LP6	CL042_HUMAN	L	333;266;333	ENSP00000447908:S333L;ENSP00000449362:S266L;ENSP00000367353:S333L	ENSP00000367353:S333L	S	-	2	0	C12orf42	102220101	0.001000	0.12720	0.000000	0.03702	0.186000	0.23388	0.929000	0.28844	0.113000	0.18004	0.655000	0.94253	TCA	C12orf42	-	NULL	ENSG00000179088		0.587	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	HGNC	protein_coding	OTTHUMT00000406754.1	14	0.00	0	G	NM_198521		103695971	103695971	-1	no_errors	ENST00000378113	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.000	A
NRDE2	55051	genome.wustl.edu	37	14	90756754	90756754	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr14:90756754delG	ENST00000354366.3	-	10	2272	c.2040delC	c.(2038-2040)ttcfs	p.F680fs	NRDE2_ENST00000357904.3_Frame_Shift_Del_p.F449fs	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	680																	ACAAAGGGTTGAAAAAAGTCA	0.502																																						dbGAP											0													47.0	50.0	49.0					14																	90756754		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.2040delC	14.37:g.90756754delG	ENSP00000346335:p.Phe680fs		B4DH71|Q4G0A7|Q9NWH6	Frame_Shift_Del	DEL	pfam_NRDE-2	p.F680fs	ENST00000354366.3	37	c.2040	CCDS9890.1	14																																																																																			C14orf102	-	NULL	ENSG00000119720		0.502	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf102	HGNC	protein_coding	OTTHUMT00000411264.1	118	0.00	0	G	NM_017970		90756754	90756754	-1	no_errors	ENST00000354366	ensembl	human	known	69_37n	frame_shift_del	69	34.82	39	DEL	0.000	-
NRDE2	55051	genome.wustl.edu	37	14	90756755	90756755	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr14:90756755A>T	ENST00000354366.3	-	10	2271	c.2039T>A	c.(2038-2040)tTc>tAc	p.F680Y	NRDE2_ENST00000357904.3_Missense_Mutation_p.F449Y	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	680																	CAAAGGGTTGAAAAAAGTCAA	0.502																																						dbGAP											0													47.0	50.0	49.0					14																	90756755		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.2039T>A	14.37:g.90756755A>T	ENSP00000346335:p.Phe680Tyr		B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	pfam_NRDE-2	p.F680Y	ENST00000354366.3	37	c.2039	CCDS9890.1	14	.	.	.	.	.	.	.	.	.	.	A	0.068	-1.208116	0.01568	.	.	ENSG00000119720	ENST00000354366;ENST00000357904	T;T	0.30714	1.52;1.52	5.91	3.6	0.41247	.	0.555807	0.19792	N	0.105943	T	0.19167	0.0460	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31475	-0.9942	10	0.07990	T	0.79	-1.7704	8.9427	0.35740	0.8426:0.0:0.1574:0.0	.	680	Q9H7Z3	CN102_HUMAN	Y	680;449	ENSP00000346335:F680Y;ENSP00000350579:F449Y	ENSP00000346335:F680Y	F	-	2	0	C14orf102	89826508	0.022000	0.18835	0.000000	0.03702	0.038000	0.13279	1.148000	0.31614	0.504000	0.28082	-0.250000	0.11733	TTC	C14orf102	-	NULL	ENSG00000119720		0.502	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf102	HGNC	protein_coding	OTTHUMT00000411264.1	120	0.00	0	A	NM_017970		90756755	90756755	-1	no_errors	ENST00000354366	ensembl	human	known	69_37n	missense	71	36.04	40	SNP	0.002	T
C9orf43	257169	genome.wustl.edu	37	9	116175869	116175869	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr9:116175869G>C	ENST00000288462.4	+	2	542	c.96G>C	c.(94-96)gaG>gaC	p.E32D	C9orf43_ENST00000490544.1_3'UTR|C9orf43_ENST00000374165.1_Missense_Mutation_p.E32D|POLE3_ENST00000374171.4_5'Flank	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	32										breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						GCCGCATTGAGAGGGGCCATC	0.557																																						dbGAP											0													89.0	83.0	85.0					9																	116175869		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.96G>C	9.37:g.116175869G>C	ENSP00000288462:p.Glu32Asp			Missense_Mutation	SNP	NULL	p.E32D	ENST00000288462.4	37	c.96	CCDS6796.1	9	.	.	.	.	.	.	.	.	.	.	G	14.35	2.507813	0.44558	.	.	ENSG00000157653	ENST00000374165;ENST00000288462	T;T	0.62105	0.05;0.05	5.68	0.655	0.17839	.	0.000000	0.47455	D	0.000226	T	0.65801	0.2726	L	0.34521	1.04	0.27423	N	0.954234	D	0.76494	0.999	D	0.76575	0.988	T	0.61312	-0.7088	10	0.59425	D	0.04	-31.5643	11.0223	0.47726	0.3601:0.0:0.6399:0.0	.	32	Q8TAL5	CI043_HUMAN	D	32	ENSP00000363280:E32D;ENSP00000288462:E32D	ENSP00000288462:E32D	E	+	3	2	C9orf43	115215690	0.996000	0.38824	0.977000	0.42913	0.067000	0.16453	0.102000	0.15272	-0.051000	0.13334	-1.119000	0.02030	GAG	C9orf43	-	NULL	ENSG00000157653		0.557	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C9orf43	HGNC	protein_coding	OTTHUMT00000053739.1	175	0.00	0	G	NM_152786		116175869	116175869	+1	no_errors	ENST00000288462	ensembl	human	known	69_37n	missense	81	19.80	20	SNP	0.972	C
C5	727	genome.wustl.edu	37	9	123722615	123722615	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr9:123722615G>A	ENST00000223642.1	-	38	4618	c.4589C>T	c.(4588-4590)gCt>gTt	p.A1530V		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1530					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	CCCACAATCAGCTGGATTTTG	0.398																																						dbGAP											0													107.0	93.0	98.0					9																	123722615		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.4589-1C>T	9.37:g.123722615G>A			Q14CJ0|Q27I61	Missense_Mutation	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn	p.A1530V	ENST00000223642.1	37	c.4589	CCDS6826.1	9	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550625	0.86127	.	.	ENSG00000106804	ENST00000223642	T	0.58506	0.33	5.65	5.65	0.86999	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.419042	0.23017	U	0.052885	T	0.75155	0.3811	M	0.69823	2.125	0.38325	D	0.94362	D	0.89917	1.0	D	0.83275	0.996	T	0.78912	-0.2017	10	0.72032	D	0.01	.	15.2273	0.73361	0.0:0.0:1.0:0.0	.	1530	P01031	CO5_HUMAN	V	1530	ENSP00000223642:A1530V	ENSP00000223642:A1530V	A	-	2	0	C5	122762436	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.878000	0.56130	2.646000	0.89796	0.655000	0.94253	GCT	C5	-	superfamily_TIMP-like_OB-fold	ENSG00000106804		0.398	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	HGNC	protein_coding	OTTHUMT00000053844.1	179	0.00	0	G	NM_001735	Missense_Mutation	123722615	123722615	-1	no_errors	ENST00000223642	ensembl	human	known	69_37n	missense	187	25.10	63	SNP	1.000	A
CBLB	868	genome.wustl.edu	37	3	105439088	105439088	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr3:105439088C>T	ENST00000264122.4	-	10	1531	c.1210G>A	c.(1210-1212)Gat>Aat	p.D404N	CBLB_ENST00000403724.1_Missense_Mutation_p.D404N|CBLB_ENST00000405772.1_Missense_Mutation_p.D404N|CBLB_ENST00000545639.1_3'UTR|CBLB_ENST00000394027.3_Missense_Mutation_p.D426N	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	404					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						CCCTGACCATCCGACTCCTAA	0.423			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	dbGAP		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													50.0	46.0	47.0					3																	105439088		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1210G>A	3.37:g.105439088C>T	ENSP00000264122:p.Asp404Asn		A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.D404N	ENST00000264122.4	37	c.1210	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.373969	0.95923	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.95238	-3.65;-3.65;-3.65;-3.65	6.03	6.03	0.97812	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.94066	0.8098	N	0.05259	-0.085	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.996	D;D;D	0.85130	0.997;0.995;0.95	D	0.95600	0.8662	10	0.87932	D	0	-22.6196	20.5753	0.99366	0.0:1.0:0.0:0.0	.	426;404;404	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	N	404;426;404;404	ENSP00000264122:D404N;ENSP00000377595:D426N;ENSP00000384816:D404N;ENSP00000384938:D404N	ENSP00000264122:D404N	D	-	1	0	CBLB	106921778	1.000000	0.71417	0.992000	0.48379	0.852000	0.48524	7.463000	0.80869	2.868000	0.98415	0.557000	0.71058	GAT	CBLB	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000114423		0.423	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	HGNC	protein_coding	OTTHUMT00000319417.2	115	0.00	0	C	NM_170662		105439088	105439088	-1	no_errors	ENST00000264122	ensembl	human	known	69_37n	missense	92	14.81	16	SNP	1.000	T
CDKN1B	1027	genome.wustl.edu	37	12	12870853	12870853	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr12:12870853C>A	ENST00000228872.4	+	1	796	c.80C>A	c.(79-81)tCg>tAg	p.S27*	CDKN1B_ENST00000477087.1_Intron|CDKN1B_ENST00000396340.1_Nonsense_Mutation_p.S27*	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	27					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)	p.C29fs*12(1)		breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		CCCAAGCCCTCGGCCTGCAGG	0.632																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)											44.0	53.0	50.0					12																	12870853		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.80C>A	12.37:g.12870853C>A	ENSP00000228872:p.Ser27*		Q16307|Q5U0H2|Q9BUS6	Nonsense_Mutation	SNP	pfam_CDI	p.S27*	ENST00000228872.4	37	c.80	CCDS8653.1	12	.	.	.	.	.	.	.	.	.	.	C	45	11.776149	0.99601	.	.	ENSG00000111276	ENST00000228872;ENST00000396340;ENST00000442489	.	.	.	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9483	16.4225	0.83771	0.0:1.0:0.0:0.0	.	.	.	.	X	27;27;20	.	ENSP00000228872:S27X	S	+	2	0	CDKN1B	12762120	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	5.562000	0.67346	2.405000	0.81733	0.655000	0.94253	TCG	CDKN1B	-	NULL	ENSG00000111276		0.632	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1B	HGNC	protein_coding	OTTHUMT00000313878.2	37	0.00	0	C	NM_004064		12870853	12870853	+1	no_errors	ENST00000228872	ensembl	human	known	69_37n	nonsense	58	29.27	24	SNP	1.000	A
CEMP1	752014	genome.wustl.edu	37	16	2580833	2580833	+	Missense_Mutation	SNP	C	C	G	rs200977329	byFrequency	TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr16:2580833C>G	ENST00000567119.1	-	1	576	c.242G>C	c.(241-243)cGc>cCc	p.R81P	AMDHD2_ENST00000565570.1_3'UTR|AMDHD2_ENST00000302956.4_3'UTR|MIR3178_ENST00000581887.1_RNA|CEMP1_ENST00000565480.1_Intron|AMDHD2_ENST00000413459.3_3'UTR|CEMP1_ENST00000382350.1_Missense_Mutation_p.R81P	NM_001048212.3	NP_001041677.1	Q6PRD7	CEMP1_HUMAN	cementum protein 1	81						cytoplasm (GO:0005737)				lung(1)|skin(1)	2						GGAAAGCAGGCGACGGATGTG	0.677																																						dbGAP											0													34.0	43.0	40.0					16																	2580833		2032	4162	6194	-	-	-	SO:0001583	missense	0			AY584596	CCDS42108.1	16p13.3	2006-09-22							32553	protein-coding gene	gene with protein product	"""cementum protein-23"""	611113				16263347	Standard	NM_001048212		Approved	CP-23	uc002cqr.3	Q6PRD7		ENST00000567119.1:c.242G>C	16.37:g.2580833C>G	ENSP00000457380:p.Arg81Pro		B2RUY1	Missense_Mutation	SNP	NULL	p.R81P	ENST00000567119.1	37	c.242	CCDS42108.1	16	.	.	.	.	.	.	.	.	.	.	C	2.826	-0.243659	0.05906	.	.	ENSG00000205923	ENST00000382350	T	0.56444	0.46	1.31	-1.86	0.07760	.	.	.	.	.	T	0.23611	0.0571	N	0.08118	0	0.09310	N	1	P	0.34864	0.473	B	0.21708	0.036	T	0.09662	-1.0664	9	0.87932	D	0	.	4.9051	0.13795	0.0:0.5987:0.0:0.4013	.	81	Q6PRD7	CEMP1_HUMAN	P	81	ENSP00000371787:R81P	ENSP00000371787:R81P	R	-	2	0	CEMP1	2520834	0.056000	0.20664	0.000000	0.03702	0.001000	0.01503	0.307000	0.19296	-0.538000	0.06281	-0.367000	0.07326	CGC	CEMP1	-	NULL	ENSG00000205923		0.677	CEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEMP1	HGNC	protein_coding	OTTHUMT00000435686.1	33	0.00	0	C	NM_001048212		2580833	2580833	-1	no_errors	ENST00000382350	ensembl	human	known	69_37n	missense	32	34.69	17	SNP	0.000	G
CHPT1	56994	genome.wustl.edu	37	12	102117533	102117533	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr12:102117533C>T	ENST00000229266.3	+	7	1208	c.973C>T	c.(973-975)Caa>Taa	p.Q325*	CHPT1_ENST00000549872.1_Nonsense_Mutation_p.Q325*	NM_020244.2	NP_064629.2	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1	325					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	diacylglycerol binding (GO:0019992)|diacylglycerol cholinephosphotransferase activity (GO:0004142)|metal ion binding (GO:0046872)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						ACTATATCTTCAAGACACTGT	0.299																																						dbGAP											0													83.0	82.0	83.0					12																	102117533		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0				CCDS9086.1	12q	2010-07-08				ENSG00000111666	2.7.8.2		17852	protein-coding gene	gene with protein product	"""phosphatidylcholine synthesizing enzyme"""					10893425	Standard	NM_020244		Approved	CPT1	uc001tin.3	Q8WUD6		ENST00000229266.3:c.973C>T	12.37:g.102117533C>T	ENSP00000229266:p.Gln325*		B3KQM2|Q7Z7H0|Q7Z7H1|Q7Z7H2|Q8IWQ4|Q8IWQ5|Q8WYI4|Q9NRQ6|Q9NRQ7|Q9Y6M6	Nonsense_Mutation	SNP	pfam_CDP-OH_P_trans,pirsf_CHOPT	p.Q325*	ENST00000229266.3	37	c.973	CCDS9086.1	12	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869044	0.72065	.	.	ENSG00000111666	ENST00000229266;ENST00000549872;ENST00000543999	.	.	.	5.82	4.93	0.64822	.	0.053751	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	0.0117	16.7625	0.85516	0.0:0.8613:0.1387:0.0	.	.	.	.	X	325;325;158	.	ENSP00000229266:Q325X	Q	+	1	0	CHPT1	100641664	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	7.463000	0.80869	1.457000	0.47850	-0.219000	0.12488	CAA	CHPT1	-	pirsf_CHOPT	ENSG00000111666		0.299	CHPT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHPT1	HGNC	protein_coding	OTTHUMT00000409173.1	102	0.00	0	C	NM_020244		102117533	102117533	+1	no_errors	ENST00000229266	ensembl	human	known	69_37n	nonsense	301	30.80	134	SNP	1.000	T
CNTN6	27255	genome.wustl.edu	37	3	1424982	1424982	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr3:1424982C>T	ENST00000446702.2	+	19	3034	c.2407C>T	c.(2407-2409)Caa>Taa	p.Q803*	CNTN6_ENST00000539053.1_Nonsense_Mutation_p.Q731*|CNTN6_ENST00000350110.2_Nonsense_Mutation_p.Q803*			Q9UQ52	CNTN6_HUMAN	contactin 6	803					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGTAGAACCTCAACTGGCCCC	0.423																																						dbGAP											0													185.0	191.0	189.0					3																	1424982		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2407C>T	3.37:g.1424982C>T	ENSP00000407822:p.Gln803*		Q2KHM2	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Q803*	ENST00000446702.2	37	c.2407	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	C	45	11.781295	0.99602	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	.	.	.	5.82	5.82	0.92795	.	0.359193	0.23789	N	0.044554	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	18.2696	0.90064	0.0:1.0:0.0:0.0	.	.	.	.	X	803;731;803	.	ENSP00000341882:Q803X	Q	+	1	0	CNTN6	1399982	0.000000	0.05858	0.961000	0.40146	0.890000	0.51754	0.871000	0.28023	2.765000	0.95021	0.591000	0.81541	CAA	CNTN6	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134115		0.423	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	215	0.00	0	C	NM_014461		1424982	1424982	+1	no_errors	ENST00000350110	ensembl	human	known	69_37n	nonsense	199	32.54	96	SNP	0.994	T
CWH43	80157	genome.wustl.edu	37	4	49030718	49030718	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr4:49030718C>G	ENST00000226432.4	+	10	1522	c.1339C>G	c.(1339-1341)Cta>Gta	p.L447V	CWH43_ENST00000513409.1_Missense_Mutation_p.L420V	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	447					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GTGGTCTAGTCTAGAAAGATC	0.413																																						dbGAP											0													98.0	94.0	96.0					4																	49030718		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1339C>G	4.37:g.49030718C>G	ENSP00000226432:p.Leu447Val		B2RPD7	Missense_Mutation	SNP	superfamily_Endo/exonuclease/phosphatase	p.L447V	ENST00000226432.4	37	c.1339	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619596	0.46736	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.33654	1.4;1.4	4.72	3.88	0.44766	Endonuclease/exonuclease/phosphatase (1);	0.000000	0.45606	D	0.000355	T	0.41971	0.1182	L	0.43152	1.355	0.36127	D	0.845843	D	0.60575	0.988	P	0.57911	0.829	T	0.48670	-0.9015	9	.	.	.	.	8.6063	0.33775	0.0:0.8082:0.0:0.1918	.	447	Q9H720	PG2IP_HUMAN	V	447;420	ENSP00000226432:L447V;ENSP00000422802:L420V	.	L	+	1	2	CWH43	48725475	0.939000	0.31865	0.911000	0.35937	0.816000	0.46133	1.692000	0.37731	1.371000	0.46172	0.462000	0.41574	CTA	CWH43	-	superfamily_Endo/exonuclease/phosphatase	ENSG00000109182		0.413	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2	265	0.00	0	C	NM_025087		49030718	49030718	+1	no_errors	ENST00000226432	ensembl	human	known	69_37n	missense	166	21.96	47	SNP	0.939	G
CYP4F11	57834	genome.wustl.edu	37	19	16034795	16034795	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr19:16034795G>C	ENST00000591841.1	-	0	907				CYP4F11_ENST00000402119.4_Missense_Mutation_p.L249V|CYP4F11_ENST00000248041.8_Missense_Mutation_p.L249V|CYP4F11_ENST00000326742.8_Missense_Mutation_p.L249V					cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						TCAGGAGTGAGATAATACAGG	0.567																																						dbGAP											0													102.0	98.0	99.0					19																	16034795		2203	4300	6503	-	-	-			0			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000591841.1:c.-231C>G	19.37:g.16034795G>C				Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.L249V	ENST00000591841.1	37	c.745		19	.	.	.	.	.	.	.	.	.	.	g	14.83	2.651536	0.47362	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	D;D;T	0.81579	-1.51;-1.51;-0.51	2.52	2.52	0.30459	.	0.087086	0.42548	U	0.000687	D	0.87767	0.6260	M	0.87971	2.92	0.29319	N	0.867472	P;P	0.41978	0.614;0.767	P;P	0.55785	0.784;0.603	D	0.83703	0.0183	10	0.72032	D	0.01	.	10.7268	0.46072	0.0:0.0:1.0:0.0	.	249;249	F8W978;Q9HBI6	.;CP4FB_HUMAN	V	249	ENSP00000384588:L249V;ENSP00000248041:L249V;ENSP00000319859:L249V	ENSP00000248041:L249V	L	-	1	0	CYP4F11	15895795	1.000000	0.71417	0.013000	0.15412	0.110000	0.19582	4.480000	0.60243	1.392000	0.46585	0.305000	0.20034	CTC	CYP4F11	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000171903		0.567	CYP4F11-003	PUTATIVE	basic	protein_coding	CYP4F11	HGNC	protein_coding	OTTHUMT00000460384.2	189	0.00	0	G	NM_021187		16034795	16034795	-1	no_errors	ENST00000248041	ensembl	human	known	69_37n	missense	103	18.25	23	SNP	0.820	C
DNAJC9	23234	genome.wustl.edu	37	10	75003169	75003169	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr10:75003169C>G	ENST00000372950.4	-	5	2444	c.772G>C	c.(772-774)Gaa>Caa	p.E258Q	FAM149B1_ENST00000242505.6_3'UTR|DNAJC9_ENST00000453189.2_5'Flank	NM_015190.3	NP_056005.1	Q8WXX5	DNJC9_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 9	258					social behavior (GO:0035176)	nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|stomach(1)	6	Prostate(51;0.0119)					TATTTCTTTTCTTTCTTGAGA	0.398																																						dbGAP											0													91.0	95.0	94.0					10																	75003169		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF327347	CCDS7322.1	10q22.3	2011-09-02			ENSG00000213551	ENSG00000213551		"""Heat shock proteins / DNAJ (HSP40)"""	19123	protein-coding gene	gene with protein product		611206					Standard	NM_015190		Approved	JDD1, SB73	uc001jtr.3	Q8WXX5	OTTHUMG00000018461	ENST00000372950.4:c.772G>C	10.37:g.75003169C>G	ENSP00000362041:p.Glu258Gln		B2RMW6	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.E258Q	ENST00000372950.4	37	c.772	CCDS7322.1	10	.	.	.	.	.	.	.	.	.	.	C	15.18	2.757949	0.49468	.	.	ENSG00000213551	ENST00000372950	T	0.17854	2.25	5.88	5.88	0.94601	.	0.288472	0.38005	N	0.001855	T	0.11367	0.0277	N	0.08118	0	0.39591	D	0.96958	B	0.23735	0.09	B	0.26310	0.068	T	0.26883	-1.0090	10	0.27082	T	0.32	.	17.7145	0.88332	0.0:1.0:0.0:0.0	.	258	Q8WXX5	DNJC9_HUMAN	Q	258	ENSP00000362041:E258Q	ENSP00000362041:E258Q	E	-	1	0	DNAJC9	74673175	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.227000	0.51262	2.790000	0.95986	0.591000	0.81541	GAA	DNAJC9	-	NULL	ENSG00000213551		0.398	DNAJC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC9	HGNC	protein_coding	OTTHUMT00000048643.1	102	0.00	0	C	NM_015190		75003169	75003169	-1	no_errors	ENST00000372950	ensembl	human	known	69_37n	missense	190	36.67	110	SNP	1.000	G
EGFR	1956	genome.wustl.edu	37	7	55223635	55223635	+	Silent	SNP	C	C	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr7:55223635C>A	ENST00000275493.2	+	8	1179	c.1002C>A	c.(1000-1002)cgC>cgA	p.R334R	EGFR_ENST00000442591.1_Silent_p.R334R|EGFR_ENST00000344576.2_Silent_p.R334R|EGFR_ENST00000455089.1_Silent_p.R289R|EGFR_ENST00000454757.2_Silent_p.R281R|EGFR_ENST00000420316.2_Silent_p.R334R|EGFR_ENST00000342916.3_Silent_p.R334R	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	334					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GGCCTTGCCGCAAAGGTAGGA	0.602		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												dbGAP	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0													27.0	25.0	26.0					7																	55223635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1002C>A	7.37:g.55223635C>A			O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R334	ENST00000275493.2	37	c.1002	CCDS5514.1	7																																																																																			EGFR	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Furin-like_Cys-rich_dom,superfamily_Growth_fac_rcpt	ENSG00000146648		0.602	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	HGNC	protein_coding	OTTHUMT00000251456.2	37	0.00	0	C	NM_005228		55223635	55223635	+1	no_errors	ENST00000275493	ensembl	human	known	69_37n	silent	16	27.27	6	SNP	0.993	A
FRMPD4	9758	genome.wustl.edu	37	X	12734858	12734858	+	Silent	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chrX:12734858C>T	ENST00000380682.1	+	15	2786	c.2280C>T	c.(2278-2280)ctC>ctT	p.L760L		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	760					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						AGGAGGACCTCGTGGTGGGGG	0.587																																						dbGAP											0													142.0	124.0	130.0					X																	12734858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2280C>T	X.37:g.12734858C>T			A8K0X9|O15032	Silent	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_Rsp5_WWP	p.L760	ENST00000380682.1	37	c.2280	CCDS35201.1	X																																																																																			FRMPD4	-	NULL	ENSG00000169933		0.587	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1	228	0.00	0	C	XM_045712		12734858	12734858	+1	no_errors	ENST00000380682	ensembl	human	known	69_37n	silent	110	14.62	19	SNP	0.972	T
GPR110	266977	genome.wustl.edu	37	6	46977528	46977528	+	Missense_Mutation	SNP	C	C	A	rs142552580		TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr6:46977528C>A	ENST00000371253.2	-	11	1858	c.1643G>T	c.(1642-1644)gGc>gTc	p.G548V	GPR110_ENST00000283297.5_Missense_Mutation_p.G351V|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	548	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						TAGGTGGCAgcctgcatcgtt	0.428																																						dbGAP											0													108.0	92.0	98.0					6																	46977528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.1643G>T	6.37:g.46977528C>A	ENSP00000360299:p.Gly548Val		Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.G548V	ENST00000371253.2	37	c.1643	CCDS34471.1	6	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845087	0.51164	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	D;D	0.84730	-1.89;-1.89	5.84	5.84	0.93424	GPS domain (3);	0.000000	0.64402	D	0.000014	D	0.93621	0.7963	M	0.94063	3.49	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94171	0.7423	10	0.59425	D	0.04	-19.1881	15.4119	0.74933	0.0:0.8513:0.1487:0.0	.	548	Q5T601	GP110_HUMAN	V	548;548;351	ENSP00000360299:G548V;ENSP00000283297:G351V	ENSP00000283297:G351V	G	-	2	0	GPR110	47085487	0.998000	0.40836	0.969000	0.41365	0.433000	0.31745	4.478000	0.60230	2.767000	0.95098	0.555000	0.69702	GGC	GPR110	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom	ENSG00000153292		0.428	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	HGNC	protein_coding	OTTHUMT00000040810.2	266	0.00	0	C	NM_153840		46977528	46977528	-1	no_errors	ENST00000371253	ensembl	human	known	69_37n	missense	85	46.54	74	SNP	1.000	A
GRK1	6011	genome.wustl.edu	37	13	114324090	114324093	+	Frame_Shift_Del	DEL	TCTG	TCTG	-			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	TCTG	TCTG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr13:114324090_114324093delTCTG	ENST00000335678.6	+	2	1020_1023	c.788_791delTCTG	c.(787-792)ctctgtfs	p.LC263fs		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			AAAGCCGACCTCTGTCTGGTGATG	0.559																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0					13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.788_791delTCTG	13.37:g.114324094_114324097delTCTG	ENSP00000334876:p.Leu263fs		Q53X14	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_GPCR_kinase,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom	p.C264fs	ENST00000335678.6	37	c.788_791		13																																																																																			GRK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000185974		0.559	GRK1-001	KNOWN	basic|appris_principal	protein_coding	GRK1	HGNC	protein_coding	OTTHUMT00000470655.1	127	0.00	0	TCTG	NM_002929		114324090	114324093	+1	no_errors	ENST00000335678	ensembl	human	known	69_37n	frame_shift_del	152	24.14	49	DEL	1.000:1.000:1.000:1.000	-
IQUB	154865	genome.wustl.edu	37	7	123152129	123152129	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr7:123152129G>A	ENST00000466202.1	-	2	842	c.266C>T	c.(265-267)tCa>tTa	p.S89L	IQUB_ENST00000488987.1_Intron|IQUB_ENST00000434450.1_Missense_Mutation_p.S89L|IQUB_ENST00000324698.6_Missense_Mutation_p.S89L	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	89					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						CGGAGTATATGAAACTTGTCT	0.388																																						dbGAP											0													230.0	196.0	208.0					7																	123152129		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.266C>T	7.37:g.123152129G>A	ENSP00000417769:p.Ser89Leu		A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	pfam_Ubiquitin,pfscan_Ubiquitin_supergroup	p.S89L	ENST00000466202.1	37	c.266	CCDS5787.1	7	.	.	.	.	.	.	.	.	.	.	G	10.80	1.453405	0.26161	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.48201	1.82;1.82;0.82	4.97	-1.48	0.08745	.	6.669200	0.00357	N	0.000023	T	0.33789	0.0875	L	0.29908	0.895	0.09310	N	1	B;B;B	0.15719	0.014;0.002;0.001	B;B;B	0.12156	0.007;0.006;0.002	T	0.08351	-1.0726	10	0.23891	T	0.37	.	5.0116	0.14315	0.4412:0.1497:0.4091:0.0	.	89;89;89	A1A4Z1;Q8NA54-2;Q8NA54	.;.;IQUB_HUMAN	L	89	ENSP00000417769:S89L;ENSP00000324882:S89L;ENSP00000388498:S89L	ENSP00000324882:S89L	S	-	2	0	IQUB	122939365	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.000000	0.12993	-0.094000	0.12374	0.650000	0.86243	TCA	IQUB	-	NULL	ENSG00000164675		0.388	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IQUB	HGNC	protein_coding	OTTHUMT00000348529.1	358	0.00	0	G	NM_178827		123152129	123152129	-1	no_errors	ENST00000324698	ensembl	human	known	69_37n	missense	280	16.67	56	SNP	0.000	A
KCNB2	9312	genome.wustl.edu	37	8	73849283	73849283	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr8:73849283G>A	ENST00000523207.1	+	3	2281	c.1693G>A	c.(1693-1695)Gag>Aag	p.E565K		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	565					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AGAAAAGCCTGAGAGGCCATC	0.502																																						dbGAP											0													87.0	79.0	81.0					8																	73849283		2203	4300	6503	-	-	-	SO:0001583	missense	0			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1693G>A	8.37:g.73849283G>A	ENSP00000430846:p.Glu565Lys		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.E565K	ENST00000523207.1	37	c.1693	CCDS6209.1	8	.	.	.	.	.	.	.	.	.	.	G	11.17	1.559275	0.27827	.	.	ENSG00000182674	ENST00000523207	T	0.23552	1.9	4.93	4.93	0.64822	.	0.166852	0.28093	N	0.016640	T	0.20941	0.0504	N	0.22421	0.69	0.26459	N	0.975476	B	0.26602	0.154	B	0.31101	0.124	T	0.10636	-1.0621	10	0.19590	T	0.45	.	18.323	0.90244	0.0:0.0:1.0:0.0	.	565	Q92953	KCNB2_HUMAN	K	565	ENSP00000430846:E565K	ENSP00000430846:E565K	E	+	1	0	KCNB2	74011837	0.167000	0.22975	0.946000	0.38457	0.954000	0.61252	2.072000	0.41510	2.543000	0.85770	0.655000	0.94253	GAG	KCNB2	-	pfam_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv2.2	ENSG00000182674		0.502	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	167	0.60	1	G	NM_004770		73849283	73849283	+1	no_errors	ENST00000523207	ensembl	human	known	69_37n	missense	123	17.45	26	SNP	0.597	A
KIAA1210	57481	genome.wustl.edu	37	X	118223589	118223589	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chrX:118223589C>G	ENST00000402510.2	-	11	1603	c.1604G>C	c.(1603-1605)aGa>aCa	p.R535T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	535										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TCTCCATCTTCTTCCATATGC	0.448																																						dbGAP											0													284.0	272.0	276.0					X																	118223589		2116	4235	6351	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1604G>C	X.37:g.118223589C>G	ENSP00000384670:p.Arg535Thr		B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.R535T	ENST00000402510.2	37	c.1604	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	11.58	1.681479	0.29872	.	.	ENSG00000250423	ENST00000402510	T	0.29142	1.58	4.95	-0.859	0.10685	.	.	.	.	.	T	0.27349	0.0671	N	0.14661	0.345	0.09310	N	1	D	0.65815	0.995	D	0.63877	0.919	T	0.17319	-1.0373	9	0.30854	T	0.27	.	4.4748	0.11729	0.0:0.3265:0.1735:0.4999	.	535	Q9ULL0	K1210_HUMAN	T	535	ENSP00000384670:R535T	ENSP00000384670:R535T	R	-	2	0	RP13-347D8.6	118107617	0.002000	0.14202	0.000000	0.03702	0.026000	0.11368	0.095000	0.15127	-0.135000	0.11495	0.462000	0.41574	AGA	KIAA1210	-	NULL	ENSG00000250423		0.448	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	885	0.00	0	C	NM_020721		118223589	118223589	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	568	31.86	266	SNP	0.000	G
LAMTOR2	28956	genome.wustl.edu	37	1	156024726	156024726	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr1:156024726A>G	ENST00000368305.4	+	1	184	c.46A>G	c.(46-48)Act>Gct	p.T16A	LAMTOR2_ENST00000368304.5_Missense_Mutation_p.T16A|LAMTOR2_ENST00000489664.1_3'UTR|LAMTOR2_ENST00000368302.3_Missense_Mutation_p.T16A|UBQLN4_ENST00000472638.1_5'Flank|UBQLN4_ENST00000368309.3_5'Flank	NM_014017.3	NP_054736.1	Q9Y2Q5	LTOR2_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 2	16					activation of MAPKK activity (GO:0000186)|cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)	extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|Ragulator complex (GO:0071986)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7						CCAAGCCAACACTGGAGGCGT	0.677																																						dbGAP											0													37.0	33.0	34.0					1																	156024726		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024190	CCDS1128.1, CCDS44243.1	1q22	2014-09-17	2011-02-15	2011-02-15	ENSG00000116586	ENSG00000116586			29796	protein-coding gene	gene with protein product	"""mitogen activated protein binding protein interacting protein"", ""MAPKSP1 adaptor protein"", ""endosomal adaptor protein"""	610389	"""roadblock domain containing 3"""	ROBLD3		11042152	Standard	NM_014017		Approved	MAPBPIP, MAPKSP1AP, p14, ENDAP, Ragulator2	uc001fnb.3	Q9Y2Q5	OTTHUMG00000017462	ENST00000368305.4:c.46A>G	1.37:g.156024726A>G	ENSP00000357288:p.Thr16Ala		Q5VY97|Q5VY98|Q5VY99	Missense_Mutation	SNP	pfam_Dynein_light-rel,smart_Dynein_light-rel	p.T16A	ENST00000368305.4	37	c.46	CCDS1128.1	1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.276896	0.80580	.	.	ENSG00000116586	ENST00000368305;ENST00000368304;ENST00000368302	T;T;T	0.23147	1.92;1.92;1.92	5.71	4.52	0.55395	.	0.051329	0.85682	D	0.000000	T	0.32526	0.0832	M	0.78285	2.405	0.54753	D	0.999984	D;P	0.60160	0.987;0.467	P;P	0.55923	0.787;0.514	T	0.13150	-1.0520	10	0.51188	T	0.08	-8.4307	10.6972	0.45905	0.8401:0.1599:0.0:0.0	.	16;16	Q5VY98;Q9Y2Q5	.;LTOR2_HUMAN	A	16	ENSP00000357288:T16A;ENSP00000357287:T16A;ENSP00000357285:T16A	ENSP00000357285:T16A	T	+	1	0	LAMTOR2	154291350	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.354000	0.73036	2.179000	0.69175	0.459000	0.35465	ACT	LAMTOR2	-	pfam_Dynein_light-rel,smart_Dynein_light-rel	ENSG00000116586		0.677	LAMTOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMTOR2	HGNC	protein_coding	OTTHUMT00000046197.1	12	0.00	0	A	NM_014017		156024726	156024726	+1	no_errors	ENST00000368302	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	G
LCA5L	150082	genome.wustl.edu	37	21	40783710	40783710	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr21:40783710C>G	ENST00000358268.2	-	7	1522	c.994G>C	c.(994-996)Gaa>Caa	p.E332Q	LCA5L_ENST00000288350.3_Missense_Mutation_p.E332Q|LCA5L_ENST00000380671.2_Missense_Mutation_p.E332Q|LCA5L_ENST00000495240.1_5'Flank|WRB_ENST00000541890.1_Intron			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	332										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				TTTTTAATTTCAAGCTCACGA	0.279																																						dbGAP											0													64.0	64.0	64.0					21																	40783710		2200	4292	6492	-	-	-	SO:0001583	missense	0			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.994G>C	21.37:g.40783710C>G	ENSP00000351008:p.Glu332Gln		D3DSI0|Q3ZCT0	Missense_Mutation	SNP	NULL	p.E332Q	ENST00000358268.2	37	c.994	CCDS13665.1	21	.	.	.	.	.	.	.	.	.	.	C	12.13	1.846221	0.32606	.	.	ENSG00000157578	ENST00000288350;ENST00000380671;ENST00000358268	T;T;T	0.57273	0.41;0.41;0.41	5.52	4.63	0.57726	.	0.315721	0.26871	N	0.022065	T	0.38639	0.1048	L	0.29908	0.895	0.27956	N	0.936973	B	0.18610	0.029	B	0.14578	0.011	T	0.27502	-1.0072	10	0.39692	T	0.17	-27.3777	9.4939	0.38976	0.1615:0.6828:0.1557:0.0	.	332	O95447	LCA5L_HUMAN	Q	332	ENSP00000288350:E332Q;ENSP00000370046:E332Q;ENSP00000351008:E332Q	ENSP00000288350:E332Q	E	-	1	0	LCA5L	39705580	0.996000	0.38824	0.953000	0.39169	0.984000	0.73092	2.132000	0.42083	1.357000	0.45904	-0.155000	0.13514	GAA	LCA5L	-	NULL	ENSG00000157578		0.279	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	72	0.00	0	C	NM_152505		40783710	40783710	-1	no_errors	ENST00000288350	ensembl	human	known	69_37n	missense	221	15.79	42	SNP	0.986	G
LYZL6	57151	genome.wustl.edu	37	17	34264771	34264771	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr17:34264771C>G	ENST00000585556.1	-	3	623	c.289G>C	c.(289-291)Gac>Cac	p.D97H	LYZL6_ENST00000394523.3_Missense_Mutation_p.D97H|LYZL6_ENST00000492340.2_5'UTR|LYZL6_ENST00000293274.4_Missense_Mutation_p.D97H			O75951	LYZL6_HUMAN	lysozyme-like 6	97					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	12				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTTGACAGTCTACGTGGCAA	0.527																																						dbGAP											0													97.0	89.0	92.0					17																	34264771		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088219, AY742214	CCDS11302.1	17q11.2	2014-04-10			ENSG00000161572	ENSG00000275722			29614	protein-coding gene	gene with protein product		612751				10213461	Standard	NM_020426		Approved	LYC1, PRO1485, TKAL754	uc002hkj.2	O75951	OTTHUMG00000188400	ENST00000585556.1:c.289G>C	17.37:g.34264771C>G	ENSP00000468094:p.Asp97His		Q6UW30	Missense_Mutation	SNP	pfam_Glyco_hydro_22,pfam_Lytic_TGlycosylase-like_cat,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	p.D97H	ENST00000585556.1	37	c.289	CCDS11302.1	17	.	.	.	.	.	.	.	.	.	.	C	5.927	0.355051	0.11239	.	.	ENSG00000161572	ENST00000293274;ENST00000394523	T;T	0.45668	0.89;0.89	4.96	2.83	0.33086	Lysozyme-like domain (1);Glycoside hydrolase, family 22, conserved site (1);	0.480369	0.18759	N	0.131948	T	0.34019	0.0883	L	0.55213	1.73	0.09310	N	1	B	0.09022	0.002	B	0.19666	0.026	T	0.17319	-1.0373	10	0.52906	T	0.07	-4.9759	5.056	0.14533	0.2088:0.6859:0.0:0.1052	.	97	O75951	LYZL6_HUMAN	H	97	ENSP00000293274:D97H;ENSP00000378031:D97H	ENSP00000293274:D97H	D	-	1	0	LYZL6	31288884	0.046000	0.20272	0.140000	0.22221	0.105000	0.19272	0.101000	0.15251	2.479000	0.83701	0.655000	0.94253	GAC	LYZL6	-	pfam_Glyco_hydro_22,pfam_Lytic_TGlycosylase-like_cat,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	ENSG00000161572		0.527	LYZL6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LYZL6	HGNC	protein_coding	OTTHUMT00000256578.2	153	0.65	1	C	NM_020426		34264771	34264771	-1	no_errors	ENST00000293274	ensembl	human	known	69_37n	missense	147	16.48	29	SNP	0.009	G
MAGEB2	4113	genome.wustl.edu	37	X	30237091	30237091	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chrX:30237091G>A	ENST00000378988.4	+	2	495	c.394G>A	c.(394-396)Gtt>Att	p.V132I		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	132	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.V132I(2)		breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						AAAAAAGTCCGTTACAAAGGG	0.468																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											57.0	56.0	57.0					X																	30237091		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.394G>A	X.37:g.30237091G>A	ENSP00000368273:p.Val132Ile		O75860	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.V132I	ENST00000378988.4	37	c.394	CCDS14219.1	X	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.527811	0.00959	.	.	ENSG00000099399	ENST00000378988	T	0.02395	4.31	3.27	-2.77	0.05877	.	0.259412	0.35772	N	0.002999	T	0.00552	0.0018	N	0.00422	-1.515	0.09310	N	1	B	0.22983	0.078	B	0.09377	0.004	T	0.36915	-0.9728	10	0.02654	T	1	.	1.1465	0.01776	0.2926:0.3895:0.1349:0.183	.	132	O15479	MAGB2_HUMAN	I	132	ENSP00000368273:V132I	ENSP00000368273:V132I	V	+	1	0	MAGEB2	30147012	0.002000	0.14202	0.000000	0.03702	0.005000	0.04900	0.335000	0.19806	-0.686000	0.05170	-0.422000	0.05995	GTT	MAGEB2	-	pfam_MAGE,pfscan_MAGE	ENSG00000099399		0.468	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB2	HGNC	protein_coding	OTTHUMT00000056157.1	139	0.00	0	G	NM_002364		30237091	30237091	+1	no_errors	ENST00000378988	ensembl	human	known	69_37n	missense	165	31.25	75	SNP	0.000	A
MAPK1	5594	genome.wustl.edu	37	22	22162014	22162014	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr22:22162014C>T	ENST00000215832.6	-	2	429	c.241G>A	c.(241-243)Gag>Aag	p.E81K	MAPK1_ENST00000398822.3_Missense_Mutation_p.E81K|MAPK1_ENST00000544786.1_Missense_Mutation_p.E81K	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	81	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	ATGATGTTCTCATGTCTGAAG	0.438																																						dbGAP											0													200.0	170.0	180.0					22																	22162014		2203	4300	6503	-	-	-	SO:0001583	missense	0			M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.241G>A	22.37:g.22162014C>T	ENSP00000215832:p.Glu81Lys		A8CZ64	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.E81K	ENST00000215832.6	37	c.241	CCDS13795.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.559617	0.96514	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.43688	0.94;0.94;0.94	4.64	4.64	0.57946	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.54127	0.1839	L	0.28740	0.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.59311	-0.7478	10	0.87932	D	0	-22.2598	18.0615	0.89379	0.0:1.0:0.0:0.0	.	81;81	A8CZ64;P28482	.;MK01_HUMAN	K	81;69;81;81	ENSP00000215832:E81K;ENSP00000381803:E81K;ENSP00000440842:E81K	ENSP00000215832:E81K	E	-	1	0	MAPK1	20492014	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.565000	0.86533	0.591000	0.81541	GAG	MAPK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000100030		0.438	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MAPK1	HGNC	protein_coding	OTTHUMT00000075396.2	402	0.00	0	C			22162014	22162014	-1	no_errors	ENST00000215832	ensembl	human	known	69_37n	missense	266	27.12	99	SNP	1.000	T
MRPL45	84311	genome.wustl.edu	37	17	36478038	36478038	+	Silent	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr17:36478038G>A	ENST00000312513.5	+	7	851	c.690G>A	c.(688-690)cgG>cgA	p.R230R		NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	230						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GGTTTGGCCGGTTGATGTATG	0.443																																						dbGAP											0													129.0	118.0	122.0					17																	36478038		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.690G>A	17.37:g.36478038G>A			A1L436|Q6ZMJ5	Silent	SNP	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45	p.R230	ENST00000312513.5	37	c.690	CCDS11326.1	17																																																																																			MRPL45	-	pfam_Tim44-related/Ribosome_L45,smart_Tim44-related/Ribosome_L45	ENSG00000174100		0.443	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	MRPL45	HGNC	protein_coding	OTTHUMT00000256792.3	279	0.00	0	G	NM_032351		36478038	36478038	+1	no_errors	ENST00000312513	ensembl	human	known	69_37n	silent	123	41.51	88	SNP	0.986	A
MUS81	80198	genome.wustl.edu	37	11	65629461	65629461	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr11:65629461C>T	ENST00000308110.4	+	4	744	c.395C>T	c.(394-396)cCa>cTa	p.P132L	MUS81_ENST00000533035.1_Missense_Mutation_p.P57L|CFL1_ENST00000525451.2_5'Flank|CFL1_ENST00000534769.1_5'Flank|CFL1_ENST00000531413.1_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	132	Interaction with BLM.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		AGCTACTGGCCAGCTCGGCAC	0.592								Homologous recombination																														dbGAP											0													23.0	23.0	23.0					11																	65629461		2197	4297	6494	-	-	-	SO:0001583	missense	0				CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.395C>T	11.37:g.65629461C>T	ENSP00000307853:p.Pro132Leu		Q9H7D9	Nonsense_Mutation	SNP	pfam_ERCC4_domain,superfamily_Restrct_endonuc-II-like,superfamily_DNA-dir_DNA_pol_X_beta-like_N,smart_ERCC4_domain	p.Q97*	ENST00000308110.4	37	c.289	CCDS8115.1	11	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721528	0.89298	.	.	ENSG00000172732	ENST00000529857;ENST00000533035;ENST00000308110;ENST00000437855;ENST00000525768	T;T;T;T	0.67523	-0.27;0.06;-0.09;-0.03	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.79857	0.4518	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.80915	-0.1169	10	0.54805	T	0.06	-14.5169	14.0752	0.64887	0.0:1.0:0.0:0.0	.	132	Q96NY9	MUS81_HUMAN	L	197;57;132;132;57	ENSP00000431979:P197L;ENSP00000432287:P57L;ENSP00000307853:P132L;ENSP00000431478:P57L	ENSP00000307853:P132L	P	+	2	0	MUS81	65386037	0.988000	0.35896	0.995000	0.50966	0.958000	0.62258	3.599000	0.54045	2.482000	0.83794	0.561000	0.74099	CCA	MUS81	-	NULL	ENSG00000172732		0.592	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUS81	HGNC	protein_coding	OTTHUMT00000390941.3	10	0.00	0	C	NM_025128		65629461	65629461	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524647	ensembl	human	known	69_37n	nonsense	45	17.86	10	SNP	0.994	T
OR10D3	26497	genome.wustl.edu	37	11	124056377	124056377	+	Missense_Mutation	SNP	T	T	C	rs2512228	byFrequency	TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr11:124056377T>C	ENST00000318666.6	+	1	455	c.401T>C	c.(400-402)gTc>gCc	p.V134A				Q8NH80	O10D3_HUMAN	olfactory receptor, family 10, subfamily D, member 3 (non-functional)	134				V -> A (in Ref. 2; X64983). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CGATACACAGTCATCATGAAC	0.507													T|||	2460	0.491214	0.4198	0.4755	5008	,	,		23059	0.5734		0.5318	False		,,,				2504	0.4724					dbGAP											0																																										-	-	-	SO:0001583	missense	0			X64983		11q24.2	2014-04-01	2010-06-25	2010-06-25	ENSG00000197309	ENSG00000197309		"""GPCR / Class A : Olfactory receptors"""	8168	other	unknown			"""olfactory receptor, family 10, subfamily D, member 3 pseudogene"""	OR10D3P		1370859	Standard	NG_004125		Approved	HTPCRX09	uc001pzv.2	Q8NH80	OTTHUMG00000165166	ENST00000318666.6:c.401T>C	11.37:g.124056377T>C	ENSP00000323895:p.Val134Ala			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V134A	ENST00000318666.6	37	c.401		11	1120	0.5128205128205128	198	0.4024390243902439	180	0.4972375690607735	348	0.6083916083916084	394	0.5197889182058048	T	7.798	0.712929	0.15306	.	.	ENSG00000197309	ENST00000318666	T	0.01015	5.44	5.27	-0.0453	0.13852	.	1.991960	0.02896	N	0.134712	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.12451	-1.0547	6	0.42905	T	0.14	-2.8115	6.3553	0.21398	0.0:0.421:0.1452:0.4338	rs2512228;rs52790556;rs56595458;rs60670420;rs2512228	.	.	.	A	134	ENSP00000323895:V134A	ENSP00000323895:V134A	V	+	2	0	OR10D3	123561587	0.000000	0.05858	0.002000	0.10522	0.251000	0.25915	-0.690000	0.05138	0.025000	0.15241	0.533000	0.62120	GTC	OR10D3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000197309		0.507	OR10D3-001	KNOWN	basic|appris_principal	protein_coding	OR10D3	HGNC	protein_coding	OTTHUMT00000382394.2	27	0.00	0	T			124056377	124056377	+1	no_errors	ENST00000318666	ensembl	human	known	69_37n	missense	9	55.00	11	SNP	0.009	C
PAPPA	5069	genome.wustl.edu	37	9	119097272	119097272	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr9:119097272C>T	ENST00000328252.3	+	13	3899	c.3530C>T	c.(3529-3531)gCc>gTc	p.A1177V	PAPPA_ENST00000534838.1_Missense_Mutation_p.A215V	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1177					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TCGGGGGTGGCCCTCCGTTCC	0.627																																						dbGAP											0													112.0	94.0	100.0					9																	119097272		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3530C>T	9.37:g.119097272C>T	ENSP00000330658:p.Ala1177Val		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.A1177V	ENST00000328252.3	37	c.3530	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	C	31	5.104227	0.94245	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.04360	4.43;3.64	5.86	5.86	0.93980	.	0.093375	0.64402	D	0.000001	T	0.20414	0.0491	M	0.73962	2.25	0.54753	D	0.999983	P;D	0.64830	0.51;0.994	B;P	0.58620	0.154;0.842	T	0.00022	-1.2337	10	0.72032	D	0.01	-25.892	20.1865	0.98220	0.0:1.0:0.0:0.0	.	215;1177	F5GZ19;Q13219	.;PAPP1_HUMAN	V	1177;215	ENSP00000330658:A1177V;ENSP00000441461:A215V	ENSP00000330658:A1177V	A	+	2	0	PAPPA	118137093	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.918000	0.63376	2.775000	0.95449	0.655000	0.94253	GCC	PAPPA	-	NULL	ENSG00000182752		0.627	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	116	0.00	0	C	NM_002581		119097272	119097272	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	missense	20	45.95	17	SNP	1.000	T
PCDHB1	29930	genome.wustl.edu	37	5	140431164	140431164	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr5:140431164G>C	ENST00000306549.3	+	1	186	c.109G>C	c.(109-111)Gag>Cag	p.E37Q		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	37	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCAGTGGCAGAGGAAATGGA	0.552																																						dbGAP											0													63.0	62.0	63.0					5																	140431164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.109G>C	5.37:g.140431164G>C	ENSP00000307234:p.Glu37Gln		Q2M257	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E37Q	ENST00000306549.3	37	c.109	CCDS4243.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.443794	0.96187	.	.	ENSG00000171815	ENST00000306549	T	0.60424	0.19	5.81	5.81	0.92471	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.47852	D	0.000205	D	0.87055	0.6082	H	0.98833	4.345	0.54753	D	0.999987	D	0.89917	1.0	D	0.91635	0.999	D	0.91747	0.5409	10	0.87932	D	0	.	20.0762	0.97745	0.0:0.0:1.0:0.0	.	37	Q9Y5F3	PCDB1_HUMAN	Q	37	ENSP00000307234:E37Q	ENSP00000307234:E37Q	E	+	1	0	PCDHB1	140411348	1.000000	0.71417	0.995000	0.50966	0.957000	0.61999	9.671000	0.98627	2.756000	0.94617	0.655000	0.94253	GAG	PCDHB1	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000171815		0.552	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	156	0.00	0	G	NM_013340		140431164	140431164	+1	no_errors	ENST00000306549	ensembl	human	known	69_37n	missense	177	25.52	61	SNP	1.000	C
PF4	5196	genome.wustl.edu	37	4	74847580	74847580	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr4:74847580C>T	ENST00000296029.3	-	1	261	c.91G>A	c.(91-93)Gct>Act	p.A31T		NM_002619.3	NP_002610.1	P02776	PLF4_HUMAN	platelet factor 4	31					blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|leukocyte chemotaxis (GO:0030595)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cytolysis (GO:0045918)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of MHC class II biosynthetic process (GO:0045347)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|heparin binding (GO:0008201)			kidney(1)|lung(1)	2	Breast(15;0.00136)		all cancers(17;0.0034)|Lung(101;0.196)		Drotrecogin alfa(DB00055)	CTGCTCTCACCGCTGGCGAAG	0.677																																						dbGAP											0													11.0	13.0	12.0					4																	74847580		1909	3541	5450	-	-	-	SO:0001630	splice_region_variant	0			M25897	CCDS3562.1	4q12-q21	2012-10-02	2008-08-29		ENSG00000163737	ENSG00000163737			8861	protein-coding gene	gene with protein product	"""chemokine (C-X-C motif) ligand 4"""	173460	"""platelet factor 4"""			3622011	Standard	NM_002619		Approved	SCYB4, CXCL4	uc003hhi.3	P02776	OTTHUMG00000130009	ENST00000296029.3:c.91+1G>A	4.37:g.74847580C>T			Q53X61|Q9UC64|Q9UC65	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXCL8/IL8,prints_Chemokine_CXC	p.A31T	ENST00000296029.3	37	c.91	CCDS3562.1	4	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871900	0.33069	.	.	ENSG00000163737	ENST00000296029	.	.	.	2.25	2.25	0.28309	Chemokine interleukin-8-like domain (1);	5.418240	0.00166	N	0.000009	T	0.14184	0.0343	N	0.08118	0	0.19775	N	0.999956	P	0.43633	0.813	B	0.28011	0.085	T	0.23655	-1.0182	8	.	.	.	.	7.9469	0.29991	0.0:1.0:0.0:0.0	.	31	P02776	PLF4_HUMAN	T	31	.	.	A	-	1	0	PF4	75066444	0.426000	0.25506	0.129000	0.21949	0.016000	0.09150	1.545000	0.36169	1.254000	0.44035	0.305000	0.20034	GCT	PF4	-	superfamily_Chemokine_IL8-like_dom	ENSG00000163737		0.677	PF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PF4	HGNC	protein_coding	OTTHUMT00000252282.1	30	0.00	0	C		Missense_Mutation	74847580	74847580	-1	no_errors	ENST00000296029	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.380	T
PIK3CA	5290	genome.wustl.edu	37	3	178916944	178916946	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr3:178916944_178916946delAAG	ENST00000263967.3	+	2	488_490	c.331_333delAAG	c.(331-333)aagdel	p.K111del		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	111					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.K111E(13)|p.K111N(12)|p.K111_L113delKIL(2)|p.K111_I112>N(1)|p.K111R(1)|p.K111del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCGTGAAGAAAAGATCCTCAATC	0.33		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	30	Substitution - Missense(26)|Deletion - In frame(3)|Complex - deletion inframe(1)	endometrium(11)|breast(8)|large_intestine(4)|lung(4)|ovary(2)|urinary_tract(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.331_333delAAG	3.37:g.178916944_178916946delAAG	ENSP00000263967:p.Lys111del		Q14CW1|Q99762	In_Frame_Del	DEL	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.K111in_frame_del	ENST00000263967.3	37	c.331_333	CCDS43171.1	3																																																																																			PIK3CA	-	NULL	ENSG00000121879		0.330	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	61	0.00	0	AAG			178916944	178916946	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	in_frame_del	87	40.94	61	DEL	1.000:1.000:1.000	-
PLD5	200150	genome.wustl.edu	37	1	242277235	242277235	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr1:242277235C>T	ENST00000536534.2	-	7	1268	c.1027G>A	c.(1027-1029)Gct>Act	p.A343T	PLD5_ENST00000442594.2_Missense_Mutation_p.A251T|PLD5_ENST00000427495.1_Missense_Mutation_p.A281T			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	343						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TCCATGACAGCGATGTACACA	0.453																																						dbGAP											0													194.0	145.0	161.0					1																	242277235		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1027G>A	1.37:g.242277235C>T	ENSP00000440896:p.Ala343Thr		A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	smart_PLipase_D/transphosphatidylase	p.A343T	ENST00000536534.2	37	c.1027	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535485	0.85812	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.24151	1.87;1.87;1.87	5.48	5.48	0.80851	Phospholipase D/viral envelope (1);	0.054625	0.85682	D	0.000000	T	0.37652	0.1011	L	0.60455	1.87	0.47621	D	0.999477	D;D;D	0.67145	0.996;0.996;0.996	P;P;P	0.50231	0.588;0.635;0.502	T	0.09596	-1.0667	10	0.49607	T	0.09	-11.6676	17.1341	0.86734	0.0:1.0:0.0:0.0	.	251;343;281	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	T	281;251;343	ENSP00000401285:A281T;ENSP00000414188:A251T;ENSP00000440896:A343T	ENSP00000401285:A281T	A	-	1	0	PLD5	240343858	0.999000	0.42202	0.918000	0.36340	0.918000	0.54935	4.539000	0.60657	2.569000	0.86673	0.643000	0.83706	GCT	PLD5	-	NULL	ENSG00000180287		0.453	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	249	0.00	0	C	NM_152666		242277235	242277235	-1	no_errors	ENST00000536534	ensembl	human	known	69_37n	missense	264	13.68	42	SNP	0.979	T
PPP2R5E	5529	genome.wustl.edu	37	14	63842801	63842801	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr14:63842801C>T	ENST00000337537.3	-	14	1932	c.1330G>A	c.(1330-1332)Gaa>Aaa	p.E444K	PPP2R5E_ENST00000555899.1_Missense_Mutation_p.E439K|PPP2R5E_ENST00000422769.2_Missense_Mutation_p.E368K	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	444					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		CACAATTCTTCACGCTCCTTT	0.323																																						dbGAP											0													183.0	159.0	167.0					14																	63842801		2203	4298	6501	-	-	-	SO:0001583	missense	0			L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.1330G>A	14.37:g.63842801C>T	ENSP00000337641:p.Glu444Lys		A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.E444K	ENST00000337537.3	37	c.1330	CCDS9758.1	14	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059981	0.76074	.	.	ENSG00000154001	ENST00000337537;ENST00000555899;ENST00000422769	.	.	.	5.86	5.86	0.93980	Armadillo-type fold (1);	0.096124	0.64402	D	0.000001	T	0.60715	0.2290	L	0.45744	1.44	0.80722	D	1	B;B	0.23735	0.09;0.09	B;B	0.25140	0.058;0.058	T	0.54977	-0.8212	9	0.44086	T	0.13	-11.7163	20.1996	0.98256	0.0:1.0:0.0:0.0	.	439;444	B7ZKK9;Q16537	.;2A5E_HUMAN	K	444;439;368	.	ENSP00000337641:E444K	E	-	1	0	PPP2R5E	62912554	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.601000	0.82783	2.776000	0.95493	0.650000	0.86243	GAA	PPP2R5E	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000154001		0.323	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP2R5E	HGNC	protein_coding	OTTHUMT00000276973.1	632	0.00	0	C	NM_006246		63842801	63842801	-1	no_errors	ENST00000337537	ensembl	human	known	69_37n	missense	484	19.73	119	SNP	1.000	T
PSMD1	5707	genome.wustl.edu	37	2	232035376	232035376	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr2:232035376G>A	ENST00000308696.6	+	24	2974	c.2812G>A	c.(2812-2814)Gag>Aag	p.E938K	PSMD1_ENST00000373635.4_Missense_Mutation_p.E907K|PSMD1_ENST00000409643.1_Missense_Mutation_p.E907K	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	938	Poly-Glu.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	AATCGAGGAGGAGGAACAAGA	0.473																																						dbGAP											0													106.0	100.0	102.0					2																	232035376		2203	4300	6503	-	-	-	SO:0001583	missense	0			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.2812G>A	2.37:g.232035376G>A	ENSP00000309474:p.Glu938Lys		B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	pfam_APC_proteasome,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn2	p.E938K	ENST00000308696.6	37	c.2812	CCDS2482.1	2	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383654	0.82792	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.61974	0.2390	L	0.28556	0.865	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	T	0.52779	-0.8530	9	0.08179	T	0.78	-15.8754	19.3542	0.94404	0.0:0.0:1.0:0.0	.	938	Q99460	PSMD1_HUMAN	K	938;907;907	.	ENSP00000309474:E938K	E	+	1	0	PSMD1	231743620	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.468000	0.97676	2.575000	0.86900	0.655000	0.94253	GAG	PSMD1	-	pirsf_26S_Psome_Rpn2	ENSG00000173692		0.473	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD1	HGNC	protein_coding	OTTHUMT00000256958.2	422	0.00	0	G			232035376	232035376	+1	no_errors	ENST00000308696	ensembl	human	known	69_37n	missense	207	26.24	74	SNP	1.000	A
RARB	5915	genome.wustl.edu	37	3	25622090	25622090	+	Silent	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr3:25622090C>T	ENST00000404969.1	+	5	684	c.684C>T	c.(682-684)ttC>ttT	p.F228F	RARB_ENST00000462272.1_3'UTR|RARB_ENST00000458646.1_Silent_p.F109F|RARB_ENST00000330688.4_Silent_p.F221F|RARB_ENST00000437042.2_Silent_p.F109F			P10826	RARB_HUMAN	retinoic acid receptor, beta	228	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	GGGACAAATTCAGTGAACTGG	0.493																																						dbGAP											0													128.0	113.0	118.0					3																	25622090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.684C>T	3.37:g.25622090C>T			P12891|Q00989|Q15298|Q9UN48	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.F228	ENST00000404969.1	37	c.684		3																																																																																			RARB	-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_Retinoic_acid_rcpt	ENSG00000077092		0.493	RARB-201	KNOWN	basic	protein_coding	RARB	HGNC	protein_coding		217	0.00	0	C	NM_000965, NM_016152		25622090	25622090	+1	no_errors	ENST00000404969	ensembl	human	known	69_37n	silent	159	17.19	33	SNP	1.000	T
RBMXL3	139804	genome.wustl.edu	37	X	114424076	114424076	+	Silent	SNP	C	C	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chrX:114424076C>A	ENST00000424776.3	+	1	114	c.72C>A	c.(70-72)ctC>ctA	p.L24L	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	24	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						AGAAAGCCCTCAAAGCCGAGT	0.527																																						dbGAP											0													65.0	61.0	62.0					X																	114424076		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.72C>A	X.37:g.114424076C>A			B4DXC0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L24	ENST00000424776.3	37	c.72	CCDS55478.1	X																																																																																			RBMXL3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000175718		0.527	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	26	0.00	0	C	NM_001145346		114424076	114424076	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	silent	81	37.88	50	SNP	0.147	A
RELN	5649	genome.wustl.edu	37	7	103301856	103301856	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr7:103301856C>T	ENST00000428762.1	-	12	1567	c.1408G>A	c.(1408-1410)Ggt>Agt	p.G470S	RELN_ENST00000424685.2_Missense_Mutation_p.G470S|RELN_ENST00000343529.5_Missense_Mutation_p.G470S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	470					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TTCCCATAACCGGTAGTGTCC	0.443																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													175.0	123.0	141.0					7																	103301856		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1408G>A	7.37:g.103301856C>T	ENSP00000392423:p.Gly470Ser		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.G470S	ENST00000428762.1	37	c.1408	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	3.110	-0.182913	0.06340	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21361	2.01;2.01;2.01	5.3	5.3	0.74995	.	0.260319	0.40385	N	0.001114	T	0.12305	0.0299	N	0.11560	0.145	0.39257	D	0.964146	B;B	0.33494	0.388;0.414	B;B	0.29524	0.103;0.093	T	0.18587	-1.0332	10	0.15499	T	0.54	.	18.9384	0.92595	0.0:1.0:0.0:0.0	.	470;470	P78509-2;P78509	.;RELN_HUMAN	S	470	ENSP00000392423:G470S;ENSP00000345694:G470S;ENSP00000388446:G470S	ENSP00000345694:G470S	G	-	1	0	RELN	103089092	0.987000	0.35691	0.976000	0.42696	0.107000	0.19398	2.855000	0.48333	2.477000	0.83638	0.467000	0.42956	GGT	RELN	-	NULL	ENSG00000189056		0.443	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	284	0.00	0	C	NM_005045		103301856	103301856	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	156	30.67	69	SNP	0.971	T
RIF1	55183	genome.wustl.edu	37	2	152320040	152320040	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr2:152320040G>A	ENST00000243326.5	+	29	4489	c.4006G>A	c.(4006-4008)Gaa>Aaa	p.E1336K	RIF1_ENST00000444746.2_Missense_Mutation_p.E1336K|RIF1_ENST00000453091.2_Missense_Mutation_p.E1336K|RIF1_ENST00000430328.2_Missense_Mutation_p.E1336K|RIF1_ENST00000428287.2_Missense_Mutation_p.E1336K			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TAATCAAACAGAATGTGTGTC	0.378																																						dbGAP											0													67.0	72.0	70.0					2																	152320040		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4006G>A	2.37:g.152320040G>A	ENSP00000243326:p.Glu1336Lys		A0AVS0|Q9NS16	Missense_Mutation	SNP	pfam_Rif1_N,superfamily_ARM-type_fold	p.E1336K	ENST00000243326.5	37	c.4006	CCDS2194.1	2	.	.	.	.	.	.	.	.	.	.	G	14.81	2.646287	0.47258	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.15017	2.47;2.46;2.46;2.47;2.46	4.71	4.71	0.59529	.	0.358634	0.31797	N	0.007045	T	0.26593	0.0650	M	0.66939	2.045	0.80722	D	1	P;P	0.50943	0.544;0.94	B;P	0.49332	0.053;0.607	T	0.01001	-1.1485	10	0.39692	T	0.17	-3.9913	11.9808	0.53119	0.0845:0.0:0.9155:0.0	.	1336;1336	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	K	1336	ENSP00000390181:E1336K;ENSP00000414615:E1336K;ENSP00000415691:E1336K;ENSP00000243326:E1336K;ENSP00000416123:E1336K	ENSP00000243326:E1336K	E	+	1	0	RIF1	152028286	1.000000	0.71417	0.852000	0.33557	0.960000	0.62799	5.232000	0.65332	2.457000	0.83068	0.557000	0.71058	GAA	RIF1	-	NULL	ENSG00000080345		0.378	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	HGNC	protein_coding	OTTHUMT00000254836.3	84	0.00	0	G			152320040	152320040	+1	no_errors	ENST00000243326	ensembl	human	known	69_37n	missense	176	33.08	87	SNP	0.934	A
SLC12A2	6558	genome.wustl.edu	37	5	127474341	127474341	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr5:127474341C>G	ENST00000262461.2	+	8	1650	c.1461C>G	c.(1459-1461)ttC>ttG	p.F487L	SLC12A2_ENST00000343225.4_Missense_Mutation_p.F487L	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	487					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	AAGAGACTTTCTTTTCTGTAT	0.368																																						dbGAP											0													155.0	149.0	151.0					5																	127474341		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1461C>G	5.37:g.127474341C>G	ENSP00000262461:p.Phe487Leu		Q8N713|Q8WWH7	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt1,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.F487L	ENST00000262461.2	37	c.1461	CCDS4144.1	5	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727142	0.69074	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.99080	-5.4;-5.4	4.96	1.96	0.26148	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99211	0.9726	M	0.90977	3.165	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.997;0.998	D	0.99410	1.0930	10	0.87932	D	0	.	8.0464	0.30551	0.0:0.6689:0.0:0.3311	.	487;487	P55011-3;P55011	.;S12A2_HUMAN	L	487	ENSP00000262461:F487L;ENSP00000340878:F487L	ENSP00000262461:F487L	F	+	3	2	SLC12A2	127502240	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	0.344000	0.19962	0.184000	0.20083	0.650000	0.86243	TTC	SLC12A2	-	pfam_AA-permease_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000064651		0.368	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	HGNC	protein_coding	OTTHUMT00000250972.1	253	0.00	0	C	NM_001046		127474341	127474341	+1	no_errors	ENST00000262461	ensembl	human	known	69_37n	missense	695	13.65	110	SNP	1.000	G
SNTG1	54212	genome.wustl.edu	37	8	51363125	51363125	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr8:51363125C>T	ENST00000522124.1	+	7	948	c.287C>T	c.(286-288)tCa>tTa	p.S96L	SNTG1_ENST00000518864.1_Missense_Mutation_p.S96L|SNTG1_ENST00000276467.5_Missense_Mutation_p.S96L|SNTG1_ENST00000517473.1_Missense_Mutation_p.S96L	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	96	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GCGGAACTTTCAGGACTACTT	0.303																																						dbGAP											0													164.0	155.0	158.0					8																	51363125		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.287C>T	8.37:g.51363125C>T	ENSP00000429842:p.Ser96Leu		Q2M3Q0|Q9NY98	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.S96L	ENST00000522124.1	37	c.287	CCDS6147.1	8	.	.	.	.	.	.	.	.	.	.	C	13.97	2.394747	0.42512	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.32	5.32	0.75619	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.47764	0.1463	L	0.41824	1.3	0.80722	D	1	P;D	0.59357	0.941;0.985	P;D	0.72338	0.761;0.977	T	0.45116	-0.9283	10	0.72032	D	0.01	.	16.4853	0.84183	0.0:1.0:0.0:0.0	.	96;96	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	L	96	ENSP00000429276:S96L;ENSP00000429842:S96L;ENSP00000431123:S96L;ENSP00000276467:S96L	ENSP00000276467:S96L	S	+	2	0	SNTG1	51525678	1.000000	0.71417	0.999000	0.59377	0.248000	0.25809	5.110000	0.64622	2.475000	0.83589	0.650000	0.86243	TCA	SNTG1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000147481		0.303	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	444	0.00	0	C			51363125	51363125	+1	no_errors	ENST00000518864	ensembl	human	known	69_37n	missense	551	14.97	97	SNP	1.000	T
SPATA19	219938	genome.wustl.edu	37	11	133712412	133712412	+	Silent	SNP	G	G	A	rs531367211		TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr11:133712412G>A	ENST00000299140.3	-	5	459	c.405C>T	c.(403-405)atC>atT	p.I135I	SPATA19_ENST00000532889.1_Silent_p.I135I	NM_174927.1	NP_777587.1	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19	135					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	mitochondrial outer membrane (GO:0005741)				cervix(1)|endometrium(2)|large_intestine(2)|lung(5)|prostate(1)	11	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		GATCTCGCATGATGTCCTCTG	0.498																																						dbGAP											0													275.0	213.0	234.0					11																	133712412		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AK098717	CCDS8493.1	11q25	2010-04-23				ENSG00000166118			30614	protein-coding gene	gene with protein product	"""spergen 1"", ""cancer/testis antigen 132"""	609805				12477932	Standard	XM_005271448		Approved	FLJ25851, spergen1, SPAS1, CT132	uc001qgv.1	Q7Z5L4		ENST00000299140.3:c.405C>T	11.37:g.133712412G>A			Q8N7A9	Silent	SNP	NULL	p.I135	ENST00000299140.3	37	c.405	CCDS8493.1	11																																																																																			SPATA19	-	NULL	ENSG00000166118		0.498	SPATA19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA19	HGNC	protein_coding	OTTHUMT00000393281.1	324	0.31	1	G	NM_174927		133712412	133712412	-1	no_errors	ENST00000299140	ensembl	human	known	69_37n	silent	177	19.18	42	SNP	0.022	A
TGFBR1	7046	genome.wustl.edu	37	9	101908824	101908824	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr9:101908824C>G	ENST00000374994.4	+	7	1305	c.1188C>G	c.(1186-1188)ttC>ttG	p.F396L	TGFBR1_ENST00000552516.1_Missense_Mutation_p.F400L|TGFBR1_ENST00000550253.1_Missense_Mutation_p.F327L|TGFBR1_ENST00000374990.2_Missense_Mutation_p.F319L|RNA5SP290_ENST00000517133.1_RNA	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	396	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TTGAATCCTTCAAACGTGCTG	0.393																																						dbGAP											0													260.0	262.0	261.0					9																	101908824		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1188C>G	9.37:g.101908824C>G	ENSP00000364133:p.Phe396Leu		Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,superfamily_Quinolinate_PRibosylTrfase_C,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F396L	ENST00000374994.4	37	c.1188	CCDS6738.1	9	.	.	.	.	.	.	.	.	.	.	C	19.49	3.836923	0.71373	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000550253	D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18	5.43	4.54	0.55810	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94902	0.8352	M	0.67953	2.075	0.80722	D	1	D;D	0.61697	0.973;0.99	P;D	0.63877	0.846;0.919	D	0.94015	0.7287	10	0.46703	T	0.11	.	9.5898	0.39539	0.0:0.8377:0.0:0.1623	.	319;396	P36897-3;P36897	.;TGFR1_HUMAN	L	396;358;319;400;327	ENSP00000364133:F396L;ENSP00000364129:F319L;ENSP00000447297:F400L;ENSP00000450052:F327L	ENSP00000364129:F319L	F	+	3	2	TGFBR1	100948645	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.695000	0.47043	1.431000	0.47355	0.467000	0.42956	TTC	TGFBR1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000106799		0.393	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR1	HGNC	protein_coding	OTTHUMT00000053390.3	286	0.00	0	C			101908824	101908824	+1	no_errors	ENST00000374994	ensembl	human	known	69_37n	missense	252	40.71	173	SNP	1.000	G
TGFBR2	7048	genome.wustl.edu	37	3	30691805	30691805	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr3:30691805G>A	ENST00000295754.5	+	3	689	c.307G>A	c.(307-309)Gac>Aac	p.D103N	TGFBR2_ENST00000359013.4_Missense_Mutation_p.D128N	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	103					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						AGTTTGCCATGACCCCAAGCT	0.433																																						dbGAP											0													112.0	109.0	110.0					3																	30691805		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.307G>A	3.37:g.30691805G>A	ENSP00000295754:p.Asp103Asn		B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt,pfscan_Prot_kinase_cat_dom	p.D128N	ENST00000295754.5	37	c.382	CCDS2648.1	3	.	.	.	.	.	.	.	.	.	.	G	10.91	1.484144	0.26598	.	.	ENSG00000163513	ENST00000295754;ENST00000359013	D;D	0.82526	-1.62;-1.62	5.97	5.97	0.96955	Transforming growth factor beta receptor 2 ectodomain (1);	0.136038	0.64402	D	0.000003	T	0.75170	0.3813	L	0.33668	1.02	0.47511	D	0.999443	B;B	0.09022	0.002;0.002	B;B	0.27170	0.035;0.077	T	0.66945	-0.5795	10	0.11794	T	0.64	.	13.6054	0.62044	0.0706:0.0:0.9294:0.0	.	103;128	P37173;D2JYI1	TGFR2_HUMAN;.	N	103;128	ENSP00000295754:D103N;ENSP00000351905:D128N	ENSP00000295754:D103N	D	+	1	0	TGFBR2	30666809	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.075000	0.50073	2.837000	0.97791	0.655000	0.94253	GAC	TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto	ENSG00000163513		0.433	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2	264	0.00	0	G			30691805	30691805	+1	no_errors	ENST00000359013	ensembl	human	known	69_37n	missense	173	28.22	68	SNP	1.000	A
TRBV7-4	28594	genome.wustl.edu	37	7	142176456	142176456	+	RNA	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr7:142176456G>A	ENST00000390369.2	-	0	219									T cell receptor beta variable 7-4 (gene/pseudogene)																		GATTTGTCTCGTTGAGCATCA	0.557																																						dbGAP											0													73.0	70.0	71.0					7																	142176456		1895	4125	6020	-	-	-			0			L36092		7q34	2012-02-07	2008-09-12		ENSG00000253409	ENSG00000253409		"""T cell receptors / TRB locus"""	12238	other	T cell receptor gene			"""T cell receptor beta variable 7-4"""			8650574	Standard	NG_001333		Approved	TRBV74, TCRBV6S8A2T, TCRBV7S4			OTTHUMG00000158508		7.37:g.142176456G>A				Nonsense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.R74*	ENST00000390369.2	37	c.220		7																																																																																			TRBV7-4	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000253409		0.557	TRBV7-4-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV7-4	HGNC	TR_V_gene	OTTHUMT00000351214.2	265	0.00	0	G	NG_001333		142176456	142176456	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390369	ensembl	human	known	69_37n	nonsense	109	29.94	47	SNP	0.000	A
TRIM5	85363	genome.wustl.edu	37	11	5686469	5686469	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr11:5686469G>C	ENST00000380034.3	-	8	1308	c.1052C>G	c.(1051-1053)tCt>tGt	p.S351C	TRIM5_ENST00000396855.3_Intron|TRIM5_ENST00000483835.1_5'UTR|TRIM5_ENST00000305836.5_Missense_Mutation_p.S351C|TRIM5_ENST00000396853.4_Intron|TRIM5_ENST00000396847.3_3'UTR|TRIM5_ENST00000380027.1_Intron	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	351	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		GATACTTTGAGAGCCCAGGAT	0.463																																						dbGAP											0													106.0	102.0	103.0					11																	5686469		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.1052C>G	11.37:g.5686469G>C	ENSP00000369373:p.Ser351Cys		A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S351C	ENST00000380034.3	37	c.1052	CCDS31393.1	11	.	.	.	.	.	.	.	.	.	.	G	5.649	0.304383	0.10678	.	.	ENSG00000132256	ENST00000305836;ENST00000380034	T;T	0.62941	-0.01;-0.01	3.81	-4.67	0.03319	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	1.380750	0.04849	N	0.441971	T	0.49660	0.1570	L	0.57536	1.79	0.09310	N	1	B	0.18166	0.026	B	0.21151	0.033	T	0.23440	-1.0188	10	0.29301	T	0.29	.	0.7351	0.00964	0.413:0.1282:0.2301:0.2287	.	351	Q9C035	TRIM5_HUMAN	C	351	ENSP00000307031:S351C;ENSP00000369373:S351C	ENSP00000307031:S351C	S	-	2	0	TRIM5	5643045	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.552000	0.02176	-0.970000	0.03569	-0.150000	0.13652	TCT	TRIM5	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY	ENSG00000132256		0.463	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM5	HGNC	protein_coding	OTTHUMT00000143360.3	410	0.00	0	G	NM_033034		5686469	5686469	-1	no_errors	ENST00000305836	ensembl	human	known	69_37n	missense	107	44.62	87	SNP	0.000	C
GOLGA8M	653720	genome.wustl.edu	37	15	28986360	28986360	+	5'Flank	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr15:28986360C>T	ENST00000563213.1	-	0	0				RP11-578F21.6_ENST00000568033.1_lincRNA					golgin A8 family, member M																		CAACCACGTTCTTCCAGTACT	0.373																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0				CCDS61572.1	15q13.1	2014-03-21			ENSG00000188626	ENSG00000188626			44404	protein-coding gene	gene with protein product							Standard	NM_001282468		Approved			H3BSY2	OTTHUMG00000176338		15.37:g.28986360C>T	Exception_encountered			RNA	SNP	-	NULL	ENST00000563213.1	37	NULL		15																																																																																			WHAMMP2	-	-	ENSG00000248334		0.373	GOLGA8M-002	KNOWN	basic	processed_transcript	WHAMMP2	HGNC	protein_coding	OTTHUMT00000431778.1	194	0.00	0	C			28986360	28986360	+1	no_errors	ENST00000508764	ensembl	human	putative	69_37n	rna	243	21.36	66	SNP	0.999	T
WSCD1	23302	genome.wustl.edu	37	17	6021367	6021367	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr17:6021367G>A	ENST00000574946.1	+	8	1624	c.1234G>A	c.(1234-1236)Gag>Aag	p.E412K	WSCD1_ENST00000574232.1_Missense_Mutation_p.E412K|WSCD1_ENST00000573634.1_Missense_Mutation_p.E296K|WSCD1_ENST00000317744.5_Missense_Mutation_p.E412K|WSCD1_ENST00000539421.1_Missense_Mutation_p.E412K			Q658N2	WSCD1_HUMAN	WSC domain containing 1	412						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						CAAAACCCACGAGAGTGGCAG	0.537																																						dbGAP											0													88.0	85.0	86.0					17																	6021367		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1234G>A	17.37:g.6021367G>A	ENSP00000460825:p.Glu412Lys		A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	pfam_WSC_carb-bd,pfam_Sulfotransferase_dom,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.E412K	ENST00000574946.1	37	c.1234	CCDS32538.1	17	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908340	0.72868	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.33216	1.42;1.42	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.56630	0.1998	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.56992	-0.7887	10	0.51188	T	0.08	-35.6106	16.8089	0.85713	0.0:0.0:1.0:0.0	.	412	Q658N2	WSCD1_HUMAN	K	412	ENSP00000323087:E412K;ENSP00000446032:E412K	ENSP00000323087:E412K	E	+	1	0	WSCD1	5962091	1.000000	0.71417	0.997000	0.53966	0.079000	0.17450	9.464000	0.97655	2.583000	0.87209	0.655000	0.94253	GAG	WSCD1	-	NULL	ENSG00000179314		0.537	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSCD1	HGNC	protein_coding	OTTHUMT00000438965.4	80	0.00	0	G	NM_015253		6021367	6021367	+1	no_errors	ENST00000317744	ensembl	human	known	69_37n	missense	48	51.02	50	SNP	1.000	A
ZNF131	7690	genome.wustl.edu	37	5	43175143	43175143	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr5:43175143G>C	ENST00000399534.1	+	7	1824	c.1780G>C	c.(1780-1782)Gat>Cat	p.D594H	ZNF131_ENST00000509156.1_Missense_Mutation_p.D594H|ZNF131_ENST00000509634.1_Missense_Mutation_p.D560H|ZNF131_ENST00000505606.2_Missense_Mutation_p.D560H|ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000306938.4_Missense_Mutation_p.D560H			P52739	ZN131_HUMAN	zinc finger protein 131	594					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						AGATCACGAAGATGCTGAGGA	0.478																																						dbGAP											0													63.0	59.0	60.0					5																	43175143		1954	4149	6103	-	-	-	SO:0001583	missense	0			U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.1780G>C	5.37:g.43175143G>C	ENSP00000382450:p.Asp594His		B4DRL3|Q6PIF0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.D594H	ENST00000399534.1	37	c.1780		5	.	.	.	.	.	.	.	.	.	.	G	4.068	0.010368	0.07912	.	.	ENSG00000172262	ENST00000509156;ENST00000306938;ENST00000399534;ENST00000505606;ENST00000509634	T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87	5.48	4.57	0.56435	.	1.021630	0.07763	N	0.950414	T	0.63153	0.2487	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.48725	-0.9010	10	0.40728	T	0.16	-3.9327	12.3751	0.55275	0.0:0.167:0.7212:0.1118	.	594;560	P52739;P52739-2	ZN131_HUMAN;.	H	594;560;594;560;560	ENSP00000426504:D594H;ENSP00000305804:D560H;ENSP00000382450:D594H;ENSP00000423945:D560H;ENSP00000421246:D560H	ENSP00000305804:D560H	D	+	1	0	ZNF131	43210900	0.534000	0.26362	0.790000	0.31976	0.650000	0.38633	1.848000	0.39309	2.567000	0.86603	0.467000	0.42956	GAT	ZNF131	-	NULL	ENSG00000172262		0.478	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	ZNF131	HGNC	protein_coding	OTTHUMT00000367982.1	107	0.00	0	G	NM_003432		43175143	43175143	+1	no_errors	ENST00000399534	ensembl	human	known	69_37n	missense	84	44.74	68	SNP	0.003	C
ZNF268	10795	genome.wustl.edu	37	12	133779637	133779637	+	Silent	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr12:133779637C>T	ENST00000536435.2	+	6	1695	c.1365C>T	c.(1363-1365)ttC>ttT	p.F455F	ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000537565.1_Silent_p.F294F|ZNF268_ENST00000228289.5_Silent_p.F455F	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	455					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CCTTTACATTCAAGTCACAGC	0.403																																						dbGAP											0													60.0	51.0	54.0					12																	133779637		692	1590	2282	-	-	-	SO:0001819	synonymous_variant	0			X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.1365C>T	12.37:g.133779637C>T			Q8TDG8|Q96RH4|Q9BZJ9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F455	ENST00000536435.2	37	c.1365	CCDS45012.1	12																																																																																			ZNF268	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000090612		0.403	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2	158	0.00	0	C	NM_152943		133779637	133779637	+1	no_errors	ENST00000228289	ensembl	human	known	69_37n	silent	274	15.12	49	SNP	0.000	T
ZNF484	83744	genome.wustl.edu	37	9	95608938	95608938	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr9:95608938G>C	ENST00000375495.3	-	5	2279	c.2131C>G	c.(2131-2133)Cag>Gag	p.Q711E	ZNF484_ENST00000395505.2_Missense_Mutation_p.Q675E|ZNF484_ENST00000332591.6_Missense_Mutation_p.Q675E|ZNF484_ENST00000395506.3_Missense_Mutation_p.Q713E|ANKRD19P_ENST00000473204.1_RNA	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	711					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						TGAATTCTCTGATGCATAATT	0.388																																						dbGAP											0													55.0	59.0	58.0					9																	95608938		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.2131C>G	9.37:g.95608938G>C	ENSP00000364645:p.Gln711Glu		B1AL89|B4DRI2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q713E	ENST00000375495.3	37	c.2137	CCDS35066.1	9	.	.	.	.	.	.	.	.	.	.	.	10.61	1.398686	0.25205	.	.	ENSG00000127081	ENST00000395505;ENST00000395506;ENST00000375495;ENST00000332591	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	2.56	2.56	0.30785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08492	0.0211	N	0.11341	0.13	0.22926	N	0.998559	P;P	0.36733	0.567;0.567	B;B	0.34536	0.185;0.185	T	0.16897	-1.0387	9	0.54805	T	0.06	.	6.7803	0.23642	0.0:0.0:0.7215:0.2785	.	713;711	B4DRI2;Q5JVG2	.;ZN484_HUMAN	E	675;713;711;675	ENSP00000378881:Q675E;ENSP00000378882:Q713E;ENSP00000364645:Q711E;ENSP00000364646:Q675E	ENSP00000364646:Q675E	Q	-	1	0	ZNF484	94648759	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	0.063000	0.14410	1.729000	0.51567	0.551000	0.68910	CAG	ZNF484	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000127081		0.388	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF484	HGNC	protein_coding	OTTHUMT00000053111.2	87	0.00	0	G	XM_046861		95608938	95608938	-1	no_errors	ENST00000395506	ensembl	human	known	69_37n	missense	128	35.18	70	SNP	0.998	C
ZNF484	83744	genome.wustl.edu	37	9	95609116	95609116	+	Silent	SNP	G	G	C			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr9:95609116G>C	ENST00000375495.3	-	5	2101	c.1953C>G	c.(1951-1953)ctC>ctG	p.L651L	ZNF484_ENST00000395505.2_Silent_p.L615L|ZNF484_ENST00000332591.6_Silent_p.L615L|ZNF484_ENST00000395506.3_Silent_p.L653L|ANKRD19P_ENST00000473204.1_RNA	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	651					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						GGTGTGTAAAGAGATTTGATC	0.418																																						dbGAP											0													83.0	84.0	83.0					9																	95609116		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.1953C>G	9.37:g.95609116G>C			B1AL89|B4DRI2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L653	ENST00000375495.3	37	c.1959	CCDS35066.1	9																																																																																			ZNF484	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000127081		0.418	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF484	HGNC	protein_coding	OTTHUMT00000053111.2	111	0.00	0	G	XM_046861		95609116	95609116	-1	no_errors	ENST00000395506	ensembl	human	known	69_37n	silent	132	35.44	73	SNP	0.036	C
ZNF484	83744	genome.wustl.edu	37	9	95610467	95610467	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr9:95610467G>C	ENST00000375495.3	-	5	750	c.602C>G	c.(601-603)tCt>tGt	p.S201C	ZNF484_ENST00000395505.2_Missense_Mutation_p.S165C|ZNF484_ENST00000332591.6_Missense_Mutation_p.S165C|ZNF484_ENST00000395506.3_Missense_Mutation_p.S203C|ANKRD19P_ENST00000473204.1_RNA	NM_031486.2	NP_113674.1	Q5JVG2	ZN484_HUMAN	zinc finger protein 484	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|kidney(8)|large_intestine(10)|lung(10)|prostate(2)	33						AGTCTTATCAGAATTTTCTGT	0.363																																						dbGAP											0													89.0	94.0	92.0					9																	95610467		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091203	CCDS35066.1, CCDS35067.1, CCDS59136.1	9q22.32	2013-01-08			ENSG00000127081	ENSG00000127081		"""Zinc fingers, C2H2-type"", ""-"""	23385	protein-coding gene	gene with protein product							Standard	NM_001007101		Approved	BA526D8.4, FLJ33884	uc004asu.2	Q5JVG2	OTTHUMG00000020236	ENST00000375495.3:c.602C>G	9.37:g.95610467G>C	ENSP00000364645:p.Ser201Cys		B1AL89|B4DRI2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S203C	ENST00000375495.3	37	c.608	CCDS35066.1	9	.	.	.	.	.	.	.	.	.	.	.	2.260	-0.369403	0.05069	.	.	ENSG00000127081	ENST00000395505;ENST00000395506;ENST00000375495;ENST00000332591	T;T;T;T	0.07114	3.22;3.36;3.37;3.22	2.94	1.81	0.25067	.	.	.	.	.	T	0.05593	0.0147	L	0.31207	0.915	0.09310	N	1	P;P	0.45078	0.85;0.761	B;B	0.37780	0.258;0.258	T	0.34378	-0.9831	9	0.62326	D	0.03	.	4.4596	0.11659	0.6959:0.0:0.3041:0.0	.	203;201	B4DRI2;Q5JVG2	.;ZN484_HUMAN	C	165;203;201;165	ENSP00000378881:S165C;ENSP00000378882:S203C;ENSP00000364645:S201C;ENSP00000364646:S165C	ENSP00000364646:S165C	S	-	2	0	ZNF484	94650288	0.000000	0.05858	0.069000	0.20011	0.045000	0.14185	-1.534000	0.02212	0.541000	0.28827	-0.323000	0.08544	TCT	ZNF484	-	NULL	ENSG00000127081		0.363	ZNF484-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF484	HGNC	protein_coding	OTTHUMT00000053111.2	118	0.00	0	G	XM_046861		95610467	95610467	-1	no_errors	ENST00000395506	ensembl	human	known	69_37n	missense	160	39.93	107	SNP	0.039	C
ZNF521	25925	genome.wustl.edu	37	18	22806691	22806691	+	Silent	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr18:22806691C>T	ENST00000361524.3	-	4	1339	c.1191G>A	c.(1189-1191)tcG>tcA	p.S397S	ZNF521_ENST00000538137.2_Silent_p.S397S|ZNF521_ENST00000584787.1_Silent_p.S177S|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	397					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.S397S(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CTTGTTTACTCGAGGGACCAG	0.478			T	PAX5	ALL																																	dbGAP		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	1	Substitution - coding silent(1)	lung(1)											99.0	93.0	95.0					18																	22806691		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1191G>A	18.37:g.22806691C>T			A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S397	ENST00000361524.3	37	c.1191	CCDS32806.1	18																																																																																			ZNF521	-	NULL	ENSG00000198795		0.478	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	98	0.00	0	C	NM_015461		22806691	22806691	-1	no_errors	ENST00000361524	ensembl	human	known	69_37n	silent	137	19.88	34	SNP	0.002	T
ZNF737	100129842	genome.wustl.edu	37	19	20728657	20728657	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr19:20728657C>T	ENST00000427401.4	-	4	446	c.352G>A	c.(352-354)Gaa>Aaa	p.E118K		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TCTACACTTTCACAGCCCTTT	0.338																																						dbGAP											0													118.0	90.0	99.0					19																	20728657		692	1591	2283	-	-	-	SO:0001583	missense	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.352G>A	19.37:g.20728657C>T	ENSP00000395733:p.Glu118Lys		C9JHM3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E118K	ENST00000427401.4	37	c.352	CCDS54238.1	19	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.092564	0.00364	.	.	ENSG00000237440	ENST00000427401	T	0.06371	3.31	0.1	0.1	0.14510	.	.	.	.	.	T	0.02119	0.0066	N	0.03948	-0.315	0.21782	N	0.999546	B	0.02656	0.0	B	0.06405	0.002	T	0.46596	-0.9180	8	0.02654	T	1	.	.	.	.	.	118	C9JHM3	.	K	118	ENSP00000395733:E118K	ENSP00000395733:E118K	E	-	1	0	ZNF737	20520497	0.104000	0.21937	0.155000	0.22561	0.156000	0.22039	0.818000	0.27295	0.170000	0.19704	0.173000	0.16961	GAA	ZNF737	-	NULL	ENSG00000237440		0.338	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF737	HGNC	protein_coding	OTTHUMT00000447844.2	467	0.00	0	C	NM_145289		20728657	20728657	-1	no_errors	ENST00000427401	ensembl	human	known	69_37n	missense	498	17.28	104	SNP	0.716	T
ZSCAN12	9753	genome.wustl.edu	37	6	28358960	28358960	+	Silent	SNP	C	C	T			TCGA-BH-A0B5-01A-11D-A12Q-09	TCGA-BH-A0B5-11A-23W-A14O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	dfa0f8ea-ae94-4673-9751-f6cdad26022a	74428f88-9ecb-427b-83a6-faee8ee09c24	g.chr6:28358960C>T	ENST00000361028.1	-	4	1252	c.1107G>A	c.(1105-1107)caG>caA	p.Q369Q	ZSCAN12_ENST00000396827.3_Silent_p.Q369Q			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	369					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						GGCCTGCTTTCTGACTAAAGG	0.438																																						dbGAP											0													111.0	90.0	96.0					6																	28358960		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.1107G>A	6.37:g.28358960C>T			O43724	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q369	ENST00000361028.1	37	c.1107		6																																																																																			ZSCAN12	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000158691		0.438	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	329	0.00	0	C	NM_014724		28358960	28358960	-1	no_errors	ENST00000361028	ensembl	human	known	69_37n	silent	148	35.09	80	SNP	0.068	T
