#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AARS	16	genome.wustl.edu	37	16	70299461	70299461	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr16:70299461C>T	ENST00000261772.8	-	10	1470	c.1327G>A	c.(1327-1329)Gag>Aag	p.E443K	RN7SL407P_ENST00000583724.1_RNA|AARS_ENST00000564359.1_5'Flank	NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		TTCCTCTCCTCTTCAAAGCCA	0.517																																						dbGAP											0													184.0	189.0	188.0					16																	70299461		2198	4300	6498	-	-	-	SO:0001583	missense	0			D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.1327G>A	16.37:g.70299461C>T	ENSP00000261772:p.Glu443Lys			Missense_Mutation	SNP	pfam_Ala-tRNA-synth_IIc_N,pfam_tRNA_SAD,pfam_Pesterase_DHHA1,superfamily_Ala-tRNA-synth_IIc_anticod-bd,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,prints_Ala-tRNA-synth_IIc,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-synth_IIc	p.E443K	ENST00000261772.8	37	c.1327	CCDS32474.1	16	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566071	0.45694	.	.	ENSG00000090861	ENST00000261772	T	0.57436	0.4	5.85	5.85	0.93711	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.144062	0.64402	D	0.000009	T	0.37156	0.0993	N	0.13299	0.325	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.18263	0.021;0.013	T	0.19128	-1.0315	10	0.13853	T	0.58	-35.357	17.6586	0.88185	0.0:1.0:0.0:0.0	.	451;443	E7ETK8;P49588	.;SYAC_HUMAN	K	443	ENSP00000261772:E443K	ENSP00000261772:E443K	E	-	1	0	AARS	68856962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.841000	0.69409	2.764000	0.94973	0.643000	0.83706	GAG	AARS	-	pfam_Ala-tRNA-synth_IIc_N,superfamily_Ala-tRNA-synth_IIc_anticod-bd,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-synth_IIc	ENSG00000090861		0.517	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARS	HGNC	protein_coding	OTTHUMT00000435021.2	83	0.00	0	C	NM_001605		70299461	70299461	-1	no_errors	ENST00000261772	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	T
AARS	16	genome.wustl.edu	37	16	70299461	70299461	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr16:70299461C>T	ENST00000261772.8	-	10	1470	c.1327G>A	c.(1327-1329)Gag>Aag	p.E443K	RN7SL407P_ENST00000583724.1_RNA|AARS_ENST00000564359.1_5'Flank	NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		TTCCTCTCCTCTTCAAAGCCA	0.517																																						dbGAP											0													184.0	189.0	188.0					16																	70299461		2198	4300	6498	-	-	-	SO:0001583	missense	0			D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.1327G>A	16.37:g.70299461C>T	ENSP00000261772:p.Glu443Lys			Missense_Mutation	SNP	pfam_Ala-tRNA-synth_IIc_N,pfam_tRNA_SAD,pfam_Pesterase_DHHA1,superfamily_Ala-tRNA-synth_IIc_anticod-bd,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,prints_Ala-tRNA-synth_IIc,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-synth_IIc	p.E443K	ENST00000261772.8	37	c.1327	CCDS32474.1	16	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566071	0.45694	.	.	ENSG00000090861	ENST00000261772	T	0.57436	0.4	5.85	5.85	0.93711	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.144062	0.64402	D	0.000009	T	0.37156	0.0993	N	0.13299	0.325	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.18263	0.021;0.013	T	0.19128	-1.0315	10	0.13853	T	0.58	-35.357	17.6586	0.88185	0.0:1.0:0.0:0.0	.	451;443	E7ETK8;P49588	.;SYAC_HUMAN	K	443	ENSP00000261772:E443K	ENSP00000261772:E443K	E	-	1	0	AARS	68856962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.841000	0.69409	2.764000	0.94973	0.643000	0.83706	GAG	AARS	-	pfam_Ala-tRNA-synth_IIc_N,superfamily_Ala-tRNA-synth_IIc_anticod-bd,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-synth_IIc	ENSG00000090861		0.517	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARS	HGNC	protein_coding	OTTHUMT00000435021.2	65	0.00	0	C	NM_001605		70299461	70299461	-1	no_errors	ENST00000261772	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	T
ABCA7	10347	genome.wustl.edu	37	19	1043431	1043431	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr19:1043431T>A	ENST00000263094.6	+	9	1120	c.889T>A	c.(889-891)Ttt>Att	p.F297I	ABCA7_ENST00000433129.1_Missense_Mutation_p.F297I|ABCA7_ENST00000435683.2_Missense_Mutation_p.F159I	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	297					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAGCTACTCTTTGCACCAGA	0.647																																						dbGAP											0													76.0	86.0	83.0					19																	1043431		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.889T>A	19.37:g.1043431T>A	ENSP00000263094:p.Phe297Ile		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.F297I	ENST00000263094.6	37	c.889	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766193	0.69878	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.84660	-1.88;-1.88	4.15	4.15	0.48705	.	.	.	.	.	D	0.88321	0.6405	M	0.61703	1.905	0.34276	D	0.681599	D;P	0.54772	0.968;0.945	P;P	0.57009	0.811;0.644	D	0.91950	0.5570	9	0.87932	D	0	.	11.1204	0.48287	0.0:0.0:0.0:1.0	.	159;297	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	I	297	ENSP00000263094:F297I;ENSP00000414062:F297I	ENSP00000263094:F297I	F	+	1	0	ABCA7	994431	1.000000	0.71417	0.433000	0.26760	0.320000	0.28249	5.615000	0.67702	1.530000	0.49136	0.260000	0.18958	TTT	ABCA7	-	NULL	ENSG00000064687		0.647	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	14	0.00	0	T	NM_019112		1043431	1043431	+1	no_errors	ENST00000263094	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.983	A
ABCA7	10347	genome.wustl.edu	37	19	1043431	1043431	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr19:1043431T>A	ENST00000263094.6	+	9	1120	c.889T>A	c.(889-891)Ttt>Att	p.F297I	ABCA7_ENST00000433129.1_Missense_Mutation_p.F297I|ABCA7_ENST00000435683.2_Missense_Mutation_p.F159I	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	297					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAGCTACTCTTTGCACCAGA	0.647																																						dbGAP											0													76.0	86.0	83.0					19																	1043431		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.889T>A	19.37:g.1043431T>A	ENSP00000263094:p.Phe297Ile		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.F297I	ENST00000263094.6	37	c.889	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766193	0.69878	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.84660	-1.88;-1.88	4.15	4.15	0.48705	.	.	.	.	.	D	0.88321	0.6405	M	0.61703	1.905	0.34276	D	0.681599	D;P	0.54772	0.968;0.945	P;P	0.57009	0.811;0.644	D	0.91950	0.5570	9	0.87932	D	0	.	11.1204	0.48287	0.0:0.0:0.0:1.0	.	159;297	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	I	297	ENSP00000263094:F297I;ENSP00000414062:F297I	ENSP00000263094:F297I	F	+	1	0	ABCA7	994431	1.000000	0.71417	0.433000	0.26760	0.320000	0.28249	5.615000	0.67702	1.530000	0.49136	0.260000	0.18958	TTT	ABCA7	-	NULL	ENSG00000064687		0.647	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	10	0.00	0	T	NM_019112		1043431	1043431	+1	no_errors	ENST00000263094	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.983	A
ADAMTS13	11093	genome.wustl.edu	37	9	136323154	136323154	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr9:136323154A>G	ENST00000371929.3	+	28	4459	c.4015A>G	c.(4015-4017)Atc>Gtc	p.I1339V	CACFD1_ENST00000540581.1_5'Flank|CACFD1_ENST00000316948.4_5'Flank|CACFD1_ENST00000291722.7_5'Flank|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000371910.1_Missense_Mutation_p.I135V|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.I1252V|CACFD1_ENST00000542192.1_5'Flank|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.I1283V|ADAMTS13_ENST00000485925.1_Intron	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	1339	CUB 2.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		ACGGATTGCCATCCATGCCCT	0.617																																						dbGAP											0													54.0	52.0	52.0					9																	136323154		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.4015A>G	9.37:g.136323154A>G	ENSP00000360997:p.Ile1339Val		Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,superfamily_CUB,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.I1339V	ENST00000371929.3	37	c.4015	CCDS6970.1	9	.	.	.	.	.	.	.	.	.	.	A	17.18	3.323472	0.60634	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000371910	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.0	3.86	0.44501	CUB (1);	.	.	.	.	T	0.50837	0.1639	M	0.74881	2.28	0.80722	D	1	B;P;P	0.46784	0.104;0.884;0.884	B;P;P	0.45610	0.05;0.487;0.487	T	0.53373	-0.8448	9	0.87932	D	0	.	8.1572	0.31176	0.9068:0.0:0.0932:0.0	.	1339;1252;1283	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	V	1339;1283;1252;135	ENSP00000360997:I1339V;ENSP00000347927:I1283V;ENSP00000348997:I1252V;ENSP00000360978:I135V	ENSP00000347927:I1283V	I	+	1	0	ADAMTS13	135312975	1.000000	0.71417	0.997000	0.53966	0.938000	0.57974	4.473000	0.60196	0.752000	0.32923	0.533000	0.62120	ATC	ADAMTS13	-	superfamily_CUB	ENSG00000160323		0.617	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAMTS13	HGNC	protein_coding	OTTHUMT00000054920.1	8	0.00	0	A	NM_139025		136323154	136323154	+1	no_errors	ENST00000371929	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	G
ADSL	158	genome.wustl.edu	37	22	40760339	40760339	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr22:40760339G>C	ENST00000216194.7	+	11	1217	c.1161G>C	c.(1159-1161)atG>atC	p.M387I	ADSL_ENST00000342312.6_Missense_Mutation_p.M387I|ADSL_ENST00000454266.2_Missense_Mutation_p.M401I	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	387					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						ACATCATCATGGCCATGGTCA	0.507																																					Colon(4;65 130 1097 1516)	dbGAP											0													95.0	82.0	86.0					22																	40760339		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.1161G>C	22.37:g.40760339G>C	ENSP00000216194:p.Met387Ile		B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	pfam_Lyase1_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase,prints_D_crystallin,tigrfam_Pur_lyase	p.M401I	ENST00000216194.7	37	c.1203	CCDS14001.1	22	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210631	0.79240	.	.	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028;ENST00000342312	D;D;D	0.95656	-3.77;-3.77;-3.59	5.47	5.47	0.80525	Adenylosuccinate lyase C-terminal metazoa/fungi (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.97179	0.9078	H	0.96333	3.805	0.80722	D	1	B;B;B;B	0.30889	0.299;0.006;0.036;0.036	B;B;B;B	0.33121	0.158;0.02;0.026;0.026	D	0.97014	0.9738	10	0.66056	D	0.02	-32.6794	19.3831	0.94545	0.0:0.0:1.0:0.0	.	401;387;387;387	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	I	387;401;207;387	ENSP00000216194:M387I;ENSP00000390107:M401I;ENSP00000341429:M387I	ENSP00000216194:M387I	M	+	3	0	ADSL	39090285	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.015000	0.93640	2.569000	0.86673	0.650000	0.86243	ATG	ADSL	-	pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,tigrfam_Pur_lyase	ENSG00000239900		0.507	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	HGNC	protein_coding	OTTHUMT00000321386.1	32	0.00	0	G	NM_000026		40760339	40760339	+1	no_errors	ENST00000454266	ensembl	human	known	69_37n	missense	34	33.33	17	SNP	1.000	C
ADSL	158	genome.wustl.edu	37	22	40760339	40760339	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr22:40760339G>C	ENST00000216194.7	+	11	1217	c.1161G>C	c.(1159-1161)atG>atC	p.M387I	ADSL_ENST00000342312.6_Missense_Mutation_p.M387I|ADSL_ENST00000454266.2_Missense_Mutation_p.M401I	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	387					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						ACATCATCATGGCCATGGTCA	0.507																																					Colon(4;65 130 1097 1516)	dbGAP											0													95.0	82.0	86.0					22																	40760339		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.1161G>C	22.37:g.40760339G>C	ENSP00000216194:p.Met387Ile		B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	pfam_Lyase1_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase,prints_D_crystallin,tigrfam_Pur_lyase	p.M401I	ENST00000216194.7	37	c.1203	CCDS14001.1	22	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210631	0.79240	.	.	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028;ENST00000342312	D;D;D	0.95656	-3.77;-3.77;-3.59	5.47	5.47	0.80525	Adenylosuccinate lyase C-terminal metazoa/fungi (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.97179	0.9078	H	0.96333	3.805	0.80722	D	1	B;B;B;B	0.30889	0.299;0.006;0.036;0.036	B;B;B;B	0.33121	0.158;0.02;0.026;0.026	D	0.97014	0.9738	10	0.66056	D	0.02	-32.6794	19.3831	0.94545	0.0:0.0:1.0:0.0	.	401;387;387;387	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	I	387;401;207;387	ENSP00000216194:M387I;ENSP00000390107:M401I;ENSP00000341429:M387I	ENSP00000216194:M387I	M	+	3	0	ADSL	39090285	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.015000	0.93640	2.569000	0.86673	0.650000	0.86243	ATG	ADSL	-	pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,tigrfam_Pur_lyase	ENSG00000239900		0.507	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	HGNC	protein_coding	OTTHUMT00000321386.1	48	0.00	0	G	NM_000026		40760339	40760339	+1	no_errors	ENST00000454266	ensembl	human	known	69_37n	missense	34	33.33	17	SNP	1.000	C
ANKHD1	54882	genome.wustl.edu	37	5	139889608	139889608	+	Missense_Mutation	SNP	G	G	T	rs202048064		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr5:139889608G>T	ENST00000360839.2	+	22	4100	c.3946G>T	c.(3946-3948)Gcc>Tcc	p.A1316S	ANKHD1_ENST00000297183.6_Missense_Mutation_p.A1316S|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.A1316S	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1316						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTACAGGGGAGCCCACATTGA	0.403																																						dbGAP											0													123.0	117.0	119.0					5																	139889608		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3946G>T	5.37:g.139889608G>T	ENSP00000354085:p.Ala1316Ser		A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.A1316S	ENST00000360839.2	37	c.3946	CCDS4225.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.325501|4.325501	0.81580|0.81580	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000532219|ENST00000246149	T;T;T;T;T|.	0.25414|.	1.8;1.8;1.8;1.8;1.8|.	5.63|5.63	5.63|5.63	0.86233|0.86233	Ankyrin repeat-containing domain (4);|.	0.060250|.	0.64402|.	D|.	0.000003|.	T|T	0.64011|0.64011	0.2560|0.2560	L|L	0.50919|0.50919	1.6|1.6	0.80722|0.80722	D|D	1|1	B;P;B;B;B|.	0.39903|.	0.256;0.694;0.153;0.362;0.362|.	B;P;B;B;B|.	0.53593|.	0.304;0.73;0.158;0.179;0.106|.	T|T	0.59408|0.59408	-0.7460|-0.7460	10|5	0.56958|.	D|.	0.05|.	.|.	14.8462|14.8462	0.70261|0.70261	0.0:0.0:0.8562:0.1438|0.0:0.0:0.8562:0.1438	.|.	527;1316;1335;1316;1316|.	E7ET58;Q8IWZ3-4;E9PDP5;Q8IWZ2;Q8IWZ3|.	.;.;.;.;ANKH1_HUMAN|.	S|D	1316;1349;1316;1316;850;527;1335;469;1316|541	ENSP00000354085:A1316S;ENSP00000297183:A1316S;ENSP00000394489:A1335S;ENSP00000405602:A469S;ENSP00000432016:A1316S|.	ENSP00000432016:A1316S|.	A|E	+|+	1|3	0|2	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139869792|139869792	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.679000|0.679000	0.39708|0.39708	7.871000|7.871000	0.87180|0.87180	2.814000|2.814000	0.96858|0.96858	0.591000|0.591000	0.81541|0.81541	GCC|GAG	ANKHD1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000131503		0.403	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1	HGNC	protein_coding	OTTHUMT00000251672.1	169	0.00	0	G	NM_017747		139889608	139889608	+1	no_errors	ENST00000297183	ensembl	human	known	69_37n	missense	163	26.24	58	SNP	1.000	T
ANKHD1	54882	genome.wustl.edu	37	5	139889608	139889608	+	Missense_Mutation	SNP	G	G	T	rs202048064		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr5:139889608G>T	ENST00000360839.2	+	22	4100	c.3946G>T	c.(3946-3948)Gcc>Tcc	p.A1316S	ANKHD1_ENST00000297183.6_Missense_Mutation_p.A1316S|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.A1316S	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1316						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTACAGGGGAGCCCACATTGA	0.403																																						dbGAP											0													123.0	117.0	119.0					5																	139889608		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3946G>T	5.37:g.139889608G>T	ENSP00000354085:p.Ala1316Ser		A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.A1316S	ENST00000360839.2	37	c.3946	CCDS4225.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.325501|4.325501	0.81580|0.81580	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000532219|ENST00000246149	T;T;T;T;T|.	0.25414|.	1.8;1.8;1.8;1.8;1.8|.	5.63|5.63	5.63|5.63	0.86233|0.86233	Ankyrin repeat-containing domain (4);|.	0.060250|.	0.64402|.	D|.	0.000003|.	T|T	0.64011|0.64011	0.2560|0.2560	L|L	0.50919|0.50919	1.6|1.6	0.80722|0.80722	D|D	1|1	B;P;B;B;B|.	0.39903|.	0.256;0.694;0.153;0.362;0.362|.	B;P;B;B;B|.	0.53593|.	0.304;0.73;0.158;0.179;0.106|.	T|T	0.59408|0.59408	-0.7460|-0.7460	10|5	0.56958|.	D|.	0.05|.	.|.	14.8462|14.8462	0.70261|0.70261	0.0:0.0:0.8562:0.1438|0.0:0.0:0.8562:0.1438	.|.	527;1316;1335;1316;1316|.	E7ET58;Q8IWZ3-4;E9PDP5;Q8IWZ2;Q8IWZ3|.	.;.;.;.;ANKH1_HUMAN|.	S|D	1316;1349;1316;1316;850;527;1335;469;1316|541	ENSP00000354085:A1316S;ENSP00000297183:A1316S;ENSP00000394489:A1335S;ENSP00000405602:A469S;ENSP00000432016:A1316S|.	ENSP00000432016:A1316S|.	A|E	+|+	1|3	0|2	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139869792|139869792	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.679000|0.679000	0.39708|0.39708	7.871000|7.871000	0.87180|0.87180	2.814000|2.814000	0.96858|0.96858	0.591000|0.591000	0.81541|0.81541	GCC|GAG	ANKHD1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000131503		0.403	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1	HGNC	protein_coding	OTTHUMT00000251672.1	186	0.00	0	G	NM_017747		139889608	139889608	+1	no_errors	ENST00000297183	ensembl	human	known	69_37n	missense	163	26.24	58	SNP	1.000	T
ANKRD11	29123	genome.wustl.edu	37	16	89351746	89351747	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr16:89351746_89351747insT	ENST00000301030.4	-	9	1663_1664	c.1203_1204insA	c.(1201-1206)aaagcgfs	p.A402fs	ANKRD11_ENST00000378330.2_Frame_Shift_Ins_p.A402fs	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	402					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CGATGGGACGCTTTCTTTGGTG	0.45																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1204dupA	16.37:g.89351749_89351749dupT	ENSP00000301030:p.Ala402fs		Q6NTG1|Q6QMF8	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A401fs	ENST00000301030.4	37	c.1204_1203	CCDS32513.1	16																																																																																			ANKRD11	-	NULL	ENSG00000167522		0.450	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	69	0.00	0	-	NM_013275		89351746	89351747	-1	no_errors	ENST00000301030	ensembl	human	known	69_37n	frame_shift_ins	35	16.67	7	INS	1.000:1.000	T
ANKRD11	29123	genome.wustl.edu	37	16	89351746	89351747	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr16:89351746_89351747insT	ENST00000301030.4	-	9	1663_1664	c.1203_1204insA	c.(1201-1206)aaagcgfs	p.A402fs	ANKRD11_ENST00000378330.2_Frame_Shift_Ins_p.A402fs	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	402					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CGATGGGACGCTTTCTTTGGTG	0.45																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1204dupA	16.37:g.89351749_89351749dupT	ENSP00000301030:p.Ala402fs		Q6NTG1|Q6QMF8	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A401fs	ENST00000301030.4	37	c.1204_1203	CCDS32513.1	16																																																																																			ANKRD11	-	NULL	ENSG00000167522		0.450	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	62	0.00	0	-	NM_013275		89351746	89351747	-1	no_errors	ENST00000301030	ensembl	human	known	69_37n	frame_shift_ins	35	16.67	7	INS	1.000:1.000	T
ANKRD12	23253	genome.wustl.edu	37	18	9255963	9255964	+	Frame_Shift_Del	DEL	AG	AG	-	rs202164347		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr18:9255963_9255964delAG	ENST00000262126.4	+	9	2938_2939	c.2698_2699delAG	c.(2698-2700)agafs	p.R900fs	ANKRD12_ENST00000383440.2_Frame_Shift_Del_p.R877fs|ANKRD12_ENST00000400020.3_Frame_Shift_Del_p.R877fs	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	900						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AACTGACGACAGAGAGAAAAGT	0.356																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2698_2699delAG	18.37:g.9255967_9255968delAG	ENSP00000262126:p.Arg900fs		O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S903fs	ENST00000262126.4	37	c.2698_2699	CCDS11843.1	18																																																																																			ANKRD12	-	NULL	ENSG00000101745		0.356	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	87	0.00	0	AG	NM_015208		9255963	9255964	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	frame_shift_del	121	21.43	33	DEL	0.991:0.998	-
ANKRD12	23253	genome.wustl.edu	37	18	9255963	9255964	+	Frame_Shift_Del	DEL	AG	AG	-	rs202164347		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr18:9255963_9255964delAG	ENST00000262126.4	+	9	2938_2939	c.2698_2699delAG	c.(2698-2700)agafs	p.R900fs	ANKRD12_ENST00000383440.2_Frame_Shift_Del_p.R877fs|ANKRD12_ENST00000400020.3_Frame_Shift_Del_p.R877fs	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	900						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AACTGACGACAGAGAGAAAAGT	0.356																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2698_2699delAG	18.37:g.9255967_9255968delAG	ENSP00000262126:p.Arg900fs		O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S903fs	ENST00000262126.4	37	c.2698_2699	CCDS11843.1	18																																																																																			ANKRD12	-	NULL	ENSG00000101745		0.356	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	193	0.00	0	AG	NM_015208		9255963	9255964	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	frame_shift_del	121	21.43	33	DEL	0.991:0.998	-
AP3B1	8546	genome.wustl.edu	37	5	77423976	77423976	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr5:77423976G>A	ENST00000255194.6	-	17	2021	c.1846C>T	c.(1846-1848)Cat>Tat	p.H616Y	AP3B1_ENST00000519295.1_Missense_Mutation_p.H567Y	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	616					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		AGCTGGAAATGATCTCTATCT	0.373									Hermansky-Pudlak syndrome																													dbGAP											0													41.0	41.0	41.0					5																	77423976		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.1846C>T	5.37:g.77423976G>A	ENSP00000255194:p.His616Tyr		E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_bsu	p.H616Y	ENST00000255194.6	37	c.1846	CCDS4041.1	5	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833659	0.50951	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.12255	2.7;2.7	5.87	4.99	0.66335	Armadillo-like helical (1);Armadillo-type fold (1);	0.100025	0.64402	D	0.000001	T	0.26085	0.0636	M	0.79805	2.47	0.40200	D	0.977504	P	0.49783	0.928	P	0.45232	0.474	T	0.18903	-1.0322	10	0.54805	T	0.06	-10.3891	16.4264	0.83816	0.0:0.0:0.8674:0.1326	.	616	O00203	AP3B1_HUMAN	Y	616;567;616;520	ENSP00000255194:H616Y;ENSP00000430597:H567Y	ENSP00000255194:H616Y	H	-	1	0	AP3B1	77459732	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.841000	0.99482	1.484000	0.48361	-0.187000	0.12897	CAT	AP3B1	-	superfamily_ARM-type_fold,pirsf_AP3_complex_bsu	ENSG00000132842		0.373	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	212	0.00	0	G			77423976	77423976	-1	no_errors	ENST00000255194	ensembl	human	known	69_37n	missense	135	24.58	44	SNP	1.000	A
AP3B1	8546	genome.wustl.edu	37	5	77423976	77423976	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr5:77423976G>A	ENST00000255194.6	-	17	2021	c.1846C>T	c.(1846-1848)Cat>Tat	p.H616Y	AP3B1_ENST00000519295.1_Missense_Mutation_p.H567Y	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	616					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		AGCTGGAAATGATCTCTATCT	0.373									Hermansky-Pudlak syndrome																													dbGAP											0													41.0	41.0	41.0					5																	77423976		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.1846C>T	5.37:g.77423976G>A	ENSP00000255194:p.His616Tyr		E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_bsu	p.H616Y	ENST00000255194.6	37	c.1846	CCDS4041.1	5	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833659	0.50951	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.12255	2.7;2.7	5.87	4.99	0.66335	Armadillo-like helical (1);Armadillo-type fold (1);	0.100025	0.64402	D	0.000001	T	0.26085	0.0636	M	0.79805	2.47	0.40200	D	0.977504	P	0.49783	0.928	P	0.45232	0.474	T	0.18903	-1.0322	10	0.54805	T	0.06	-10.3891	16.4264	0.83816	0.0:0.0:0.8674:0.1326	.	616	O00203	AP3B1_HUMAN	Y	616;567;616;520	ENSP00000255194:H616Y;ENSP00000430597:H567Y	ENSP00000255194:H616Y	H	-	1	0	AP3B1	77459732	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.841000	0.99482	1.484000	0.48361	-0.187000	0.12897	CAT	AP3B1	-	superfamily_ARM-type_fold,pirsf_AP3_complex_bsu	ENSG00000132842		0.373	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	79	0.00	0	G			77423976	77423976	-1	no_errors	ENST00000255194	ensembl	human	known	69_37n	missense	135	24.58	44	SNP	1.000	A
ATAD2B	54454	genome.wustl.edu	37	2	24011446	24011446	+	Silent	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:24011446T>C	ENST00000238789.5	-	20	3055	c.2712A>G	c.(2710-2712)agA>agG	p.R904R	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	904						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAAAAATTTTCTTCTGTCTT	0.358																																						dbGAP											0													126.0	114.0	118.0					2																	24011446		1822	4068	5890	-	-	-	SO:0001819	synonymous_variant	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2712A>G	2.37:g.24011446T>C			B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E185G	ENST00000238789.5	37	c.554	CCDS46227.1	2	.	.	.	.	.	.	.	.	.	.	T	9.712	1.157296	0.21454	.	.	ENSG00000119778	ENST00000381024	.	.	.	5.7	1.98	0.26296	.	.	.	.	.	T	0.41259	0.1151	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35375	-0.9791	4	.	.	.	.	0.5102	0.00594	0.175:0.2742:0.1822:0.3686	.	.	.	.	G	185	.	.	E	-	2	0	ATAD2B	23864950	0.997000	0.39634	1.000000	0.80357	0.988000	0.76386	0.244000	0.18124	1.104000	0.41587	-0.256000	0.11100	GAA	ATAD2B	-	NULL	ENSG00000119778		0.358	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	176	0.00	0	T	NM_017552		24011446	24011446	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000381024	ensembl	human	novel	69_37n	missense	149	28.57	60	SNP	1.000	C
ATAD2B	54454	genome.wustl.edu	37	2	24011446	24011446	+	Silent	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:24011446T>C	ENST00000238789.5	-	20	3055	c.2712A>G	c.(2710-2712)agA>agG	p.R904R	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	904						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAAAAATTTTCTTCTGTCTT	0.358																																						dbGAP											0													126.0	114.0	118.0					2																	24011446		1822	4068	5890	-	-	-	SO:0001819	synonymous_variant	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2712A>G	2.37:g.24011446T>C			B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E185G	ENST00000238789.5	37	c.554	CCDS46227.1	2	.	.	.	.	.	.	.	.	.	.	T	9.712	1.157296	0.21454	.	.	ENSG00000119778	ENST00000381024	.	.	.	5.7	1.98	0.26296	.	.	.	.	.	T	0.41259	0.1151	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35375	-0.9791	4	.	.	.	.	0.5102	0.00594	0.175:0.2742:0.1822:0.3686	.	.	.	.	G	185	.	.	E	-	2	0	ATAD2B	23864950	0.997000	0.39634	1.000000	0.80357	0.988000	0.76386	0.244000	0.18124	1.104000	0.41587	-0.256000	0.11100	GAA	ATAD2B	-	NULL	ENSG00000119778		0.358	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	146	0.00	0	T	NM_017552		24011446	24011446	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000381024	ensembl	human	novel	69_37n	missense	149	28.57	60	SNP	1.000	C
BSCL2	26580	genome.wustl.edu	37	11	62458135	62458135	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr11:62458135C>T	ENST00000403550.1	-	10	1414	c.991G>A	c.(991-993)Gat>Aat	p.D331N	BSCL2_ENST00000433053.1_Missense_Mutation_p.D395N|BSCL2_ENST00000407022.3_Missense_Mutation_p.D331N|BSCL2_ENST00000405837.1_Missense_Mutation_p.D397N|BSCL2_ENST00000278893.7_Silent_p.Q283Q|HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR|LRRN4CL_ENST00000317449.4_5'Flank|BSCL2_ENST00000421906.1_Missense_Mutation_p.D331N|BSCL2_ENST00000360796.5_Missense_Mutation_p.D395N			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)	331					cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						GGCTGCTGATCTGGTTTCTCC	0.602																																						dbGAP											0													80.0	76.0	77.0					11																	62458135		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000403550.1:c.991G>A	11.37:g.62458135C>T	ENSP00000385561:p.Asp331Asn		G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Missense_Mutation	SNP	pfam_Adipose-reg_protein_Seipin	p.D395N	ENST00000403550.1	37	c.1183	CCDS8031.1	11	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111816	0.56398	.	.	ENSG00000168000	ENST00000449636;ENST00000405837;ENST00000433053;ENST00000360796;ENST00000403550;ENST00000407022;ENST00000421906	D;D;D;D;D;D	0.89810	-2.57;-2.51;-2.51;-2.47;-2.47;-2.47	4.87	4.87	0.63330	.	1.156280	0.06822	U	0.792422	D	0.87006	0.6070	.	.	.	0.09310	N	1	B;P;B	0.38504	0.361;0.634;0.361	B;B;B	0.39465	0.102;0.3;0.102	T	0.77869	-0.2427	9	0.49607	T	0.09	-12.8484	13.3707	0.60711	0.0:1.0:0.0:0.0	.	331;395;331	Q53EN3;G3XAE4;Q96G97	.;.;BSCL2_HUMAN	N	83;397;395;395;331;331;331	ENSP00000385332:D397N;ENSP00000414002:D395N;ENSP00000354032:D395N;ENSP00000385561:D331N;ENSP00000384080:D331N;ENSP00000413209:D331N	ENSP00000354032:D395N	D	-	1	0	BSCL2	62214711	0.052000	0.20516	0.038000	0.18304	0.989000	0.77384	2.015000	0.40961	2.513000	0.84729	0.561000	0.74099	GAT	BSCL2	-	NULL	ENSG00000168000		0.602	BSCL2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	BSCL2	HGNC	protein_coding	OTTHUMT00000319185.1	71	0.00	0	C	NM_032667		62458135	62458135	-1	no_errors	ENST00000360796	ensembl	human	known	69_37n	missense	81	21.36	22	SNP	0.019	T
BSCL2	26580	genome.wustl.edu	37	11	62458334	62458334	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr11:62458334C>T	ENST00000403550.1	-	9	1309	c.886G>A	c.(886-888)Gaa>Aaa	p.E296K	BSCL2_ENST00000433053.1_Missense_Mutation_p.E360K|BSCL2_ENST00000407022.3_Missense_Mutation_p.E296K|BSCL2_ENST00000405837.1_Missense_Mutation_p.E362K|BSCL2_ENST00000278893.7_Silent_p.L248L|HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR|LRRN4CL_ENST00000317449.4_5'Flank|BSCL2_ENST00000421906.1_Missense_Mutation_p.E296K|BSCL2_ENST00000360796.5_Missense_Mutation_p.E360K			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)	296					cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						TCCTGGCCTTCAGGCCCTGCA	0.587																																						dbGAP											0													62.0	56.0	58.0					11																	62458334		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000403550.1:c.886G>A	11.37:g.62458334C>T	ENSP00000385561:p.Glu296Lys		G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Missense_Mutation	SNP	pfam_Adipose-reg_protein_Seipin	p.E360K	ENST00000403550.1	37	c.1078	CCDS8031.1	11	.	.	.	.	.	.	.	.	.	.	C	10.92	1.485735	0.26686	.	.	ENSG00000168000	ENST00000449636;ENST00000405837;ENST00000433053;ENST00000360796;ENST00000403550;ENST00000407022;ENST00000421906	D;D;D;D;D;D	0.88586	-2.39;-2.4;-2.4;-2.39;-2.39;-2.39	5.16	2.07	0.26955	.	2.481950	0.02865	U	0.130752	T	0.76314	0.3970	.	.	.	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.66122	-0.6002	9	0.08381	T	0.77	-16.076	4.7682	0.13142	0.0:0.3287:0.3747:0.2965	.	296;360;296	Q53EN3;G3XAE4;Q96G97	.;.;BSCL2_HUMAN	K	45;362;360;360;296;296;296	ENSP00000385332:E362K;ENSP00000414002:E360K;ENSP00000354032:E360K;ENSP00000385561:E296K;ENSP00000384080:E296K;ENSP00000413209:E296K	ENSP00000354032:E360K	E	-	1	0	BSCL2	62214910	0.052000	0.20516	0.509000	0.27700	0.706000	0.40770	0.312000	0.19397	0.779000	0.33543	0.561000	0.74099	GAA	BSCL2	-	NULL	ENSG00000168000		0.587	BSCL2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	BSCL2	HGNC	protein_coding	OTTHUMT00000319185.1	108	0.00	0	C	NM_032667		62458334	62458334	-1	no_errors	ENST00000360796	ensembl	human	known	69_37n	missense	57	24.00	18	SNP	0.308	T
C6orf136	221545	genome.wustl.edu	37	6	30617375	30617375	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr6:30617375G>A	ENST00000376473.5	+	2	272	c.113G>A	c.(112-114)tGg>tAg	p.W38*	C6orf136_ENST00000293604.6_Nonsense_Mutation_p.W219*|C6orf136_ENST00000376471.4_Intron|C6orf136_ENST00000528347.2_5'Flank|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000493705.1_3'UTR	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	38						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						CCACCCCTTTGGCCCCACTCC	0.547																																						dbGAP											0													217.0	220.0	219.0					6																	30617375		2009	4159	6168	-	-	-	SO:0001587	stop_gained	0			BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.113G>A	6.37:g.30617375G>A	ENSP00000365656:p.Trp38*		A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Nonsense_Mutation	SNP	pfam_DUF2358	p.W219*	ENST00000376473.5	37	c.656	CCDS43443.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.888320	0.97068	.	.	ENSG00000204564	ENST00000293604;ENST00000376473;ENST00000446773	.	.	.	6.03	4.23	0.50019	.	0.185727	0.38272	N	0.001748	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.9031	7.3598	0.26739	0.1384:0.1454:0.7162:0.0	.	.	.	.	X	219;38;156	.	ENSP00000293604:W219X	W	+	2	0	C6orf136	30725354	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.367000	0.44213	1.549000	0.49425	0.557000	0.71058	TGG	C6orf136	-	NULL	ENSG00000204564		0.547	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf136	HGNC	protein_coding	OTTHUMT00000076457.4	179	0.00	0	G	NM_145029		30617375	30617375	+1	no_errors	ENST00000293604	ensembl	human	known	69_37n	nonsense	173	17.22	36	SNP	0.993	A
C6orf136	221545	genome.wustl.edu	37	6	30617375	30617375	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr6:30617375G>A	ENST00000376473.5	+	2	272	c.113G>A	c.(112-114)tGg>tAg	p.W38*	C6orf136_ENST00000293604.6_Nonsense_Mutation_p.W219*|C6orf136_ENST00000376471.4_Intron|C6orf136_ENST00000528347.2_5'Flank|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000493705.1_3'UTR	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136	38						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						CCACCCCTTTGGCCCCACTCC	0.547																																						dbGAP											0													217.0	220.0	219.0					6																	30617375		2009	4159	6168	-	-	-	SO:0001587	stop_gained	0			BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.113G>A	6.37:g.30617375G>A	ENSP00000365656:p.Trp38*		A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Nonsense_Mutation	SNP	pfam_DUF2358	p.W219*	ENST00000376473.5	37	c.656	CCDS43443.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.888320	0.97068	.	.	ENSG00000204564	ENST00000293604;ENST00000376473;ENST00000446773	.	.	.	6.03	4.23	0.50019	.	0.185727	0.38272	N	0.001748	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.9031	7.3598	0.26739	0.1384:0.1454:0.7162:0.0	.	.	.	.	X	219;38;156	.	ENSP00000293604:W219X	W	+	2	0	C6orf136	30725354	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.367000	0.44213	1.549000	0.49425	0.557000	0.71058	TGG	C6orf136	-	NULL	ENSG00000204564		0.547	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf136	HGNC	protein_coding	OTTHUMT00000076457.4	311	0.00	0	G	NM_145029		30617375	30617375	+1	no_errors	ENST00000293604	ensembl	human	known	69_37n	nonsense	173	17.22	36	SNP	0.993	A
CALHM2	51063	genome.wustl.edu	37	10	105209118	105209118	+	Intron	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr10:105209118G>A	ENST00000260743.5	-	3	1079				CALHM2_ENST00000494180.1_5'Flank|CALHM2_ENST00000393235.1_Missense_Mutation_p.S194F|CALHM2_ENST00000369788.3_Intron|RP11-225H22.7_ENST00000608063.1_RNA	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2						ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						TAGGGAAGAGGAGCTTCCCTT	0.597																																						dbGAP											0													62.0	65.0	64.0					10																	105209118		2184	4278	6462	-	-	-	SO:0001627	intron_variant	0			BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.555+25C>T	10.37:g.105209118G>A			D3DR94|O95893|Q6ZUV9	Missense_Mutation	SNP	NULL	p.S194F	ENST00000260743.5	37	c.581	CCDS7549.1	10	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149393	0.37923	.	.	ENSG00000138172	ENST00000393235	T	0.26518	1.73	3.73	0.766	0.18476	.	.	.	.	.	T	0.09113	0.0225	.	.	.	0.09310	N	1	B	0.32467	0.372	B	0.28305	0.088	T	0.28964	-1.0027	8	0.09084	T	0.74	.	3.3914	0.07290	0.0987:0.1704:0.5552:0.1758	.	194	Q9HA72-2	.	F	194	ENSP00000376927:S194F	ENSP00000376927:S194F	S	-	2	0	CALHM2	105199108	0.000000	0.05858	0.000000	0.03702	0.221000	0.24807	-0.331000	0.07914	0.160000	0.19432	0.561000	0.74099	TCC	CALHM2	-	NULL	ENSG00000138172		0.597	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM2	HGNC	protein_coding	OTTHUMT00000050159.1	60	0.00	0	G	NM_015916		105209118	105209118	-1	no_errors	ENST00000393235	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	0.000	A
CALHM2	51063	genome.wustl.edu	37	10	105209118	105209118	+	Intron	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr10:105209118G>A	ENST00000260743.5	-	3	1079				CALHM2_ENST00000494180.1_5'Flank|CALHM2_ENST00000393235.1_Missense_Mutation_p.S194F|CALHM2_ENST00000369788.3_Intron|RP11-225H22.7_ENST00000608063.1_RNA	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2						ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						TAGGGAAGAGGAGCTTCCCTT	0.597																																						dbGAP											0													62.0	65.0	64.0					10																	105209118		2184	4278	6462	-	-	-	SO:0001627	intron_variant	0			BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.555+25C>T	10.37:g.105209118G>A			D3DR94|O95893|Q6ZUV9	Missense_Mutation	SNP	NULL	p.S194F	ENST00000260743.5	37	c.581	CCDS7549.1	10	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149393	0.37923	.	.	ENSG00000138172	ENST00000393235	T	0.26518	1.73	3.73	0.766	0.18476	.	.	.	.	.	T	0.09113	0.0225	.	.	.	0.09310	N	1	B	0.32467	0.372	B	0.28305	0.088	T	0.28964	-1.0027	8	0.09084	T	0.74	.	3.3914	0.07290	0.0987:0.1704:0.5552:0.1758	.	194	Q9HA72-2	.	F	194	ENSP00000376927:S194F	ENSP00000376927:S194F	S	-	2	0	CALHM2	105199108	0.000000	0.05858	0.000000	0.03702	0.221000	0.24807	-0.331000	0.07914	0.160000	0.19432	0.561000	0.74099	TCC	CALHM2	-	NULL	ENSG00000138172		0.597	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM2	HGNC	protein_coding	OTTHUMT00000050159.1	34	0.00	0	G	NM_015916		105209118	105209118	-1	no_errors	ENST00000393235	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	0.000	A
CAND1	55832	genome.wustl.edu	37	12	67699121	67699121	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr12:67699121C>T	ENST00000545606.1	+	10	2110	c.1673C>T	c.(1672-1674)tCg>tTg	p.S558L		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	558					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CAGCCTTCCTCGTTTGATGCA	0.388																																						dbGAP											0													147.0	143.0	144.0					12																	67699121		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1673C>T	12.37:g.67699121C>T	ENSP00000442318:p.Ser558Leu		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.S558L	ENST00000545606.1	37	c.1673	CCDS8977.1	12	.	.	.	.	.	.	.	.	.	.	C	8.925	0.961953	0.18583	.	.	ENSG00000111530	ENST00000545606;ENST00000299218	T	0.69306	-0.39	5.43	5.43	0.79202	Armadillo-like helical (1);Armadillo-type fold (1);	0.334869	0.35838	N	0.002948	T	0.63082	0.2481	L	0.49126	1.545	0.51767	D	0.999937	B	0.02656	0.0	B	0.01281	0.0	T	0.56854	-0.7910	9	.	.	.	-8.4492	19.5983	0.95549	0.0:1.0:0.0:0.0	.	558	Q86VP6	CAND1_HUMAN	L	558	ENSP00000442318:S558L	.	S	+	2	0	CAND1	65985388	0.957000	0.32711	0.982000	0.44146	0.967000	0.64934	2.240000	0.43088	2.704000	0.92352	0.650000	0.86243	TCG	CAND1	-	superfamily_ARM-type_fold	ENSG00000111530		0.388	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	HGNC	protein_coding	OTTHUMT00000402105.1	492	0.00	0	C	NM_018448		67699121	67699121	+1	no_errors	ENST00000299218	ensembl	human	known	69_37n	missense	415	25.05	139	SNP	0.994	T
CAND1	55832	genome.wustl.edu	37	12	67699121	67699121	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr12:67699121C>T	ENST00000545606.1	+	10	2110	c.1673C>T	c.(1672-1674)tCg>tTg	p.S558L		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	558					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CAGCCTTCCTCGTTTGATGCA	0.388																																						dbGAP											0													147.0	143.0	144.0					12																	67699121		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1673C>T	12.37:g.67699121C>T	ENSP00000442318:p.Ser558Leu		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.S558L	ENST00000545606.1	37	c.1673	CCDS8977.1	12	.	.	.	.	.	.	.	.	.	.	C	8.925	0.961953	0.18583	.	.	ENSG00000111530	ENST00000545606;ENST00000299218	T	0.69306	-0.39	5.43	5.43	0.79202	Armadillo-like helical (1);Armadillo-type fold (1);	0.334869	0.35838	N	0.002948	T	0.63082	0.2481	L	0.49126	1.545	0.51767	D	0.999937	B	0.02656	0.0	B	0.01281	0.0	T	0.56854	-0.7910	9	.	.	.	-8.4492	19.5983	0.95549	0.0:1.0:0.0:0.0	.	558	Q86VP6	CAND1_HUMAN	L	558	ENSP00000442318:S558L	.	S	+	2	0	CAND1	65985388	0.957000	0.32711	0.982000	0.44146	0.967000	0.64934	2.240000	0.43088	2.704000	0.92352	0.650000	0.86243	TCG	CAND1	-	superfamily_ARM-type_fold	ENSG00000111530		0.388	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	HGNC	protein_coding	OTTHUMT00000402105.1	374	0.00	0	C	NM_018448		67699121	67699121	+1	no_errors	ENST00000299218	ensembl	human	known	69_37n	missense	415	25.05	139	SNP	0.994	T
CBLB	868	genome.wustl.edu	37	3	105452983	105452983	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr3:105452983T>C	ENST00000264122.4	-	9	1394	c.1073A>G	c.(1072-1074)gAa>gGa	p.E358G	CBLB_ENST00000394027.3_Splice_Site_p.E380G|CBLB_ENST00000403724.1_Splice_Site_p.E358G|CBLB_ENST00000545639.1_3'UTR|CBLB_ENST00000405772.1_Splice_Site_p.E358G	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	358	Linker.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TTCATATTGTTCCTGGAATTT	0.368			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	dbGAP		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													68.0	70.0	69.0					3																	105452983		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1072-1A>G	3.37:g.105452983T>C			A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.E358G	ENST00000264122.4	37	c.1073	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470028	0.63625	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81	5.41	5.41	0.78517	SH2 motif (1);	0.000000	0.85682	D	0.000000	D	0.94653	0.8276	M	0.78456	2.415	0.80722	D	1	B;B;B	0.33000	0.273;0.393;0.314	B;B;B	0.29353	0.045;0.061;0.101	D	0.94423	0.7642	10	0.87932	D	0	-9.6263	15.4455	0.75225	0.0:0.0:0.0:1.0	.	380;358;358	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	G	358;380;358;358	ENSP00000264122:E358G;ENSP00000377595:E380G;ENSP00000384816:E358G;ENSP00000384938:E358G	ENSP00000264122:E358G	E	-	2	0	CBLB	106935673	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.654000	0.83653	2.054000	0.61138	0.477000	0.44152	GAA	CBLB	-	NULL	ENSG00000114423		0.368	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	HGNC	protein_coding	OTTHUMT00000319417.2	120	0.00	0	T	NM_170662	Missense_Mutation	105452983	105452983	-1	no_errors	ENST00000264122	ensembl	human	known	69_37n	missense	106	19.55	26	SNP	1.000	C
CBLB	868	genome.wustl.edu	37	3	105452983	105452983	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr3:105452983T>C	ENST00000264122.4	-	9	1394	c.1073A>G	c.(1072-1074)gAa>gGa	p.E358G	CBLB_ENST00000394027.3_Splice_Site_p.E380G|CBLB_ENST00000403724.1_Splice_Site_p.E358G|CBLB_ENST00000545639.1_3'UTR|CBLB_ENST00000405772.1_Splice_Site_p.E358G	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	358	Linker.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TTCATATTGTTCCTGGAATTT	0.368			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	dbGAP		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													68.0	70.0	69.0					3																	105452983		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1072-1A>G	3.37:g.105452983T>C			A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.E358G	ENST00000264122.4	37	c.1073	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470028	0.63625	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81	5.41	5.41	0.78517	SH2 motif (1);	0.000000	0.85682	D	0.000000	D	0.94653	0.8276	M	0.78456	2.415	0.80722	D	1	B;B;B	0.33000	0.273;0.393;0.314	B;B;B	0.29353	0.045;0.061;0.101	D	0.94423	0.7642	10	0.87932	D	0	-9.6263	15.4455	0.75225	0.0:0.0:0.0:1.0	.	380;358;358	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	G	358;380;358;358	ENSP00000264122:E358G;ENSP00000377595:E380G;ENSP00000384816:E358G;ENSP00000384938:E358G	ENSP00000264122:E358G	E	-	2	0	CBLB	106935673	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.654000	0.83653	2.054000	0.61138	0.477000	0.44152	GAA	CBLB	-	NULL	ENSG00000114423		0.368	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	HGNC	protein_coding	OTTHUMT00000319417.2	105	0.00	0	T	NM_170662	Missense_Mutation	105452983	105452983	-1	no_errors	ENST00000264122	ensembl	human	known	69_37n	missense	106	19.55	26	SNP	1.000	C
CEP72	55722	genome.wustl.edu	37	5	620293	620293	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr5:620293A>G	ENST00000264935.5	+	3	410	c.320A>G	c.(319-321)gAc>gGc	p.D107G	CEP72_ENST00000444221.1_Missense_Mutation_p.D107G	NM_018140.3	NP_060610.2	Q9P209	CEP72_HUMAN	centrosomal protein 72kDa	107					G2/M transition of mitotic cell cycle (GO:0000086)|gamma-tubulin complex localization (GO:0033566)|mitotic cell cycle (GO:0000278)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)				autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	20			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GTGGATGTGGACTTCCGGCTG	0.562																																						dbGAP											0													145.0	122.0	130.0					5																	620293		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000132	CCDS34126.1	5p15.33	2014-02-20			ENSG00000112877	ENSG00000112877			25547	protein-coding gene	gene with protein product						10819331	Standard	NM_018140		Approved	KIAA1519, FLJ10565	uc003jbf.3	Q9P209	OTTHUMG00000161745	ENST00000264935.5:c.320A>G	5.37:g.620293A>G	ENSP00000264935:p.Asp107Gly		B4DR26|Q9BV03|Q9BWM3|Q9NVR4	Missense_Mutation	SNP	smart_Leu-rich_rpt_typical-subtyp,smart_U2A'_phosphoprotein32A_C	p.D107G	ENST00000264935.5	37	c.320	CCDS34126.1	5	.	.	.	.	.	.	.	.	.	.	A	17.45	3.392144	0.62066	.	.	ENSG00000112877	ENST00000264935;ENST00000444221	T;T	0.24908	1.83;1.83	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.50599	0.1625	M	0.79475	2.455	0.48696	D	0.999695	D	0.89917	1.0	D	0.87578	0.998	T	0.54721	-0.8251	10	0.62326	D	0.03	-35.4124	12.1786	0.54199	1.0:0.0:0.0:0.0	.	107	Q9P209	CEP72_HUMAN	G	107	ENSP00000264935:D107G;ENSP00000392052:D107G	ENSP00000264935:D107G	D	+	2	0	CEP72	673293	1.000000	0.71417	0.999000	0.59377	0.329000	0.28539	4.571000	0.60879	1.902000	0.55061	0.379000	0.24179	GAC	CEP72	-	NULL	ENSG00000112877		0.562	CEP72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP72	HGNC	protein_coding	OTTHUMT00000365967.3	45	0.00	0	A	NM_018140		620293	620293	+1	no_errors	ENST00000264935	ensembl	human	known	69_37n	missense	54	21.74	15	SNP	1.000	G
CEP72	55722	genome.wustl.edu	37	5	620293	620293	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr5:620293A>G	ENST00000264935.5	+	3	410	c.320A>G	c.(319-321)gAc>gGc	p.D107G	CEP72_ENST00000444221.1_Missense_Mutation_p.D107G	NM_018140.3	NP_060610.2	Q9P209	CEP72_HUMAN	centrosomal protein 72kDa	107					G2/M transition of mitotic cell cycle (GO:0000086)|gamma-tubulin complex localization (GO:0033566)|mitotic cell cycle (GO:0000278)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)				autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	20			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GTGGATGTGGACTTCCGGCTG	0.562																																						dbGAP											0													145.0	122.0	130.0					5																	620293		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000132	CCDS34126.1	5p15.33	2014-02-20			ENSG00000112877	ENSG00000112877			25547	protein-coding gene	gene with protein product						10819331	Standard	NM_018140		Approved	KIAA1519, FLJ10565	uc003jbf.3	Q9P209	OTTHUMG00000161745	ENST00000264935.5:c.320A>G	5.37:g.620293A>G	ENSP00000264935:p.Asp107Gly		B4DR26|Q9BV03|Q9BWM3|Q9NVR4	Missense_Mutation	SNP	smart_Leu-rich_rpt_typical-subtyp,smart_U2A'_phosphoprotein32A_C	p.D107G	ENST00000264935.5	37	c.320	CCDS34126.1	5	.	.	.	.	.	.	.	.	.	.	A	17.45	3.392144	0.62066	.	.	ENSG00000112877	ENST00000264935;ENST00000444221	T;T	0.24908	1.83;1.83	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.50599	0.1625	M	0.79475	2.455	0.48696	D	0.999695	D	0.89917	1.0	D	0.87578	0.998	T	0.54721	-0.8251	10	0.62326	D	0.03	-35.4124	12.1786	0.54199	1.0:0.0:0.0:0.0	.	107	Q9P209	CEP72_HUMAN	G	107	ENSP00000264935:D107G;ENSP00000392052:D107G	ENSP00000264935:D107G	D	+	2	0	CEP72	673293	1.000000	0.71417	0.999000	0.59377	0.329000	0.28539	4.571000	0.60879	1.902000	0.55061	0.379000	0.24179	GAC	CEP72	-	NULL	ENSG00000112877		0.562	CEP72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP72	HGNC	protein_coding	OTTHUMT00000365967.3	73	0.00	0	A	NM_018140		620293	620293	+1	no_errors	ENST00000264935	ensembl	human	known	69_37n	missense	54	21.74	15	SNP	1.000	G
CNTRL	11064	genome.wustl.edu	37	9	123888093	123888093	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr9:123888093C>A	ENST00000373855.1	+	14	2164	c.1904C>A	c.(1903-1905)gCc>gAc	p.A635D	CNTRL_ENST00000373850.1_Missense_Mutation_p.A83D|CNTRL_ENST00000238341.5_Missense_Mutation_p.A635D|CNTRL_ENST00000373847.1_Missense_Mutation_p.A83D			Q7Z7A1	CNTRL_HUMAN	centriolin	635					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GCAACTCAGGCCCAGAATGAG	0.498																																						dbGAP											0													117.0	120.0	119.0					9																	123888093		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1904C>A	9.37:g.123888093C>A	ENSP00000362962:p.Ala635Asp		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.A635D	ENST00000373855.1	37	c.1904	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434348	0.83776	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.36520	1.55;1.55;1.25;1.28	5.7	4.79	0.61399	.	.	.	.	.	T	0.42630	0.1211	L	0.32530	0.975	0.41751	D	0.989661	D;D;D	0.71674	0.998;0.992;0.986	P;P;P	0.60068	0.852;0.868;0.741	T	0.06807	-1.0806	9	0.23891	T	0.37	.	14.0701	0.64854	0.0:0.9269:0.0:0.073	.	635;635;635	B2RP65;F5GZN0;Q7Z7A1	.;.;CNTRL_HUMAN	D	635;635;635;117;83;83	ENSP00000362962:A635D;ENSP00000238341:A635D;ENSP00000362956:A83D;ENSP00000362953:A83D	ENSP00000238341:A635D	A	+	2	0	CNTRL	122927914	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.529000	0.53532	2.683000	0.91414	0.650000	0.86243	GCC	CNTRL	-	NULL	ENSG00000119397		0.498	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	356	0.00	0	C	NM_007018		123888093	123888093	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	291	20.22	74	SNP	1.000	A
CNTRL	11064	genome.wustl.edu	37	9	123888093	123888093	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr9:123888093C>A	ENST00000373855.1	+	14	2164	c.1904C>A	c.(1903-1905)gCc>gAc	p.A635D	CNTRL_ENST00000373850.1_Missense_Mutation_p.A83D|CNTRL_ENST00000238341.5_Missense_Mutation_p.A635D|CNTRL_ENST00000373847.1_Missense_Mutation_p.A83D			Q7Z7A1	CNTRL_HUMAN	centriolin	635					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GCAACTCAGGCCCAGAATGAG	0.498																																						dbGAP											0													117.0	120.0	119.0					9																	123888093		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1904C>A	9.37:g.123888093C>A	ENSP00000362962:p.Ala635Asp		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.A635D	ENST00000373855.1	37	c.1904	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434348	0.83776	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.36520	1.55;1.55;1.25;1.28	5.7	4.79	0.61399	.	.	.	.	.	T	0.42630	0.1211	L	0.32530	0.975	0.41751	D	0.989661	D;D;D	0.71674	0.998;0.992;0.986	P;P;P	0.60068	0.852;0.868;0.741	T	0.06807	-1.0806	9	0.23891	T	0.37	.	14.0701	0.64854	0.0:0.9269:0.0:0.073	.	635;635;635	B2RP65;F5GZN0;Q7Z7A1	.;.;CNTRL_HUMAN	D	635;635;635;117;83;83	ENSP00000362962:A635D;ENSP00000238341:A635D;ENSP00000362956:A83D;ENSP00000362953:A83D	ENSP00000238341:A635D	A	+	2	0	CNTRL	122927914	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.529000	0.53532	2.683000	0.91414	0.650000	0.86243	GCC	CNTRL	-	NULL	ENSG00000119397		0.498	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	219	0.45	1	C	NM_007018		123888093	123888093	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	291	20.22	74	SNP	1.000	A
COBLL1	22837	genome.wustl.edu	37	2	165550903	165550903	+	Missense_Mutation	SNP	C	C	A	rs201288773	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:165550903C>A	ENST00000392717.2	-	13	3231	c.3227G>T	c.(3226-3228)aGt>aTt	p.S1076I	COBLL1_ENST00000342193.4_Missense_Mutation_p.S1038I|COBLL1_ENST00000194871.6_Missense_Mutation_p.S1105I|COBLL1_ENST00000375458.2_Missense_Mutation_p.S1000I|COBLL1_ENST00000409184.3_Missense_Mutation_p.S1038I			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1076						extracellular vesicular exosome (GO:0070062)		p.S1038N(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						GCGCTCTTTACTGAAAGACTG	0.463																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											116.0	106.0	109.0					2																	165550903		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3227G>T	2.37:g.165550903C>A	ENSP00000376478:p.Ser1076Ile		A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	pfam_Cordon-bleu_domain,pfscan_WH2_dom	p.S1105I	ENST00000392717.2	37	c.3314		2	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972739	0.53614	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.95	5.07	0.68467	.	0.078221	0.64402	D	0.000011	T	0.62466	0.2430	M	0.62723	1.935	0.26447	N	0.975671	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.71656	0.943;0.959;0.974	T	0.55522	-0.8128	9	0.46703	T	0.11	-16.8615	11.7379	0.51775	0.0:0.8694:0.0:0.1306	.	1076;1105;1038	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	I	1000;1038;1038;1076;1105	.	ENSP00000194871:S1105I	S	-	2	0	COBLL1	165259149	1.000000	0.71417	0.999000	0.59377	0.568000	0.35870	1.156000	0.31712	2.824000	0.97209	0.655000	0.94253	AGT	COBLL1	-	NULL	ENSG00000082438		0.463	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		112	0.00	0	C	NM_014900		165550903	165550903	-1	no_errors	ENST00000194871	ensembl	human	known	69_37n	missense	113	24.16	36	SNP	1.000	A
COBLL1	22837	genome.wustl.edu	37	2	165550903	165550903	+	Missense_Mutation	SNP	C	C	A	rs201288773	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:165550903C>A	ENST00000392717.2	-	13	3231	c.3227G>T	c.(3226-3228)aGt>aTt	p.S1076I	COBLL1_ENST00000342193.4_Missense_Mutation_p.S1038I|COBLL1_ENST00000194871.6_Missense_Mutation_p.S1105I|COBLL1_ENST00000375458.2_Missense_Mutation_p.S1000I|COBLL1_ENST00000409184.3_Missense_Mutation_p.S1038I			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1076						extracellular vesicular exosome (GO:0070062)		p.S1038N(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						GCGCTCTTTACTGAAAGACTG	0.463																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											116.0	106.0	109.0					2																	165550903		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3227G>T	2.37:g.165550903C>A	ENSP00000376478:p.Ser1076Ile		A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	pfam_Cordon-bleu_domain,pfscan_WH2_dom	p.S1105I	ENST00000392717.2	37	c.3314		2	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972739	0.53614	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.95	5.07	0.68467	.	0.078221	0.64402	D	0.000011	T	0.62466	0.2430	M	0.62723	1.935	0.26447	N	0.975671	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.71656	0.943;0.959;0.974	T	0.55522	-0.8128	9	0.46703	T	0.11	-16.8615	11.7379	0.51775	0.0:0.8694:0.0:0.1306	.	1076;1105;1038	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	I	1000;1038;1038;1076;1105	.	ENSP00000194871:S1105I	S	-	2	0	COBLL1	165259149	1.000000	0.71417	0.999000	0.59377	0.568000	0.35870	1.156000	0.31712	2.824000	0.97209	0.655000	0.94253	AGT	COBLL1	-	NULL	ENSG00000082438		0.463	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		157	0.63	1	C	NM_014900		165550903	165550903	-1	no_errors	ENST00000194871	ensembl	human	known	69_37n	missense	113	24.16	36	SNP	1.000	A
COL4A5	1287	genome.wustl.edu	37	X	107924151	107924151	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chrX:107924151G>T	ENST00000361603.2	+	44	4278	c.4034G>T	c.(4033-4035)gGc>gTc	p.G1345V	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1351V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1345	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGATCAGCTGGCCCTGAGGGG	0.443									Alport syndrome with Diffuse Leiomyomatosis																													dbGAP											0													127.0	117.0	120.0					X																	107924151		2203	4299	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4034G>T	X.37:g.107924151G>T	ENSP00000354505:p.Gly1345Val		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G1351V	ENST00000361603.2	37	c.4052	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707682	0.68615	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99637	-6.29;-6.29	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	H	0.99444	4.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96243	0.9177	10	0.87932	D	0	.	18.2781	0.90089	0.0:0.0:1.0:0.0	.	1348;1345	E7EVY4;P29400	.;CO4A5_HUMAN	V	1351;1345;1351	ENSP00000331902:G1351V;ENSP00000354505:G1345V	ENSP00000331902:G1351V	G	+	2	0	COL4A5	107810807	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	9.076000	0.94009	2.255000	0.74692	0.506000	0.49869	GGC	COL4A5	-	pfam_Collagen	ENSG00000188153		0.443	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	225	0.44	1	G			107924151	107924151	+1	no_errors	ENST00000328300	ensembl	human	known	69_37n	missense	150	28.57	60	SNP	1.000	T
COL4A5	1287	genome.wustl.edu	37	X	107924151	107924151	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chrX:107924151G>T	ENST00000361603.2	+	44	4278	c.4034G>T	c.(4033-4035)gGc>gTc	p.G1345V	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1351V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1345	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGATCAGCTGGCCCTGAGGGG	0.443									Alport syndrome with Diffuse Leiomyomatosis																													dbGAP											0													127.0	117.0	120.0					X																	107924151		2203	4299	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4034G>T	X.37:g.107924151G>T	ENSP00000354505:p.Gly1345Val		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G1351V	ENST00000361603.2	37	c.4052	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707682	0.68615	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99637	-6.29;-6.29	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	H	0.99444	4.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96243	0.9177	10	0.87932	D	0	.	18.2781	0.90089	0.0:0.0:1.0:0.0	.	1348;1345	E7EVY4;P29400	.;CO4A5_HUMAN	V	1351;1345;1351	ENSP00000331902:G1351V;ENSP00000354505:G1345V	ENSP00000331902:G1351V	G	+	2	0	COL4A5	107810807	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	9.076000	0.94009	2.255000	0.74692	0.506000	0.49869	GGC	COL4A5	-	pfam_Collagen	ENSG00000188153		0.443	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	280	0.71	2	G			107924151	107924151	+1	no_errors	ENST00000328300	ensembl	human	known	69_37n	missense	150	28.57	60	SNP	1.000	T
CPXM1	56265	genome.wustl.edu	37	20	2774881	2774881	+	Silent	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr20:2774881C>T	ENST00000380605.2	-	14	2224	c.2160G>A	c.(2158-2160)ccG>ccA	p.P720P		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	720					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TGCGAAGGTCCGGGGGCACCT	0.622																																						dbGAP											0													36.0	41.0	39.0					20																	2774881		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.2160G>A	20.37:g.2774881C>T			Q6P4G8|Q6UW65|Q9NUB5	Silent	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom	p.P720	ENST00000380605.2	37	c.2160	CCDS13033.1	20																																																																																			CPXM1	-	superfamily_CarboxyPept-like_regulatory	ENSG00000088882		0.622	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	71	0.00	0	C	NM_019609		2774881	2774881	-1	no_errors	ENST00000380605	ensembl	human	known	69_37n	silent	45	22.41	13	SNP	0.109	T
CPXM1	56265	genome.wustl.edu	37	20	2774881	2774881	+	Silent	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr20:2774881C>T	ENST00000380605.2	-	14	2224	c.2160G>A	c.(2158-2160)ccG>ccA	p.P720P		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	720					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TGCGAAGGTCCGGGGGCACCT	0.622																																						dbGAP											0													36.0	41.0	39.0					20																	2774881		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.2160G>A	20.37:g.2774881C>T			Q6P4G8|Q6UW65|Q9NUB5	Silent	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom	p.P720	ENST00000380605.2	37	c.2160	CCDS13033.1	20																																																																																			CPXM1	-	superfamily_CarboxyPept-like_regulatory	ENSG00000088882		0.622	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	33	0.00	0	C	NM_019609		2774881	2774881	-1	no_errors	ENST00000380605	ensembl	human	known	69_37n	silent	45	22.41	13	SNP	0.109	T
CROCCP2	84809	genome.wustl.edu	37	1	16946407	16946407	+	lincRNA	SNP	T	T	G	rs10796418		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:16946407T>G	ENST00000412962.1	-	0	1112				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGCAATCTCCTCACTCAGCTG	0.672																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946407T>G			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.672	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	14	0.00	0	T	NR_026752.1		16946407	16946407	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	6	40.00	4	SNP	1.000	G
CTNNA2	1496	genome.wustl.edu	37	2	80540719	80540719	+	Intron	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:80540719A>G	ENST00000402739.4	+	7	1061				CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000343114.3_Silent_p.V11V|CTNNA2_ENST00000361291.4_Intron	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2						axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						tccagtcagtaggcaaagtct	0.443																																						dbGAP											0													46.0	41.0	42.0					2																	80540719		876	1991	2867	-	-	-	SO:0001627	intron_variant	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1057-79617A>G	2.37:g.80540719A>G			B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.V11	ENST00000402739.4	37	c.33		2																																																																																			CTNNA2	-	NULL	ENSG00000066032		0.443	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	67	0.00	0	A	NM_004389		80540719	80540719	+1	no_errors	ENST00000343114	ensembl	human	putative	69_37n	silent	45	28.57	18	SNP	0.010	G
CTNNA2	1496	genome.wustl.edu	37	2	80540719	80540719	+	Intron	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:80540719A>G	ENST00000402739.4	+	7	1061				CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000343114.3_Silent_p.V11V|CTNNA2_ENST00000361291.4_Intron	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2						axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						tccagtcagtaggcaaagtct	0.443																																						dbGAP											0													46.0	41.0	42.0					2																	80540719		876	1991	2867	-	-	-	SO:0001627	intron_variant	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1057-79617A>G	2.37:g.80540719A>G			B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.V11	ENST00000402739.4	37	c.33		2																																																																																			CTNNA2	-	NULL	ENSG00000066032		0.443	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	97	0.00	0	A	NM_004389		80540719	80540719	+1	no_errors	ENST00000343114	ensembl	human	putative	69_37n	silent	45	28.57	18	SNP	0.010	G
CYP11A1	1583	genome.wustl.edu	37	15	74631030	74631030	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr15:74631030C>A	ENST00000268053.6	-	8	1470	c.1316G>T	c.(1315-1317)cGa>cTa	p.R439L	CYP11A1_ENST00000419019.2_Missense_Mutation_p.R281L|CYP11A1_ENST00000358632.4_Missense_Mutation_p.R281L	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	439					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	GCTCAGCCATCGGGTTGGGTC	0.572																																					Esophageal Squamous(87;818 1337 4093 9268 37314)	dbGAP											0													152.0	139.0	144.0					15																	74631030		2197	4297	6494	-	-	-	SO:0001583	missense	0			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.1316G>T	15.37:g.74631030C>A	ENSP00000268053:p.Arg439Leu		A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_mitochondrial,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.R439L	ENST00000268053.6	37	c.1316	CCDS32291.1	15	.	.	.	.	.	.	.	.	.	.	C	22.5	4.293232	0.80914	.	.	ENSG00000140459	ENST00000268053;ENST00000358632;ENST00000419019;ENST00000452422	D;D;D	0.90504	-2.68;-2.68;-2.68	5.15	4.17	0.49024	.	0.000000	0.85682	D	0.000000	D	0.96639	0.8903	H	0.95982	3.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.97506	1.0063	10	0.87932	D	0	-11.6791	14.0465	0.64708	0.1518:0.8482:0.0:0.0	.	409;439	B4DTE5;P05108	.;CP11A_HUMAN	L	439;281;281;204	ENSP00000268053:R439L;ENSP00000351455:R281L;ENSP00000405488:R281L	ENSP00000268053:R439L	R	-	2	0	CYP11A1	72418083	1.000000	0.71417	0.143000	0.22291	0.908000	0.53690	5.449000	0.66619	2.393000	0.81446	0.549000	0.68633	CGA	CYP11A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	ENSG00000140459		0.572	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11A1	HGNC	protein_coding	OTTHUMT00000319737.1	105	0.00	0	C			74631030	74631030	-1	no_errors	ENST00000268053	ensembl	human	known	69_37n	missense	74	26.73	27	SNP	0.353	A
CYP20A1	57404	genome.wustl.edu	37	2	204154590	204154590	+	Silent	SNP	T	T	C	rs142764636	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:204154590T>C	ENST00000356079.4	+	10	1197	c.1074T>C	c.(1072-1074)atT>atC	p.I358I	CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Silent_p.I366I	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	358						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						GATTTATTATTCCTAGAGAGG	0.348																																						dbGAP											0													48.0	45.0	46.0					2																	204154590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.1074T>C	2.37:g.204154590T>C			Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	p.I358	ENST00000356079.4	37	c.1074	CCDS2357.1	2																																																																																			CYP20A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000119004		0.348	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP20A1	HGNC	protein_coding	OTTHUMT00000256328.3	81	0.00	0	T	NM_020674		204154590	204154590	+1	no_errors	ENST00000356079	ensembl	human	known	69_37n	silent	84	28.57	34	SNP	1.000	C
CYP20A1	57404	genome.wustl.edu	37	2	204154590	204154590	+	Silent	SNP	T	T	C	rs142764636	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:204154590T>C	ENST00000356079.4	+	10	1197	c.1074T>C	c.(1072-1074)atT>atC	p.I358I	CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Silent_p.I366I	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	358						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						GATTTATTATTCCTAGAGAGG	0.348																																						dbGAP											0													48.0	45.0	46.0					2																	204154590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.1074T>C	2.37:g.204154590T>C			Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	p.I358	ENST00000356079.4	37	c.1074	CCDS2357.1	2																																																																																			CYP20A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000119004		0.348	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP20A1	HGNC	protein_coding	OTTHUMT00000256328.3	72	0.00	0	T	NM_020674		204154590	204154590	+1	no_errors	ENST00000356079	ensembl	human	known	69_37n	silent	84	28.57	34	SNP	1.000	C
DCST1	149095	genome.wustl.edu	37	1	155014231	155014231	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:155014231G>T	ENST00000295542.1	+	8	886	c.790G>T	c.(790-792)Gac>Tac	p.D264Y	DCST1_ENST00000423025.2_Missense_Mutation_p.D239Y|DCST1_ENST00000368419.2_Missense_Mutation_p.D264Y|DCST1_ENST00000392480.1_Missense_Mutation_p.D264Y	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	264						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TCGTTGGTTTGACCGCAAGCA	0.542																																						dbGAP											0													175.0	133.0	148.0					1																	155014231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.790G>T	1.37:g.155014231G>T	ENSP00000295542:p.Asp264Tyr		B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	pfam_DC_STAMP-like,pfscan_Znf_RING	p.D264Y	ENST00000295542.1	37	c.790	CCDS1083.1	1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.786154	0.49997	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	4.88	3.01	0.34805	.	0.413129	0.22654	N	0.057288	T	0.43077	0.1231	M	0.70595	2.14	0.26112	N	0.980672	P;D;P	0.53151	0.956;0.958;0.956	P;P;P	0.47827	0.459;0.558;0.459	T	0.37549	-0.9701	10	0.66056	D	0.02	-16.2837	6.4469	0.21882	0.2922:0.0:0.7078:0.0	.	239;289;264	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	Y	264;264;239;264	ENSP00000295542:D264Y;ENSP00000376271:D264Y;ENSP00000387369:D239Y;ENSP00000357404:D264Y	ENSP00000295542:D264Y	D	+	1	0	DCST1	153280855	0.004000	0.15560	0.696000	0.30242	0.873000	0.50193	0.282000	0.18829	0.659000	0.30945	0.563000	0.77884	GAC	DCST1	-	NULL	ENSG00000163357		0.542	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST1	HGNC	protein_coding	OTTHUMT00000099006.1	54	0.00	0	G	NM_152494		155014231	155014231	+1	no_errors	ENST00000295542	ensembl	human	known	69_37n	missense	62	22.50	18	SNP	0.591	T
DCST1	149095	genome.wustl.edu	37	1	155014231	155014231	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:155014231G>T	ENST00000295542.1	+	8	886	c.790G>T	c.(790-792)Gac>Tac	p.D264Y	DCST1_ENST00000423025.2_Missense_Mutation_p.D239Y|DCST1_ENST00000368419.2_Missense_Mutation_p.D264Y|DCST1_ENST00000392480.1_Missense_Mutation_p.D264Y	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	264						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TCGTTGGTTTGACCGCAAGCA	0.542																																						dbGAP											0													175.0	133.0	148.0					1																	155014231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.790G>T	1.37:g.155014231G>T	ENSP00000295542:p.Asp264Tyr		B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	pfam_DC_STAMP-like,pfscan_Znf_RING	p.D264Y	ENST00000295542.1	37	c.790	CCDS1083.1	1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.786154	0.49997	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	4.88	3.01	0.34805	.	0.413129	0.22654	N	0.057288	T	0.43077	0.1231	M	0.70595	2.14	0.26112	N	0.980672	P;D;P	0.53151	0.956;0.958;0.956	P;P;P	0.47827	0.459;0.558;0.459	T	0.37549	-0.9701	10	0.66056	D	0.02	-16.2837	6.4469	0.21882	0.2922:0.0:0.7078:0.0	.	239;289;264	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	Y	264;264;239;264	ENSP00000295542:D264Y;ENSP00000376271:D264Y;ENSP00000387369:D239Y;ENSP00000357404:D264Y	ENSP00000295542:D264Y	D	+	1	0	DCST1	153280855	0.004000	0.15560	0.696000	0.30242	0.873000	0.50193	0.282000	0.18829	0.659000	0.30945	0.563000	0.77884	GAC	DCST1	-	NULL	ENSG00000163357		0.542	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST1	HGNC	protein_coding	OTTHUMT00000099006.1	98	0.00	0	G	NM_152494		155014231	155014231	+1	no_errors	ENST00000295542	ensembl	human	known	69_37n	missense	62	22.50	18	SNP	0.591	T
DDC	1644	genome.wustl.edu	37	7	50611610	50611610	+	Silent	SNP	G	G	A	rs200233157		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr7:50611610G>A	ENST00000444124.2	-	2	374	c.174C>T	c.(172-174)aaC>aaT	p.N58N	DDC_ENST00000426377.1_Silent_p.N58N|DDC_ENST00000380984.4_Silent_p.N58N|DDC_ENST00000431062.1_Silent_p.N58N|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000357936.5_Silent_p.N58N	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	58	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	TCTCAACGTCGTTGATGATGT	0.562																																						dbGAP											0													134.0	125.0	128.0					7																	50611610		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.174C>T	7.37:g.50611610G>A			C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_Aromatic_deC	p.T24M	ENST00000444124.2	37	c.71	CCDS5511.1	7	.	.	.	.	.	.	.	.	.	.	G	0.261	-0.999753	0.02128	.	.	ENSG00000132437	ENST00000430300	.	.	.	5.92	-11.8	0.00035	.	.	.	.	.	T	0.43612	0.1255	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59010	-0.7534	4	.	.	.	-10.9366	7.352	0.26697	0.6721:0.0847:0.0823:0.1609	.	.	.	.	M	24	.	.	T	-	2	0	DDC	50579104	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.768000	0.01794	-3.765000	0.00110	-1.740000	0.00687	ACG	DDC	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_Aromatic_deC	ENSG00000132437		0.562	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DDC	HGNC	protein_coding	OTTHUMT00000342593.1	96	0.00	0	G			50611610	50611610	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430300	ensembl	human	novel	69_37n	missense	64	28.89	26	SNP	0.000	A
DDC	1644	genome.wustl.edu	37	7	50611610	50611610	+	Silent	SNP	G	G	A	rs200233157		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr7:50611610G>A	ENST00000444124.2	-	2	374	c.174C>T	c.(172-174)aaC>aaT	p.N58N	DDC_ENST00000426377.1_Silent_p.N58N|DDC_ENST00000380984.4_Silent_p.N58N|DDC_ENST00000431062.1_Silent_p.N58N|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000357936.5_Silent_p.N58N	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	58	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	TCTCAACGTCGTTGATGATGT	0.562																																						dbGAP											0													134.0	125.0	128.0					7																	50611610		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.174C>T	7.37:g.50611610G>A			C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_Aromatic_deC	p.T24M	ENST00000444124.2	37	c.71	CCDS5511.1	7	.	.	.	.	.	.	.	.	.	.	G	0.261	-0.999753	0.02128	.	.	ENSG00000132437	ENST00000430300	.	.	.	5.92	-11.8	0.00035	.	.	.	.	.	T	0.43612	0.1255	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59010	-0.7534	4	.	.	.	-10.9366	7.352	0.26697	0.6721:0.0847:0.0823:0.1609	.	.	.	.	M	24	.	.	T	-	2	0	DDC	50579104	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.768000	0.01794	-3.765000	0.00110	-1.740000	0.00687	ACG	DDC	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_Aromatic_deC	ENSG00000132437		0.562	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DDC	HGNC	protein_coding	OTTHUMT00000342593.1	99	0.00	0	G			50611610	50611610	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430300	ensembl	human	novel	69_37n	missense	64	28.89	26	SNP	0.000	A
DOC2A	8448	genome.wustl.edu	37	16	30017763	30017763	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr16:30017763T>C	ENST00000350119.4	-	10	1218	c.1028A>G	c.(1027-1029)tAt>tGt	p.Y343C	DOC2A_ENST00000564944.1_Missense_Mutation_p.Y343C|DOC2A_ENST00000564979.1_Missense_Mutation_p.Y343C	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	343	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Interaction with UNC13D.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						GCCAATGTCATAGTCCCAGAC	0.602																																						dbGAP											0													126.0	122.0	123.0					16																	30017763		2197	4300	6497	-	-	-	SO:0001583	missense	0			D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.1028A>G	16.37:g.30017763T>C	ENSP00000340017:p.Tyr343Cys		B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pirsf_Doc2,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.Y343C	ENST00000350119.4	37	c.1028	CCDS10666.1	16	.	.	.	.	.	.	.	.	.	.	T	13.37	2.215847	0.39102	.	.	ENSG00000149927	ENST00000350119	T	0.69926	-0.44	5.95	5.95	0.96441	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.49305	D	0.000149	D	0.84037	0.5384	M	0.92268	3.29	0.49687	D	0.99981	D	0.89917	1.0	D	0.91635	0.999	D	0.86825	0.2007	10	0.87932	D	0	.	8.8297	0.35076	0.0:0.0827:0.0:0.9173	.	343	Q14183	DOC2A_HUMAN	C	343	ENSP00000340017:Y343C	ENSP00000340017:Y343C	Y	-	2	0	DOC2A	29925264	1.000000	0.71417	0.999000	0.59377	0.167000	0.22549	5.961000	0.70356	2.279000	0.76181	0.533000	0.62120	TAT	DOC2A	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pirsf_Doc2,pfscan_C2_membr_targeting,prints_C2_dom	ENSG00000149927		0.602	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOC2A	HGNC	protein_coding	OTTHUMT00000255148.2	76	0.00	0	T	NM_003586		30017763	30017763	-1	no_errors	ENST00000350119	ensembl	human	known	69_37n	missense	66	29.03	27	SNP	1.000	C
DOC2A	8448	genome.wustl.edu	37	16	30017763	30017763	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr16:30017763T>C	ENST00000350119.4	-	10	1218	c.1028A>G	c.(1027-1029)tAt>tGt	p.Y343C	DOC2A_ENST00000564944.1_Missense_Mutation_p.Y343C|DOC2A_ENST00000564979.1_Missense_Mutation_p.Y343C	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	343	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Interaction with UNC13D.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						GCCAATGTCATAGTCCCAGAC	0.602																																						dbGAP											0													126.0	122.0	123.0					16																	30017763		2197	4300	6497	-	-	-	SO:0001583	missense	0			D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.1028A>G	16.37:g.30017763T>C	ENSP00000340017:p.Tyr343Cys		B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pirsf_Doc2,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.Y343C	ENST00000350119.4	37	c.1028	CCDS10666.1	16	.	.	.	.	.	.	.	.	.	.	T	13.37	2.215847	0.39102	.	.	ENSG00000149927	ENST00000350119	T	0.69926	-0.44	5.95	5.95	0.96441	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.49305	D	0.000149	D	0.84037	0.5384	M	0.92268	3.29	0.49687	D	0.99981	D	0.89917	1.0	D	0.91635	0.999	D	0.86825	0.2007	10	0.87932	D	0	.	8.8297	0.35076	0.0:0.0827:0.0:0.9173	.	343	Q14183	DOC2A_HUMAN	C	343	ENSP00000340017:Y343C	ENSP00000340017:Y343C	Y	-	2	0	DOC2A	29925264	1.000000	0.71417	0.999000	0.59377	0.167000	0.22549	5.961000	0.70356	2.279000	0.76181	0.533000	0.62120	TAT	DOC2A	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pirsf_Doc2,pfscan_C2_membr_targeting,prints_C2_dom	ENSG00000149927		0.602	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOC2A	HGNC	protein_coding	OTTHUMT00000255148.2	72	0.00	0	T	NM_003586		30017763	30017763	-1	no_errors	ENST00000350119	ensembl	human	known	69_37n	missense	66	29.03	27	SNP	1.000	C
DOCK11	139818	genome.wustl.edu	37	X	117749569	117749569	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chrX:117749569G>C	ENST00000276202.7	+	30	3250	c.3187G>C	c.(3187-3189)Gct>Cct	p.A1063P	DOCK11_ENST00000276204.6_Missense_Mutation_p.A1063P	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1063					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTAGGTTCTGGCTGAATACAA	0.353																																						dbGAP											0													79.0	67.0	71.0					X																	117749569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3187G>C	X.37:g.117749569G>C	ENSP00000276202:p.Ala1063Pro		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A1063P	ENST00000276202.7	37	c.3187	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	12.55	1.971065	0.34754	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.04015	3.73;3.73	5.5	4.58	0.56647	.	0.237368	0.42420	D	0.000719	T	0.05686	0.0149	L	0.40543	1.245	0.29695	N	0.840643	B;B	0.34329	0.449;0.449	B;B	0.33254	0.16;0.106	T	0.11324	-1.0592	10	0.36615	T	0.2	-8.4116	14.4113	0.67117	0.0:0.0:0.8521:0.1478	.	1063;1063	A6NIW2;Q5JSL3	.;DOC11_HUMAN	P	1063	ENSP00000276204:A1063P;ENSP00000276202:A1063P	ENSP00000276202:A1063P	A	+	1	0	DOCK11	117633597	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.751000	0.47508	2.442000	0.82660	0.544000	0.68410	GCT	DOCK11	-	NULL	ENSG00000147251		0.353	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	130	0.00	0	G	NM_144658		117749569	117749569	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	89	30.47	39	SNP	0.991	C
DOCK11	139818	genome.wustl.edu	37	X	117749569	117749569	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chrX:117749569G>C	ENST00000276202.7	+	30	3250	c.3187G>C	c.(3187-3189)Gct>Cct	p.A1063P	DOCK11_ENST00000276204.6_Missense_Mutation_p.A1063P	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1063					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTAGGTTCTGGCTGAATACAA	0.353																																						dbGAP											0													79.0	67.0	71.0					X																	117749569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3187G>C	X.37:g.117749569G>C	ENSP00000276202:p.Ala1063Pro		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A1063P	ENST00000276202.7	37	c.3187	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	12.55	1.971065	0.34754	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.04015	3.73;3.73	5.5	4.58	0.56647	.	0.237368	0.42420	D	0.000719	T	0.05686	0.0149	L	0.40543	1.245	0.29695	N	0.840643	B;B	0.34329	0.449;0.449	B;B	0.33254	0.16;0.106	T	0.11324	-1.0592	10	0.36615	T	0.2	-8.4116	14.4113	0.67117	0.0:0.0:0.8521:0.1478	.	1063;1063	A6NIW2;Q5JSL3	.;DOC11_HUMAN	P	1063	ENSP00000276204:A1063P;ENSP00000276202:A1063P	ENSP00000276202:A1063P	A	+	1	0	DOCK11	117633597	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.751000	0.47508	2.442000	0.82660	0.544000	0.68410	GCT	DOCK11	-	NULL	ENSG00000147251		0.353	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	121	0.00	0	G	NM_144658		117749569	117749569	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	89	30.47	39	SNP	0.991	C
DOCK7	85440	genome.wustl.edu	37	1	63005436	63005436	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:63005436G>T	ENST00000340370.5	-	25	3097	c.3080C>A	c.(3079-3081)tCa>tAa	p.S1027*	DOCK7_ENST00000251157.5_Nonsense_Mutation_p.S1058*	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1058					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CTGAAATCGTGAAACTATATC	0.343																																						dbGAP											0													82.0	81.0	82.0					1																	63005436		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.3080C>A	1.37:g.63005436G>T	ENSP00000340742:p.Ser1027*		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Nonsense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.S1058*	ENST00000340370.5	37	c.3173	CCDS30734.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.356702|9.356702	0.99147|0.99147	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370	.|.	.|.	.|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.47764|.	0.1463|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.33803|.	-0.9854|.	3|.	.|0.02654	.|T	.|1	.|.	19.5721|19.5721	0.95425|0.95425	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	229|1058;1058;1027	.|.	.|ENSP00000251157:S1058X	F|S	-|-	3|2	2|0	DOCK7|DOCK7	62778024|62778024	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	6.442000|6.442000	0.73443|0.73443	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	TTC|TCA	DOCK7	-	NULL	ENSG00000116641		0.343	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	164	0.61	1	G	NM_033407		63005436	63005436	-1	no_errors	ENST00000251157	ensembl	human	known	69_37n	nonsense	132	27.32	50	SNP	1.000	T
DOCK7	85440	genome.wustl.edu	37	1	63005436	63005436	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:63005436G>T	ENST00000340370.5	-	25	3097	c.3080C>A	c.(3079-3081)tCa>tAa	p.S1027*	DOCK7_ENST00000251157.5_Nonsense_Mutation_p.S1058*	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1058					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CTGAAATCGTGAAACTATATC	0.343																																						dbGAP											0													82.0	81.0	82.0					1																	63005436		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.3080C>A	1.37:g.63005436G>T	ENSP00000340742:p.Ser1027*		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Nonsense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.S1058*	ENST00000340370.5	37	c.3173	CCDS30734.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.356702|9.356702	0.99147|0.99147	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370	.|.	.|.	.|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.47764|.	0.1463|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.33803|.	-0.9854|.	3|.	.|0.02654	.|T	.|1	.|.	19.5721|19.5721	0.95425|0.95425	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	229|1058;1058;1027	.|.	.|ENSP00000251157:S1058X	F|S	-|-	3|2	2|0	DOCK7|DOCK7	62778024|62778024	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	6.442000|6.442000	0.73443|0.73443	2.857000|2.857000	0.98124|0.98124	0.650000|0.650000	0.86243|0.86243	TTC|TCA	DOCK7	-	NULL	ENSG00000116641		0.343	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	170	0.00	0	G	NM_033407		63005436	63005436	-1	no_errors	ENST00000251157	ensembl	human	known	69_37n	nonsense	132	27.32	50	SNP	1.000	T
DSC2	1824	genome.wustl.edu	37	18	28659860	28659860	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr18:28659860G>A	ENST00000280904.6	-	11	2059	c.1616C>T	c.(1615-1617)aCc>aTc	p.T539I	DSC2_ENST00000251081.6_Missense_Mutation_p.T539I	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	539	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			ATTTTTGATGGTCTCTGCCTC	0.383																																						dbGAP											0													203.0	201.0	202.0					18																	28659860		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1616C>T	18.37:g.28659860G>A	ENSP00000280904:p.Thr539Ile			Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin,prints_Desmo_cadherin	p.T539I	ENST00000280904.6	37	c.1616	CCDS11892.1	18	.	.	.	.	.	.	.	.	.	.	G	6.045	0.376590	0.11466	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.60040	0.25;0.22	5.43	-1.52	0.08637	Cadherin (4);Cadherin-like (1);	1.423870	0.05270	N	0.517400	T	0.50171	0.1600	M	0.69823	2.125	0.09310	N	1	B;B	0.34061	0.436;0.382	B;B	0.32342	0.144;0.089	T	0.27938	-1.0059	10	0.22706	T	0.39	.	4.1282	0.10138	0.0746:0.2293:0.2006:0.4954	.	539;539	Q02487;Q02487-2	DSC2_HUMAN;.	I	539;539;305;552	ENSP00000251081:T539I;ENSP00000280904:T539I	ENSP00000251081:T539I	T	-	2	0	DSC2	26913858	0.000000	0.05858	0.002000	0.10522	0.609000	0.37215	0.043000	0.13971	-0.277000	0.09193	0.491000	0.48974	ACC	DSC2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000134755		0.383	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	HGNC	protein_coding	OTTHUMT00000254943.1	310	0.00	0	G	NM_004949		28659860	28659860	-1	no_errors	ENST00000280904	ensembl	human	known	69_37n	missense	269	29.02	110	SNP	0.000	A
DSC2	1824	genome.wustl.edu	37	18	28659860	28659860	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr18:28659860G>A	ENST00000280904.6	-	11	2059	c.1616C>T	c.(1615-1617)aCc>aTc	p.T539I	DSC2_ENST00000251081.6_Missense_Mutation_p.T539I	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	539	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			ATTTTTGATGGTCTCTGCCTC	0.383																																						dbGAP											0													203.0	201.0	202.0					18																	28659860		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1616C>T	18.37:g.28659860G>A	ENSP00000280904:p.Thr539Ile			Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin,prints_Desmo_cadherin	p.T539I	ENST00000280904.6	37	c.1616	CCDS11892.1	18	.	.	.	.	.	.	.	.	.	.	G	6.045	0.376590	0.11466	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.60040	0.25;0.22	5.43	-1.52	0.08637	Cadherin (4);Cadherin-like (1);	1.423870	0.05270	N	0.517400	T	0.50171	0.1600	M	0.69823	2.125	0.09310	N	1	B;B	0.34061	0.436;0.382	B;B	0.32342	0.144;0.089	T	0.27938	-1.0059	10	0.22706	T	0.39	.	4.1282	0.10138	0.0746:0.2293:0.2006:0.4954	.	539;539	Q02487;Q02487-2	DSC2_HUMAN;.	I	539;539;305;552	ENSP00000251081:T539I;ENSP00000280904:T539I	ENSP00000251081:T539I	T	-	2	0	DSC2	26913858	0.000000	0.05858	0.002000	0.10522	0.609000	0.37215	0.043000	0.13971	-0.277000	0.09193	0.491000	0.48974	ACC	DSC2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000134755		0.383	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	HGNC	protein_coding	OTTHUMT00000254943.1	174	0.00	0	G	NM_004949		28659860	28659860	-1	no_errors	ENST00000280904	ensembl	human	known	69_37n	missense	269	29.02	110	SNP	0.000	A
EPB41L5	57669	genome.wustl.edu	37	2	120918514	120918514	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:120918514G>T	ENST00000263713.5	+	21	2065	c.1851G>T	c.(1849-1851)atG>atT	p.M617I	EPB41L5_ENST00000443902.2_Missense_Mutation_p.M617I|EPB41L5_ENST00000488691.1_3'UTR|EPB41L5_ENST00000452780.1_Missense_Mutation_p.M617I	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	617					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						AGACTCTGATGCTTATCACAC	0.373																																						dbGAP											0													134.0	140.0	138.0					2																	120918514		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1851G>T	2.37:g.120918514G>T	ENSP00000263713:p.Met617Ile		Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.M617I	ENST00000263713.5	37	c.1851	CCDS2130.1	2	.	.	.	.	.	.	.	.	.	.	G	3.528	-0.096286	0.07010	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000452780	T;T;T	0.80738	-1.39;-1.41;-1.39	5.46	-5.72	0.02406	.	2.445710	0.01217	N	0.007992	T	0.60011	0.2236	N	0.14661	0.345	0.09310	N	1	B;B;B	0.12013	0.001;0.0;0.005	B;B;B	0.09377	0.002;0.001;0.004	T	0.50448	-0.8827	10	0.16420	T	0.52	.	4.1702	0.10326	0.5806:0.1172:0.1836:0.1187	.	617;617;617	Q9HCM4-3;Q9HCM4-4;Q9HCM4	.;.;E41L5_HUMAN	I	617	ENSP00000263713:M617I;ENSP00000393856:M617I;ENSP00000390439:M617I	ENSP00000263713:M617I	M	+	3	0	EPB41L5	120634984	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.706000	0.05047	-1.101000	0.03027	-1.879000	0.00546	ATG	EPB41L5	-	NULL	ENSG00000115109		0.373	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	247	0.00	0	G	NM_020909		120918514	120918514	+1	no_errors	ENST00000263713	ensembl	human	known	69_37n	missense	283	16.52	56	SNP	0.000	T
EPB41L5	57669	genome.wustl.edu	37	2	120918514	120918514	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:120918514G>T	ENST00000263713.5	+	21	2065	c.1851G>T	c.(1849-1851)atG>atT	p.M617I	EPB41L5_ENST00000443902.2_Missense_Mutation_p.M617I|EPB41L5_ENST00000488691.1_3'UTR|EPB41L5_ENST00000452780.1_Missense_Mutation_p.M617I	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	617					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						AGACTCTGATGCTTATCACAC	0.373																																						dbGAP											0													134.0	140.0	138.0					2																	120918514		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1851G>T	2.37:g.120918514G>T	ENSP00000263713:p.Met617Ile		Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.M617I	ENST00000263713.5	37	c.1851	CCDS2130.1	2	.	.	.	.	.	.	.	.	.	.	G	3.528	-0.096286	0.07010	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000452780	T;T;T	0.80738	-1.39;-1.41;-1.39	5.46	-5.72	0.02406	.	2.445710	0.01217	N	0.007992	T	0.60011	0.2236	N	0.14661	0.345	0.09310	N	1	B;B;B	0.12013	0.001;0.0;0.005	B;B;B	0.09377	0.002;0.001;0.004	T	0.50448	-0.8827	10	0.16420	T	0.52	.	4.1702	0.10326	0.5806:0.1172:0.1836:0.1187	.	617;617;617	Q9HCM4-3;Q9HCM4-4;Q9HCM4	.;.;E41L5_HUMAN	I	617	ENSP00000263713:M617I;ENSP00000393856:M617I;ENSP00000390439:M617I	ENSP00000263713:M617I	M	+	3	0	EPB41L5	120634984	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.706000	0.05047	-1.101000	0.03027	-1.879000	0.00546	ATG	EPB41L5	-	NULL	ENSG00000115109		0.373	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	224	0.44	1	G	NM_020909		120918514	120918514	+1	no_errors	ENST00000263713	ensembl	human	known	69_37n	missense	283	16.52	56	SNP	0.000	T
FAM21A	387680	genome.wustl.edu	37	10	51853633	51853633	+	Missense_Mutation	SNP	C	C	T	rs199520696	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr10:51853633C>T	ENST00000282633.5	+	13	1181	c.1136C>T	c.(1135-1137)aCg>aTg	p.T379M	FAM21A_ENST00000399339.2_Missense_Mutation_p.T291M|FAM21A_ENST00000314664.7_Missense_Mutation_p.T379M|FAM21A_ENST00000351071.6_Missense_Mutation_p.T379M	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	379					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						GACCTCTTCACGGAAGCCCCC	0.488																																						dbGAP											0													1.0	1.0	1.0					10																	51853633		353	936	1289	-	-	-	SO:0001583	missense	0			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1136C>T	10.37:g.51853633C>T	ENSP00000282633:p.Thr379Met		A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	NULL	p.T379M	ENST00000282633.5	37	c.1136	CCDS41527.1	10	.	.	.	.	.	.	.	.	.	.	C	6.414	0.444490	0.12164	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.88	-5.37	0.02681	.	0.781535	0.12699	N	0.446536	T	0.14527	0.0351	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.29253	0.05;0.02;0.005;0.02;0.239	B;B;B;B;B	0.16722	0.013;0.013;0.003;0.013;0.016	T	0.05767	-1.0865	9	0.42905	T	0.14	2.3495	2.2948	0.04147	0.3714:0.2592:0.2739:0.0955	.	379;379;291;379;273	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	M	379;379;273;379;291	.	ENSP00000282633:T379M	T	+	2	0	FAM21A	51523639	0.024000	0.19004	0.096000	0.21009	0.033000	0.12548	-0.884000	0.04166	-1.796000	0.01253	-1.109000	0.02080	ACG	FAM21A	-	NULL	ENSG00000099290		0.488	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM21A	HGNC	protein_coding	OTTHUMT00000276917.2	44	0.00	0	C	NM_001005751		51853633	51853633	+1	no_errors	ENST00000282633	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	0.370	T
FHDC1	85462	genome.wustl.edu	37	4	153893569	153893570	+	Frame_Shift_Del	DEL	AA	AA	-	rs61750794	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr4:153893569_153893570delAA	ENST00000511601.1	+	11	1447_1448	c.1259_1260delAA	c.(1258-1260)caafs	p.Q420fs	FHDC1_ENST00000260008.3_Frame_Shift_Del_p.Q420fs			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	420	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.								ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					TGCTGGAAACAAGAGCTCCAGG	0.436																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.1259_1260delAA	4.37:g.153893569_153893570delAA	ENSP00000427567:p.Gln420fs			Frame_Shift_Del	DEL	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.Q420fs	ENST00000511601.1	37	c.1259_1260	CCDS34081.1	4																																																																																			FHDC1	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000137460		0.436	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	82	0.00	0	AA	NM_033393		153893569	153893570	+1	no_errors	ENST00000260008	ensembl	human	known	69_37n	frame_shift_del	75	16.67	15	DEL	0.105:0.098	-
FHDC1	85462	genome.wustl.edu	37	4	153893569	153893570	+	Frame_Shift_Del	DEL	AA	AA	-	rs61750794	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr4:153893569_153893570delAA	ENST00000511601.1	+	11	1447_1448	c.1259_1260delAA	c.(1258-1260)caafs	p.Q420fs	FHDC1_ENST00000260008.3_Frame_Shift_Del_p.Q420fs			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	420	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.								ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					TGCTGGAAACAAGAGCTCCAGG	0.436																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.1259_1260delAA	4.37:g.153893569_153893570delAA	ENSP00000427567:p.Gln420fs			Frame_Shift_Del	DEL	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.Q420fs	ENST00000511601.1	37	c.1259_1260	CCDS34081.1	4																																																																																			FHDC1	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000137460		0.436	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	121	0.00	0	AA	NM_033393		153893569	153893570	+1	no_errors	ENST00000260008	ensembl	human	known	69_37n	frame_shift_del	75	16.67	15	DEL	0.105:0.098	-
GATA3	2625	genome.wustl.edu	37	10	8115941	8115942	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr10:8115941_8115942insT	ENST00000346208.3	+	6	1742_1743	c.1287_1288insT	c.(1288-1290)tttfs	p.F430fs	GATA3_ENST00000379328.3_Frame_Shift_Ins_p.F431fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	430					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.F431fs*>14(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CCAGCCTGTCCTTTGGACCACA	0.639			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1290dupT	10.37:g.8115944_8115944dupT	ENSP00000341619:p.Phe430fs		Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.G431fs	ENST00000346208.3	37	c.1290_1291	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.639	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	84	0.00	0	-	NM_001002295		8115941	8115942	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	108	21.74	30	INS	1.000:1.000	T
GATA3	2625	genome.wustl.edu	37	10	8115941	8115942	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr10:8115941_8115942insT	ENST00000346208.3	+	6	1742_1743	c.1287_1288insT	c.(1288-1290)tttfs	p.F430fs	GATA3_ENST00000379328.3_Frame_Shift_Ins_p.F431fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	430					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.F431fs*>14(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CCAGCCTGTCCTTTGGACCACA	0.639			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1290dupT	10.37:g.8115944_8115944dupT	ENSP00000341619:p.Phe430fs		Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.G431fs	ENST00000346208.3	37	c.1290_1291	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.639	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	86	0.00	0	-	NM_001002295		8115941	8115942	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	108	21.74	30	INS	1.000:1.000	T
GINM1	116254	genome.wustl.edu	37	6	149893676	149893676	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr6:149893676G>A	ENST00000367419.5	+	3	335	c.214G>A	c.(214-216)Gtg>Atg	p.V72M	RP1-12G14.6_ENST00000435273.2_RNA	NM_138785.3	NP_620140.1	Q9NU53	GINM1_HUMAN	glycoprotein integral membrane 1	72						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GAGTGGACAGGTGTATGTAAA	0.313																																						dbGAP											0													122.0	125.0	124.0					6																	149893676		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211			21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72			Standard	NM_138785		Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.214G>A	6.37:g.149893676G>A	ENSP00000356389:p.Val72Met		B2RDY7|E1P5A2	Missense_Mutation	SNP	NULL	p.V72M	ENST00000367419.5	37	c.214	CCDS5216.1	6	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731142	0.69189	.	.	ENSG00000055211	ENST00000367419	.	.	.	5.84	3.84	0.44239	.	0.221034	0.39341	N	0.001399	T	0.54565	0.1866	M	0.69823	2.125	0.38568	D	0.949863	D	0.56746	0.977	P	0.54100	0.742	T	0.59172	-0.7504	8	.	.	.	-4.6596	9.8941	0.41306	0.2033:0.0:0.7967:0.0	.	72	Q9NU53	CF072_HUMAN	M	72	.	.	V	+	1	0	C6orf72	149935369	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.719000	0.38011	1.480000	0.48289	0.650000	0.86243	GTG	GINM1	-	NULL	ENSG00000055211		0.313	GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINM1	HGNC	protein_coding	OTTHUMT00000042644.1	82	0.00	0	G	NM_138785		149893676	149893676	+1	no_errors	ENST00000367419	ensembl	human	known	69_37n	missense	73	22.34	21	SNP	1.000	A
GINM1	116254	genome.wustl.edu	37	6	149893676	149893676	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr6:149893676G>A	ENST00000367419.5	+	3	335	c.214G>A	c.(214-216)Gtg>Atg	p.V72M	RP1-12G14.6_ENST00000435273.2_RNA	NM_138785.3	NP_620140.1	Q9NU53	GINM1_HUMAN	glycoprotein integral membrane 1	72						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GAGTGGACAGGTGTATGTAAA	0.313																																						dbGAP											0													122.0	125.0	124.0					6																	149893676		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211			21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72			Standard	NM_138785		Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.214G>A	6.37:g.149893676G>A	ENSP00000356389:p.Val72Met		B2RDY7|E1P5A2	Missense_Mutation	SNP	NULL	p.V72M	ENST00000367419.5	37	c.214	CCDS5216.1	6	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731142	0.69189	.	.	ENSG00000055211	ENST00000367419	.	.	.	5.84	3.84	0.44239	.	0.221034	0.39341	N	0.001399	T	0.54565	0.1866	M	0.69823	2.125	0.38568	D	0.949863	D	0.56746	0.977	P	0.54100	0.742	T	0.59172	-0.7504	8	.	.	.	-4.6596	9.8941	0.41306	0.2033:0.0:0.7967:0.0	.	72	Q9NU53	CF072_HUMAN	M	72	.	.	V	+	1	0	C6orf72	149935369	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.719000	0.38011	1.480000	0.48289	0.650000	0.86243	GTG	GINM1	-	NULL	ENSG00000055211		0.313	GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINM1	HGNC	protein_coding	OTTHUMT00000042644.1	119	0.00	0	G	NM_138785		149893676	149893676	+1	no_errors	ENST00000367419	ensembl	human	known	69_37n	missense	73	22.34	21	SNP	1.000	A
GPR107	57720	genome.wustl.edu	37	9	132863474	132863474	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr9:132863474A>T	ENST00000372406.1	+	12	1610	c.1103A>T	c.(1102-1104)aAg>aTg	p.K368M	GPR107_ENST00000372410.3_Missense_Mutation_p.K368M|GPR107_ENST00000347136.6_Missense_Mutation_p.K368M	NM_001136557.1	NP_001130029.1	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107	368						integral component of membrane (GO:0016021)				endometrium(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	11		Ovarian(14;0.000531)				AAAGACAAAAAGATCTTCATG	0.458																																						dbGAP											0													184.0	175.0	178.0					9																	132863474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF376725	CCDS35162.1, CCDS48041.1, CCDS48042.1	9q34.2	2014-01-30			ENSG00000148358	ENSG00000148358		"""GPCR / Unclassified : 7TM orphan receptors"""	17830	protein-coding gene	gene with protein product							Standard	NM_020960		Approved	KIAA1624, RP11-88G17, FLJ20998, LUSTR1	uc004bzd.2	Q5VW38	OTTHUMG00000020804	ENST00000372406.1:c.1103A>T	9.37:g.132863474A>T	ENSP00000361483:p.Lys368Met		A6NJ53|Q2TB81|Q5JPA3|Q5VW39|Q96T26|Q9H658|Q9HCE8	Missense_Mutation	SNP	pfam_TM_rcpt_euk,pfam_Rhodopsin-like_GPCR_TM_domain	p.K368M	ENST00000372406.1	37	c.1103	CCDS48041.1	9	.	.	.	.	.	.	.	.	.	.	A	28.7	4.944404	0.92593	.	.	ENSG00000148358	ENST00000372406;ENST00000347136;ENST00000372410;ENST00000455412	T;T;T	0.32515	1.45;1.46;1.47	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.62780	0.2456	M	0.88181	2.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.70296	-0.4911	10	0.87932	D	0	-20.2588	15.2294	0.73374	1.0:0.0:0.0:0.0	.	368;368;368	G5E994;Q5VW38;Q5VW38-2	.;GP107_HUMAN;.	M	368	ENSP00000361483:K368M;ENSP00000336988:K368M;ENSP00000361487:K368M	ENSP00000336988:K368M	K	+	2	0	GPR107	131903295	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.598000	0.90852	2.265000	0.75225	0.482000	0.46254	AAG	GPR107	-	pfam_TM_rcpt_euk,pfam_Rhodopsin-like_GPCR_TM_domain	ENSG00000148358		0.458	GPR107-003	NOVEL	basic|CCDS	protein_coding	GPR107	HGNC	protein_coding	OTTHUMT00000054643.2	198	0.00	0	A			132863474	132863474	+1	no_errors	ENST00000372406	ensembl	human	known	69_37n	missense	139	27.23	52	SNP	1.000	T
GPR107	57720	genome.wustl.edu	37	9	132863474	132863474	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr9:132863474A>T	ENST00000372406.1	+	12	1610	c.1103A>T	c.(1102-1104)aAg>aTg	p.K368M	GPR107_ENST00000372410.3_Missense_Mutation_p.K368M|GPR107_ENST00000347136.6_Missense_Mutation_p.K368M	NM_001136557.1	NP_001130029.1	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107	368						integral component of membrane (GO:0016021)				endometrium(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	11		Ovarian(14;0.000531)				AAAGACAAAAAGATCTTCATG	0.458																																						dbGAP											0													184.0	175.0	178.0					9																	132863474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF376725	CCDS35162.1, CCDS48041.1, CCDS48042.1	9q34.2	2014-01-30			ENSG00000148358	ENSG00000148358		"""GPCR / Unclassified : 7TM orphan receptors"""	17830	protein-coding gene	gene with protein product							Standard	NM_020960		Approved	KIAA1624, RP11-88G17, FLJ20998, LUSTR1	uc004bzd.2	Q5VW38	OTTHUMG00000020804	ENST00000372406.1:c.1103A>T	9.37:g.132863474A>T	ENSP00000361483:p.Lys368Met		A6NJ53|Q2TB81|Q5JPA3|Q5VW39|Q96T26|Q9H658|Q9HCE8	Missense_Mutation	SNP	pfam_TM_rcpt_euk,pfam_Rhodopsin-like_GPCR_TM_domain	p.K368M	ENST00000372406.1	37	c.1103	CCDS48041.1	9	.	.	.	.	.	.	.	.	.	.	A	28.7	4.944404	0.92593	.	.	ENSG00000148358	ENST00000372406;ENST00000347136;ENST00000372410;ENST00000455412	T;T;T	0.32515	1.45;1.46;1.47	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.62780	0.2456	M	0.88181	2.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.70296	-0.4911	10	0.87932	D	0	-20.2588	15.2294	0.73374	1.0:0.0:0.0:0.0	.	368;368;368	G5E994;Q5VW38;Q5VW38-2	.;GP107_HUMAN;.	M	368	ENSP00000361483:K368M;ENSP00000336988:K368M;ENSP00000361487:K368M	ENSP00000336988:K368M	K	+	2	0	GPR107	131903295	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.598000	0.90852	2.265000	0.75225	0.482000	0.46254	AAG	GPR107	-	pfam_TM_rcpt_euk,pfam_Rhodopsin-like_GPCR_TM_domain	ENSG00000148358		0.458	GPR107-003	NOVEL	basic|CCDS	protein_coding	GPR107	HGNC	protein_coding	OTTHUMT00000054643.2	122	0.81	1	A			132863474	132863474	+1	no_errors	ENST00000372406	ensembl	human	known	69_37n	missense	139	27.23	52	SNP	1.000	T
GRID1	2894	genome.wustl.edu	37	10	87898775	87898775	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr10:87898775C>T	ENST00000327946.7	-	4	612	c.527G>A	c.(526-528)cGt>cAt	p.R176H		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	176					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TTGAAGCCCACGGATATCTGA	0.507										Multiple Myeloma(13;0.14)																												dbGAP											0													113.0	110.0	111.0					10																	87898775		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.527G>A	10.37:g.87898775C>T	ENSP00000330148:p.Arg176His		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R176H	ENST00000327946.7	37	c.527	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	c	26.3	4.725789	0.89298	.	.	ENSG00000182771	ENST00000327946	D	0.83250	-1.7	5.13	5.13	0.70059	Extracellular ligand-binding receptor (1);	0.116529	0.64402	D	0.000014	D	0.89774	0.6812	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89320	0.3639	10	0.44086	T	0.13	.	17.672	0.88221	0.0:1.0:0.0:0.0	.	176	Q9ULK0	GRID1_HUMAN	H	176	ENSP00000330148:R176H	ENSP00000330148:R176H	R	-	2	0	GRID1	87888755	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.785000	0.85724	2.409000	0.81822	0.544000	0.68410	CGT	GRID1	-	pfam_ANF_lig-bd_rcpt	ENSG00000182771		0.507	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	121	0.00	0	C	XM_043613		87898775	87898775	-1	no_errors	ENST00000327946	ensembl	human	known	69_37n	missense	109	22.70	32	SNP	1.000	T
GRID1	2894	genome.wustl.edu	37	10	87898775	87898775	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr10:87898775C>T	ENST00000327946.7	-	4	612	c.527G>A	c.(526-528)cGt>cAt	p.R176H		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	176					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TTGAAGCCCACGGATATCTGA	0.507										Multiple Myeloma(13;0.14)																												dbGAP											0													113.0	110.0	111.0					10																	87898775		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.527G>A	10.37:g.87898775C>T	ENSP00000330148:p.Arg176His		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R176H	ENST00000327946.7	37	c.527	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	c	26.3	4.725789	0.89298	.	.	ENSG00000182771	ENST00000327946	D	0.83250	-1.7	5.13	5.13	0.70059	Extracellular ligand-binding receptor (1);	0.116529	0.64402	D	0.000014	D	0.89774	0.6812	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89320	0.3639	10	0.44086	T	0.13	.	17.672	0.88221	0.0:1.0:0.0:0.0	.	176	Q9ULK0	GRID1_HUMAN	H	176	ENSP00000330148:R176H	ENSP00000330148:R176H	R	-	2	0	GRID1	87888755	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.785000	0.85724	2.409000	0.81822	0.544000	0.68410	CGT	GRID1	-	pfam_ANF_lig-bd_rcpt	ENSG00000182771		0.507	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	133	0.00	0	C	XM_043613		87898775	87898775	-1	no_errors	ENST00000327946	ensembl	human	known	69_37n	missense	109	22.70	32	SNP	1.000	T
MROH2B	133558	genome.wustl.edu	37	5	41058279	41058279	+	Silent	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr5:41058279C>T	ENST00000399564.4	-	7	1092	c.642G>A	c.(640-642)ggG>ggA	p.G214G	MROH2B_ENST00000506092.2_5'UTR	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	214																	TCACCGTGGGCCCGTGGGCCT	0.502																																						dbGAP											0													59.0	58.0	58.0					5																	41058279		1924	4137	6061	-	-	-	SO:0001819	synonymous_variant	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.642G>A	5.37:g.41058279C>T			Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	superfamily_ARM-type_fold	p.G214	ENST00000399564.4	37	c.642	CCDS47202.1	5																																																																																			HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.502	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	84	0.00	0	C	NM_173489		41058279	41058279	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	silent	68	22.73	20	SNP	0.998	T
MROH2B	133558	genome.wustl.edu	37	5	41058279	41058279	+	Silent	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr5:41058279C>T	ENST00000399564.4	-	7	1092	c.642G>A	c.(640-642)ggG>ggA	p.G214G	MROH2B_ENST00000506092.2_5'UTR	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	214																	TCACCGTGGGCCCGTGGGCCT	0.502																																						dbGAP											0													59.0	58.0	58.0					5																	41058279		1924	4137	6061	-	-	-	SO:0001819	synonymous_variant	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.642G>A	5.37:g.41058279C>T			Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	superfamily_ARM-type_fold	p.G214	ENST00000399564.4	37	c.642	CCDS47202.1	5																																																																																			HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.502	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	65	0.00	0	C	NM_173489		41058279	41058279	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	silent	68	22.73	20	SNP	0.998	T
ILF2	3608	genome.wustl.edu	37	1	153635021	153635021	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:153635021C>A	ENST00000361891.4	-	14	1149	c.1024G>T	c.(1024-1026)Gaa>Taa	p.E342*	ILF2_ENST00000480213.1_5'UTR	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	342	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTAGATATTTCAGAAGCAAGA	0.388																																						dbGAP											0													122.0	121.0	121.0					1																	153635021		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.1024G>T	1.37:g.153635021C>A	ENSP00000355011:p.Glu342*		A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	Nonsense_Mutation	SNP	pfam_DZF,smart_DZF,pfscan_2-5-oligoadenylate_synth_N	p.E342*	ENST00000361891.4	37	c.1024	CCDS1050.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.932323	0.97116	.	.	ENSG00000143621	ENST00000361891	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-10.4016	16.6653	0.85252	0.0:1.0:0.0:0.0	.	.	.	.	X	342	.	ENSP00000355011:E342X	E	-	1	0	ILF2	151901645	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.149000	0.71795	2.806000	0.96561	0.655000	0.94253	GAA	ILF2	-	NULL	ENSG00000143621		0.388	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF2	HGNC	protein_coding	OTTHUMT00000090040.1	225	0.00	0	C	NM_004515		153635021	153635021	-1	no_errors	ENST00000361891	ensembl	human	known	69_37n	nonsense	199	16.74	40	SNP	1.000	A
ILF2	3608	genome.wustl.edu	37	1	153635021	153635021	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:153635021C>A	ENST00000361891.4	-	14	1149	c.1024G>T	c.(1024-1026)Gaa>Taa	p.E342*	ILF2_ENST00000480213.1_5'UTR	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	342	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTAGATATTTCAGAAGCAAGA	0.388																																						dbGAP											0													122.0	121.0	121.0					1																	153635021		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.1024G>T	1.37:g.153635021C>A	ENSP00000355011:p.Glu342*		A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	Nonsense_Mutation	SNP	pfam_DZF,smart_DZF,pfscan_2-5-oligoadenylate_synth_N	p.E342*	ENST00000361891.4	37	c.1024	CCDS1050.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.932323	0.97116	.	.	ENSG00000143621	ENST00000361891	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-10.4016	16.6653	0.85252	0.0:1.0:0.0:0.0	.	.	.	.	X	342	.	ENSP00000355011:E342X	E	-	1	0	ILF2	151901645	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.149000	0.71795	2.806000	0.96561	0.655000	0.94253	GAA	ILF2	-	NULL	ENSG00000143621		0.388	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF2	HGNC	protein_coding	OTTHUMT00000090040.1	360	0.00	0	C	NM_004515		153635021	153635021	-1	no_errors	ENST00000361891	ensembl	human	known	69_37n	nonsense	199	16.74	40	SNP	1.000	A
HLX	3142	genome.wustl.edu	37	1	221055680	221055680	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:221055680C>T	ENST00000366903.6	+	3	2448	c.947C>T	c.(946-948)aCg>aTg	p.T316M	HLX_ENST00000549319.1_Missense_Mutation_p.T102M|HLA-AS1_ENST00000552026.1_RNA	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	316					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T316M(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		CTGGGCCTCACGGACGCACAG	0.632																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											45.0	40.0	41.0					1																	221055680		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.947C>T	1.37:g.221055680C>T	ENSP00000355870:p.Thr316Met		B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.T316M	ENST00000366903.6	37	c.947	CCDS1527.1	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787392	0.90367	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	D;D;D	0.96459	-4.02;-4.02;-4.02	5.9	5.9	0.94986	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.093858	0.44097	D	0.000481	D	0.97707	0.9248	M	0.87682	2.9	0.58432	D	0.999999	P	0.46706	0.883	P	0.50405	0.64	D	0.98083	1.0405	10	0.87932	D	0	-18.9445	20.3436	0.98782	0.0:1.0:0.0:0.0	.	316	Q14774	HLX_HUMAN	M	316;49;102	ENSP00000355870:T316M;ENSP00000408248:T49M;ENSP00000449882:T102M	ENSP00000355870:T316M	T	+	2	0	HLX	219122303	1.000000	0.71417	0.967000	0.41034	0.594000	0.36715	6.072000	0.71238	2.821000	0.97095	0.555000	0.69702	ACG	HLX	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	ENSG00000136630		0.632	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLX	HGNC	protein_coding	OTTHUMT00000090902.3	38	0.00	0	C	NM_021958		221055680	221055680	+1	no_errors	ENST00000366903	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	T
HLX	3142	genome.wustl.edu	37	1	221055680	221055680	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:221055680C>T	ENST00000366903.6	+	3	2448	c.947C>T	c.(946-948)aCg>aTg	p.T316M	HLX_ENST00000549319.1_Missense_Mutation_p.T102M|HLA-AS1_ENST00000552026.1_RNA	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	316					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T316M(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		CTGGGCCTCACGGACGCACAG	0.632																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											45.0	40.0	41.0					1																	221055680		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.947C>T	1.37:g.221055680C>T	ENSP00000355870:p.Thr316Met		B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.T316M	ENST00000366903.6	37	c.947	CCDS1527.1	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787392	0.90367	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	D;D;D	0.96459	-4.02;-4.02;-4.02	5.9	5.9	0.94986	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.093858	0.44097	D	0.000481	D	0.97707	0.9248	M	0.87682	2.9	0.58432	D	0.999999	P	0.46706	0.883	P	0.50405	0.64	D	0.98083	1.0405	10	0.87932	D	0	-18.9445	20.3436	0.98782	0.0:1.0:0.0:0.0	.	316	Q14774	HLX_HUMAN	M	316;49;102	ENSP00000355870:T316M;ENSP00000408248:T49M;ENSP00000449882:T102M	ENSP00000355870:T316M	T	+	2	0	HLX	219122303	1.000000	0.71417	0.967000	0.41034	0.594000	0.36715	6.072000	0.71238	2.821000	0.97095	0.555000	0.69702	ACG	HLX	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	ENSG00000136630		0.632	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLX	HGNC	protein_coding	OTTHUMT00000090902.3	27	0.00	0	C	NM_021958		221055680	221055680	+1	no_errors	ENST00000366903	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	T
ITGB7	3695	genome.wustl.edu	37	12	53587622	53587622	+	Silent	SNP	G	G	T	rs368927212		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr12:53587622G>T	ENST00000267082.5	-	11	1603	c.1372C>A	c.(1372-1374)Cgg>Agg	p.R458R	ITGB7_ENST00000422257.3_Silent_p.R458R|ITGB7_ENST00000338737.4_Silent_p.R458R|ITGB7_ENST00000550743.2_Silent_p.R458R	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	458					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCAAGGGCCCGGAGCCTCAGG	0.577																																						dbGAP											0													55.0	59.0	58.0					12																	53587622		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.1372C>A	12.37:g.53587622G>T			Q9UCP7|Q9UCS7	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Plexin-like_fold,superfamily_Integrin_bsu_tail,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.R458	ENST00000267082.5	37	c.1372	CCDS8849.1	12																																																																																			ITGB7	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000139626		0.577	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB7	HGNC	protein_coding	OTTHUMT00000405821.2	43	0.00	0	G			53587622	53587622	-1	no_errors	ENST00000267082	ensembl	human	known	69_37n	silent	42	14.29	7	SNP	1.000	T
KIAA1524	57650	genome.wustl.edu	37	3	108287044	108287044	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr3:108287044T>A	ENST00000295746.8	-	10	1307	c.1231A>T	c.(1231-1233)Aaa>Taa	p.K411*	KIAA1524_ENST00000491772.1_Nonsense_Mutation_p.K252*|KIAA1524_ENST00000487834.1_5'UTR	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	411					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCACATTTTTTTCTTGTTAAA	0.358																																						dbGAP											0													138.0	138.0	138.0					3																	108287044		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.1231A>T	3.37:g.108287044T>A	ENSP00000295746:p.Lys411*		A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.K411*	ENST00000295746.8	37	c.1231	CCDS33812.1	3	.	.	.	.	.	.	.	.	.	.	T	38	6.786943	0.97837	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	.	.	.	5.91	5.91	0.95273	.	0.081669	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4834	16.3453	0.83126	0.0:0.0:0.0:1.0	.	.	.	.	X	252;411	.	ENSP00000295746:K411X	K	-	1	0	KIAA1524	109769734	1.000000	0.71417	0.982000	0.44146	0.968000	0.65278	6.113000	0.71553	2.261000	0.74972	0.533000	0.62120	AAA	KIAA1524	-	superfamily_ARM-type_fold	ENSG00000163507		0.358	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1524	HGNC	protein_coding	OTTHUMT00000353975.2	170	0.00	0	T	NM_020890		108287044	108287044	-1	no_errors	ENST00000295746	ensembl	human	known	69_37n	nonsense	153	25.96	54	SNP	1.000	A
KIAA1524	57650	genome.wustl.edu	37	3	108287044	108287044	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr3:108287044T>A	ENST00000295746.8	-	10	1307	c.1231A>T	c.(1231-1233)Aaa>Taa	p.K411*	KIAA1524_ENST00000491772.1_Nonsense_Mutation_p.K252*|KIAA1524_ENST00000487834.1_5'UTR	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	411					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCACATTTTTTTCTTGTTAAA	0.358																																						dbGAP											0													138.0	138.0	138.0					3																	108287044		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.1231A>T	3.37:g.108287044T>A	ENSP00000295746:p.Lys411*		A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.K411*	ENST00000295746.8	37	c.1231	CCDS33812.1	3	.	.	.	.	.	.	.	.	.	.	T	38	6.786943	0.97837	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	.	.	.	5.91	5.91	0.95273	.	0.081669	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4834	16.3453	0.83126	0.0:0.0:0.0:1.0	.	.	.	.	X	252;411	.	ENSP00000295746:K411X	K	-	1	0	KIAA1524	109769734	1.000000	0.71417	0.982000	0.44146	0.968000	0.65278	6.113000	0.71553	2.261000	0.74972	0.533000	0.62120	AAA	KIAA1524	-	superfamily_ARM-type_fold	ENSG00000163507		0.358	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1524	HGNC	protein_coding	OTTHUMT00000353975.2	134	0.00	0	T	NM_020890		108287044	108287044	-1	no_errors	ENST00000295746	ensembl	human	known	69_37n	nonsense	153	25.96	54	SNP	1.000	A
KIF1C	10749	genome.wustl.edu	37	17	4906970	4906970	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr17:4906970G>A	ENST00000320785.5	+	9	1141	c.784G>A	c.(784-786)Ggc>Agc	p.G262S		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	262	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						AGGGGCCCGGGGCATGCGCCT	0.602																																					Melanoma(96;1023 1447 10250 19259 33730)	dbGAP											0													40.0	48.0	45.0					17																	4906970		2203	4300	6503	-	-	-	SO:0001583	missense	0			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.784G>A	17.37:g.4906970G>A	ENSP00000320821:p.Gly262Ser		D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G262S	ENST00000320785.5	37	c.784	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.718806	0.96839	.	.	ENSG00000129250	ENST00000320785	D	0.90955	-2.76	5.66	5.66	0.87406	Kinesin, motor domain (4);	.	.	.	.	D	0.96266	0.8782	M	0.90425	3.115	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.96582	0.9431	9	0.87932	D	0	.	17.6164	0.88068	0.0:0.0:1.0:0.0	.	262	O43896	KIF1C_HUMAN	S	262	ENSP00000320821:G262S	ENSP00000320821:G262S	G	+	1	0	KIF1C	4847694	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.823000	0.99369	2.842000	0.97951	0.655000	0.94253	GGC	KIF1C	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000129250		0.602	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	HGNC	protein_coding	OTTHUMT00000216916.1	25	0.00	0	G			4906970	4906970	+1	no_errors	ENST00000320785	ensembl	human	known	69_37n	missense	8	42.86	6	SNP	1.000	A
KIF1C	10749	genome.wustl.edu	37	17	4906970	4906970	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr17:4906970G>A	ENST00000320785.5	+	9	1141	c.784G>A	c.(784-786)Ggc>Agc	p.G262S		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	262	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						AGGGGCCCGGGGCATGCGCCT	0.602																																					Melanoma(96;1023 1447 10250 19259 33730)	dbGAP											0													40.0	48.0	45.0					17																	4906970		2203	4300	6503	-	-	-	SO:0001583	missense	0			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.784G>A	17.37:g.4906970G>A	ENSP00000320821:p.Gly262Ser		D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G262S	ENST00000320785.5	37	c.784	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.718806	0.96839	.	.	ENSG00000129250	ENST00000320785	D	0.90955	-2.76	5.66	5.66	0.87406	Kinesin, motor domain (4);	.	.	.	.	D	0.96266	0.8782	M	0.90425	3.115	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.96582	0.9431	9	0.87932	D	0	.	17.6164	0.88068	0.0:0.0:1.0:0.0	.	262	O43896	KIF1C_HUMAN	S	262	ENSP00000320821:G262S	ENSP00000320821:G262S	G	+	1	0	KIF1C	4847694	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.823000	0.99369	2.842000	0.97951	0.655000	0.94253	GGC	KIF1C	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000129250		0.602	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	HGNC	protein_coding	OTTHUMT00000216916.1	24	0.00	0	G			4906970	4906970	+1	no_errors	ENST00000320785	ensembl	human	known	69_37n	missense	8	42.86	6	SNP	1.000	A
LIX1	167410	genome.wustl.edu	37	5	96430596	96430596	+	Silent	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr5:96430596G>T	ENST00000274382.4	-	6	1000	c.705C>A	c.(703-705)gcC>gcA	p.A235A	CTD-2215E18.1_ENST00000509481.1_Intron	NM_153234.4	NP_694966.3	Q8N485	LIX1_HUMAN	Lix1 homolog (chicken)	235										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)	10		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)		CTGCTTTCCTGGCTTCCTCCA	0.512																																						dbGAP											0													118.0	121.0	120.0					5																	96430596		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4088.1	5q15	2008-03-06	2008-03-06	2005-02-07	ENSG00000145721	ENSG00000145721			18581	protein-coding gene	gene with protein product		610466	"""chromosome 5 open reading frame 11"", ""Lix1 homolog (mouse)"""	C5orf11		11731258	Standard	NM_153234		Approved		uc003kmy.4	Q8N485	OTTHUMG00000128720	ENST00000274382.4:c.705C>A	5.37:g.96430596G>T			A8K4R9|Q8N7I2	Silent	SNP	NULL	p.A235	ENST00000274382.4	37	c.705	CCDS4088.1	5																																																																																			LIX1	-	NULL	ENSG00000145721		0.512	LIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIX1	HGNC	protein_coding	OTTHUMT00000250625.1	186	0.00	0	G	NM_153234		96430596	96430596	-1	no_errors	ENST00000274382	ensembl	human	known	69_37n	silent	192	27.44	73	SNP	1.000	T
LIX1	167410	genome.wustl.edu	37	5	96430596	96430596	+	Silent	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr5:96430596G>T	ENST00000274382.4	-	6	1000	c.705C>A	c.(703-705)gcC>gcA	p.A235A	CTD-2215E18.1_ENST00000509481.1_Intron	NM_153234.4	NP_694966.3	Q8N485	LIX1_HUMAN	Lix1 homolog (chicken)	235										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)	10		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)		CTGCTTTCCTGGCTTCCTCCA	0.512																																						dbGAP											0													118.0	121.0	120.0					5																	96430596		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4088.1	5q15	2008-03-06	2008-03-06	2005-02-07	ENSG00000145721	ENSG00000145721			18581	protein-coding gene	gene with protein product		610466	"""chromosome 5 open reading frame 11"", ""Lix1 homolog (mouse)"""	C5orf11		11731258	Standard	NM_153234		Approved		uc003kmy.4	Q8N485	OTTHUMG00000128720	ENST00000274382.4:c.705C>A	5.37:g.96430596G>T			A8K4R9|Q8N7I2	Silent	SNP	NULL	p.A235	ENST00000274382.4	37	c.705	CCDS4088.1	5																																																																																			LIX1	-	NULL	ENSG00000145721		0.512	LIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIX1	HGNC	protein_coding	OTTHUMT00000250625.1	168	0.00	0	G	NM_153234		96430596	96430596	-1	no_errors	ENST00000274382	ensembl	human	known	69_37n	silent	192	27.44	73	SNP	1.000	T
LONRF2	164832	genome.wustl.edu	37	2	100903408	100903408	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:100903408C>A	ENST00000393437.3	-	11	2677	c.2038G>T	c.(2038-2040)Ggg>Tgg	p.G680W	LONRF2_ENST00000409647.1_Missense_Mutation_p.G437W	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	680	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						GGCATTACCCCAAAATGACTT	0.463																																						dbGAP											0													127.0	119.0	122.0					2																	100903408		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.2038G>T	2.37:g.100903408C>A	ENSP00000377086:p.Gly680Trp		B9A006|Q6ZSR4	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.G680W	ENST00000393437.3	37	c.2038	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727697	0.89390	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	T;T	0.44881	0.91;0.91	4.95	4.95	0.65309	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.73426	0.3585	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81046	-0.1110	10	0.62326	D	0.03	-28.3255	18.2043	0.89850	0.0:1.0:0.0:0.0	.	680	Q1L5Z9	LONF2_HUMAN	W	680;437	ENSP00000377086:G680W;ENSP00000386823:G437W	ENSP00000377086:G680W	G	-	1	0	LONRF2	100269840	1.000000	0.71417	0.995000	0.50966	0.898000	0.52572	7.408000	0.80041	2.288000	0.76882	0.655000	0.94253	GGG	LONRF2	-	pfam_Pept_S16_N,superfamily_PUA-like_domain,smart_Pept_S16_N	ENSG00000170500		0.463	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	HGNC	protein_coding	OTTHUMT00000253161.2	180	0.00	0	C	NM_198461		100903408	100903408	-1	no_errors	ENST00000393437	ensembl	human	known	69_37n	missense	187	24.60	61	SNP	1.000	A
LONRF2	164832	genome.wustl.edu	37	2	100903408	100903408	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:100903408C>A	ENST00000393437.3	-	11	2677	c.2038G>T	c.(2038-2040)Ggg>Tgg	p.G680W	LONRF2_ENST00000409647.1_Missense_Mutation_p.G437W	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	680	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						GGCATTACCCCAAAATGACTT	0.463																																						dbGAP											0													127.0	119.0	122.0					2																	100903408		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.2038G>T	2.37:g.100903408C>A	ENSP00000377086:p.Gly680Trp		B9A006|Q6ZSR4	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.G680W	ENST00000393437.3	37	c.2038	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727697	0.89390	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	T;T	0.44881	0.91;0.91	4.95	4.95	0.65309	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.73426	0.3585	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81046	-0.1110	10	0.62326	D	0.03	-28.3255	18.2043	0.89850	0.0:1.0:0.0:0.0	.	680	Q1L5Z9	LONF2_HUMAN	W	680;437	ENSP00000377086:G680W;ENSP00000386823:G437W	ENSP00000377086:G680W	G	-	1	0	LONRF2	100269840	1.000000	0.71417	0.995000	0.50966	0.898000	0.52572	7.408000	0.80041	2.288000	0.76882	0.655000	0.94253	GGG	LONRF2	-	pfam_Pept_S16_N,superfamily_PUA-like_domain,smart_Pept_S16_N	ENSG00000170500		0.463	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	HGNC	protein_coding	OTTHUMT00000253161.2	380	0.26	1	C	NM_198461		100903408	100903408	-1	no_errors	ENST00000393437	ensembl	human	known	69_37n	missense	187	24.60	61	SNP	1.000	A
LRP2	4036	genome.wustl.edu	37	2	170022539	170022539	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:170022539G>T	ENST00000263816.3	-	62	11946	c.11661C>A	c.(11659-11661)aaC>aaA	p.N3887K		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3887	LDL-receptor class A 35. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACCGGAAACGGTTTGGTGAAT	0.398																																						dbGAP											0													163.0	151.0	155.0					2																	170022539		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11661C>A	2.37:g.170022539G>T	ENSP00000263816:p.Asn3887Lys		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.N3887K	ENST00000263816.3	37	c.11661	CCDS2232.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.53|16.53	3.148660|3.148660	0.57151|0.57151	.|.	.|.	ENSG00000081479|ENSG00000081479	ENST00000263816|ENST00000536293	D|.	0.95656|.	-3.77|.	6.06|6.06	-4.2|-4.2	0.03823|0.03823	.|.	0.957219|.	0.08794|.	N|.	0.892761|.	T|T	0.37732|0.37732	0.1014|0.1014	L|L	0.48877|0.48877	1.53|1.53	0.80722|0.80722	D|D	1|1	B|.	0.29481|.	0.245|.	B|.	0.31101|.	0.124|.	T|T	0.38478|0.38478	-0.9659|-0.9659	10|6	0.25106|0.18710	T|T	0.35|0.47	.|.	0.4773|0.4773	0.00542|0.00542	0.2266:0.1823:0.2781:0.313|0.2266:0.1823:0.2781:0.313	.|.	3887|.	P98164|.	LRP2_HUMAN|.	K|N	3887|552	ENSP00000263816:N3887K|.	ENSP00000263816:N3887K|ENSP00000438157:T552N	N|T	-|-	3|2	2|0	LRP2|LRP2	169730785|169730785	0.987000|0.987000	0.35691|0.35691	0.004000|0.004000	0.12327|0.12327	0.935000|0.935000	0.57460|0.57460	0.178000|0.178000	0.16820|0.16820	-0.854000|-0.854000	0.04131|0.04131	0.650000|0.650000	0.86243|0.86243	AAC|ACC	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.398	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	285	0.00	0	G	NM_004525		170022539	170022539	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	314	23.54	97	SNP	0.017	T
LRP2	4036	genome.wustl.edu	37	2	170022539	170022539	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:170022539G>T	ENST00000263816.3	-	62	11946	c.11661C>A	c.(11659-11661)aaC>aaA	p.N3887K		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3887	LDL-receptor class A 35. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACCGGAAACGGTTTGGTGAAT	0.398																																						dbGAP											0													163.0	151.0	155.0					2																	170022539		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11661C>A	2.37:g.170022539G>T	ENSP00000263816:p.Asn3887Lys		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.N3887K	ENST00000263816.3	37	c.11661	CCDS2232.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.53|16.53	3.148660|3.148660	0.57151|0.57151	.|.	.|.	ENSG00000081479|ENSG00000081479	ENST00000263816|ENST00000536293	D|.	0.95656|.	-3.77|.	6.06|6.06	-4.2|-4.2	0.03823|0.03823	.|.	0.957219|.	0.08794|.	N|.	0.892761|.	T|T	0.37732|0.37732	0.1014|0.1014	L|L	0.48877|0.48877	1.53|1.53	0.80722|0.80722	D|D	1|1	B|.	0.29481|.	0.245|.	B|.	0.31101|.	0.124|.	T|T	0.38478|0.38478	-0.9659|-0.9659	10|6	0.25106|0.18710	T|T	0.35|0.47	.|.	0.4773|0.4773	0.00542|0.00542	0.2266:0.1823:0.2781:0.313|0.2266:0.1823:0.2781:0.313	.|.	3887|.	P98164|.	LRP2_HUMAN|.	K|N	3887|552	ENSP00000263816:N3887K|.	ENSP00000263816:N3887K|ENSP00000438157:T552N	N|T	-|-	3|2	2|0	LRP2|LRP2	169730785|169730785	0.987000|0.987000	0.35691|0.35691	0.004000|0.004000	0.12327|0.12327	0.935000|0.935000	0.57460|0.57460	0.178000|0.178000	0.16820|0.16820	-0.854000|-0.854000	0.04131|0.04131	0.650000|0.650000	0.86243|0.86243	AAC|ACC	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.398	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	337	0.59	2	G	NM_004525		170022539	170022539	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	314	23.54	97	SNP	0.017	T
MALAT1	378938	genome.wustl.edu	37	11	65266724	65266726	+	lincRNA	DEL	AGA	AGA	-	rs374676811		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr11:65266724_65266726delAGA	ENST00000534336.1	+	0	1492_1494				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		ATGAAGACTTAGAAGAGTAGCAT	0.276																																						dbGAP											0																																										-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266727_65266729delAGA				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.276	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	15	0.00	0	AGA	NR_002819		65266724	65266726	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	13	27.78	5	DEL	0.473:0.552:0.384	-
MALAT1	378938	genome.wustl.edu	37	11	65266724	65266726	+	lincRNA	DEL	AGA	AGA	-	rs374676811		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr11:65266724_65266726delAGA	ENST00000534336.1	+	0	1492_1494				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		ATGAAGACTTAGAAGAGTAGCAT	0.276																																						dbGAP											0																																										-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266727_65266729delAGA				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.276	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	25	0.00	0	AGA	NR_002819		65266724	65266726	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	13	27.78	5	DEL	0.473:0.552:0.384	-
MALAT1	378938	genome.wustl.edu	37	11	65268913	65268914	+	lincRNA	INS	-	-	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr11:65268913_65268914insA	ENST00000534336.1	+	0	3681_3682					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TGGCTGGTAGTTACTCTTTTTT	0.406																																						dbGAP											0																																										-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268913_65268914insA				RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.406	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	28	0.00	0	-	NR_002819		65268913	65268914	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	23	36.11	13	INS	0.941:0.589	A
MALAT1	378938	genome.wustl.edu	37	11	65268913	65268914	+	lincRNA	INS	-	-	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr11:65268913_65268914insA	ENST00000534336.1	+	0	3681_3682					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TGGCTGGTAGTTACTCTTTTTT	0.406																																						dbGAP											0																																										-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268913_65268914insA				RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.406	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	37	0.00	0	-	NR_002819		65268913	65268914	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	23	36.11	13	INS	0.941:0.589	A
MALAT1	378938	genome.wustl.edu	37	11	65271704	65271705	+	lincRNA	DEL	TT	TT	-			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr11:65271704_65271705delTT	ENST00000534336.1	+	0	6472_6473					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTGCAGTGAGTTTATCAGCATA	0.411																																						dbGAP											0																																										-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271704_65271705delTT				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.411	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	47	0.00	0	TT	NR_002819		65271704	65271705	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	36	33.93	19	DEL	0.889:0.645	-
MALAT1	378938	genome.wustl.edu	37	11	65271704	65271705	+	lincRNA	DEL	TT	TT	-			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr11:65271704_65271705delTT	ENST00000534336.1	+	0	6472_6473					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTGCAGTGAGTTTATCAGCATA	0.411																																						dbGAP											0																																										-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271704_65271705delTT				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.411	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	51	0.00	0	TT	NR_002819		65271704	65271705	+1	no_errors	ENST00000534336	ensembl	human	known	69_37n	rna	36	33.93	19	DEL	0.889:0.645	-
METTL2B	55798	genome.wustl.edu	37	7	128119302	128119302	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr7:128119302C>G	ENST00000262432.8	+	3	330	c.293C>G	c.(292-294)aCc>aGc	p.T98S	METTL2B_ENST00000480046.1_Missense_Mutation_p.T33S|RP11-212P7.3_ENST00000462662.1_RNA	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	98					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TGGCTTTTTACCGAATTCCCT	0.368																																						dbGAP											0													52.0	54.0	53.0					7																	128119302		2202	4296	6498	-	-	-	SO:0001583	missense	0			AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.293C>G	7.37:g.128119302C>G	ENSP00000262432:p.Thr98Ser		B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase_METTL2_prd	p.T98S	ENST00000262432.8	37	c.293	CCDS5803.2	7	.	.	.	.	.	.	.	.	.	.	C	15.16	2.752261	0.49362	.	.	ENSG00000165055	ENST00000462662;ENST00000262432;ENST00000480046	T;D;T	0.81579	3.81;-1.51;3.81	2.86	1.92	0.25849	.	0.000000	0.85682	D	0.000000	D	0.85767	0.5773	M	0.78285	2.405	0.47698	D	0.99949	D;D	0.71674	0.998;0.992	D;D	0.68353	0.957;0.917	T	0.81996	-0.0676	10	0.18710	T	0.47	-0.0049	9.4111	0.38491	0.0:0.7789:0.2211:0.0	.	33;98	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	S	92;98;33	ENSP00000418634:T92S;ENSP00000262432:T98S;ENSP00000418402:T33S	ENSP00000262432:T98S	T	+	2	0	METTL2B	127906538	1.000000	0.71417	0.632000	0.29296	0.478000	0.33099	5.778000	0.68940	0.496000	0.27904	0.405000	0.27470	ACC	METTL2B	-	pirsf_MeTrfase_METTL2_prd	ENSG00000165055		0.368	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2B	HGNC	protein_coding	OTTHUMT00000289817.1	169	0.00	0	C	NM_018396		128119302	128119302	+1	no_errors	ENST00000262432	ensembl	human	known	69_37n	missense	149	13.37	23	SNP	0.991	G
METTL2B	55798	genome.wustl.edu	37	7	128119302	128119302	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr7:128119302C>G	ENST00000262432.8	+	3	330	c.293C>G	c.(292-294)aCc>aGc	p.T98S	METTL2B_ENST00000480046.1_Missense_Mutation_p.T33S|RP11-212P7.3_ENST00000462662.1_RNA	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	98					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TGGCTTTTTACCGAATTCCCT	0.368																																						dbGAP											0													52.0	54.0	53.0					7																	128119302		2202	4296	6498	-	-	-	SO:0001583	missense	0			AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.293C>G	7.37:g.128119302C>G	ENSP00000262432:p.Thr98Ser		B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase_METTL2_prd	p.T98S	ENST00000262432.8	37	c.293	CCDS5803.2	7	.	.	.	.	.	.	.	.	.	.	C	15.16	2.752261	0.49362	.	.	ENSG00000165055	ENST00000462662;ENST00000262432;ENST00000480046	T;D;T	0.81579	3.81;-1.51;3.81	2.86	1.92	0.25849	.	0.000000	0.85682	D	0.000000	D	0.85767	0.5773	M	0.78285	2.405	0.47698	D	0.99949	D;D	0.71674	0.998;0.992	D;D	0.68353	0.957;0.917	T	0.81996	-0.0676	10	0.18710	T	0.47	-0.0049	9.4111	0.38491	0.0:0.7789:0.2211:0.0	.	33;98	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	S	92;98;33	ENSP00000418634:T92S;ENSP00000262432:T98S;ENSP00000418402:T33S	ENSP00000262432:T98S	T	+	2	0	METTL2B	127906538	1.000000	0.71417	0.632000	0.29296	0.478000	0.33099	5.778000	0.68940	0.496000	0.27904	0.405000	0.27470	ACC	METTL2B	-	pirsf_MeTrfase_METTL2_prd	ENSG00000165055		0.368	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2B	HGNC	protein_coding	OTTHUMT00000289817.1	136	0.00	0	C	NM_018396		128119302	128119302	+1	no_errors	ENST00000262432	ensembl	human	known	69_37n	missense	149	13.37	23	SNP	0.991	G
DLEU2	8847	genome.wustl.edu	37	13	50623160	50623160	+	RNA	SNP	T	T	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr13:50623160T>G	ENST00000607334.1	-	0	166				MIR16-1_ENST00000385271.1_RNA	NR_029485.1				deleted in lymphocytic leukemia 2 (non-protein coding)																		TTTAGAATCTTAACGCCAATA	0.323																																						dbGAP											0													134.0	121.0	125.0					13																	50623160		1568	3582	5150	-	-	-			0			Y15228		13q14	2014-07-18	2008-08-13		ENSG00000231607	ENSG00000231607		"""-"""	13748	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 22"", ""long intergenic non-protein coding RNA 22"", ""mir-15a-16-1 cluster host gene (non-protein coding)"""	605766	"""ret finger protein 2 opposite strand"", ""deleted in lymphocytic leukemia, 2"""	DLB2, BCMSUN, RFP2OS		9395242, 11072235	Standard	NR_002612		Approved	LEU2, TRIM13OS, NCRNA00022, LINC00022, MIR15AHG	uc001vdo.1		OTTHUMG00000016927		13.37:g.50623160T>G				RNA	SNP	-	NULL	ENST00000607334.1	37	NULL		13																																																																																			MIR16-1	-	-	ENSG00000208006		0.323	DLEU2-202	KNOWN	basic	miRNA	MIR16-1	HGNC	processed_transcript		241	0.00	0	T	NR_002612		50623160	50623160	-1	no_errors	ENST00000385271	ensembl	human	known	69_37n	rna	117	31.58	54	SNP	1.000	G
DLEU2	8847	genome.wustl.edu	37	13	50623160	50623160	+	RNA	SNP	T	T	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr13:50623160T>G	ENST00000607334.1	-	0	166				MIR16-1_ENST00000385271.1_RNA	NR_029485.1				deleted in lymphocytic leukemia 2 (non-protein coding)																		TTTAGAATCTTAACGCCAATA	0.323																																						dbGAP											0													134.0	121.0	125.0					13																	50623160		1568	3582	5150	-	-	-			0			Y15228		13q14	2014-07-18	2008-08-13		ENSG00000231607	ENSG00000231607		"""-"""	13748	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 22"", ""long intergenic non-protein coding RNA 22"", ""mir-15a-16-1 cluster host gene (non-protein coding)"""	605766	"""ret finger protein 2 opposite strand"", ""deleted in lymphocytic leukemia, 2"""	DLB2, BCMSUN, RFP2OS		9395242, 11072235	Standard	NR_002612		Approved	LEU2, TRIM13OS, NCRNA00022, LINC00022, MIR15AHG	uc001vdo.1		OTTHUMG00000016927		13.37:g.50623160T>G				RNA	SNP	-	NULL	ENST00000607334.1	37	NULL		13																																																																																			MIR16-1	-	-	ENSG00000208006		0.323	DLEU2-202	KNOWN	basic	miRNA	MIR16-1	HGNC	processed_transcript		127	0.00	0	T	NR_002612		50623160	50623160	-1	no_errors	ENST00000385271	ensembl	human	known	69_37n	rna	117	31.58	54	SNP	1.000	G
MPHOSPH9	10198	genome.wustl.edu	37	12	123687511	123687511	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr12:123687511C>G	ENST00000606320.1	-	10	1647	c.1441G>C	c.(1441-1443)Gag>Cag	p.E481Q	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.E329Q|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.E451Q|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.E329Q			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	481						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		ATACTAGGCTCTAGAACAGAG	0.443																																						dbGAP											0													113.0	120.0	118.0					12																	123687511		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.1441G>C	12.37:g.123687511C>G	ENSP00000475489:p.Glu481Gln		A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	superfamily_Prefoldin	p.E329Q	ENST00000606320.1	37	c.985		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.14|16.14	3.039049|3.039049	0.55003|0.55003	.|.	.|.	ENSG00000051825|ENSG00000257076	ENST00000302349;ENST00000541076|ENST00000539336	T;T|.	0.37915|.	1.17;1.18|.	6.03|6.03	5.13|5.13	0.70059|0.70059	.|.	0.464596|.	0.25166|.	N|.	0.032631|.	T|T	0.73361|0.73361	0.3577|0.3577	M|M	0.68952|0.68952	2.095|2.095	0.38505|0.38505	D|D	0.948312|0.948312	B|.	0.24426|.	0.103|.	B|.	0.27715|.	0.082|.	T|T	0.75473|0.75473	-0.3305|-0.3305	10|5	0.54805|.	T|.	0.06|.	-9.0849|-9.0849	17.2227|17.2227	0.86962|0.86962	0.0:0.8741:0.1259:0.0|0.0:0.8741:0.1259:0.0	.|.	329|.	Q99550|.	MPP9_HUMAN|.	Q|T	329|338	ENSP00000303597:E329Q;ENSP00000445859:E329Q|.	ENSP00000303597:E329Q|.	E|R	-|-	1|2	0|0	MPHOSPH9|RP11-546D6.2	122253464|122253464	0.996000|0.996000	0.38824|0.38824	0.941000|0.941000	0.38009|0.38009	0.993000|0.993000	0.82548|0.82548	5.298000|5.298000	0.65710|0.65710	1.524000|1.524000	0.49035|0.49035	0.557000|0.557000	0.71058|0.71058	GAG|AGA	MPHOSPH9	-	NULL	ENSG00000051825		0.443	MPHOSPH9-030	NOVEL	basic	protein_coding	MPHOSPH9	HGNC	protein_coding	OTTHUMT00000471390.2	239	0.00	0	C			123687511	123687511	-1	no_errors	ENST00000541076	ensembl	human	known	69_37n	missense	250	20.38	64	SNP	0.977	G
MPHOSPH9	10198	genome.wustl.edu	37	12	123687511	123687511	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr12:123687511C>G	ENST00000606320.1	-	10	1647	c.1441G>C	c.(1441-1443)Gag>Cag	p.E481Q	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.E329Q|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.E451Q|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.E329Q			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	481						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		ATACTAGGCTCTAGAACAGAG	0.443																																						dbGAP											0													113.0	120.0	118.0					12																	123687511		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.1441G>C	12.37:g.123687511C>G	ENSP00000475489:p.Glu481Gln		A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	superfamily_Prefoldin	p.E329Q	ENST00000606320.1	37	c.985		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.14|16.14	3.039049|3.039049	0.55003|0.55003	.|.	.|.	ENSG00000051825|ENSG00000257076	ENST00000302349;ENST00000541076|ENST00000539336	T;T|.	0.37915|.	1.17;1.18|.	6.03|6.03	5.13|5.13	0.70059|0.70059	.|.	0.464596|.	0.25166|.	N|.	0.032631|.	T|T	0.73361|0.73361	0.3577|0.3577	M|M	0.68952|0.68952	2.095|2.095	0.38505|0.38505	D|D	0.948312|0.948312	B|.	0.24426|.	0.103|.	B|.	0.27715|.	0.082|.	T|T	0.75473|0.75473	-0.3305|-0.3305	10|5	0.54805|.	T|.	0.06|.	-9.0849|-9.0849	17.2227|17.2227	0.86962|0.86962	0.0:0.8741:0.1259:0.0|0.0:0.8741:0.1259:0.0	.|.	329|.	Q99550|.	MPP9_HUMAN|.	Q|T	329|338	ENSP00000303597:E329Q;ENSP00000445859:E329Q|.	ENSP00000303597:E329Q|.	E|R	-|-	1|2	0|0	MPHOSPH9|RP11-546D6.2	122253464|122253464	0.996000|0.996000	0.38824|0.38824	0.941000|0.941000	0.38009|0.38009	0.993000|0.993000	0.82548|0.82548	5.298000|5.298000	0.65710|0.65710	1.524000|1.524000	0.49035|0.49035	0.557000|0.557000	0.71058|0.71058	GAG|AGA	MPHOSPH9	-	NULL	ENSG00000051825		0.443	MPHOSPH9-030	NOVEL	basic	protein_coding	MPHOSPH9	HGNC	protein_coding	OTTHUMT00000471390.2	211	0.47	1	C			123687511	123687511	-1	no_errors	ENST00000541076	ensembl	human	known	69_37n	missense	250	20.38	64	SNP	0.977	G
MUC16	94025	genome.wustl.edu	37	19	9091401	9091401	+	Silent	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr19:9091401T>C	ENST00000397910.4	-	1	617	c.414A>G	c.(412-414)ggA>ggG	p.G138G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	138	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G138G(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTAAAATTTCCTTCTGTGG	0.493																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(2)											91.0	91.0	91.0					19																	9091401		1962	4156	6118	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.414A>G	19.37:g.9091401T>C			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.G138	ENST00000397910.4	37	c.414	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	363	0.27	1	T	NM_024690		9091401	9091401	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	253	27.01	94	SNP	0.000	C
MUC16	94025	genome.wustl.edu	37	19	9091401	9091401	+	Silent	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr19:9091401T>C	ENST00000397910.4	-	1	617	c.414A>G	c.(412-414)ggA>ggG	p.G138G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	138	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G138G(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTAAAATTTCCTTCTGTGG	0.493																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(2)											91.0	91.0	91.0					19																	9091401		1962	4156	6118	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.414A>G	19.37:g.9091401T>C			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.G138	ENST00000397910.4	37	c.414	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	405	0.00	0	T	NM_024690		9091401	9091401	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	253	27.01	94	SNP	0.000	C
MUC5B	727897	genome.wustl.edu	37	11	1268931	1268931	+	Silent	SNP	A	A	C	rs2334757	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr11:1268931A>C	ENST00000529681.1	+	31	10879	c.10821A>C	c.(10819-10821)gcA>gcC	p.A3607A	MUC5B_ENST00000447027.1_Silent_p.A3610A|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3607	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCGGAGGGGCAGTCTGTGAGC	0.672													-|||	1447	0.288938	0.2065	0.2565	5008	,	,		10450	0.5159		0.2078	False		,,,				2504	0.273					dbGAP											0													38.0	41.0	40.0					11																	1268931		1863	4019	5882	-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10821A>C	11.37:g.1268931A>C			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A3610	ENST00000529681.1	37	c.10830	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.672	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	9	0.00	0	A	XM_001126093		1268931	1268931	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	6	40.00	4	SNP	0.000	C
NGFR	4804	genome.wustl.edu	37	17	47589366	47589366	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr17:47589366C>T	ENST00000172229.3	+	5	1059	c.934C>T	c.(934-936)Cag>Tag	p.Q312*	NGFR_ENST00000504201.1_Nonsense_Mutation_p.Q218*|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	312					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					CGTGGACAGCCAGAGCCTGCA	0.647																																						dbGAP											0													68.0	65.0	66.0					17																	47589366		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.934C>T	17.37:g.47589366C>T	ENSP00000172229:p.Gln312*		B2R961|B4E096	Nonsense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,pfscan_Death,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_16	p.Q312*	ENST00000172229.3	37	c.934	CCDS11549.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.713665	0.97784	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	.	.	.	5.18	5.18	0.71444	.	0.125141	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-24.3074	13.5774	0.61883	0.0:0.8437:0.1563:0.0	.	.	.	.	X	312;218	.	ENSP00000172229:Q312X	Q	+	1	0	NGFR	44944365	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.825000	0.69286	2.547000	0.85894	0.655000	0.94253	CAG	NGFR	-	NULL	ENSG00000064300		0.647	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGFR	HGNC	protein_coding	OTTHUMT00000365150.1	12	0.00	0	C			47589366	47589366	+1	no_errors	ENST00000172229	ensembl	human	known	69_37n	nonsense	9	43.75	7	SNP	1.000	T
NRP2	8828	genome.wustl.edu	37	2	206617652	206617652	+	Missense_Mutation	SNP	G	G	A	rs372658596		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:206617652G>A	ENST00000357785.5	+	12	2028	c.1997G>A	c.(1996-1998)cGg>cAg	p.R666Q	NRP2_ENST00000272849.3_Missense_Mutation_p.R666Q|NRP2_ENST00000412873.2_Missense_Mutation_p.R666Q|NRP2_ENST00000540178.1_Missense_Mutation_p.R666Q|NRP2_ENST00000357118.4_Missense_Mutation_p.R666Q|NRP2_ENST00000360409.3_Missense_Mutation_p.R666Q|NRP2_ENST00000540841.1_Missense_Mutation_p.R666Q			Q99435	NELL2_HUMAN	neuropilin 2	0	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						AAGTGGCTCCGGACCACCTGG	0.522																																						dbGAP											0													70.0	71.0	70.0					2																	206617652		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1997G>A	2.37:g.206617652G>A	ENSP00000350432:p.Arg666Gln		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.R666Q	ENST00000357785.5	37	c.1997	CCDS46496.1	2	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639062	0.29157	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	T;T;T;T;T;T;T	0.02498	4.27;4.27;4.27;4.27;4.27;4.27;4.27	5.71	2.69	0.31865	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.614373	0.18223	N	0.147812	T	0.02688	0.0081	L	0.48642	1.525	0.09310	N	1	P;B;B;P;P	0.34997	0.479;0.001;0.002;0.479;0.479	B;B;B;B;B	0.28709	0.093;0.002;0.003;0.093;0.093	T	0.43410	-0.9393	10	0.44086	T	0.13	-13.0501	5.8977	0.18949	0.1427:0.155:0.6036:0.0988	.	666;666;666;666;666	O60462-2;O60462-3;O60462;O60462-4;O60462-5	.;.;NRP2_HUMAN;.;.	Q	666	ENSP00000353582:R666Q;ENSP00000439658:R666Q;ENSP00000439261:R666Q;ENSP00000349632:R666Q;ENSP00000350432:R666Q;ENSP00000407626:R666Q;ENSP00000272849:R666Q	ENSP00000272849:R666Q	R	+	2	0	NRP2	206325897	0.097000	0.21791	0.237000	0.24090	0.906000	0.53458	1.364000	0.34171	0.741000	0.32674	0.561000	0.74099	CGG	NRP2	-	pirsf_Neuropilin,pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000118257		0.522	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1	50	0.00	0	G			206617652	206617652	+1	no_errors	ENST00000360409	ensembl	human	known	69_37n	missense	47	27.94	19	SNP	0.002	A
NRP2	8828	genome.wustl.edu	37	2	206617652	206617652	+	Missense_Mutation	SNP	G	G	A	rs372658596		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:206617652G>A	ENST00000357785.5	+	12	2028	c.1997G>A	c.(1996-1998)cGg>cAg	p.R666Q	NRP2_ENST00000272849.3_Missense_Mutation_p.R666Q|NRP2_ENST00000412873.2_Missense_Mutation_p.R666Q|NRP2_ENST00000540178.1_Missense_Mutation_p.R666Q|NRP2_ENST00000357118.4_Missense_Mutation_p.R666Q|NRP2_ENST00000360409.3_Missense_Mutation_p.R666Q|NRP2_ENST00000540841.1_Missense_Mutation_p.R666Q			Q99435	NELL2_HUMAN	neuropilin 2	0	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						AAGTGGCTCCGGACCACCTGG	0.522																																						dbGAP											0													70.0	71.0	70.0					2																	206617652		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1997G>A	2.37:g.206617652G>A	ENSP00000350432:p.Arg666Gln		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.R666Q	ENST00000357785.5	37	c.1997	CCDS46496.1	2	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639062	0.29157	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	T;T;T;T;T;T;T	0.02498	4.27;4.27;4.27;4.27;4.27;4.27;4.27	5.71	2.69	0.31865	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.614373	0.18223	N	0.147812	T	0.02688	0.0081	L	0.48642	1.525	0.09310	N	1	P;B;B;P;P	0.34997	0.479;0.001;0.002;0.479;0.479	B;B;B;B;B	0.28709	0.093;0.002;0.003;0.093;0.093	T	0.43410	-0.9393	10	0.44086	T	0.13	-13.0501	5.8977	0.18949	0.1427:0.155:0.6036:0.0988	.	666;666;666;666;666	O60462-2;O60462-3;O60462;O60462-4;O60462-5	.;.;NRP2_HUMAN;.;.	Q	666	ENSP00000353582:R666Q;ENSP00000439658:R666Q;ENSP00000439261:R666Q;ENSP00000349632:R666Q;ENSP00000350432:R666Q;ENSP00000407626:R666Q;ENSP00000272849:R666Q	ENSP00000272849:R666Q	R	+	2	0	NRP2	206325897	0.097000	0.21791	0.237000	0.24090	0.906000	0.53458	1.364000	0.34171	0.741000	0.32674	0.561000	0.74099	CGG	NRP2	-	pirsf_Neuropilin,pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000118257		0.522	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1	77	0.00	0	G			206617652	206617652	+1	no_errors	ENST00000360409	ensembl	human	known	69_37n	missense	47	27.94	19	SNP	0.002	A
NSL1	25936	genome.wustl.edu	37	1	212911824	212911824	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:212911824T>C	ENST00000366977.3	-	6	790	c.772A>G	c.(772-774)Aga>Gga	p.R258G	NSL1_ENST00000422588.2_3'UTR|NSL1_ENST00000366976.1_Intron|NSL1_ENST00000366978.1_Intron|NSL1_ENST00000366975.6_Missense_Mutation_p.R217G	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	258					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		GTTTGCTTTCTTTTCAGTACC	0.398																																						dbGAP											0													165.0	164.0	164.0					1																	212911824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.772A>G	1.37:g.212911824T>C	ENSP00000355944:p.Arg258Gly		E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	pfam_Kinetochore_Mis14	p.R258G	ENST00000366977.3	37	c.772	CCDS1509.1	1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690025	0.48097	.	.	ENSG00000117697	ENST00000366977;ENST00000366975	T;T	0.37584	1.19;1.19	5.51	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.57021	-0.7882	10	0.66056	D	0.02	-17.9782	10.7638	0.46281	0.0:0.0:0.1591:0.8409	.	217;258	B4E071;Q96IY1	.;NSL1_HUMAN	G	258;217	ENSP00000355944:R258G;ENSP00000355942:R217G	ENSP00000355942:R217G	R	-	1	2	NSL1	210978447	1.000000	0.71417	0.315000	0.25238	0.295000	0.27426	4.443000	0.59994	0.978000	0.38470	0.528000	0.53228	AGA	NSL1	-	NULL	ENSG00000117697		0.398	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSL1	HGNC	protein_coding	OTTHUMT00000089398.2	164	0.00	0	T	NM_015471		212911824	212911824	-1	no_errors	ENST00000366977	ensembl	human	known	69_37n	missense	190	41.54	135	SNP	0.990	C
NSL1	25936	genome.wustl.edu	37	1	212911824	212911824	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:212911824T>C	ENST00000366977.3	-	6	790	c.772A>G	c.(772-774)Aga>Gga	p.R258G	NSL1_ENST00000422588.2_3'UTR|NSL1_ENST00000366976.1_Intron|NSL1_ENST00000366978.1_Intron|NSL1_ENST00000366975.6_Missense_Mutation_p.R217G	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	258					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		GTTTGCTTTCTTTTCAGTACC	0.398																																						dbGAP											0													165.0	164.0	164.0					1																	212911824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.772A>G	1.37:g.212911824T>C	ENSP00000355944:p.Arg258Gly		E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	pfam_Kinetochore_Mis14	p.R258G	ENST00000366977.3	37	c.772	CCDS1509.1	1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690025	0.48097	.	.	ENSG00000117697	ENST00000366977;ENST00000366975	T;T	0.37584	1.19;1.19	5.51	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.57021	-0.7882	10	0.66056	D	0.02	-17.9782	10.7638	0.46281	0.0:0.0:0.1591:0.8409	.	217;258	B4E071;Q96IY1	.;NSL1_HUMAN	G	258;217	ENSP00000355944:R258G;ENSP00000355942:R217G	ENSP00000355942:R217G	R	-	1	2	NSL1	210978447	1.000000	0.71417	0.315000	0.25238	0.295000	0.27426	4.443000	0.59994	0.978000	0.38470	0.528000	0.53228	AGA	NSL1	-	NULL	ENSG00000117697		0.398	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSL1	HGNC	protein_coding	OTTHUMT00000089398.2	138	0.00	0	T	NM_015471		212911824	212911824	-1	no_errors	ENST00000366977	ensembl	human	known	69_37n	missense	190	41.54	135	SNP	0.990	C
ODAM	54959	genome.wustl.edu	37	4	71062264	71062264	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr4:71062264A>G	ENST00000396094.2	+	1	52	c.4A>G	c.(4-6)Aaa>Gaa	p.K2E		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	2					biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						TACGAAAATGAAAATTATAAT	0.313																																						dbGAP											0													48.0	44.0	45.0					4																	71062264		1800	4070	5870	-	-	-	SO:0001583	missense	0			AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.4A>G	4.37:g.71062264A>G	ENSP00000379401:p.Lys2Glu		Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	NULL	p.K2E	ENST00000396094.2	37	c.4	CCDS3536.2	4	.	.	.	.	.	.	.	.	.	.	A	19.00	3.742621	0.69418	.	.	ENSG00000109205	ENST00000396094;ENST00000510709	T	0.53423	0.62	5.27	4.1	0.47936	.	.	.	.	.	T	0.41259	0.1151	L	0.50333	1.59	0.23010	N	0.99843	B	0.25563	0.129	B	0.23419	0.046	T	0.39014	-0.9634	9	0.66056	D	0.02	-3.4665	7.6862	0.28542	0.9065:0.0:0.0935:0.0	.	2	A1E959	ODAM_HUMAN	E	2	ENSP00000379401:K2E	ENSP00000379401:K2E	K	+	1	0	ODAM	71096853	0.991000	0.36638	0.971000	0.41717	0.869000	0.49853	2.526000	0.45607	1.031000	0.39867	0.528000	0.53228	AAA	ODAM	-	NULL	ENSG00000109205		0.313	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODAM	HGNC	protein_coding	OTTHUMT00000251562.1	118	0.00	0	A	NM_017855		71062264	71062264	+1	no_errors	ENST00000396094	ensembl	human	known	69_37n	missense	96	21.31	26	SNP	0.909	G
ODAM	54959	genome.wustl.edu	37	4	71062264	71062264	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr4:71062264A>G	ENST00000396094.2	+	1	52	c.4A>G	c.(4-6)Aaa>Gaa	p.K2E		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	2					biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						TACGAAAATGAAAATTATAAT	0.313																																						dbGAP											0													48.0	44.0	45.0					4																	71062264		1800	4070	5870	-	-	-	SO:0001583	missense	0			AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.4A>G	4.37:g.71062264A>G	ENSP00000379401:p.Lys2Glu		Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	NULL	p.K2E	ENST00000396094.2	37	c.4	CCDS3536.2	4	.	.	.	.	.	.	.	.	.	.	A	19.00	3.742621	0.69418	.	.	ENSG00000109205	ENST00000396094;ENST00000510709	T	0.53423	0.62	5.27	4.1	0.47936	.	.	.	.	.	T	0.41259	0.1151	L	0.50333	1.59	0.23010	N	0.99843	B	0.25563	0.129	B	0.23419	0.046	T	0.39014	-0.9634	9	0.66056	D	0.02	-3.4665	7.6862	0.28542	0.9065:0.0:0.0935:0.0	.	2	A1E959	ODAM_HUMAN	E	2	ENSP00000379401:K2E	ENSP00000379401:K2E	K	+	1	0	ODAM	71096853	0.991000	0.36638	0.971000	0.41717	0.869000	0.49853	2.526000	0.45607	1.031000	0.39867	0.528000	0.53228	AAA	ODAM	-	NULL	ENSG00000109205		0.313	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODAM	HGNC	protein_coding	OTTHUMT00000251562.1	61	0.00	0	A	NM_017855		71062264	71062264	+1	no_errors	ENST00000396094	ensembl	human	known	69_37n	missense	96	21.31	26	SNP	0.909	G
OLFML3	56944	genome.wustl.edu	37	1	114523891	114523891	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:114523891C>G	ENST00000320334.4	+	3	795	c.721C>G	c.(721-723)Cta>Gta	p.L241V	OLFML3_ENST00000369551.1_Missense_Mutation_p.L221V|OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000393300.2_Missense_Mutation_p.L221V	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	241	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACTTTGCAGCTAATCAAATT	0.542																																						dbGAP											0													72.0	71.0	71.0					1																	114523891		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.721C>G	1.37:g.114523891C>G	ENSP00000322273:p.Leu241Val		Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Missense_Mutation	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.L241V	ENST00000320334.4	37	c.721	CCDS870.1	1	.	.	.	.	.	.	.	.	.	.	C	9.040	0.989534	0.18966	.	.	ENSG00000116774	ENST00000369551;ENST00000320334;ENST00000393300	D;D;D	0.88896	-2.44;-2.44;-2.44	6.07	4.09	0.47781	Olfactomedin-like (3);	0.186317	0.45867	D	0.000324	T	0.58308	0.2113	N	0.03071	-0.42	0.42812	D	0.993964	B;B	0.19331	0.035;0.004	B;B	0.18561	0.022;0.007	T	0.57516	-0.7798	10	0.20046	T	0.44	.	10.7914	0.46434	0.1225:0.4687:0.4088:0.0	.	221;241	Q9NRN5-2;Q9NRN5	.;OLFL3_HUMAN	V	221;241;221	ENSP00000358564:L221V;ENSP00000322273:L241V;ENSP00000376977:L221V	ENSP00000322273:L241V	L	+	1	2	OLFML3	114325414	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.330000	0.33781	1.567000	0.49668	0.655000	0.94253	CTA	OLFML3	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000116774		0.542	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML3	HGNC	protein_coding	OTTHUMT00000033119.1	123	0.00	0	C	NM_020190		114523891	114523891	+1	no_errors	ENST00000320334	ensembl	human	known	69_37n	missense	128	24.26	41	SNP	1.000	G
OLFML3	56944	genome.wustl.edu	37	1	114523891	114523891	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:114523891C>G	ENST00000320334.4	+	3	795	c.721C>G	c.(721-723)Cta>Gta	p.L241V	OLFML3_ENST00000369551.1_Missense_Mutation_p.L221V|OLFML3_ENST00000491700.1_3'UTR|OLFML3_ENST00000393300.2_Missense_Mutation_p.L221V	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3	241	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACTTTGCAGCTAATCAAATT	0.542																																						dbGAP											0													72.0	71.0	71.0					1																	114523891		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.721C>G	1.37:g.114523891C>G	ENSP00000322273:p.Leu241Val		Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	Missense_Mutation	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.L241V	ENST00000320334.4	37	c.721	CCDS870.1	1	.	.	.	.	.	.	.	.	.	.	C	9.040	0.989534	0.18966	.	.	ENSG00000116774	ENST00000369551;ENST00000320334;ENST00000393300	D;D;D	0.88896	-2.44;-2.44;-2.44	6.07	4.09	0.47781	Olfactomedin-like (3);	0.186317	0.45867	D	0.000324	T	0.58308	0.2113	N	0.03071	-0.42	0.42812	D	0.993964	B;B	0.19331	0.035;0.004	B;B	0.18561	0.022;0.007	T	0.57516	-0.7798	10	0.20046	T	0.44	.	10.7914	0.46434	0.1225:0.4687:0.4088:0.0	.	221;241	Q9NRN5-2;Q9NRN5	.;OLFL3_HUMAN	V	221;241;221	ENSP00000358564:L221V;ENSP00000322273:L241V;ENSP00000376977:L221V	ENSP00000322273:L241V	L	+	1	2	OLFML3	114325414	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.330000	0.33781	1.567000	0.49668	0.655000	0.94253	CTA	OLFML3	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000116774		0.542	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML3	HGNC	protein_coding	OTTHUMT00000033119.1	160	0.00	0	C	NM_020190		114523891	114523891	+1	no_errors	ENST00000320334	ensembl	human	known	69_37n	missense	128	24.26	41	SNP	1.000	G
OR52E4	390081	genome.wustl.edu	37	11	5906297	5906298	+	Frame_Shift_Del	DEL	TC	TC	-	rs201423767		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr11:5906297_5906298delTC	ENST00000316987.2	+	1	797_798	c.775_776delTC	c.(775-777)tctfs	p.S259fs		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S259Y(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCATTTTTTTCTTTTATGACA	0.426																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.775_776delTC	11.37:g.5906297_5906298delTC	ENSP00000321426:p.Ser259fs		Q6IFG0	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S259fs	ENST00000316987.2	37	c.775_776	CCDS31401.1	11																																																																																			OR52E4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000180974		0.426	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E4	HGNC	protein_coding	OTTHUMT00000401146.1	421	0.00	0	TC	NM_001005165		5906297	5906298	+1	no_errors	ENST00000316987	ensembl	human	known	69_37n	frame_shift_del	238	25.39	81	DEL	1.000:1.000	-
OR52E4	390081	genome.wustl.edu	37	11	5906297	5906298	+	Frame_Shift_Del	DEL	TC	TC	-	rs201423767		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr11:5906297_5906298delTC	ENST00000316987.2	+	1	797_798	c.775_776delTC	c.(775-777)tctfs	p.S259fs		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S259Y(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCATTTTTTTCTTTTATGACA	0.426																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.775_776delTC	11.37:g.5906297_5906298delTC	ENSP00000321426:p.Ser259fs		Q6IFG0	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S259fs	ENST00000316987.2	37	c.775_776	CCDS31401.1	11																																																																																			OR52E4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000180974		0.426	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E4	HGNC	protein_coding	OTTHUMT00000401146.1	346	0.00	0	TC	NM_001005165		5906297	5906298	+1	no_errors	ENST00000316987	ensembl	human	known	69_37n	frame_shift_del	238	25.39	81	DEL	1.000:1.000	-
P2RY1	5028	genome.wustl.edu	37	3	152554217	152554217	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr3:152554217A>T	ENST00000305097.3	+	1	1482	c.646A>T	c.(646-648)Atc>Ttc	p.I216F	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	216					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AAGTTATTTCATCTACAGCAT	0.488																																						dbGAP											0													170.0	154.0	160.0					3																	152554217		2203	4300	6503	-	-	-	SO:0001583	missense	0			U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.646A>T	3.37:g.152554217A>T	ENSP00000304767:p.Ile216Phe			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_P2Y_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.I216F	ENST00000305097.3	37	c.646	CCDS3169.1	3	.	.	.	.	.	.	.	.	.	.	A	7.842	0.722093	0.15372	.	.	ENSG00000169860	ENST00000305097	T	0.20598	2.06	5.57	0.352	0.16051	GPCR, rhodopsin-like superfamily (1);	0.124846	0.52532	D	0.000063	T	0.16041	0.0386	L	0.43646	1.37	0.53005	D	0.999964	B	0.26577	0.153	B	0.36666	0.23	T	0.11842	-1.0571	10	0.09843	T	0.71	.	6.3787	0.21521	0.614:0.1202:0.2658:0.0	.	216	P47900	P2RY1_HUMAN	F	216	ENSP00000304767:I216F	ENSP00000304767:I216F	I	+	1	0	P2RY1	154036907	1.000000	0.71417	0.548000	0.28192	0.956000	0.61745	2.975000	0.49281	-0.164000	0.10927	0.533000	0.62120	ATC	P2RY1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000169860		0.488	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY1	HGNC	protein_coding	OTTHUMT00000356943.1	91	0.00	0	A	NM_002563		152554217	152554217	+1	no_errors	ENST00000305097	ensembl	human	known	69_37n	missense	73	31.13	33	SNP	0.995	T
P2RY1	5028	genome.wustl.edu	37	3	152554217	152554217	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr3:152554217A>T	ENST00000305097.3	+	1	1482	c.646A>T	c.(646-648)Atc>Ttc	p.I216F	RP11-38P22.2_ENST00000460407.1_lincRNA	NM_002563.3	NP_002554.1	P47900	P2RY1_HUMAN	purinergic receptor P2Y, G-protein coupled, 1	216					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|aging (GO:0007568)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cell surface receptor signaling pathway (GO:0007166)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of binding (GO:0051100)|negative regulation of norepinephrine secretion (GO:0010700)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of hormone secretion (GO:0046887)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of ion transport (GO:0043270)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to plasma membrane (GO:0072659)|regulation of receptor activity (GO:0010469)|regulation of vasodilation (GO:0042312)|relaxation of muscle (GO:0090075)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|sensory perception of pain (GO:0019233)|signal transduction involved in regulation of gene expression (GO:0023019)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ADP binding (GO:0043531)|ADP-activated nucleotide receptor activity (GO:0045032)|ATP binding (GO:0005524)|ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			AAGTTATTTCATCTACAGCAT	0.488																																						dbGAP											0													170.0	154.0	160.0					3																	152554217		2203	4300	6503	-	-	-	SO:0001583	missense	0			U42029	CCDS3169.1	3q25.2	2012-08-08			ENSG00000169860	ENSG00000169860		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8539	protein-coding gene	gene with protein product		601167				8579591	Standard	NM_002563		Approved	P2Y1	uc003ezq.3	P47900	OTTHUMG00000159694	ENST00000305097.3:c.646A>T	3.37:g.152554217A>T	ENSP00000304767:p.Ile216Phe			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_P2Y_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.I216F	ENST00000305097.3	37	c.646	CCDS3169.1	3	.	.	.	.	.	.	.	.	.	.	A	7.842	0.722093	0.15372	.	.	ENSG00000169860	ENST00000305097	T	0.20598	2.06	5.57	0.352	0.16051	GPCR, rhodopsin-like superfamily (1);	0.124846	0.52532	D	0.000063	T	0.16041	0.0386	L	0.43646	1.37	0.53005	D	0.999964	B	0.26577	0.153	B	0.36666	0.23	T	0.11842	-1.0571	10	0.09843	T	0.71	.	6.3787	0.21521	0.614:0.1202:0.2658:0.0	.	216	P47900	P2RY1_HUMAN	F	216	ENSP00000304767:I216F	ENSP00000304767:I216F	I	+	1	0	P2RY1	154036907	1.000000	0.71417	0.548000	0.28192	0.956000	0.61745	2.975000	0.49281	-0.164000	0.10927	0.533000	0.62120	ATC	P2RY1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000169860		0.488	P2RY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY1	HGNC	protein_coding	OTTHUMT00000356943.1	112	0.00	0	A	NM_002563		152554217	152554217	+1	no_errors	ENST00000305097	ensembl	human	known	69_37n	missense	73	31.13	33	SNP	0.995	T
PCDHB18	54660	genome.wustl.edu	37	5	140616393	140616393	+	RNA	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr5:140616393C>T	ENST00000526308.1	+	0	2456					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						GTGTGTCTGACGGGAGGCTCA	0.592																																						dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140616393C>T			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.592	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	101	0.00	0	C			140616393	140616393	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	92	16.36	18	SNP	0.067	T
PCDHB18	54660	genome.wustl.edu	37	5	140616393	140616393	+	RNA	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr5:140616393C>T	ENST00000526308.1	+	0	2456					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						GTGTGTCTGACGGGAGGCTCA	0.592																																						dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140616393C>T			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.592	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	106	0.00	0	C			140616393	140616393	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	92	16.36	18	SNP	0.067	T
PHTF2	57157	genome.wustl.edu	37	7	77469618	77469619	+	Splice_Site	INS	-	-	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr7:77469618_77469619insT	ENST00000248550.7	+	1	121		c.e1+1		PHTF2_ENST00000275575.7_Splice_Site|PHTF2_ENST00000307305.8_Splice_Site|PHTF2_ENST00000450574.1_Splice_Site|PHTF2_ENST00000416283.2_Splice_Site|PHTF2_ENST00000415251.2_Splice_Site|PHTF2_ENST00000424760.1_Splice_Site|PHTF2_ENST00000422959.2_Splice_Site			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						TCAAAAGAAGGTAAGTTGATAG	0.337																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.45+1->T	7.37:g.77469619_77469619dupT			A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Splice_Site	INS	-	e1+1	ENST00000248550.7	37	c.45+1_45+1		7																																																																																			PHTF2	-	-	ENSG00000006576		0.337	PHTF2-006	KNOWN	basic	protein_coding	PHTF2	HGNC	protein_coding	OTTHUMT00000340638.2	147	0.00	0	-	NM_020432	Intron	77469618	77469619	+1	no_errors	ENST00000248550	ensembl	human	known	69_37n	splice_site_ins	263	14.33	44	INS	1.000:1.000	T
PHTF2	57157	genome.wustl.edu	37	7	77469618	77469619	+	Splice_Site	INS	-	-	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr7:77469618_77469619insT	ENST00000248550.7	+	1	121		c.e1+1		PHTF2_ENST00000275575.7_Splice_Site|PHTF2_ENST00000307305.8_Splice_Site|PHTF2_ENST00000450574.1_Splice_Site|PHTF2_ENST00000416283.2_Splice_Site|PHTF2_ENST00000415251.2_Splice_Site|PHTF2_ENST00000424760.1_Splice_Site|PHTF2_ENST00000422959.2_Splice_Site			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						TCAAAAGAAGGTAAGTTGATAG	0.337																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.45+1->T	7.37:g.77469619_77469619dupT			A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Splice_Site	INS	-	e1+1	ENST00000248550.7	37	c.45+1_45+1		7																																																																																			PHTF2	-	-	ENSG00000006576		0.337	PHTF2-006	KNOWN	basic	protein_coding	PHTF2	HGNC	protein_coding	OTTHUMT00000340638.2	348	0.00	0	-	NM_020432	Intron	77469618	77469619	+1	no_errors	ENST00000248550	ensembl	human	known	69_37n	splice_site_ins	263	14.33	44	INS	1.000:1.000	T
PI4K2B	55300	genome.wustl.edu	37	4	25258269	25258269	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr4:25258269G>C	ENST00000264864.6	+	4	918	c.729G>C	c.(727-729)aaG>aaC	p.K243N	PI4K2B_ENST00000512921.1_Missense_Mutation_p.K147N	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	243	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				TGGGTAGAAAGTTTCATAGGA	0.413																																						dbGAP											0													107.0	109.0	108.0					4																	25258269		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.729G>C	4.37:g.25258269G>C	ENSP00000264864:p.Lys243Asn		Q9NUW2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom	p.K243N	ENST00000264864.6	37	c.729	CCDS3433.1	4	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725901	0.69074	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	T;T	0.75704	-0.96;-0.96	6.07	3.98	0.46160	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.090751	0.85682	D	0.000000	T	0.78861	0.4350	M	0.65975	2.015	0.47476	D	0.999431	P	0.51933	0.949	P	0.57960	0.83	T	0.76963	-0.2764	10	0.56958	D	0.05	-18.8898	5.6473	0.17596	0.5546:0.0:0.4454:0.0	.	243	Q8TCG2	P4K2B_HUMAN	N	147;243;212	ENSP00000423373:K147N;ENSP00000264864:K243N	ENSP00000264864:K243N	K	+	3	2	PI4K2B	24867367	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.877000	0.28106	0.714000	0.32081	0.655000	0.94253	AAG	PI4K2B	-	pfam_PI3/4_kinase_cat_dom	ENSG00000038210		0.413	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI4K2B	HGNC	protein_coding	OTTHUMT00000250415.1	133	0.00	0	G	NM_018323		25258269	25258269	+1	no_errors	ENST00000264864	ensembl	human	known	69_37n	missense	123	30.51	54	SNP	1.000	C
PI4K2B	55300	genome.wustl.edu	37	4	25258269	25258269	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr4:25258269G>C	ENST00000264864.6	+	4	918	c.729G>C	c.(727-729)aaG>aaC	p.K243N	PI4K2B_ENST00000512921.1_Missense_Mutation_p.K147N	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	243	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				TGGGTAGAAAGTTTCATAGGA	0.413																																						dbGAP											0													107.0	109.0	108.0					4																	25258269		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.729G>C	4.37:g.25258269G>C	ENSP00000264864:p.Lys243Asn		Q9NUW2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom	p.K243N	ENST00000264864.6	37	c.729	CCDS3433.1	4	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725901	0.69074	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	T;T	0.75704	-0.96;-0.96	6.07	3.98	0.46160	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.090751	0.85682	D	0.000000	T	0.78861	0.4350	M	0.65975	2.015	0.47476	D	0.999431	P	0.51933	0.949	P	0.57960	0.83	T	0.76963	-0.2764	10	0.56958	D	0.05	-18.8898	5.6473	0.17596	0.5546:0.0:0.4454:0.0	.	243	Q8TCG2	P4K2B_HUMAN	N	147;243;212	ENSP00000423373:K147N;ENSP00000264864:K243N	ENSP00000264864:K243N	K	+	3	2	PI4K2B	24867367	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.877000	0.28106	0.714000	0.32081	0.655000	0.94253	AAG	PI4K2B	-	pfam_PI3/4_kinase_cat_dom	ENSG00000038210		0.413	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI4K2B	HGNC	protein_coding	OTTHUMT00000250415.1	111	0.00	0	G	NM_018323		25258269	25258269	+1	no_errors	ENST00000264864	ensembl	human	known	69_37n	missense	123	30.51	54	SNP	1.000	C
PIK3CA	5290	genome.wustl.edu	37	3	178927980	178927980	+	Missense_Mutation	SNP	T	T	C	rs121913272		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr3:178927980T>C	ENST00000263967.3	+	8	1415	c.1258T>C	c.(1258-1260)Tgt>Cgt	p.C420R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	420	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		C -> R (in CLOVE and CRC; shows an increase in lipid kinase activity; may increase the affinity for lipid membranes). {ECO:0000269|PubMed:22658544}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.C420R(40)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TAAGGAACACTGTCCATTGGC	0.328	C420R(CCK81_LARGE_INTESTINE)|C420R(EFM192A_BREAST)|C420R(HEC151_ENDOMETRIUM)|C420R(OVISE_OVARY)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	40	Substitution - Missense(40)	breast(15)|large_intestine(10)|endometrium(7)|central_nervous_system(2)|lung(2)|prostate(2)|stomach(1)|NS(1)											85.0	80.0	82.0					3																	178927980		1822	4078	5900	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1258T>C	3.37:g.178927980T>C	ENSP00000263967:p.Cys420Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.C420R	ENST00000263967.3	37	c.1258	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	T	19.97	3.925687	0.73213	.	.	ENSG00000121879	ENST00000263967	T	0.68903	-0.36	5.51	5.51	0.81932	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.000000	0.85682	D	0.000000	T	0.76856	0.4046	M	0.61703	1.905	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	T	0.74284	-0.3715	10	0.25751	T	0.34	-11.2314	15.6207	0.76805	0.0:0.0:0.0:1.0	.	420	P42336	PK3CA_HUMAN	R	420	ENSP00000263967:C420R	ENSP00000263967:C420R	C	+	1	0	PIK3CA	180410674	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.698000	0.84413	2.105000	0.64084	0.460000	0.39030	TGT	PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000121879		0.328	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	120	0.00	0	T			178927980	178927980	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	100	39.88	67	SNP	1.000	C
PIK3CA	5290	genome.wustl.edu	37	3	178927980	178927980	+	Missense_Mutation	SNP	T	T	C	rs121913272		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr3:178927980T>C	ENST00000263967.3	+	8	1415	c.1258T>C	c.(1258-1260)Tgt>Cgt	p.C420R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	420	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		C -> R (in CLOVE and CRC; shows an increase in lipid kinase activity; may increase the affinity for lipid membranes). {ECO:0000269|PubMed:22658544}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.C420R(40)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TAAGGAACACTGTCCATTGGC	0.328	C420R(CCK81_LARGE_INTESTINE)|C420R(EFM192A_BREAST)|C420R(HEC151_ENDOMETRIUM)|C420R(OVISE_OVARY)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	40	Substitution - Missense(40)	breast(15)|large_intestine(10)|endometrium(7)|central_nervous_system(2)|lung(2)|prostate(2)|stomach(1)|NS(1)											85.0	80.0	82.0					3																	178927980		1822	4078	5900	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1258T>C	3.37:g.178927980T>C	ENSP00000263967:p.Cys420Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.C420R	ENST00000263967.3	37	c.1258	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	T	19.97	3.925687	0.73213	.	.	ENSG00000121879	ENST00000263967	T	0.68903	-0.36	5.51	5.51	0.81932	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.000000	0.85682	D	0.000000	T	0.76856	0.4046	M	0.61703	1.905	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	T	0.74284	-0.3715	10	0.25751	T	0.34	-11.2314	15.6207	0.76805	0.0:0.0:0.0:1.0	.	420	P42336	PK3CA_HUMAN	R	420	ENSP00000263967:C420R	ENSP00000263967:C420R	C	+	1	0	PIK3CA	180410674	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.698000	0.84413	2.105000	0.64084	0.460000	0.39030	TGT	PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000121879		0.328	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	89	0.00	0	T			178927980	178927980	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	100	39.88	67	SNP	1.000	C
PKD1L1	168507	genome.wustl.edu	37	7	47847972	47847972	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr7:47847972C>T	ENST00000289672.2	-	52	7750	c.7700G>A	c.(7699-7701)gGa>gAa	p.G2567E	C7orf69_ENST00000258776.4_Intron|PKD1L1_ENST00000462350.1_5'Flank|C7orf69_ENST00000418326.2_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2567					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GAGGCTCACTCCAACCACGGA	0.522																																						dbGAP											0													101.0	90.0	93.0					7																	47847972		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.7700G>A	7.37:g.47847972C>T	ENSP00000289672:p.Gly2567Glu		Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.G2567E	ENST00000289672.2	37	c.7700	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763941	0.49574	.	.	ENSG00000158683	ENST00000289672	T	0.70045	-0.45	5.12	5.12	0.69794	Polycystin cation channel, PKD1/PKD2 (1);	0.338051	0.24405	N	0.038813	T	0.74351	0.3705	L	0.46157	1.445	0.34912	D	0.747544	D	0.76494	0.999	D	0.69824	0.966	T	0.79940	-0.1591	10	0.46703	T	0.11	-20.808	11.8794	0.52566	0.0:0.8236:0.1764:0.0	.	2567	Q8TDX9	PK1L1_HUMAN	E	2567	ENSP00000289672:G2567E	ENSP00000289672:G2567E	G	-	2	0	PKD1L1	47814497	0.060000	0.20803	0.022000	0.16811	0.003000	0.03518	2.304000	0.43655	2.385000	0.81259	0.655000	0.94253	GGA	PKD1L1	-	pfam_PKD1_2_channel	ENSG00000158683		0.522	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	49	0.00	0	C	NM_138295		47847972	47847972	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	47	35.62	26	SNP	0.085	T
PKD1L1	168507	genome.wustl.edu	37	7	47847972	47847972	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr7:47847972C>T	ENST00000289672.2	-	52	7750	c.7700G>A	c.(7699-7701)gGa>gAa	p.G2567E	C7orf69_ENST00000258776.4_Intron|PKD1L1_ENST00000462350.1_5'Flank|C7orf69_ENST00000418326.2_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2567					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GAGGCTCACTCCAACCACGGA	0.522																																						dbGAP											0													101.0	90.0	93.0					7																	47847972		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.7700G>A	7.37:g.47847972C>T	ENSP00000289672:p.Gly2567Glu		Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.G2567E	ENST00000289672.2	37	c.7700	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763941	0.49574	.	.	ENSG00000158683	ENST00000289672	T	0.70045	-0.45	5.12	5.12	0.69794	Polycystin cation channel, PKD1/PKD2 (1);	0.338051	0.24405	N	0.038813	T	0.74351	0.3705	L	0.46157	1.445	0.34912	D	0.747544	D	0.76494	0.999	D	0.69824	0.966	T	0.79940	-0.1591	10	0.46703	T	0.11	-20.808	11.8794	0.52566	0.0:0.8236:0.1764:0.0	.	2567	Q8TDX9	PK1L1_HUMAN	E	2567	ENSP00000289672:G2567E	ENSP00000289672:G2567E	G	-	2	0	PKD1L1	47814497	0.060000	0.20803	0.022000	0.16811	0.003000	0.03518	2.304000	0.43655	2.385000	0.81259	0.655000	0.94253	GGA	PKD1L1	-	pfam_PKD1_2_channel	ENSG00000158683		0.522	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	67	0.00	0	C	NM_138295		47847972	47847972	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	47	35.62	26	SNP	0.085	T
PKN2	5586	genome.wustl.edu	37	1	89298781	89298781	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:89298781C>T	ENST00000370521.3	+	21	3051	c.2692C>T	c.(2692-2694)Cgg>Tgg	p.R898W	PKN2_ENST00000370513.5_Missense_Mutation_p.R850W|PKN2_ENST00000544045.1_Missense_Mutation_p.R572W|PKN2_ENST00000495119.1_3'UTR|PKN2_ENST00000370505.3_Missense_Mutation_p.R741W	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	898	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		AAATCCTGAACGGCGCCTTGG	0.318																																						dbGAP											0													47.0	47.0	47.0					1																	89298781		1796	4061	5857	-	-	-	SO:0001583	missense	0			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.2692C>T	1.37:g.89298781C>T	ENSP00000359552:p.Arg898Trp		B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_HR1_rho-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.R898W	ENST00000370521.3	37	c.2692	CCDS714.1	1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911098	0.52439	.	.	ENSG00000065243	ENST00000370521;ENST00000370505;ENST00000370513;ENST00000544045	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.62	2.53	0.30540	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40554	U	0.001070	T	0.61837	0.2379	M	0.81179	2.53	0.53005	D	0.999966	D;D;D	0.76494	0.999;0.998;0.995	D;D;P	0.73380	0.98;0.927;0.727	T	0.66917	-0.5802	10	0.87932	D	0	.	11.1259	0.48317	0.2809:0.5989:0.1202:0.0	.	882;850;898	B4DTP5;E7ESL7;Q16513	.;.;PKN2_HUMAN	W	898;741;850;572	ENSP00000359552:R898W;ENSP00000359536:R741W;ENSP00000359544:R850W;ENSP00000439643:R572W	ENSP00000359536:R741W	R	+	1	2	PKN2	89071369	1.000000	0.71417	0.883000	0.34634	0.725000	0.41563	2.230000	0.42999	0.224000	0.20940	0.467000	0.42956	CGG	PKN2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000065243		0.318	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN2	HGNC	protein_coding	OTTHUMT00000027828.3	106	0.00	0	C	NM_006256		89298781	89298781	+1	no_errors	ENST00000370521	ensembl	human	known	69_37n	missense	62	25.30	21	SNP	0.985	T
PKN2	5586	genome.wustl.edu	37	1	89298781	89298781	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:89298781C>T	ENST00000370521.3	+	21	3051	c.2692C>T	c.(2692-2694)Cgg>Tgg	p.R898W	PKN2_ENST00000370513.5_Missense_Mutation_p.R850W|PKN2_ENST00000544045.1_Missense_Mutation_p.R572W|PKN2_ENST00000495119.1_3'UTR|PKN2_ENST00000370505.3_Missense_Mutation_p.R741W	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	898	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		AAATCCTGAACGGCGCCTTGG	0.318																																						dbGAP											0													47.0	47.0	47.0					1																	89298781		1796	4061	5857	-	-	-	SO:0001583	missense	0			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.2692C>T	1.37:g.89298781C>T	ENSP00000359552:p.Arg898Trp		B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_HR1_rho-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.R898W	ENST00000370521.3	37	c.2692	CCDS714.1	1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911098	0.52439	.	.	ENSG00000065243	ENST00000370521;ENST00000370505;ENST00000370513;ENST00000544045	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.62	2.53	0.30540	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40554	U	0.001070	T	0.61837	0.2379	M	0.81179	2.53	0.53005	D	0.999966	D;D;D	0.76494	0.999;0.998;0.995	D;D;P	0.73380	0.98;0.927;0.727	T	0.66917	-0.5802	10	0.87932	D	0	.	11.1259	0.48317	0.2809:0.5989:0.1202:0.0	.	882;850;898	B4DTP5;E7ESL7;Q16513	.;.;PKN2_HUMAN	W	898;741;850;572	ENSP00000359552:R898W;ENSP00000359536:R741W;ENSP00000359544:R850W;ENSP00000439643:R572W	ENSP00000359536:R741W	R	+	1	2	PKN2	89071369	1.000000	0.71417	0.883000	0.34634	0.725000	0.41563	2.230000	0.42999	0.224000	0.20940	0.467000	0.42956	CGG	PKN2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000065243		0.318	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN2	HGNC	protein_coding	OTTHUMT00000027828.3	40	0.00	0	C	NM_006256		89298781	89298781	+1	no_errors	ENST00000370521	ensembl	human	known	69_37n	missense	62	25.30	21	SNP	0.985	T
POP1	10940	genome.wustl.edu	37	8	99135672	99135672	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr8:99135672G>C	ENST00000401707.2	+	2	188	c.107G>C	c.(106-108)aGt>aCt	p.S36T	POP1_ENST00000349693.3_Missense_Mutation_p.S36T	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	36					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			AAGCACCACAGTGGAGGTGAA	0.463																																						dbGAP											0													98.0	89.0	92.0					8																	99135672		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.107G>C	8.37:g.99135672G>C	ENSP00000385787:p.Ser36Thr		A8K5W9|Q15037	Missense_Mutation	SNP	pfam_RNase_P/MRP_POP1,pfam_POPLD	p.S36T	ENST00000401707.2	37	c.107	CCDS6277.1	8	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.641265	0.00799	.	.	ENSG00000104356	ENST00000522319;ENST00000401707;ENST00000349693	T;T;T	0.41758	0.99;1.31;1.31	4.87	-2.65	0.06095	.	0.874348	0.09948	N	0.735000	T	0.18383	0.0441	N	0.14661	0.345	0.09310	N	1	B	0.18166	0.026	B	0.14023	0.01	T	0.27434	-1.0074	10	0.11794	T	0.64	-12.1197	4.2756	0.10808	0.5604:0.0:0.1646:0.2749	.	36	Q99575	POP1_HUMAN	T	36	ENSP00000428945:S36T;ENSP00000385787:S36T;ENSP00000339529:S36T	ENSP00000339529:S36T	S	+	2	0	POP1	99204848	0.953000	0.32496	0.040000	0.18447	0.550000	0.35303	0.560000	0.23500	-0.652000	0.05408	-1.506000	0.00953	AGT	POP1	-	NULL	ENSG00000104356		0.463	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	HGNC	protein_coding	OTTHUMT00000379470.1	189	0.00	0	G	NM_015029		99135672	99135672	+1	no_errors	ENST00000349693	ensembl	human	known	69_37n	missense	185	17.78	40	SNP	0.364	C
POP1	10940	genome.wustl.edu	37	8	99135672	99135672	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr8:99135672G>C	ENST00000401707.2	+	2	188	c.107G>C	c.(106-108)aGt>aCt	p.S36T	POP1_ENST00000349693.3_Missense_Mutation_p.S36T	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	36					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			AAGCACCACAGTGGAGGTGAA	0.463																																						dbGAP											0													98.0	89.0	92.0					8																	99135672		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.107G>C	8.37:g.99135672G>C	ENSP00000385787:p.Ser36Thr		A8K5W9|Q15037	Missense_Mutation	SNP	pfam_RNase_P/MRP_POP1,pfam_POPLD	p.S36T	ENST00000401707.2	37	c.107	CCDS6277.1	8	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.641265	0.00799	.	.	ENSG00000104356	ENST00000522319;ENST00000401707;ENST00000349693	T;T;T	0.41758	0.99;1.31;1.31	4.87	-2.65	0.06095	.	0.874348	0.09948	N	0.735000	T	0.18383	0.0441	N	0.14661	0.345	0.09310	N	1	B	0.18166	0.026	B	0.14023	0.01	T	0.27434	-1.0074	10	0.11794	T	0.64	-12.1197	4.2756	0.10808	0.5604:0.0:0.1646:0.2749	.	36	Q99575	POP1_HUMAN	T	36	ENSP00000428945:S36T;ENSP00000385787:S36T;ENSP00000339529:S36T	ENSP00000339529:S36T	S	+	2	0	POP1	99204848	0.953000	0.32496	0.040000	0.18447	0.550000	0.35303	0.560000	0.23500	-0.652000	0.05408	-1.506000	0.00953	AGT	POP1	-	NULL	ENSG00000104356		0.463	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	HGNC	protein_coding	OTTHUMT00000379470.1	170	0.00	0	G	NM_015029		99135672	99135672	+1	no_errors	ENST00000349693	ensembl	human	known	69_37n	missense	185	17.78	40	SNP	0.364	C
PRKD2	25865	genome.wustl.edu	37	19	47181714	47181714	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr19:47181714G>C	ENST00000291281.4	-	16	2502	c.2277C>G	c.(2275-2277)gaC>gaG	p.D759E	DACT3-AS1_ENST00000525008.1_RNA|PRKD2_ENST00000600194.1_Missense_Mutation_p.D602E|PRKD2_ENST00000595515.1_Missense_Mutation_p.D759E|PRKD2_ENST00000593492.1_5'Flank|PRKD2_ENST00000433867.1_Missense_Mutation_p.D759E|PRKD2_ENST00000601806.1_Missense_Mutation_p.D602E			Q9BZL6	KPCD2_HUMAN	protein kinase D2	759	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TCTGGATCTGGTCATTGATGT	0.622																																						dbGAP											0													154.0	119.0	131.0					19																	47181714		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.2277C>G	19.37:g.47181714G>C	ENSP00000291281:p.Asp759Glu		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_DAG/PE-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.D759E	ENST00000291281.4	37	c.2277	CCDS12689.1	19	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773050	0.49680	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	D;D	0.82255	-1.59;-1.59	4.65	3.6	0.41247	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000003	T	0.73156	0.3551	N	0.04245	-0.25	0.51482	D	0.999925	B;B;P	0.45212	0.179;0.02;0.853	B;B;P	0.53062	0.147;0.06;0.717	T	0.71133	-0.4681	10	0.24483	T	0.36	-45.1396	11.4596	0.50202	0.0906:0.0:0.9094:0.0	.	759;244;759	E7ER94;A0JLT6;Q9BZL6	.;.;KPCD2_HUMAN	E	759	ENSP00000291281:D759E;ENSP00000393978:D759E	ENSP00000291281:D759E	D	-	3	2	PRKD2	51873554	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.053000	0.41326	2.308000	0.77769	0.563000	0.77884	GAC	PRKD2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000105287		0.622	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD2	HGNC	protein_coding	OTTHUMT00000466591.1	25	0.00	0	G	NM_016457		47181714	47181714	-1	no_errors	ENST00000291281	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	C
PRKD2	25865	genome.wustl.edu	37	19	47181714	47181714	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr19:47181714G>C	ENST00000291281.4	-	16	2502	c.2277C>G	c.(2275-2277)gaC>gaG	p.D759E	DACT3-AS1_ENST00000525008.1_RNA|PRKD2_ENST00000600194.1_Missense_Mutation_p.D602E|PRKD2_ENST00000595515.1_Missense_Mutation_p.D759E|PRKD2_ENST00000593492.1_5'Flank|PRKD2_ENST00000433867.1_Missense_Mutation_p.D759E|PRKD2_ENST00000601806.1_Missense_Mutation_p.D602E			Q9BZL6	KPCD2_HUMAN	protein kinase D2	759	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TCTGGATCTGGTCATTGATGT	0.622																																						dbGAP											0													154.0	119.0	131.0					19																	47181714		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.2277C>G	19.37:g.47181714G>C	ENSP00000291281:p.Asp759Glu		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_DAG/PE-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.D759E	ENST00000291281.4	37	c.2277	CCDS12689.1	19	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773050	0.49680	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	D;D	0.82255	-1.59;-1.59	4.65	3.6	0.41247	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000003	T	0.73156	0.3551	N	0.04245	-0.25	0.51482	D	0.999925	B;B;P	0.45212	0.179;0.02;0.853	B;B;P	0.53062	0.147;0.06;0.717	T	0.71133	-0.4681	10	0.24483	T	0.36	-45.1396	11.4596	0.50202	0.0906:0.0:0.9094:0.0	.	759;244;759	E7ER94;A0JLT6;Q9BZL6	.;.;KPCD2_HUMAN	E	759	ENSP00000291281:D759E;ENSP00000393978:D759E	ENSP00000291281:D759E	D	-	3	2	PRKD2	51873554	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.053000	0.41326	2.308000	0.77769	0.563000	0.77884	GAC	PRKD2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000105287		0.622	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD2	HGNC	protein_coding	OTTHUMT00000466591.1	25	0.00	0	G	NM_016457		47181714	47181714	-1	no_errors	ENST00000291281	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	C
PRSS53	339105	genome.wustl.edu	37	16	31098970	31098971	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr16:31098970_31098971delCT	ENST00000280606.6	-	3	282_283	c.129_130delAG	c.(127-132)acagtcfs	p.V44fs	RP11-196G11.1_ENST00000529564.1_Frame_Shift_Del_p.V119fs	NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	44	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						TCGCCAGGGACTGTGTTGCCCT	0.649																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.129_130delAG	16.37:g.31098970_31098971delCT	ENSP00000280606:p.Val44fs			Frame_Shift_Del	DEL	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.V44fs	ENST00000280606.6	37	c.130_129	CCDS42153.1	16																																																																																			PRSS53	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000151006		0.649	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS53	HGNC	protein_coding	OTTHUMT00000108580.4	14	0.00	0	CT	NM_001081268		31098970	31098971	-1	no_errors	ENST00000280606	ensembl	human	known	69_37n	frame_shift_del	9	33.33	5	DEL	0.000:0.000	-
PRSS53	339105	genome.wustl.edu	37	16	31098970	31098971	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr16:31098970_31098971delCT	ENST00000280606.6	-	3	282_283	c.129_130delAG	c.(127-132)acagtcfs	p.V44fs	RP11-196G11.1_ENST00000529564.1_Frame_Shift_Del_p.V119fs	NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	44	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						TCGCCAGGGACTGTGTTGCCCT	0.649																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.129_130delAG	16.37:g.31098970_31098971delCT	ENSP00000280606:p.Val44fs			Frame_Shift_Del	DEL	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.V44fs	ENST00000280606.6	37	c.130_129	CCDS42153.1	16																																																																																			PRSS53	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000151006		0.649	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS53	HGNC	protein_coding	OTTHUMT00000108580.4	22	0.00	0	CT	NM_001081268		31098970	31098971	-1	no_errors	ENST00000280606	ensembl	human	known	69_37n	frame_shift_del	9	33.33	5	DEL	0.000:0.000	-
PSEN2	5664	genome.wustl.edu	37	1	227076718	227076718	+	Missense_Mutation	SNP	C	C	T	rs201403206		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:227076718C>T	ENST00000366783.3	+	8	1191	c.755C>T	c.(754-756)gCg>gTg	p.A252V	PSEN2_ENST00000472139.2_Missense_Mutation_p.A108V|PSEN2_ENST00000366782.1_Missense_Mutation_p.A285V|PSEN2_ENST00000391872.2_Missense_Mutation_p.A285V|PSEN2_ENST00000340188.4_Missense_Mutation_p.A252V|PSEN2_ENST00000422240.2_Missense_Mutation_p.A252V	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	252					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				GAGTGGTCCGCGTGGGTCATC	0.617																																						dbGAP											0													110.0	86.0	94.0					1																	227076718		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.755C>T	1.37:g.227076718C>T	ENSP00000355747:p.Ala252Val		A8K8D4|B1AP21|Q96P32	Missense_Mutation	SNP	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Pept_A22A_PS2,prints_Peptidase_A22A	p.A285V	ENST00000366783.3	37	c.854	CCDS1556.1	1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852714	0.71719	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000422240;ENST00000460775;ENST00000366782;ENST00000391872;ENST00000472139	D;D;D;D;D;D;D	0.99507	-6.04;-6.04;-6.04;-6.04;-6.04;-6.04;-6.04	4.92	4.92	0.64577	.	0.048972	0.85682	D	0.000000	D	0.98454	0.9485	L	0.42008	1.315	0.80722	D	1	P;P	0.52316	0.659;0.952	B;P	0.45681	0.319;0.49	D	0.98897	1.0775	10	0.31617	T	0.26	.	18.4832	0.90819	0.0:1.0:0.0:0.0	.	252;252	A8K8D4;P49810	.;PSN2_HUMAN	V	252;252;252;79;285;285;108	ENSP00000355747:A252V;ENSP00000339860:A252V;ENSP00000403737:A252V;ENSP00000427912:A79V;ENSP00000355746:A285V;ENSP00000375745:A285V;ENSP00000427806:A108V	ENSP00000339860:A252V	A	+	2	0	PSEN2	225143341	1.000000	0.71417	0.922000	0.36590	0.986000	0.74619	4.792000	0.62467	2.426000	0.82243	0.561000	0.74099	GCG	PSEN2	-	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Peptidase_A22A	ENSG00000143801		0.617	PSEN2-001	KNOWN	basic|CCDS	protein_coding	PSEN2	HGNC	protein_coding	OTTHUMT00000091539.1	28	0.00	0	C	NM_000447		227076718	227076718	+1	no_errors	ENST00000391872	ensembl	human	known	69_37n	missense	19	52.50	21	SNP	1.000	T
PSEN2	5664	genome.wustl.edu	37	1	227076718	227076718	+	Missense_Mutation	SNP	C	C	T	rs201403206		TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:227076718C>T	ENST00000366783.3	+	8	1191	c.755C>T	c.(754-756)gCg>gTg	p.A252V	PSEN2_ENST00000472139.2_Missense_Mutation_p.A108V|PSEN2_ENST00000366782.1_Missense_Mutation_p.A285V|PSEN2_ENST00000391872.2_Missense_Mutation_p.A285V|PSEN2_ENST00000340188.4_Missense_Mutation_p.A252V|PSEN2_ENST00000422240.2_Missense_Mutation_p.A252V	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	252					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				GAGTGGTCCGCGTGGGTCATC	0.617																																						dbGAP											0													110.0	86.0	94.0					1																	227076718		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.755C>T	1.37:g.227076718C>T	ENSP00000355747:p.Ala252Val		A8K8D4|B1AP21|Q96P32	Missense_Mutation	SNP	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Pept_A22A_PS2,prints_Peptidase_A22A	p.A285V	ENST00000366783.3	37	c.854	CCDS1556.1	1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852714	0.71719	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000422240;ENST00000460775;ENST00000366782;ENST00000391872;ENST00000472139	D;D;D;D;D;D;D	0.99507	-6.04;-6.04;-6.04;-6.04;-6.04;-6.04;-6.04	4.92	4.92	0.64577	.	0.048972	0.85682	D	0.000000	D	0.98454	0.9485	L	0.42008	1.315	0.80722	D	1	P;P	0.52316	0.659;0.952	B;P	0.45681	0.319;0.49	D	0.98897	1.0775	10	0.31617	T	0.26	.	18.4832	0.90819	0.0:1.0:0.0:0.0	.	252;252	A8K8D4;P49810	.;PSN2_HUMAN	V	252;252;252;79;285;285;108	ENSP00000355747:A252V;ENSP00000339860:A252V;ENSP00000403737:A252V;ENSP00000427912:A79V;ENSP00000355746:A285V;ENSP00000375745:A285V;ENSP00000427806:A108V	ENSP00000339860:A252V	A	+	2	0	PSEN2	225143341	1.000000	0.71417	0.922000	0.36590	0.986000	0.74619	4.792000	0.62467	2.426000	0.82243	0.561000	0.74099	GCG	PSEN2	-	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Peptidase_A22A	ENSG00000143801		0.617	PSEN2-001	KNOWN	basic|CCDS	protein_coding	PSEN2	HGNC	protein_coding	OTTHUMT00000091539.1	67	0.00	0	C	NM_000447		227076718	227076718	+1	no_errors	ENST00000391872	ensembl	human	known	69_37n	missense	19	52.50	21	SNP	1.000	T
PTPN12	5782	genome.wustl.edu	37	7	77256423	77256423	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr7:77256423C>G	ENST00000248594.6	+	13	1699	c.1427C>G	c.(1426-1428)tCt>tGt	p.S476C	PTPN12_ENST00000435495.2_Missense_Mutation_p.S346C|PTPN12_ENST00000415482.2_Missense_Mutation_p.S357C	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	476					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						GATAAAATCTCTAAGCCACAG	0.373																																						dbGAP											0													65.0	66.0	66.0					7																	77256423		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1427C>G	7.37:g.77256423C>G	ENSP00000248594:p.Ser476Cys		A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-12,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S476C	ENST00000248594.6	37	c.1427	CCDS5592.1	7	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848257	0.32699	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495	T;T;T	0.08458	3.67;3.09;3.09	6.06	1.66	0.24008	.	0.549874	0.20226	N	0.096584	T	0.17831	0.0428	L	0.53249	1.67	0.09310	N	1	D	0.67145	0.996	D	0.63033	0.91	T	0.02588	-1.1137	10	0.62326	D	0.03	.	8.6675	0.34130	0.0:0.626:0.1162:0.2579	.	476	Q05209	PTN12_HUMAN	C	476;357;357;346	ENSP00000248594:S476C;ENSP00000392429:S357C;ENSP00000397991:S346C	ENSP00000248594:S476C	S	+	2	0	PTPN12	77094359	0.526000	0.26298	0.006000	0.13384	0.760000	0.43138	1.314000	0.33597	0.424000	0.26061	0.655000	0.94253	TCT	PTPN12	-	pirsf_Tyr_Pase_non-rcpt_typ-12	ENSG00000127947		0.373	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN12	HGNC	protein_coding	OTTHUMT00000253183.3	193	0.00	0	C			77256423	77256423	+1	no_errors	ENST00000248594	ensembl	human	known	69_37n	missense	202	20.78	53	SNP	0.000	G
PTPN12	5782	genome.wustl.edu	37	7	77256423	77256423	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr7:77256423C>G	ENST00000248594.6	+	13	1699	c.1427C>G	c.(1426-1428)tCt>tGt	p.S476C	PTPN12_ENST00000435495.2_Missense_Mutation_p.S346C|PTPN12_ENST00000415482.2_Missense_Mutation_p.S357C	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	476					protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						GATAAAATCTCTAAGCCACAG	0.373																																						dbGAP											0													65.0	66.0	66.0					7																	77256423		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.1427C>G	7.37:g.77256423C>G	ENSP00000248594:p.Ser476Cys		A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-12,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S476C	ENST00000248594.6	37	c.1427	CCDS5592.1	7	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848257	0.32699	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495	T;T;T	0.08458	3.67;3.09;3.09	6.06	1.66	0.24008	.	0.549874	0.20226	N	0.096584	T	0.17831	0.0428	L	0.53249	1.67	0.09310	N	1	D	0.67145	0.996	D	0.63033	0.91	T	0.02588	-1.1137	10	0.62326	D	0.03	.	8.6675	0.34130	0.0:0.626:0.1162:0.2579	.	476	Q05209	PTN12_HUMAN	C	476;357;357;346	ENSP00000248594:S476C;ENSP00000392429:S357C;ENSP00000397991:S346C	ENSP00000248594:S476C	S	+	2	0	PTPN12	77094359	0.526000	0.26298	0.006000	0.13384	0.760000	0.43138	1.314000	0.33597	0.424000	0.26061	0.655000	0.94253	TCT	PTPN12	-	pirsf_Tyr_Pase_non-rcpt_typ-12	ENSG00000127947		0.373	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN12	HGNC	protein_coding	OTTHUMT00000253183.3	203	0.00	0	C			77256423	77256423	+1	no_errors	ENST00000248594	ensembl	human	known	69_37n	missense	202	20.78	53	SNP	0.000	G
PWP2	5822	genome.wustl.edu	37	21	45540528	45540528	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr21:45540528A>T	ENST00000291576.7	+	12	1481	c.1354A>T	c.(1354-1356)Acc>Tcc	p.T452S		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	452					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		AAACTTCCGCACCTTCACCTC	0.617																																						dbGAP											0													91.0	71.0	78.0					21																	45540528		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.1354A>T	21.37:g.45540528A>T	ENSP00000291576:p.Thr452Ser		B2RAG8|Q96A77	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T452S	ENST00000291576.7	37	c.1354	CCDS33579.1	21	.	.	.	.	.	.	.	.	.	.	A	27.0	4.788517	0.90367	.	.	ENSG00000241945	ENST00000291576	T	0.04970	3.52	4.73	4.73	0.59995	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.25791	0.0628	M	0.93283	3.4	0.54753	D	0.999983	D	0.59767	0.986	P	0.53722	0.733	T	0.30707	-0.9969	10	0.72032	D	0.01	-16.6608	13.1132	0.59285	1.0:0.0:0.0:0.0	.	452	Q15269	PWP2_HUMAN	S	452	ENSP00000291576:T452S	ENSP00000291576:T452S	T	+	1	0	PWP2	44364956	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.273000	0.89887	1.902000	0.55061	0.533000	0.62120	ACC	PWP2	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000241945		0.617	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP2	HGNC	protein_coding	OTTHUMT00000195736.3	45	0.00	0	A	NM_005049		45540528	45540528	+1	no_errors	ENST00000291576	ensembl	human	known	69_37n	missense	27	17.65	6	SNP	1.000	T
PWP2	5822	genome.wustl.edu	37	21	45540528	45540528	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr21:45540528A>T	ENST00000291576.7	+	12	1481	c.1354A>T	c.(1354-1356)Acc>Tcc	p.T452S		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	452					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		AAACTTCCGCACCTTCACCTC	0.617																																						dbGAP											0													91.0	71.0	78.0					21																	45540528		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.1354A>T	21.37:g.45540528A>T	ENSP00000291576:p.Thr452Ser		B2RAG8|Q96A77	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T452S	ENST00000291576.7	37	c.1354	CCDS33579.1	21	.	.	.	.	.	.	.	.	.	.	A	27.0	4.788517	0.90367	.	.	ENSG00000241945	ENST00000291576	T	0.04970	3.52	4.73	4.73	0.59995	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.25791	0.0628	M	0.93283	3.4	0.54753	D	0.999983	D	0.59767	0.986	P	0.53722	0.733	T	0.30707	-0.9969	10	0.72032	D	0.01	-16.6608	13.1132	0.59285	1.0:0.0:0.0:0.0	.	452	Q15269	PWP2_HUMAN	S	452	ENSP00000291576:T452S	ENSP00000291576:T452S	T	+	1	0	PWP2	44364956	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	8.273000	0.89887	1.902000	0.55061	0.533000	0.62120	ACC	PWP2	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000241945		0.617	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP2	HGNC	protein_coding	OTTHUMT00000195736.3	42	0.00	0	A	NM_005049		45540528	45540528	+1	no_errors	ENST00000291576	ensembl	human	known	69_37n	missense	27	17.65	6	SNP	1.000	T
RNF214	257160	genome.wustl.edu	37	11	117152922	117152922	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr11:117152922C>A	ENST00000531452.1	+	11	1694	c.1648C>A	c.(1648-1650)Caa>Aaa	p.Q550K	RNF214_ENST00000530849.1_Missense_Mutation_p.Q395K|RNF214_ENST00000531287.1_Missense_Mutation_p.Q395K|RNF214_ENST00000300650.4_Missense_Mutation_p.Q550K|RNF214_ENST00000524917.1_Intron	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	550	Pro-rich.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		TCCCCGGCCCCAACCAGTAGA	0.572																																						dbGAP											0													87.0	91.0	89.0					11																	117152922		1894	4096	5990	-	-	-	SO:0001583	missense	0			AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.1648C>A	11.37:g.117152922C>A	ENSP00000431643:p.Gln550Lys		B2RUW0|B4DTD1	Missense_Mutation	SNP	pfscan_Znf_RING	p.Q550K	ENST00000531452.1	37	c.1648	CCDS41720.1	11	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913109	0.52439	.	.	ENSG00000167257	ENST00000531287;ENST00000531452;ENST00000530849;ENST00000300650;ENST00000534709	T;T;T;T	0.41065	1.01;1.3;1.3;1.3	5.39	4.48	0.54585	.	0.136170	0.47852	D	0.000209	T	0.51398	0.1672	L	0.57536	1.79	0.36959	D	0.893226	P;D	0.57257	0.892;0.979	P;D	0.63957	0.702;0.92	T	0.56080	-0.8038	10	0.02654	T	1	-4.2892	12.9257	0.58258	0.0:0.9221:0.0:0.0779	.	395;550	B4DTD1;Q8ND24	.;RN214_HUMAN	K	395;550;395;550;102	ENSP00000435361:Q395K;ENSP00000431643:Q550K;ENSP00000432903:Q395K;ENSP00000300650:Q550K	ENSP00000300650:Q550K	Q	+	1	0	RNF214	116658132	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.291000	0.59025	1.269000	0.44280	0.561000	0.74099	CAA	RNF214	-	NULL	ENSG00000167257		0.572	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF214	HGNC	protein_coding	OTTHUMT00000392884.1	325	0.00	0	C	NM_001077239		117152922	117152922	+1	no_errors	ENST00000300650	ensembl	human	known	69_37n	missense	144	27.64	55	SNP	1.000	A
RNF214	257160	genome.wustl.edu	37	11	117152922	117152922	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr11:117152922C>A	ENST00000531452.1	+	11	1694	c.1648C>A	c.(1648-1650)Caa>Aaa	p.Q550K	RNF214_ENST00000530849.1_Missense_Mutation_p.Q395K|RNF214_ENST00000531287.1_Missense_Mutation_p.Q395K|RNF214_ENST00000300650.4_Missense_Mutation_p.Q550K|RNF214_ENST00000524917.1_Intron	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	550	Pro-rich.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		TCCCCGGCCCCAACCAGTAGA	0.572																																						dbGAP											0													87.0	91.0	89.0					11																	117152922		1894	4096	5990	-	-	-	SO:0001583	missense	0			AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.1648C>A	11.37:g.117152922C>A	ENSP00000431643:p.Gln550Lys		B2RUW0|B4DTD1	Missense_Mutation	SNP	pfscan_Znf_RING	p.Q550K	ENST00000531452.1	37	c.1648	CCDS41720.1	11	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913109	0.52439	.	.	ENSG00000167257	ENST00000531287;ENST00000531452;ENST00000530849;ENST00000300650;ENST00000534709	T;T;T;T	0.41065	1.01;1.3;1.3;1.3	5.39	4.48	0.54585	.	0.136170	0.47852	D	0.000209	T	0.51398	0.1672	L	0.57536	1.79	0.36959	D	0.893226	P;D	0.57257	0.892;0.979	P;D	0.63957	0.702;0.92	T	0.56080	-0.8038	10	0.02654	T	1	-4.2892	12.9257	0.58258	0.0:0.9221:0.0:0.0779	.	395;550	B4DTD1;Q8ND24	.;RN214_HUMAN	K	395;550;395;550;102	ENSP00000435361:Q395K;ENSP00000431643:Q550K;ENSP00000432903:Q395K;ENSP00000300650:Q550K	ENSP00000300650:Q550K	Q	+	1	0	RNF214	116658132	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.291000	0.59025	1.269000	0.44280	0.561000	0.74099	CAA	RNF214	-	NULL	ENSG00000167257		0.572	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF214	HGNC	protein_coding	OTTHUMT00000392884.1	213	0.00	0	C	NM_001077239		117152922	117152922	+1	no_errors	ENST00000300650	ensembl	human	known	69_37n	missense	144	27.64	55	SNP	1.000	A
RPRD1B	58490	genome.wustl.edu	37	20	36676792	36676792	+	Silent	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr20:36676792G>A	ENST00000373433.4	+	3	726	c.324G>A	c.(322-324)ctG>ctA	p.L108L		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	108	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						AAAGATTGCTGAACATCTGGC	0.423																																						dbGAP											0													106.0	91.0	96.0					20																	36676792		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.324G>A	20.37:g.36676792G>A			Q1WDE7|Q6PKF4	Silent	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.L108	ENST00000373433.4	37	c.324	CCDS13301.1	20																																																																																			RPRD1B	-	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	ENSG00000101413		0.423	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRD1B	HGNC	protein_coding	OTTHUMT00000079142.2	217	0.00	0	G	NM_021215		36676792	36676792	+1	no_errors	ENST00000373433	ensembl	human	known	69_37n	silent	204	16.73	41	SNP	1.000	A
RPRD1B	58490	genome.wustl.edu	37	20	36676792	36676792	+	Silent	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr20:36676792G>A	ENST00000373433.4	+	3	726	c.324G>A	c.(322-324)ctG>ctA	p.L108L		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	108	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						AAAGATTGCTGAACATCTGGC	0.423																																						dbGAP											0													106.0	91.0	96.0					20																	36676792		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.324G>A	20.37:g.36676792G>A			Q1WDE7|Q6PKF4	Silent	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.L108	ENST00000373433.4	37	c.324	CCDS13301.1	20																																																																																			RPRD1B	-	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	ENSG00000101413		0.423	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRD1B	HGNC	protein_coding	OTTHUMT00000079142.2	166	0.00	0	G	NM_021215		36676792	36676792	+1	no_errors	ENST00000373433	ensembl	human	known	69_37n	silent	204	16.73	41	SNP	1.000	A
SCFD1	23256	genome.wustl.edu	37	14	31119774	31119774	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr14:31119774C>A	ENST00000458591.2	+	9	900	c.673C>A	c.(673-675)Cta>Ata	p.L225I	SCFD1_ENST00000544052.2_Missense_Mutation_p.L158I|SCFD1_ENST00000396629.2_Missense_Mutation_p.L133I|SCFD1_ENST00000421551.3_Missense_Mutation_p.L166I|SCFD1_ENST00000541123.1_Missense_Mutation_p.L40I	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	225					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TTTTCAGAAACTAGACAAGAA	0.299																																						dbGAP											0													41.0	47.0	45.0					14																	31119774		2203	4291	6494	-	-	-	SO:0001583	missense	0			AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.673C>A	14.37:g.31119774C>A	ENSP00000390783:p.Leu225Ile		A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.L225I	ENST00000458591.2	37	c.673	CCDS9639.1	14	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508604	0.64410	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000553693;ENST00000396629;ENST00000469043	D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000001	D	0.91637	0.7357	M	0.89287	3.02	0.58432	D	0.999994	D;D;D;D	0.64830	0.988;0.973;0.994;0.973	P;P;D;P	0.67900	0.896;0.811;0.954;0.811	D	0.92340	0.5881	10	0.59425	D	0.04	-9.9628	14.1355	0.65284	0.0:0.926:0.0:0.074	.	166;158;133;225	B7Z738;B7Z4U7;B7Z594;Q8WVM8	.;.;.;SCFD1_HUMAN	I	225;158;166;40;66;133;80	ENSP00000390783:L225I;ENSP00000443010:L158I;ENSP00000388078:L166I;ENSP00000443537:L40I;ENSP00000452308:L66I;ENSP00000379870:L133I;ENSP00000452448:L80I	ENSP00000309417:L233I	L	+	1	2	SCFD1	30189525	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	2.050000	0.41297	2.699000	0.92147	0.655000	0.94253	CTA	SCFD1	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000092108		0.299	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD1	HGNC	protein_coding	OTTHUMT00000276612.3	69	0.00	0	C	NM_182835		31119774	31119774	+1	no_errors	ENST00000458591	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	1.000	A
SCFD1	23256	genome.wustl.edu	37	14	31119774	31119774	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr14:31119774C>A	ENST00000458591.2	+	9	900	c.673C>A	c.(673-675)Cta>Ata	p.L225I	SCFD1_ENST00000544052.2_Missense_Mutation_p.L158I|SCFD1_ENST00000396629.2_Missense_Mutation_p.L133I|SCFD1_ENST00000421551.3_Missense_Mutation_p.L166I|SCFD1_ENST00000541123.1_Missense_Mutation_p.L40I	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	225					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TTTTCAGAAACTAGACAAGAA	0.299																																						dbGAP											0													41.0	47.0	45.0					14																	31119774		2203	4291	6494	-	-	-	SO:0001583	missense	0			AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.673C>A	14.37:g.31119774C>A	ENSP00000390783:p.Leu225Ile		A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.L225I	ENST00000458591.2	37	c.673	CCDS9639.1	14	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508604	0.64410	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000553693;ENST00000396629;ENST00000469043	D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000001	D	0.91637	0.7357	M	0.89287	3.02	0.58432	D	0.999994	D;D;D;D	0.64830	0.988;0.973;0.994;0.973	P;P;D;P	0.67900	0.896;0.811;0.954;0.811	D	0.92340	0.5881	10	0.59425	D	0.04	-9.9628	14.1355	0.65284	0.0:0.926:0.0:0.074	.	166;158;133;225	B7Z738;B7Z4U7;B7Z594;Q8WVM8	.;.;.;SCFD1_HUMAN	I	225;158;166;40;66;133;80	ENSP00000390783:L225I;ENSP00000443010:L158I;ENSP00000388078:L166I;ENSP00000443537:L40I;ENSP00000452308:L66I;ENSP00000379870:L133I;ENSP00000452448:L80I	ENSP00000309417:L233I	L	+	1	2	SCFD1	30189525	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	2.050000	0.41297	2.699000	0.92147	0.655000	0.94253	CTA	SCFD1	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000092108		0.299	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD1	HGNC	protein_coding	OTTHUMT00000276612.3	23	0.00	0	C	NM_182835		31119774	31119774	+1	no_errors	ENST00000458591	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	1.000	A
SEC16A	9919	genome.wustl.edu	37	9	139357554	139357554	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr9:139357554G>T	ENST00000371706.3	-	10	4177	c.4144C>A	c.(4144-4146)Ctg>Atg	p.L1382M	SEC16A_ENST00000290037.6_Missense_Mutation_p.L1382M|SEC16A_ENST00000313050.7_Missense_Mutation_p.L1560M|SEC16A_ENST00000431893.2_Missense_Mutation_p.L1382M			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1382					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TCTCGTAACAGAAGCTCCGCA	0.547																																						dbGAP											0													68.0	73.0	72.0					9																	139357554		2049	4191	6240	-	-	-	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.4144C>A	9.37:g.139357554G>T	ENSP00000360771:p.Leu1382Met		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.L1560M	ENST00000371706.3	37	c.4678		9	.	.	.	.	.	.	.	.	.	.	G	15.01	2.704843	0.48412	.	.	ENSG00000148396	ENST00000313050;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T;T	0.56275	0.74;0.47;0.74;0.75;0.76	5.4	-3.8	0.04307	.	0.000000	0.85682	D	0.000000	T	0.57710	0.2072	L	0.34521	1.04	0.38369	D	0.944834	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	T	0.60707	-0.7210	10	0.66056	D	0.02	-17.6361	15.9315	0.79663	0.2485:0.0:0.7515:0.0	.	1560;1382;1382;950	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	M	1560;282;1382;1382;1382;950	ENSP00000325827:L1560M;ENSP00000403525:L282M;ENSP00000360771:L1382M;ENSP00000290037:L1382M;ENSP00000387583:L1382M	ENSP00000290037:L1382M	L	-	1	2	SEC16A	138477375	0.000000	0.05858	0.001000	0.08648	0.655000	0.38815	-0.273000	0.08548	-0.754000	0.04715	-0.390000	0.06520	CTG	SEC16A	-	NULL	ENSG00000148396		0.547	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	55	0.00	0	G	XM_088459		139357554	139357554	-1	no_errors	ENST00000313050	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	0.015	T
SEC16A	9919	genome.wustl.edu	37	9	139357554	139357554	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr9:139357554G>T	ENST00000371706.3	-	10	4177	c.4144C>A	c.(4144-4146)Ctg>Atg	p.L1382M	SEC16A_ENST00000290037.6_Missense_Mutation_p.L1382M|SEC16A_ENST00000313050.7_Missense_Mutation_p.L1560M|SEC16A_ENST00000431893.2_Missense_Mutation_p.L1382M			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1382					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TCTCGTAACAGAAGCTCCGCA	0.547																																						dbGAP											0													68.0	73.0	72.0					9																	139357554		2049	4191	6240	-	-	-	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.4144C>A	9.37:g.139357554G>T	ENSP00000360771:p.Leu1382Met		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.L1560M	ENST00000371706.3	37	c.4678		9	.	.	.	.	.	.	.	.	.	.	G	15.01	2.704843	0.48412	.	.	ENSG00000148396	ENST00000313050;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T;T	0.56275	0.74;0.47;0.74;0.75;0.76	5.4	-3.8	0.04307	.	0.000000	0.85682	D	0.000000	T	0.57710	0.2072	L	0.34521	1.04	0.38369	D	0.944834	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	T	0.60707	-0.7210	10	0.66056	D	0.02	-17.6361	15.9315	0.79663	0.2485:0.0:0.7515:0.0	.	1560;1382;1382;950	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	M	1560;282;1382;1382;1382;950	ENSP00000325827:L1560M;ENSP00000403525:L282M;ENSP00000360771:L1382M;ENSP00000290037:L1382M;ENSP00000387583:L1382M	ENSP00000290037:L1382M	L	-	1	2	SEC16A	138477375	0.000000	0.05858	0.001000	0.08648	0.655000	0.38815	-0.273000	0.08548	-0.754000	0.04715	-0.390000	0.06520	CTG	SEC16A	-	NULL	ENSG00000148396		0.547	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	137	0.00	0	G	XM_088459		139357554	139357554	-1	no_errors	ENST00000313050	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	0.015	T
SLC25A16	8034	genome.wustl.edu	37	10	70243321	70243321	+	Nonsense_Mutation	SNP	A	A	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr10:70243321A>C	ENST00000609923.1	-	9	965	c.867T>G	c.(865-867)taT>taG	p.Y289*	SLC25A16_ENST00000539557.1_Nonsense_Mutation_p.Y191*|SLC25A16_ENST00000265870.3_5'UTR	NM_152707.3	NP_689920.1	P16260	GDC_HUMAN	solute carrier family 25 (mitochondrial carrier), member 16	289					coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	antiporter activity (GO:0015297)			endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	7						GTCCATAGACATACTTCATAG	0.378																																						dbGAP											0													155.0	153.0	154.0					10																	70243321		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M31659	CCDS7280.1	10q21.3-q22.1	2014-06-17	2014-06-17		ENSG00000122912	ENSG00000122912		"""Solute carriers"""	10986	protein-coding gene	gene with protein product	"""Graves disease autoantigen"""	139080				8444471, 2575220	Standard	NM_152707		Approved	GDA, D10S105E, HGT.1, ML7	uc001joi.3	P16260	OTTHUMG00000018354	ENST00000609923.1:c.867T>G	10.37:g.70243321A>C	ENSP00000476815:p.Tyr289*		Q8N2U1	Nonsense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Graves_DC,prints_Mit_carrier	p.Y289*	ENST00000609923.1	37	c.867	CCDS7280.1	10	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242335	0.79912	.	.	ENSG00000122912	ENST00000265870;ENST00000539557	.	.	.	5.67	1.56	0.23342	.	0.058415	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-14.4045	9.6993	0.40175	0.6695:0.0:0.3305:0.0	.	.	.	.	X	289;191	.	ENSP00000265870:Y289X	Y	-	3	2	SLC25A16	69913327	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.414000	0.34736	0.008000	0.14787	0.454000	0.30748	TAT	SLC25A16	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000122912		0.378	SLC25A16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A16	HGNC	protein_coding	OTTHUMT00000048347.2	137	0.00	0	A			70243321	70243321	-1	no_errors	ENST00000265870	ensembl	human	known	69_37n	nonsense	118	25.32	40	SNP	1.000	C
SLC25A16	8034	genome.wustl.edu	37	10	70243321	70243321	+	Nonsense_Mutation	SNP	A	A	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr10:70243321A>C	ENST00000609923.1	-	9	965	c.867T>G	c.(865-867)taT>taG	p.Y289*	SLC25A16_ENST00000539557.1_Nonsense_Mutation_p.Y191*|SLC25A16_ENST00000265870.3_5'UTR	NM_152707.3	NP_689920.1	P16260	GDC_HUMAN	solute carrier family 25 (mitochondrial carrier), member 16	289					coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	antiporter activity (GO:0015297)			endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	7						GTCCATAGACATACTTCATAG	0.378																																						dbGAP											0													155.0	153.0	154.0					10																	70243321		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M31659	CCDS7280.1	10q21.3-q22.1	2014-06-17	2014-06-17		ENSG00000122912	ENSG00000122912		"""Solute carriers"""	10986	protein-coding gene	gene with protein product	"""Graves disease autoantigen"""	139080				8444471, 2575220	Standard	NM_152707		Approved	GDA, D10S105E, HGT.1, ML7	uc001joi.3	P16260	OTTHUMG00000018354	ENST00000609923.1:c.867T>G	10.37:g.70243321A>C	ENSP00000476815:p.Tyr289*		Q8N2U1	Nonsense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Graves_DC,prints_Mit_carrier	p.Y289*	ENST00000609923.1	37	c.867	CCDS7280.1	10	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242335	0.79912	.	.	ENSG00000122912	ENST00000265870;ENST00000539557	.	.	.	5.67	1.56	0.23342	.	0.058415	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-14.4045	9.6993	0.40175	0.6695:0.0:0.3305:0.0	.	.	.	.	X	289;191	.	ENSP00000265870:Y289X	Y	-	3	2	SLC25A16	69913327	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.414000	0.34736	0.008000	0.14787	0.454000	0.30748	TAT	SLC25A16	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000122912		0.378	SLC25A16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A16	HGNC	protein_coding	OTTHUMT00000048347.2	143	0.69	1	A			70243321	70243321	-1	no_errors	ENST00000265870	ensembl	human	known	69_37n	nonsense	118	25.32	40	SNP	1.000	C
SLC26A9	115019	genome.wustl.edu	37	1	205897041	205897041	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:205897041C>G	ENST00000367135.3	-	9	1203	c.1090G>C	c.(1090-1092)Gat>Cat	p.D364H	SLC26A9_ENST00000367134.2_Missense_Mutation_p.D364H|SLC26A9_ENST00000340781.4_Missense_Mutation_p.D364H	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	364					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TGGTTCGAATCCACGTCGTAG	0.597																																						dbGAP											0													117.0	100.0	106.0					1																	205897041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1090G>C	1.37:g.205897041C>G	ENSP00000356103:p.Asp364His		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.D364H	ENST00000367135.3	37	c.1090	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182347	0.78677	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.94828	-3.53;-3.53;-3.53	5.08	5.08	0.68730	Sulphate transporter (1);	0.135740	0.46145	D	0.000309	D	0.97028	0.9029	M	0.80183	2.485	0.58432	D	0.999999	D;D	0.54397	0.966;0.966	P;P	0.62649	0.905;0.905	D	0.97517	1.0070	10	0.87932	D	0	.	18.2466	0.89988	0.0:1.0:0.0:0.0	.	364;364	Q7LBE3;B1AVM8	S26A9_HUMAN;.	H	364	ENSP00000341682:D364H;ENSP00000356103:D364H;ENSP00000356102:D364H	ENSP00000341682:D364H	D	-	1	0	SLC26A9	204163664	1.000000	0.71417	0.994000	0.49952	0.665000	0.39181	5.536000	0.67180	2.640000	0.89533	0.655000	0.94253	GAT	SLC26A9	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000174502		0.597	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	HGNC	protein_coding	OTTHUMT00000087742.1	57	0.00	0	C	NM_052934		205897041	205897041	-1	no_errors	ENST00000340781	ensembl	human	known	69_37n	missense	92	12.38	13	SNP	1.000	G
SLK	9748	genome.wustl.edu	37	10	105762296	105762296	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr10:105762296A>T	ENST00000369755.3	+	9	1905	c.1360A>T	c.(1360-1362)Aat>Tat	p.N454Y	SLK_ENST00000335753.4_Missense_Mutation_p.N454Y	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	454	Glu-rich.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AAAAGAGAATAATATAATGAT	0.338																																					NSCLC(111;540 1651 1927 4474 17706)	dbGAP											0													69.0	77.0	74.0					10																	105762296		2199	4294	6493	-	-	-	SO:0001583	missense	0				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.1360A>T	10.37:g.105762296A>T	ENSP00000358770:p.Asn454Tyr		D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UVR_dom,pfscan_Prot_kinase_cat_dom	p.N454Y	ENST00000369755.3	37	c.1360	CCDS7553.1	10	.	.	.	.	.	.	.	.	.	.	A	10.34	1.323665	0.24080	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.69926	-0.42;-0.44	5.18	-0.0607	0.13788	Protein kinase-like domain (1);	0.580240	0.18646	N	0.135153	T	0.55832	0.1945	L	0.50333	1.59	0.09310	N	1	B;B	0.33212	0.402;0.28	B;B	0.36666	0.23;0.115	T	0.50162	-0.8860	10	0.52906	T	0.07	.	5.3701	0.16134	0.5127:0.2688:0.2185:0.0	.	454;454	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	Y	454	ENSP00000336824:N454Y;ENSP00000358770:N454Y	ENSP00000336824:N454Y	N	+	1	0	SLK	105752286	0.044000	0.20184	0.014000	0.15608	0.962000	0.63368	0.586000	0.23894	0.074000	0.16767	0.454000	0.30748	AAT	SLK	-	superfamily_Kinase-like_dom	ENSG00000065613		0.338	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLK	HGNC	protein_coding	OTTHUMT00000050188.1	263	0.00	0	A	NM_014720		105762296	105762296	+1	no_errors	ENST00000369755	ensembl	human	known	69_37n	missense	213	23.66	66	SNP	0.002	T
SLK	9748	genome.wustl.edu	37	10	105762296	105762296	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr10:105762296A>T	ENST00000369755.3	+	9	1905	c.1360A>T	c.(1360-1362)Aat>Tat	p.N454Y	SLK_ENST00000335753.4_Missense_Mutation_p.N454Y	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	454	Glu-rich.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AAAAGAGAATAATATAATGAT	0.338																																					NSCLC(111;540 1651 1927 4474 17706)	dbGAP											0													69.0	77.0	74.0					10																	105762296		2199	4294	6493	-	-	-	SO:0001583	missense	0				CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.1360A>T	10.37:g.105762296A>T	ENSP00000358770:p.Asn454Tyr		D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UVR_dom,pfscan_Prot_kinase_cat_dom	p.N454Y	ENST00000369755.3	37	c.1360	CCDS7553.1	10	.	.	.	.	.	.	.	.	.	.	A	10.34	1.323665	0.24080	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.69926	-0.42;-0.44	5.18	-0.0607	0.13788	Protein kinase-like domain (1);	0.580240	0.18646	N	0.135153	T	0.55832	0.1945	L	0.50333	1.59	0.09310	N	1	B;B	0.33212	0.402;0.28	B;B	0.36666	0.23;0.115	T	0.50162	-0.8860	10	0.52906	T	0.07	.	5.3701	0.16134	0.5127:0.2688:0.2185:0.0	.	454;454	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	Y	454	ENSP00000336824:N454Y;ENSP00000358770:N454Y	ENSP00000336824:N454Y	N	+	1	0	SLK	105752286	0.044000	0.20184	0.014000	0.15608	0.962000	0.63368	0.586000	0.23894	0.074000	0.16767	0.454000	0.30748	AAT	SLK	-	superfamily_Kinase-like_dom	ENSG00000065613		0.338	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLK	HGNC	protein_coding	OTTHUMT00000050188.1	209	0.00	0	A	NM_014720		105762296	105762296	+1	no_errors	ENST00000369755	ensembl	human	known	69_37n	missense	213	23.66	66	SNP	0.002	T
SPATA21	374955	genome.wustl.edu	37	1	16735620	16735620	+	Silent	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:16735620T>C	ENST00000335496.1	-	7	1148	c.666A>G	c.(664-666)caA>caG	p.Q222Q	SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000540400.1_Silent_p.Q199Q	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	222							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		CACCTTCCTCTTGCTTCAGGG	0.607																																						dbGAP											0													96.0	72.0	80.0					1																	16735620		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.666A>G	1.37:g.16735620T>C			B9EK40|F5GXP5	Silent	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.Q222	ENST00000335496.1	37	c.666	CCDS172.1	1																																																																																			SPATA21	-	NULL	ENSG00000187144		0.607	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA21	HGNC	protein_coding	OTTHUMT00000006677.2	78	0.00	0	T	NM_198546		16735620	16735620	-1	no_errors	ENST00000335496	ensembl	human	known	69_37n	silent	46	29.23	19	SNP	0.951	C
SPATA21	374955	genome.wustl.edu	37	1	16735620	16735620	+	Silent	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:16735620T>C	ENST00000335496.1	-	7	1148	c.666A>G	c.(664-666)caA>caG	p.Q222Q	SPATA21_ENST00000466212.1_5'UTR|SPATA21_ENST00000540400.1_Silent_p.Q199Q	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	222							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		CACCTTCCTCTTGCTTCAGGG	0.607																																						dbGAP											0													96.0	72.0	80.0					1																	16735620		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.666A>G	1.37:g.16735620T>C			B9EK40|F5GXP5	Silent	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.Q222	ENST00000335496.1	37	c.666	CCDS172.1	1																																																																																			SPATA21	-	NULL	ENSG00000187144		0.607	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA21	HGNC	protein_coding	OTTHUMT00000006677.2	73	0.00	0	T	NM_198546		16735620	16735620	-1	no_errors	ENST00000335496	ensembl	human	known	69_37n	silent	46	29.23	19	SNP	0.951	C
SPHKAP	80309	genome.wustl.edu	37	2	228881884	228881884	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr2:228881884C>T	ENST00000392056.3	-	7	3732	c.3686G>A	c.(3685-3687)cGa>cAa	p.R1229Q	SPHKAP_ENST00000344657.5_Missense_Mutation_p.R1229Q	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1229						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.R1229Q(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CACTGGGGATCGCAGAGAAGG	0.567																																						dbGAP											2	Substitution - Missense(2)	lung(2)											73.0	73.0	73.0					2																	228881884		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3686G>A	2.37:g.228881884C>T	ENSP00000375909:p.Arg1229Gln		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.R1229Q	ENST00000392056.3	37	c.3686	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654225	0.67472	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.42900	0.96;0.96	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.66426	0.2788	M	0.72894	2.215	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.67043	-0.5770	10	0.72032	D	0.01	.	19.1942	0.93681	0.0:1.0:0.0:0.0	.	260;1229;1229	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	Q	1229	ENSP00000375909:R1229Q;ENSP00000339886:R1229Q	ENSP00000339886:R1229Q	R	-	2	0	SPHKAP	228590128	1.000000	0.71417	0.690000	0.30148	0.117000	0.20001	7.194000	0.77789	2.785000	0.95823	0.655000	0.94253	CGA	SPHKAP	-	NULL	ENSG00000153820		0.567	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	107	0.00	0	C	NM_030623		228881884	228881884	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	83	23.85	26	SNP	0.953	T
SPHKAP	80309	genome.wustl.edu	37	2	228881884	228881884	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr2:228881884C>T	ENST00000392056.3	-	7	3732	c.3686G>A	c.(3685-3687)cGa>cAa	p.R1229Q	SPHKAP_ENST00000344657.5_Missense_Mutation_p.R1229Q	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1229						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.R1229Q(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CACTGGGGATCGCAGAGAAGG	0.567																																						dbGAP											2	Substitution - Missense(2)	lung(2)											73.0	73.0	73.0					2																	228881884		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3686G>A	2.37:g.228881884C>T	ENSP00000375909:p.Arg1229Gln		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.R1229Q	ENST00000392056.3	37	c.3686	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654225	0.67472	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.42900	0.96;0.96	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.66426	0.2788	M	0.72894	2.215	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.67043	-0.5770	10	0.72032	D	0.01	.	19.1942	0.93681	0.0:1.0:0.0:0.0	.	260;1229;1229	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	Q	1229	ENSP00000375909:R1229Q;ENSP00000339886:R1229Q	ENSP00000339886:R1229Q	R	-	2	0	SPHKAP	228590128	1.000000	0.71417	0.690000	0.30148	0.117000	0.20001	7.194000	0.77789	2.785000	0.95823	0.655000	0.94253	CGA	SPHKAP	-	NULL	ENSG00000153820		0.567	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	128	0.00	0	C	NM_030623		228881884	228881884	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	83	23.85	26	SNP	0.953	T
SPRED3	399473	genome.wustl.edu	37	19	38882594	38882594	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr19:38882594G>T	ENST00000338502.4	+	2	289	c.186G>T	c.(184-186)ttG>ttT	p.L62F	SPRED3_ENST00000587564.2_3'UTR|SPRED3_ENST00000586301.1_Missense_Mutation_p.L62F|SPRED3_ENST00000587013.1_Missense_Mutation_p.L106F	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	62	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGACAACCTTGGAGTGTACAC	0.542																																						dbGAP											0													125.0	122.0	123.0					19																	38882594		2040	4201	6241	-	-	-	SO:0001583	missense	0				CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.186G>T	19.37:g.38882594G>T	ENSP00000345405:p.Leu62Phe		Q2MJR1	Missense_Mutation	SNP	pfam_Sprouty,pfam_EVH1,smart_EVH1,pfscan_EVH1	p.L62F	ENST00000338502.4	37	c.186	CCDS42560.1	19	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458374	0.63401	.	.	ENSG00000188766	ENST00000338502;ENST00000396877	D	0.98717	-5.09	3.3	2.25	0.28309	EVH1 (2);Pleckstrin homology-type (1);	0.212776	0.31233	N	0.008004	D	0.98817	0.9601	M	0.82630	2.6	0.51767	D	0.999938	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98871	1.0766	10	0.87932	D	0	-6.7649	8.3282	0.32169	0.1223:0.0:0.8777:0.0	.	62;62	Q2MJR0;Q2MJR1	SPRE3_HUMAN;.	F	62	ENSP00000345405:L62F	ENSP00000345405:L62F	L	+	3	2	SPRED3	43574434	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	6.144000	0.71762	0.735000	0.32537	0.455000	0.32223	TTG	SPRED3	-	pfam_EVH1,smart_EVH1,pfscan_EVH1	ENSG00000188766		0.542	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	HGNC	protein_coding	OTTHUMT00000459216.1	225	0.00	0	G	XM_351191		38882594	38882594	+1	no_errors	ENST00000338502	ensembl	human	known	69_37n	missense	249	22.19	71	SNP	1.000	T
SPRED3	399473	genome.wustl.edu	37	19	38882594	38882594	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr19:38882594G>T	ENST00000338502.4	+	2	289	c.186G>T	c.(184-186)ttG>ttT	p.L62F	SPRED3_ENST00000587564.2_3'UTR|SPRED3_ENST00000586301.1_Missense_Mutation_p.L62F|SPRED3_ENST00000587013.1_Missense_Mutation_p.L106F	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	62	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGACAACCTTGGAGTGTACAC	0.542																																						dbGAP											0													125.0	122.0	123.0					19																	38882594		2040	4201	6241	-	-	-	SO:0001583	missense	0				CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.186G>T	19.37:g.38882594G>T	ENSP00000345405:p.Leu62Phe		Q2MJR1	Missense_Mutation	SNP	pfam_Sprouty,pfam_EVH1,smart_EVH1,pfscan_EVH1	p.L62F	ENST00000338502.4	37	c.186	CCDS42560.1	19	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458374	0.63401	.	.	ENSG00000188766	ENST00000338502;ENST00000396877	D	0.98717	-5.09	3.3	2.25	0.28309	EVH1 (2);Pleckstrin homology-type (1);	0.212776	0.31233	N	0.008004	D	0.98817	0.9601	M	0.82630	2.6	0.51767	D	0.999938	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98871	1.0766	10	0.87932	D	0	-6.7649	8.3282	0.32169	0.1223:0.0:0.8777:0.0	.	62;62	Q2MJR0;Q2MJR1	SPRE3_HUMAN;.	F	62	ENSP00000345405:L62F	ENSP00000345405:L62F	L	+	3	2	SPRED3	43574434	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	6.144000	0.71762	0.735000	0.32537	0.455000	0.32223	TTG	SPRED3	-	pfam_EVH1,smart_EVH1,pfscan_EVH1	ENSG00000188766		0.542	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	HGNC	protein_coding	OTTHUMT00000459216.1	402	0.25	1	G	XM_351191		38882594	38882594	+1	no_errors	ENST00000338502	ensembl	human	known	69_37n	missense	249	22.19	71	SNP	1.000	T
SRRM2	23524	genome.wustl.edu	37	16	2817327	2817327	+	Silent	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr16:2817327G>A	ENST00000301740.8	+	11	7347	c.6798G>A	c.(6796-6798)gcG>gcA	p.A2266A	AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2266	Ala-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTGCAGCAGCGGCCATGAACT	0.642																																						dbGAP											0													75.0	79.0	77.0					16																	2817327		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6798G>A	16.37:g.2817327G>A			A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	pfam_mRNA_splic_Cwf21	p.A2266	ENST00000301740.8	37	c.6798	CCDS32373.1	16																																																																																			SRRM2	-	NULL	ENSG00000167978		0.642	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	194	0.00	0	G			2817327	2817327	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	silent	164	21.53	45	SNP	1.000	A
SRRM2	23524	genome.wustl.edu	37	16	2817327	2817327	+	Silent	SNP	G	G	A			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr16:2817327G>A	ENST00000301740.8	+	11	7347	c.6798G>A	c.(6796-6798)gcG>gcA	p.A2266A	AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2266	Ala-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTGCAGCAGCGGCCATGAACT	0.642																																						dbGAP											0													75.0	79.0	77.0					16																	2817327		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6798G>A	16.37:g.2817327G>A			A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	pfam_mRNA_splic_Cwf21	p.A2266	ENST00000301740.8	37	c.6798	CCDS32373.1	16																																																																																			SRRM2	-	NULL	ENSG00000167978		0.642	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	130	0.76	1	G			2817327	2817327	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	silent	164	21.53	45	SNP	1.000	A
STRN3	29966	genome.wustl.edu	37	14	31381224	31381224	+	Silent	SNP	A	A	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr14:31381224A>C	ENST00000357479.5	-	11	1735	c.1539T>G	c.(1537-1539)gtT>gtG	p.V513V	STRN3_ENST00000355683.5_Silent_p.V429V|STRN3_ENST00000366206.2_5'Flank	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	513					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		TTTTGGCAGGAACTGTTTTTT	0.383																																						dbGAP											0													89.0	89.0	89.0					14																	31381224		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1539T>G	14.37:g.31381224A>C			A2RTX7|A6NHZ7|Q9NRA5	Silent	SNP	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V513	ENST00000357479.5	37	c.1539	CCDS41938.1	14																																																																																			STRN3	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196792		0.383	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	STRN3	HGNC	protein_coding	OTTHUMT00000409713.1	220	0.00	0	A	NM_014574		31381224	31381224	-1	no_errors	ENST00000357479	ensembl	human	known	69_37n	silent	209	28.47	84	SNP	1.000	C
STRN3	29966	genome.wustl.edu	37	14	31381224	31381224	+	Silent	SNP	A	A	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr14:31381224A>C	ENST00000357479.5	-	11	1735	c.1539T>G	c.(1537-1539)gtT>gtG	p.V513V	STRN3_ENST00000355683.5_Silent_p.V429V|STRN3_ENST00000366206.2_5'Flank	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	513					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		TTTTGGCAGGAACTGTTTTTT	0.383																																						dbGAP											0													89.0	89.0	89.0					14																	31381224		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1539T>G	14.37:g.31381224A>C			A2RTX7|A6NHZ7|Q9NRA5	Silent	SNP	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.V513	ENST00000357479.5	37	c.1539	CCDS41938.1	14																																																																																			STRN3	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196792		0.383	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	STRN3	HGNC	protein_coding	OTTHUMT00000409713.1	285	0.35	1	A	NM_014574		31381224	31381224	-1	no_errors	ENST00000357479	ensembl	human	known	69_37n	silent	209	28.47	84	SNP	1.000	C
TATDN1	83940	genome.wustl.edu	37	8	125528004	125528004	+	Silent	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr8:125528004G>T	ENST00000276692.6	-	6	409	c.372C>A	c.(370-372)ccC>ccA	p.P124P	TATDN1_ENST00000605953.1_Silent_p.P124P|TATDN1_ENST00000519548.1_Silent_p.P77P|TATDN1_ENST00000521546.1_5'UTR|TATDN1_ENST00000517678.1_Silent_p.P70P	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1	124					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GAGTATCTTTGGGACAAAACT	0.284																																						dbGAP											0													51.0	53.0	52.0					8																	125528004		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068	ENST00000276692.6:c.372C>A	8.37:g.125528004G>T			B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	pfam_TatD_superfamily,pirsf_DNase_TatD	p.Q154K	ENST00000276692.6	37	c.460	CCDS6351.1	8	.	.	.	.	.	.	.	.	.	.	G	7.703	0.693500	0.15039	.	.	ENSG00000147687	ENST00000519232	.	.	.	5.46	1.44	0.22558	.	.	.	.	.	T	0.43590	0.1254	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21827	-1.0234	4	.	.	.	-0.1116	2.5799	0.04816	0.1982:0.2145:0.4654:0.1219	.	.	.	.	K	154	.	.	Q	-	1	0	TATDN1	125597185	0.997000	0.39634	1.000000	0.80357	0.981000	0.71138	0.289000	0.18957	0.233000	0.21120	0.563000	0.77884	CAA	TATDN1	-	pfam_TatD_superfamily,pirsf_DNase_TatD	ENSG00000147687		0.284	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TATDN1	HGNC	protein_coding	OTTHUMT00000381655.1	89	0.00	0	G	NM_032026		125528004	125528004	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000519232	ensembl	human	putative	69_37n	missense	89	19.82	22	SNP	0.991	T
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	37	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	49	34.21	26	SNP	0.994	A
TMEM167B	56900	genome.wustl.edu	37	1	109637064	109637064	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:109637064T>G	ENST00000338272.8	+	3	1238	c.168T>G	c.(166-168)caT>caG	p.H56Q		NM_020141.3	NP_064526.1	Q9NRX6	KISHB_HUMAN	transmembrane protein 167B	56						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)	7						CCAGGCTGCATGCTGCTGTGG	0.473																																						dbGAP											0													234.0	194.0	208.0					1																	109637064		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30789.1	1p13.3	2008-06-06	2008-06-06	2008-06-06	ENSG00000215717	ENSG00000215717			30187	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 119"""	C1orf119		12477932	Standard	NM_020141		Approved	AD-020, FLJ90710	uc001dwn.3	Q9NRX6	OTTHUMG00000042364	ENST00000338272.8:c.168T>G	1.37:g.109637064T>G	ENSP00000342148:p.His56Gln		B2RUU9	Missense_Mutation	SNP	pfam_DUF1242	p.H56Q	ENST00000338272.8	37	c.168	CCDS30789.1	1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380296	0.61845	.	.	ENSG00000215717	ENST00000338272	.	.	.	5.52	3.18	0.36537	.	0.187665	0.31922	U	0.006842	T	0.24084	0.0583	.	.	.	0.37492	D	0.916411	P	0.50272	0.933	B	0.41440	0.357	T	0.08472	-1.0720	8	0.62326	D	0.03	-6.933	6.3728	0.21491	0.0:0.2636:0.0:0.7364	.	56	Q9NRX6	KISHB_HUMAN	Q	56	.	ENSP00000342148:H56Q	H	+	3	2	TMEM167B	109438587	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.150000	0.31639	0.888000	0.36160	0.533000	0.62120	CAT	TMEM167B	-	NULL	ENSG00000215717		0.473	TMEM167B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM167B	HGNC	protein_coding	OTTHUMT00000100611.2	105	0.00	0	T	NM_020141		109637064	109637064	+1	no_errors	ENST00000338272	ensembl	human	known	69_37n	missense	105	18.60	24	SNP	1.000	G
TMEM167B	56900	genome.wustl.edu	37	1	109637064	109637064	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:109637064T>G	ENST00000338272.8	+	3	1238	c.168T>G	c.(166-168)caT>caG	p.H56Q		NM_020141.3	NP_064526.1	Q9NRX6	KISHB_HUMAN	transmembrane protein 167B	56						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)	7						CCAGGCTGCATGCTGCTGTGG	0.473																																						dbGAP											0													234.0	194.0	208.0					1																	109637064		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30789.1	1p13.3	2008-06-06	2008-06-06	2008-06-06	ENSG00000215717	ENSG00000215717			30187	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 119"""	C1orf119		12477932	Standard	NM_020141		Approved	AD-020, FLJ90710	uc001dwn.3	Q9NRX6	OTTHUMG00000042364	ENST00000338272.8:c.168T>G	1.37:g.109637064T>G	ENSP00000342148:p.His56Gln		B2RUU9	Missense_Mutation	SNP	pfam_DUF1242	p.H56Q	ENST00000338272.8	37	c.168	CCDS30789.1	1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380296	0.61845	.	.	ENSG00000215717	ENST00000338272	.	.	.	5.52	3.18	0.36537	.	0.187665	0.31922	U	0.006842	T	0.24084	0.0583	.	.	.	0.37492	D	0.916411	P	0.50272	0.933	B	0.41440	0.357	T	0.08472	-1.0720	8	0.62326	D	0.03	-6.933	6.3728	0.21491	0.0:0.2636:0.0:0.7364	.	56	Q9NRX6	KISHB_HUMAN	Q	56	.	ENSP00000342148:H56Q	H	+	3	2	TMEM167B	109438587	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.150000	0.31639	0.888000	0.36160	0.533000	0.62120	CAT	TMEM167B	-	NULL	ENSG00000215717		0.473	TMEM167B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM167B	HGNC	protein_coding	OTTHUMT00000100611.2	127	0.78	1	T	NM_020141		109637064	109637064	+1	no_errors	ENST00000338272	ensembl	human	known	69_37n	missense	105	18.60	24	SNP	1.000	G
TNR	7143	genome.wustl.edu	37	1	175334374	175334374	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr1:175334374A>G	ENST00000367674.2	-	12	3067	c.2359T>C	c.(2359-2361)Tcc>Ccc	p.S787P	TNR_ENST00000263525.2_Missense_Mutation_p.S787P			Q92752	TENR_HUMAN	tenascin R	787	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ACACTGGAGGAGGTCACATGA	0.517																																						dbGAP											0													84.0	81.0	82.0					1																	175334374		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2359T>C	1.37:g.175334374A>G	ENSP00000356646:p.Ser787Pro		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.S787P	ENST00000367674.2	37	c.2359	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	A	17.30	3.355085	0.61293	.	.	ENSG00000116147	ENST00000367674;ENST00000263525	T;T	0.58940	0.3;0.3	5.91	5.91	0.95273	Fibronectin, type III (4);	0.000000	0.85682	D	0.000000	T	0.59432	0.2193	L	0.27975	0.815	0.58432	D	0.999999	D	0.76494	0.999	D	0.70935	0.971	T	0.54437	-0.8294	10	0.11794	T	0.64	.	11.9373	0.52880	0.855:0.145:0.0:0.0	.	787	Q92752	TENR_HUMAN	P	787	ENSP00000356646:S787P;ENSP00000263525:S787P	ENSP00000263525:S787P	S	-	1	0	TNR	173600997	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	5.474000	0.66781	2.254000	0.74563	0.533000	0.62120	TCC	TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.517	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	74	0.00	0	A	NM_003285		175334374	175334374	-1	no_errors	ENST00000263525	ensembl	human	known	69_37n	missense	80	16.67	16	SNP	1.000	G
TNR	7143	genome.wustl.edu	37	1	175334374	175334374	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr1:175334374A>G	ENST00000367674.2	-	12	3067	c.2359T>C	c.(2359-2361)Tcc>Ccc	p.S787P	TNR_ENST00000263525.2_Missense_Mutation_p.S787P			Q92752	TENR_HUMAN	tenascin R	787	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					ACACTGGAGGAGGTCACATGA	0.517																																						dbGAP											0													84.0	81.0	82.0					1																	175334374		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2359T>C	1.37:g.175334374A>G	ENSP00000356646:p.Ser787Pro		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.S787P	ENST00000367674.2	37	c.2359	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	A	17.30	3.355085	0.61293	.	.	ENSG00000116147	ENST00000367674;ENST00000263525	T;T	0.58940	0.3;0.3	5.91	5.91	0.95273	Fibronectin, type III (4);	0.000000	0.85682	D	0.000000	T	0.59432	0.2193	L	0.27975	0.815	0.58432	D	0.999999	D	0.76494	0.999	D	0.70935	0.971	T	0.54437	-0.8294	10	0.11794	T	0.64	.	11.9373	0.52880	0.855:0.145:0.0:0.0	.	787	Q92752	TENR_HUMAN	P	787	ENSP00000356646:S787P;ENSP00000263525:S787P	ENSP00000263525:S787P	S	-	1	0	TNR	173600997	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	5.474000	0.66781	2.254000	0.74563	0.533000	0.62120	TCC	TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.517	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	97	0.00	0	A	NM_003285		175334374	175334374	-1	no_errors	ENST00000263525	ensembl	human	known	69_37n	missense	80	16.67	16	SNP	1.000	G
TRPM7	54822	genome.wustl.edu	37	15	50884259	50884259	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr15:50884259T>C	ENST00000313478.7	-	26	4454	c.4173A>G	c.(4171-4173)atA>atG	p.I1391M	TRPM7_ENST00000560955.1_Missense_Mutation_p.I1391M	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1391					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		ACAGATGTGGTATGCTAGTAG	0.398																																						dbGAP											0													115.0	107.0	110.0					15																	50884259		1812	4086	5898	-	-	-	SO:0001583	missense	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.4173A>G	15.37:g.50884259T>C	ENSP00000320239:p.Ile1391Met		Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.I1391M	ENST00000313478.7	37	c.4173	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	T	10.71	1.426632	0.25726	.	.	ENSG00000092439	ENST00000313478	T	0.53640	0.61	6.04	4.89	0.63831	.	0.875440	0.10494	N	0.668083	T	0.24699	0.0599	N	0.08118	0	0.24700	N	0.993267	B	0.02656	0.0	B	0.04013	0.001	T	0.23297	-1.0192	10	0.21540	T	0.41	-4.491	4.1237	0.10118	0.0:0.1684:0.1881:0.6435	.	1391	Q96QT4	TRPM7_HUMAN	M	1391	ENSP00000320239:I1391M	ENSP00000320239:I1391M	I	-	3	3	TRPM7	48671551	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.178000	0.42519	1.064000	0.40671	0.529000	0.55759	ATA	TRPM7	-	NULL	ENSG00000092439		0.398	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	140	0.00	0	T	NM_017672		50884259	50884259	-1	no_errors	ENST00000313478	ensembl	human	known	69_37n	missense	108	21.74	30	SNP	1.000	C
TRPM7	54822	genome.wustl.edu	37	15	50884259	50884259	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr15:50884259T>C	ENST00000313478.7	-	26	4454	c.4173A>G	c.(4171-4173)atA>atG	p.I1391M	TRPM7_ENST00000560955.1_Missense_Mutation_p.I1391M	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1391					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		ACAGATGTGGTATGCTAGTAG	0.398																																						dbGAP											0													115.0	107.0	110.0					15																	50884259		1812	4086	5898	-	-	-	SO:0001583	missense	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.4173A>G	15.37:g.50884259T>C	ENSP00000320239:p.Ile1391Met		Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.I1391M	ENST00000313478.7	37	c.4173	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	T	10.71	1.426632	0.25726	.	.	ENSG00000092439	ENST00000313478	T	0.53640	0.61	6.04	4.89	0.63831	.	0.875440	0.10494	N	0.668083	T	0.24699	0.0599	N	0.08118	0	0.24700	N	0.993267	B	0.02656	0.0	B	0.04013	0.001	T	0.23297	-1.0192	10	0.21540	T	0.41	-4.491	4.1237	0.10118	0.0:0.1684:0.1881:0.6435	.	1391	Q96QT4	TRPM7_HUMAN	M	1391	ENSP00000320239:I1391M	ENSP00000320239:I1391M	I	-	3	3	TRPM7	48671551	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.178000	0.42519	1.064000	0.40671	0.529000	0.55759	ATA	TRPM7	-	NULL	ENSG00000092439		0.398	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	80	0.00	0	T	NM_017672		50884259	50884259	-1	no_errors	ENST00000313478	ensembl	human	known	69_37n	missense	108	21.74	30	SNP	1.000	C
ZBTB24	9841	genome.wustl.edu	37	6	109787472	109787472	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr6:109787472G>T	ENST00000230122.3	-	7	1843	c.1676C>A	c.(1675-1677)tCt>tAt	p.S559Y	MICAL1_ENST00000368952.4_5'Flank	NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	559					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		GTTATGTACAGAATCGGTTAC	0.463																																						dbGAP											0													143.0	136.0	138.0					6																	109787472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1676C>A	6.37:g.109787472G>T	ENSP00000230122:p.Ser559Tyr		Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S559Y	ENST00000230122.3	37	c.1676	CCDS34509.1	6	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132570	0.77662	.	.	ENSG00000112365	ENST00000230122	T	0.12361	2.69	6.06	6.06	0.98353	.	0.230919	0.44285	D	0.000469	T	0.11879	0.0289	N	0.24115	0.695	0.33747	D	0.620208	D	0.56521	0.976	P	0.51016	0.656	T	0.01099	-1.1452	10	0.87932	D	0	-18.8938	20.6208	0.99490	0.0:0.0:1.0:0.0	.	559	O43167	ZBT24_HUMAN	Y	559	ENSP00000230122:S559Y	ENSP00000230122:S559Y	S	-	2	0	ZBTB24	109894165	0.998000	0.40836	0.994000	0.49952	0.991000	0.79684	4.518000	0.60510	2.882000	0.98803	0.655000	0.94253	TCT	ZBTB24	-	NULL	ENSG00000112365		0.463	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB24	HGNC	protein_coding	OTTHUMT00000041758.1	251	0.40	1	G	NM_014797		109787472	109787472	-1	no_errors	ENST00000230122	ensembl	human	known	69_37n	missense	220	29.94	94	SNP	0.997	T
ZBTB24	9841	genome.wustl.edu	37	6	109787472	109787472	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr6:109787472G>T	ENST00000230122.3	-	7	1843	c.1676C>A	c.(1675-1677)tCt>tAt	p.S559Y	MICAL1_ENST00000368952.4_5'Flank	NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	559					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		GTTATGTACAGAATCGGTTAC	0.463																																						dbGAP											0													143.0	136.0	138.0					6																	109787472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.1676C>A	6.37:g.109787472G>T	ENSP00000230122:p.Ser559Tyr		Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S559Y	ENST00000230122.3	37	c.1676	CCDS34509.1	6	.	.	.	.	.	.	.	.	.	.	G	21.3	4.132570	0.77662	.	.	ENSG00000112365	ENST00000230122	T	0.12361	2.69	6.06	6.06	0.98353	.	0.230919	0.44285	D	0.000469	T	0.11879	0.0289	N	0.24115	0.695	0.33747	D	0.620208	D	0.56521	0.976	P	0.51016	0.656	T	0.01099	-1.1452	10	0.87932	D	0	-18.8938	20.6208	0.99490	0.0:0.0:1.0:0.0	.	559	O43167	ZBT24_HUMAN	Y	559	ENSP00000230122:S559Y	ENSP00000230122:S559Y	S	-	2	0	ZBTB24	109894165	0.998000	0.40836	0.994000	0.49952	0.991000	0.79684	4.518000	0.60510	2.882000	0.98803	0.655000	0.94253	TCT	ZBTB24	-	NULL	ENSG00000112365		0.463	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB24	HGNC	protein_coding	OTTHUMT00000041758.1	309	0.00	0	G	NM_014797		109787472	109787472	-1	no_errors	ENST00000230122	ensembl	human	known	69_37n	missense	220	29.94	94	SNP	0.997	T
ZFYVE16	9765	genome.wustl.edu	37	5	79734566	79734566	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-11A-13W-A100-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	7ed0e2a4-53ff-456f-8772-e49db779b612	g.chr5:79734566A>C	ENST00000338008.5	+	3	2242	c.2062A>C	c.(2062-2064)Act>Cct	p.T688P	ZFYVE16_ENST00000505560.1_Missense_Mutation_p.T688P|ZFYVE16_ENST00000510158.1_Missense_Mutation_p.T688P	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	688					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TGTTCCAATCACTTGTGCTAT	0.403																																					Melanoma(150;1452 1854 16018 17851 37292)	dbGAP											0													104.0	97.0	100.0					5																	79734566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.2062A>C	5.37:g.79734566A>C	ENSP00000337159:p.Thr688Pro		O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	pfam_DUF3480,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.T688P	ENST00000338008.5	37	c.2062	CCDS4050.1	5	.	.	.	.	.	.	.	.	.	.	A	2.109	-0.404141	0.04832	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.39056	1.1;1.1;1.1	5.82	2.05	0.26809	.	0.927142	0.09122	N	0.845641	T	0.29158	0.0725	L	0.32530	0.975	0.09310	N	1	B;B	0.15473	0.013;0.002	B;B	0.15870	0.014;0.002	T	0.29579	-1.0007	10	0.52906	T	0.07	-0.5043	3.0531	0.06175	0.5442:0.0:0.2699:0.1859	.	688;688	Q7Z3T8-3;Q7Z3T8	.;ZFY16_HUMAN	P	688	ENSP00000337159:T688P;ENSP00000423663:T688P;ENSP00000426848:T688P	ENSP00000337159:T688P	T	+	1	0	ZFYVE16	79770322	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.533000	0.23082	0.429000	0.26202	0.528000	0.53228	ACT	ZFYVE16	-	pirsf_Znf_FYVE_SARA/endofin	ENSG00000039319		0.403	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE16	HGNC	protein_coding	OTTHUMT00000226982.2	201	0.00	0	A	NM_014733		79734566	79734566	+1	no_errors	ENST00000338008	ensembl	human	known	69_37n	missense	225	24.50	73	SNP	0.000	C
ZFYVE16	9765	genome.wustl.edu	37	5	79734566	79734566	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0DK-01A-21W-A071-09	TCGA-BH-A0DK-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	24973c7f-21be-48c6-9a24-636cbf7e39dd	0d68bf71-2788-4cda-a04d-ddf7de2fa8c9	g.chr5:79734566A>C	ENST00000338008.5	+	3	2242	c.2062A>C	c.(2062-2064)Act>Cct	p.T688P	ZFYVE16_ENST00000505560.1_Missense_Mutation_p.T688P|ZFYVE16_ENST00000510158.1_Missense_Mutation_p.T688P	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	688					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TGTTCCAATCACTTGTGCTAT	0.403																																					Melanoma(150;1452 1854 16018 17851 37292)	dbGAP											0													104.0	97.0	100.0					5																	79734566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.2062A>C	5.37:g.79734566A>C	ENSP00000337159:p.Thr688Pro		O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	pfam_DUF3480,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.T688P	ENST00000338008.5	37	c.2062	CCDS4050.1	5	.	.	.	.	.	.	.	.	.	.	A	2.109	-0.404141	0.04832	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.39056	1.1;1.1;1.1	5.82	2.05	0.26809	.	0.927142	0.09122	N	0.845641	T	0.29158	0.0725	L	0.32530	0.975	0.09310	N	1	B;B	0.15473	0.013;0.002	B;B	0.15870	0.014;0.002	T	0.29579	-1.0007	10	0.52906	T	0.07	-0.5043	3.0531	0.06175	0.5442:0.0:0.2699:0.1859	.	688;688	Q7Z3T8-3;Q7Z3T8	.;ZFY16_HUMAN	P	688	ENSP00000337159:T688P;ENSP00000423663:T688P;ENSP00000426848:T688P	ENSP00000337159:T688P	T	+	1	0	ZFYVE16	79770322	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.533000	0.23082	0.429000	0.26202	0.528000	0.53228	ACT	ZFYVE16	-	pirsf_Znf_FYVE_SARA/endofin	ENSG00000039319		0.403	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE16	HGNC	protein_coding	OTTHUMT00000226982.2	213	0.00	0	A	NM_014733		79734566	79734566	+1	no_errors	ENST00000338008	ensembl	human	known	69_37n	missense	225	24.50	73	SNP	0.000	C
