#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ARMCX2	9823	genome.wustl.edu	37	X	100912411	100912411	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chrX:100912411G>C	ENST00000328766.5	-	5	617	c.164C>G	c.(163-165)gCt>gGt	p.A55G	ARMCX2_ENST00000356824.4_Missense_Mutation_p.A55G|ARMCX2_ENST00000467416.1_5'UTR|ARMCX2_ENST00000330154.2_Missense_Mutation_p.A55G	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	55						integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						TCTTAGcccagctctagccct	0.577																																						dbGAP											0													65.0	62.0	63.0					X																	100912411		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.164C>G	X.37:g.100912411G>C	ENSP00000331662:p.Ala55Gly		O60267|Q5H9D9	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo	p.A55G	ENST00000328766.5	37	c.164	CCDS14490.1	X	.	.	.	.	.	.	.	.	.	.	G	8.959	0.970158	0.18659	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824;ENST00000413506;ENST00000433318;ENST00000440675;ENST00000458024;ENST00000431597	T;T;T;T;T	0.51325	1.36;1.36;1.36;0.73;0.71	4.7	2.93	0.34026	.	0.555420	0.13761	N	0.364615	T	0.37046	0.0989	L	0.42245	1.32	0.18873	N	0.999987	B	0.27823	0.19	B	0.24155	0.051	T	0.19063	-1.0317	10	0.35671	T	0.21	-3.2104	8.6409	0.33976	0.2011:0.0:0.7989:0.0	.	55	Q7L311	ARMX2_HUMAN	G	55	ENSP00000331662:A55G;ENSP00000328631:A55G;ENSP00000349281:A55G;ENSP00000412481:A55G;ENSP00000410151:A55G	ENSP00000331662:A55G	A	-	2	0	ARMCX2	100799067	0.580000	0.26733	0.140000	0.22221	0.143000	0.21401	1.036000	0.30228	0.496000	0.27904	0.544000	0.68410	GCT	ARMCX2	-	NULL	ENSG00000184867		0.577	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX2	HGNC	protein_coding	OTTHUMT00000057586.1	104	0.00	0	G	NM_014782		100912411	100912411	-1	no_errors	ENST00000328766	ensembl	human	known	69_37n	missense	100	29.08	41	SNP	0.393	C
C3AR1	719	genome.wustl.edu	37	12	8212541	8212541	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr12:8212541G>A	ENST00000307637.4	-	2	444	c.241C>T	c.(241-243)Cac>Tac	p.H81Y		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	81					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		AGAGCCAAGTGAGCCAGCGAG	0.572																																						dbGAP											0													109.0	88.0	95.0					12																	8212541		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.241C>T	12.37:g.8212541G>A	ENSP00000302079:p.His81Tyr		O43771|Q92868	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_C3A_anaphtx_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_Frt_met_rcpt,prints_C5A_anaphtx_rcpt	p.H81Y	ENST00000307637.4	37	c.241	CCDS8588.1	12	.	.	.	.	.	.	.	.	.	.	G	10.26	1.301628	0.23736	.	.	ENSG00000171860	ENST00000307637;ENST00000546241	T;T	0.69926	-0.44;-0.44	5.69	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.165039	0.40144	N	0.001168	T	0.38427	0.1040	N	0.04959	-0.14	0.09310	N	0.999999	P	0.35192	0.489	B	0.30179	0.112	T	0.18587	-1.0332	10	0.21540	T	0.41	.	8.7558	0.34645	0.079:0.0:0.7702:0.1508	.	81	Q16581	C3AR_HUMAN	Y	81	ENSP00000302079:H81Y;ENSP00000444500:H81Y	ENSP00000302079:H81Y	H	-	1	0	C3AR1	8103808	0.998000	0.40836	0.403000	0.26384	0.068000	0.16541	2.914000	0.48797	0.744000	0.32741	0.585000	0.79938	CAC	C3AR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_C3A_anaphtx_rcpt,prints_Frt_met_rcpt,prints_C5A_anaphtx_rcpt	ENSG00000171860		0.572	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3AR1	HGNC	protein_coding	OTTHUMT00000400254.1	225	0.00	0	G			8212541	8212541	-1	no_errors	ENST00000307637	ensembl	human	known	69_37n	missense	188	24.80	62	SNP	0.036	A
CACNA1S	779	genome.wustl.edu	37	1	201030559	201030559	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr1:201030559C>T	ENST00000362061.3	-	25	3317	c.3091G>A	c.(3091-3093)Gtg>Atg	p.V1031M	CACNA1S_ENST00000367338.3_Missense_Mutation_p.V1031M	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1031	Dihydropyridine binding. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATGGGACCCACGTCCTCCGCA	0.537																																						dbGAP											0													176.0	150.0	159.0					1																	201030559		2203	4300	6503	-	-	-	SO:0001583	missense	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3091G>A	1.37:g.201030559C>T	ENSP00000355192:p.Val1031Met		A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.V1031M	ENST00000362061.3	37	c.3091	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	C	7.995	0.754202	0.15778	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.95821	-3.82;-3.75	5.21	-1.34	0.09143	Ion transport (1);	0.609351	0.18367	N	0.143383	D	0.82719	0.5098	N	0.02213	-0.635	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.73681	-0.3906	10	0.20519	T	0.43	.	6.8743	0.24139	0.1197:0.424:0.0:0.4563	.	1031	Q13698	CAC1S_HUMAN	M	1031	ENSP00000355192:V1031M;ENSP00000356307:V1031M	ENSP00000355192:V1031M	V	-	1	0	CACNA1S	199297182	0.000000	0.05858	0.010000	0.14722	0.073000	0.16967	-0.640000	0.05440	-0.433000	0.07286	-0.291000	0.09656	GTG	CACNA1S	-	pfam_Ion_trans_dom	ENSG00000081248		0.537	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	57	0.00	0	C	NM_000069		201030559	201030559	-1	no_errors	ENST00000362061	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	0.009	T
CEP68	23177	genome.wustl.edu	37	2	65299971	65299971	+	Missense_Mutation	SNP	G	G	T	rs374865357		TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr2:65299971G>T	ENST00000377990.2	+	3	1944	c.1741G>T	c.(1741-1743)Ggg>Tgg	p.G581W	RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000260569.4_Intron|CEP68_ENST00000546106.1_Missense_Mutation_p.G581W|CEP68_ENST00000537589.1_Missense_Mutation_p.G193W|CEP68_ENST00000497039.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	581					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.G581W(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						CCAGGCCCTCGGGGTCTCCTC	0.627																																						dbGAP											1	Substitution - Missense(1)	lung(1)											75.0	83.0	80.0					2																	65299971		1947	4151	6098	-	-	-	SO:0001583	missense	0			BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1741G>T	2.37:g.65299971G>T	ENSP00000367229:p.Gly581Trp		B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	NULL	p.G581W	ENST00000377990.2	37	c.1741	CCDS1880.2	2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471033	0.84533	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000537589;ENST00000545501	T;T;T	0.30981	2.26;2.25;1.51	5.42	1.4	0.22301	.	0.339409	0.27236	N	0.020298	T	0.43765	0.1262	M	0.64997	1.995	0.09310	N	0.999998	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.83275	0.994;0.994;0.968;0.996	T	0.15521	-1.0434	9	.	.	.	-15.7947	3.9858	0.09516	0.2596:0.0:0.5755:0.1649	.	569;581;581;581	F5H3N9;F5H2Y2;Q76N32;Q05C09	.;.;CEP68_HUMAN;.	W	581;581;193;569	ENSP00000367229:G581W;ENSP00000438306:G581W;ENSP00000443357:G193W	.	G	+	1	0	CEP68	65153475	0.001000	0.12720	0.016000	0.15963	0.940000	0.58332	0.094000	0.15107	0.371000	0.24564	-0.216000	0.12614	GGG	CEP68	-	NULL	ENSG00000011523		0.627	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP68	HGNC	protein_coding	OTTHUMT00000251727.2	96	0.00	0	G	NM_015147		65299971	65299971	+1	no_errors	ENST00000377990	ensembl	human	known	69_37n	missense	60	25.93	21	SNP	0.001	T
CPXM1	56265	genome.wustl.edu	37	20	2776476	2776476	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr20:2776476G>A	ENST00000380605.2	-	11	1553	c.1489C>T	c.(1489-1491)Ctc>Ttc	p.L497F		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	497					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CCCCCGTGGAGGTTGGCACTT	0.617																																						dbGAP											0													64.0	59.0	61.0					20																	2776476		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1489C>T	20.37:g.2776476G>A	ENSP00000369979:p.Leu497Phe		Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom	p.L497F	ENST00000380605.2	37	c.1489	CCDS13033.1	20	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717253	0.48622	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.14766	2.48	5.15	4.13	0.48395	Peptidase M14, carboxypeptidase A (3);	0.064392	0.64402	D	0.000008	T	0.27419	0.0673	M	0.61703	1.905	0.48341	D	0.999631	D	0.89917	1.0	D	0.74023	0.982	T	0.01048	-1.1469	10	0.52906	T	0.07	-26.2888	5.1212	0.14862	0.1062:0.0:0.6857:0.2082	.	497	Q96SM3	CPXM1_HUMAN	F	497;193	ENSP00000369979:L497F	ENSP00000369979:L497F	L	-	1	0	CPXM1	2724476	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	2.628000	0.46477	2.687000	0.91594	0.563000	0.77884	CTC	CPXM1	-	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	ENSG00000088882		0.617	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	51	0.00	0	G	NM_019609		2776476	2776476	-1	no_errors	ENST00000380605	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	A
DNMBP	23268	genome.wustl.edu	37	10	101728874	101728874	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr10:101728874C>T	ENST00000324109.4	-	3	357	c.266G>A	c.(265-267)cGa>cAa	p.R89Q	DNMBP_ENST00000342239.3_Missense_Mutation_p.R89Q	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	89	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CAGCTTACCTCGATGGAGGGG	0.413																																						dbGAP											0													99.0	93.0	95.0					10																	101728874		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.266G>A	10.37:g.101728874C>T	ENSP00000315659:p.Arg89Gln		Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,prints_p67phox,prints_Spectrin_alpha_SH3,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.R89Q	ENST00000324109.4	37	c.266	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.179919	0.94846	.	.	ENSG00000107554	ENST00000342239;ENST00000324109	T;T	0.08720	3.06;3.06	4.87	4.87	0.63330	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.39687	N	0.001292	T	0.28466	0.0704	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.09662	-1.0664	10	0.11485	T	0.65	-15.1004	18.5675	0.91121	0.0:1.0:0.0:0.0	.	89	Q6XZF7	DNMBP_HUMAN	Q	89	ENSP00000344914:R89Q;ENSP00000315659:R89Q	ENSP00000315659:R89Q	R	-	2	0	DNMBP	101718864	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	5.691000	0.68249	2.686000	0.91538	0.591000	0.81541	CGA	DNMBP	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000107554		0.413	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	128	0.00	0	C	NM_015221		101728874	101728874	-1	no_errors	ENST00000342239	ensembl	human	known	69_37n	missense	91	26.02	32	SNP	1.000	T
FBN1	2200	genome.wustl.edu	37	15	48757774	48757774	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr15:48757774C>T	ENST00000316623.5	-	40	5388	c.4933G>A	c.(4933-4935)Gtg>Atg	p.V1645M		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1645	EGF-like 27; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CCATCACACACTCGTGTATCT	0.453																																						dbGAP											0													159.0	139.0	146.0					15																	48757774		2198	4296	6494	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4933G>A	15.37:g.48757774C>T	ENSP00000325527:p.Val1645Met		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.V1645M	ENST00000316623.5	37	c.4933	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040784	0.75732	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.92249	-3.0	6.17	6.17	0.99709	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.117466	0.56097	D	0.000023	D	0.90762	0.7100	N	0.16656	0.425	0.80722	D	1	D	0.62365	0.991	P	0.53549	0.729	D	0.89899	0.4043	10	0.37606	T	0.19	.	20.4745	0.99168	0.0:1.0:0.0:0.0	.	1645	P35555	FBN1_HUMAN	M	1645;213;535	ENSP00000325527:V1645M	ENSP00000325527:V1645M	V	-	1	0	FBN1	46545066	0.996000	0.38824	1.000000	0.80357	0.946000	0.59487	2.383000	0.44354	2.941000	0.99782	0.655000	0.94253	GTG	FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000166147		0.453	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	183	0.00	0	C			48757774	48757774	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	141	29.35	59	SNP	1.000	T
FOXN2	3344	genome.wustl.edu	37	2	48600495	48600495	+	Missense_Mutation	SNP	A	A	C	rs368231934		TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr2:48600495A>C	ENST00000340553.3	+	6	1029	c.768A>C	c.(766-768)ttA>ttC	p.L256F		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	256					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			AAGGAATTTTAGAATGTAAGT	0.249																																						dbGAP											0													64.0	71.0	69.0					2																	48600495		2199	4288	6487	-	-	-	SO:0001583	missense	0				CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.768A>C	2.37:g.48600495A>C	ENSP00000343633:p.Leu256Phe		Q15769|Q6P4Q2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L256F	ENST00000340553.3	37	c.768	CCDS1838.1	2	.	.	.	.	.	.	.	.	.	.	A	2.538	-0.306957	0.05458	.	.	ENSG00000170802	ENST00000304367;ENST00000340553	D	0.93811	-3.29	5.08	2.56	0.30785	.	0.642001	0.15643	N	0.251762	D	0.91240	0.7239	N	0.17312	0.475	0.37200	D	0.904321	D	0.69078	0.997	D	0.63597	0.916	D	0.88523	0.3097	9	.	.	.	.	9.0782	0.36536	0.7691:0.0:0.2309:0.0	.	256	P32314	FOXN2_HUMAN	F	165;256	ENSP00000343633:L256F	.	L	+	3	2	FOXN2	48453999	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.522000	0.35921	0.798000	0.33994	0.377000	0.23210	TTA	FOXN2	-	NULL	ENSG00000170802		0.249	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN2	HGNC	protein_coding	OTTHUMT00000251240.3	113	0.00	0	A	NM_002158		48600495	48600495	+1	no_errors	ENST00000340553	ensembl	human	known	69_37n	missense	72	34.23	38	SNP	1.000	C
GORAB	92344	genome.wustl.edu	37	1	170508668	170508668	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr1:170508668C>A	ENST00000367763.3	+	2	474	c.454C>A	c.(454-456)Cca>Aca	p.P152T	GORAB_ENST00000465717.1_3'UTR|GORAB_ENST00000367762.1_Missense_Mutation_p.P152T	NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	152						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						GATTCTACCTCCAAAGCCAGA	0.418																																						dbGAP											0													62.0	63.0	63.0					1																	170508668		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.454C>A	1.37:g.170508668C>A	ENSP00000356737:p.Pro152Thr		Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Missense_Mutation	SNP	pfam_Golgin_RAB6-interacting	p.P152T	ENST00000367763.3	37	c.454	CCDS1289.1	1	.	.	.	.	.	.	.	.	.	.	C	8.206	0.799287	0.16397	.	.	ENSG00000120370	ENST00000367763;ENST00000367762	T;T	0.62498	0.02;0.02	5.51	4.57	0.56435	.	0.382363	0.32204	N	0.006421	T	0.42291	0.1196	M	0.65498	2.005	0.38259	D	0.941831	B	0.13145	0.007	B	0.15870	0.014	T	0.46582	-0.9181	10	0.44086	T	0.13	-5.5083	8.8517	0.35203	0.0:0.8217:0.0:0.1783	.	152	Q5T7V8	GORAB_HUMAN	T	152	ENSP00000356737:P152T;ENSP00000356736:P152T	ENSP00000356736:P152T	P	+	1	0	GORAB	168775292	0.801000	0.28930	0.988000	0.46212	0.021000	0.10359	0.657000	0.24963	1.250000	0.43966	0.585000	0.79938	CCA	GORAB	-	NULL	ENSG00000120370		0.418	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GORAB	HGNC	protein_coding	OTTHUMT00000085226.1	122	0.00	0	C	NM_152281		170508668	170508668	+1	no_errors	ENST00000367763	ensembl	human	known	69_37n	missense	111	26.00	39	SNP	0.999	A
GPR42	2866	genome.wustl.edu	37	19	35862846	35862846	+	Silent	SNP	C	C	A			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr19:35862846C>A	ENST00000454971.1	+	2	786	c.585C>A	c.(583-585)gtC>gtA	p.V195V	GPR42_ENST00000597214.1_Silent_p.V195V			O15529	GPR42_HUMAN	G protein-coupled receptor 42 (gene/pseudogene)	195						integral component of plasma membrane (GO:0005887)	signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|skin(2)	4	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TCTTTGTGGTCCCGCTGATCA	0.667																																						dbGAP											0													4.0	5.0	4.0					19																	35862846		874	2251	3125	-	-	-	SO:0001819	synonymous_variant	0			AF024689		19q13.12	2012-08-20	2010-02-09	2010-02-09	ENSG00000126251	ENSG00000126251		"""GPCR / Class A : Fatty acid receptors"""	4500	protein-coding gene	gene with protein product		603822	"""G protein-coupled receptor 42 pseudogene"""	GPR42P		9344866, 19630535	Standard	NG_008348		Approved	GPR41L, FFAR3L		O15529	OTTHUMG00000157124	ENST00000454971.1:c.585C>A	19.37:g.35862846C>A				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_GPR40-rel_recept	p.V195	ENST00000454971.1	37	c.585		19																																																																																			GPR42	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000126251		0.667	GPR42-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GPR42	HGNC	protein_coding	OTTHUMT00000347518.1	17	0.00	0	C	NM_005305		35862846	35862846	+1	no_errors	ENST00000454971	ensembl	human	known	69_37n	silent	4	66.67	10	SNP	0.854	A
HDAC6	10013	genome.wustl.edu	37	X	48681900	48681901	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chrX:48681900_48681901insC	ENST00000334136.5	+	25	3269_3270	c.3091_3092insC	c.(3091-3093)accfs	p.T1031fs	HDAC6_ENST00000376619.2_Frame_Shift_Ins_p.T1031fs|HDAC6_ENST00000444343.2_Frame_Shift_Ins_p.T1045fs			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1031					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	AGACCACCAGACCCCCCCAACC	0.589																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.3098dupC	X.37:g.48681907_48681907dupC	ENSP00000334061:p.Thr1031fs		O94975|Q6NT75|Q7L3E5|Q96CY0	Frame_Shift_Ins	INS	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.T1048fs	ENST00000334136.5	37	c.3133_3134	CCDS14306.1	X																																																																																			HDAC6	-	NULL	ENSG00000094631		0.589	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	35	0.00	0	-	NM_006044		48681900	48681901	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	frame_shift_ins	17	15.00	3	INS	0.328:0.014	C
KIAA0430	9665	genome.wustl.edu	37	16	15696479	15696480	+	Intron	DEL	GA	GA	-	rs373385405|rs373082870|rs79821793|rs76777980|rs71293163	byFrequency	TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr16:15696479_15696480delGA	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000344181.3_Frame_Shift_Del_p.P1117fs|KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000540441.2_Intron|KIAA0430_ENST00000548025.1_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						ggaggaggaggaaggaaagaag	0.406																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-419TC>-	16.37:g.15696479_15696480delGA			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Del	DEL	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1114fs	ENST00000396368.3	37	c.3340_3339	CCDS10562.2	16																																																																																			KIAA0430	-	NULL	ENSG00000166783		0.406	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	22	0.00	0	GA	NM_014647		15696479	15696480	-1	no_errors	ENST00000344181	ensembl	human	known	69_37n	frame_shift_del	6	36.36	4	DEL	0.000:0.000	-
ZSWIM8	23053	genome.wustl.edu	37	10	75552004	75552005	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr10:75552004_75552005insG	ENST00000605216.1	+	10	1924_1925	c.1707_1708insG	c.(1708-1710)gggfs	p.G570fs	ZSWIM8_ENST00000431225.1_3'UTR|ZSWIM8_ENST00000604524.1_Frame_Shift_Ins_p.G570fs|ZSWIM8_ENST00000603114.1_Frame_Shift_Ins_p.G570fs|ZSWIM8_ENST00000398706.2_Frame_Shift_Ins_p.G570fs|ZSWIM8_ENST00000604729.1_Frame_Shift_Ins_p.G570fs	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	570	Gly-rich.						zinc ion binding (GO:0008270)										TCTCAGCTGAAGGGGGAGATAA	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.1712dupG	10.37:g.75552009_75552009dupG	ENSP00000474748:p.Gly570fs		B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Frame_Shift_Ins	INS	pfscan_Znf_SWIM	p.D571fs	ENST00000605216.1	37	c.1707_1708		10																																																																																			KIAA0913	-	NULL	ENSG00000214655		0.653	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	14	0.00	0	-	NM_001242487		75552004	75552005	+1	no_errors	ENST00000398706	ensembl	human	known	69_37n	frame_shift_ins	11	15.38	2	INS	0.977:1.000	G
MALAT1	378938	genome.wustl.edu	37	11	65271072	65271074	+	lincRNA	DEL	AAT	AAT	-	rs533896189		TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	AAT	AAT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr11:65271072_65271074delAAT	ENST00000534336.1	+	0	5840_5842					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AATCATTCAAAATAATAAACTAT	0.291																																						dbGAP											0										0,1834		0,0,917						2.8	0.8			70	3,3989		1,1,1994	no	intergenic				1,1,2911	A1A1,A1R,RR		0.0752,0.0,0.0515				3,5823				-	-	-			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271075_65271077delAAT				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.291	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	173	0.00	0	AAT	NR_002819		65271072	65271074	+1	no_errors	ENST00000508832	ensembl	human	known	69_37n	rna	167	24.66	55	DEL	0.061:0.073:0.070	-
NEB	4703	genome.wustl.edu	37	2	152432783	152432783	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr2:152432783G>T	ENST00000172853.10	-	78	11834	c.11687C>A	c.(11686-11688)gCc>gAc	p.A3896D	NEB_ENST00000427231.2_Missense_Mutation_p.A5597D|NEB_ENST00000397345.3_Missense_Mutation_p.A5597D|NEB_ENST00000603639.1_Missense_Mutation_p.A5597D|NEB_ENST00000409198.1_Missense_Mutation_p.A3896D|NEB_ENST00000604864.1_Missense_Mutation_p.A5597D			P20929	NEBU_HUMAN	nebulin	3896					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.A3896V(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GATATTCTGGGCGTTTTTGAC	0.473																																						dbGAP											1	Substitution - Missense(1)	skin(1)											95.0	99.0	98.0					2																	152432783		1899	4128	6027	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11687C>A	2.37:g.152432783G>T	ENSP00000172853:p.Ala3896Asp		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.A5597D	ENST00000172853.10	37	c.16790		2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737951	0.89573	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000413693;ENST00000172853	T;T;T;T;T	0.15603	2.63;2.75;2.74;2.41;2.62	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.48187	0.1486	M	0.81614	2.55	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.41610	-0.9499	10	0.56958	D	0.05	.	20.282	0.98514	0.0:0.0:1.0:0.0	.	3896;327	P20929;Q14215	NEBU_HUMAN;.	D	3896;5597;5597;327;3896	ENSP00000386259:A3896D;ENSP00000380505:A5597D;ENSP00000416578:A5597D;ENSP00000410961:A327D;ENSP00000172853:A3896D	ENSP00000172853:A3896D	A	-	2	0	NEB	152141029	1.000000	0.71417	1.000000	0.80357	0.467000	0.32768	9.578000	0.98200	2.786000	0.95864	0.563000	0.77884	GCC	NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.473	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		103	0.00	0	G	NM_004543		152432783	152432783	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	93	26.77	34	SNP	1.000	T
PDE8A	5151	genome.wustl.edu	37	15	85659299	85659299	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr15:85659299A>T	ENST00000310298.4	+	17	1736	c.1484A>T	c.(1483-1485)gAg>gTg	p.E495V	PDE8A_ENST00000557957.1_Missense_Mutation_p.E423V|PDE8A_ENST00000339708.5_Missense_Mutation_p.E449V|PDE8A_ENST00000394553.1_Missense_Mutation_p.E495V			O60658	PDE8A_HUMAN	phosphodiesterase 8A	495					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	ATGGAAAATGAGGAATACTGG	0.473																																						dbGAP											0													111.0	106.0	107.0					15																	85659299		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.1484A>T	15.37:g.85659299A>T	ENSP00000311453:p.Glu495Val		B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_Sig_transdc_resp-reg_receiver,pfam_PAS_fold,pfam_PAS_4,superfamily_CheY-like_superfamily,smart_HD/PDEase_dom,pfscan_PAS,prints_PDEase,tigrfam_PAS	p.E495V	ENST00000310298.4	37	c.1484	CCDS10336.1	15	.	.	.	.	.	.	.	.	.	.	A	14.05	2.420591	0.42918	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	T;T;T	0.74209	-0.82;-0.82;-0.82	5.07	1.32	0.21799	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.109289	0.64402	N	0.000010	T	0.65790	0.2725	L	0.50919	1.6	0.58432	D	0.999999	B;B	0.27700	0.186;0.096	B;B	0.36289	0.221;0.062	T	0.50259	-0.8849	10	0.11182	T	0.66	.	9.056	0.36405	0.5812:0.0:0.0:0.4188	.	449;495	O60658-2;O60658	.;PDE8A_HUMAN	V	495;495;449	ENSP00000311453:E495V;ENSP00000378056:E495V;ENSP00000340679:E449V	ENSP00000311453:E495V	E	+	2	0	PDE8A	83460303	1.000000	0.71417	0.003000	0.11579	0.051000	0.14879	4.011000	0.57124	0.043000	0.15746	-0.317000	0.08691	GAG	PDE8A	-	NULL	ENSG00000073417		0.473	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE8A	HGNC	protein_coding	OTTHUMT00000309018.1	293	0.00	0	A	NM_002605		85659299	85659299	+1	no_errors	ENST00000310298	ensembl	human	known	69_37n	missense	145	31.78	68	SNP	0.908	T
PPIG	9360	genome.wustl.edu	37	2	170493412	170493412	+	Silent	SNP	A	A	G			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr2:170493412A>G	ENST00000260970.3	+	14	1864	c.1644A>G	c.(1642-1644)gaA>gaG	p.E548E	PPIG_ENST00000409714.3_Silent_p.E533E|PPIG_ENST00000448752.2_Silent_p.E548E	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	548	Arg/Ser-rich (RS domain).				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	GGAGTAGAGAATGTGATATAA	0.388																																						dbGAP											0													87.0	83.0	85.0					2																	170493412		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1644A>G	2.37:g.170493412A>G			D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Silent	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.E548	ENST00000260970.3	37	c.1644	CCDS2235.1	2																																																																																			PPIG	-	NULL	ENSG00000138398		0.388	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIG	HGNC	protein_coding	OTTHUMT00000255264.2	186	0.00	0	A			170493412	170493412	+1	no_errors	ENST00000260970	ensembl	human	known	69_37n	silent	120	37.17	71	SNP	1.000	G
PRPF8	10594	genome.wustl.edu	37	17	1564332	1564332	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr17:1564332G>A	ENST00000572621.1	-	27	4728	c.4463C>T	c.(4462-4464)aCa>aTa	p.T1488I	PRPF8_ENST00000304992.6_Missense_Mutation_p.T1488I			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1488	Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CTTAAAGAGTGTGTGTTCCAG	0.532																																						dbGAP											0													110.0	94.0	100.0					17																	1564332		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4463C>T	17.37:g.1564332G>A	ENSP00000460348:p.Thr1488Ile		O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_Pre-mRNA-splicing_factor-8,pfam_Prp8_U5-snRNA-bd,pfam_PRO_C,pfam_RRM_spliceosomal_PrP8,pfam_JAB1_Mov34_MPN_PAD1,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB1_Mov34_MPN_PAD1	p.T1488I	ENST00000572621.1	37	c.4463	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	g	25.5	4.648202	0.87958	.	.	ENSG00000174231	ENST00000304992;ENST00000540177	D	0.83755	-1.76	6.02	6.02	0.97574	Pre-mRNA-processing-splicing factor 8, U6-snRNA-binding (1);	0.087193	0.85682	D	0.000000	D	0.92551	0.7634	M	0.86178	2.8	0.80722	D	1	D	0.67145	0.996	D	0.76575	0.988	D	0.92590	0.6082	10	0.87932	D	0	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	1488	Q6P2Q9	PRP8_HUMAN	I	1488;15	ENSP00000304350:T1488I	ENSP00000304350:T1488I	T	-	2	0	PRPF8	1511082	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	9.835000	0.99442	2.865000	0.98341	0.655000	0.94253	ACA	PRPF8	-	pfam_Prp8_U6-snRNA-bd	ENSG00000174231		0.532	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	74	0.00	0	G			1564332	1564332	-1	no_errors	ENST00000304992	ensembl	human	known	69_37n	missense	81	11.96	11	SNP	1.000	A
RB1CC1	9821	genome.wustl.edu	37	8	53543057	53543057	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr8:53543057C>T	ENST00000025008.5	-	21	4995	c.4472G>A	c.(4471-4473)aGg>aAg	p.R1491K	RB1CC1_ENST00000539297.1_Missense_Mutation_p.R1491K|RB1CC1_ENST00000435644.2_Missense_Mutation_p.R1491K|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1491					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTCAGAATGCCTTGAAGATAC	0.284																																					GBM(180;1701 2102 13475 42023 52570)	dbGAP											0													39.0	37.0	38.0					8																	53543057		2199	4293	6492	-	-	-	SO:0001583	missense	0			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4472G>A	8.37:g.53543057C>T	ENSP00000025008:p.Arg1491Lys		Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	pfam_Autophagy-rel_p11	p.R1491K	ENST00000025008.5	37	c.4472	CCDS34892.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.11|14.11	2.436864|2.436864	0.43224|0.43224	.|.	.|.	ENSG00000023287|ENSG00000023287	ENST00000519912|ENST00000025008;ENST00000435644;ENST00000539297	.|T;T;T	.|0.15256	.|2.44;2.44;2.44	5.12|5.12	4.24|4.24	0.50183|0.50183	.|.	.|0.056712	.|0.64402	.|D	.|0.000001	T|T	0.15696|0.15696	0.0378|0.0378	N|N	0.03608|0.03608	-0.345|-0.345	0.53005|0.53005	D|D	0.999962|0.999962	.|D;D	.|0.67145	.|0.996;0.987	.|D;D	.|0.76071	.|0.987;0.979	T|T	0.08351|0.08351	-1.0726|-1.0726	5|10	.|0.06099	.|T	.|0.92	-11.6453|-11.6453	13.6461|13.6461	0.62281|0.62281	0.0:0.9255:0.0:0.0745|0.0:0.9255:0.0:0.0745	.|.	.|1491;1491	.|Q8TDY2-2;Q8TDY2	.|.;RBCC1_HUMAN	S|K	34|1491	.|ENSP00000025008:R1491K;ENSP00000396067:R1491K;ENSP00000445960:R1491K	.|ENSP00000025008:R1491K	G|R	-|-	1|2	0|0	RB1CC1|RB1CC1	53705610|53705610	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.841000|0.841000	0.47740|0.47740	7.009000|7.009000	0.76347|0.76347	1.287000|1.287000	0.44583|0.44583	0.655000|0.655000	0.94253|0.94253	GGC|AGG	RB1CC1	-	pfam_Autophagy-rel_p11	ENSG00000023287		0.284	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RB1CC1	HGNC	protein_coding	OTTHUMT00000378011.1	33	0.00	0	C	NM_014781		53543057	53543057	-1	no_errors	ENST00000025008	ensembl	human	known	69_37n	missense	26	38.10	16	SNP	1.000	T
SETD2	29072	genome.wustl.edu	37	3	47142959	47142959	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr3:47142959G>C	ENST00000409792.3	-	8	5046	c.5004C>G	c.(5002-5004)ttC>ttG	p.F1668L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1668					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CATATCTCTGGAACTGATAGT	0.373			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													164.0	168.0	167.0					3																	47142959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5004C>G	3.37:g.47142959G>C	ENSP00000386759:p.Phe1668Leu		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.F1668L	ENST00000409792.3	37	c.5004	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127480	0.77549	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	T	0.80033	-1.33	5.94	-0.626	0.11544	SET domain (2);	0.000000	0.56097	D	0.000031	T	0.81781	0.4895	L	0.39326	1.205	0.80722	D	1	D;D	0.63046	0.992;0.992	D;D	0.66602	0.945;0.945	T	0.79427	-0.1808	10	0.54805	T	0.06	.	11.6498	0.51282	0.4:0.0:0.6:0.0	.	1668;1668	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	1668	ENSP00000386759:F1668L	ENSP00000386759:F1668L	F	-	3	2	SETD2	47117963	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.351000	0.34022	-0.057000	0.13199	0.650000	0.86243	TTC	SETD2	-	smart_SET_dom,pfscan_SET_dom	ENSG00000181555		0.373	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	364	0.00	0	G	NM_014159		47142959	47142959	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	missense	271	29.79	115	SNP	0.997	C
SELT	51714	genome.wustl.edu	37	3	150340928	150340928	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr3:150340928G>T	ENST00000485923.1	+	3	561	c.173G>T	c.(172-174)aGc>aTc	p.S58I	SELT_ENST00000471696.1_Missense_Mutation_p.S116I|SELT_ENST00000480740.1_Missense_Mutation_p.S58I|SELT_ENST00000477889.1_Missense_Mutation_p.S58I			P62341	SELT_HUMAN		116					cell redox homeostasis (GO:0045454)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|pancreas development (GO:0031016)|selenocysteine incorporation (GO:0001514)	endoplasmic reticulum (GO:0005783)	selenium binding (GO:0008430)							LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CAAGCTCCTAGCATCTGGCAG	0.358																																						dbGAP											0													73.0	64.0	66.0					3																	150340928		1831	4073	5904	-	-	-	SO:0001583	missense	0																														ENST00000485923.1:c.173G>T	3.37:g.150340928G>T	ENSP00000420390:p.Ser58Ile		O95904|Q8IY80|Q9CZ45|Q9NZJ3	Missense_Mutation	SNP	pfam_Selenoprotein_Rdx-typ,superfamily_Thioredoxin-like_fold,tigrfam_Selenoprotein_Rdx-typ	p.S58I	ENST00000485923.1	37	c.173		3	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956494	0.73902	.	.	ENSG00000198843	ENST00000480740;ENST00000471696;ENST00000477889;ENST00000485923	.	.	.	5.76	4.87	0.63330	Thioredoxin-like fold (1);	0.036803	0.85682	D	0.000000	T	0.58991	0.2161	L	0.52905	1.665	0.54753	D	0.999981	P	0.50710	0.938	P	0.45343	0.477	T	0.62277	-0.6888	9	0.48119	T	0.1	-11.9554	16.6812	0.85292	0.0:0.1297:0.8703:0.0	.	116	P62341	SELT_HUMAN	I	58;116;58;58	.	ENSP00000418910:S116I	S	+	2	0	RP11-392O18.1	151823618	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.285000	0.78660	1.396000	0.46663	0.650000	0.86243	AGC	RP11-392O18.1	-	pfam_Selenoprotein_Rdx-typ,tigrfam_Selenoprotein_Rdx-typ	ENSG00000198843		0.358	SELT-005	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	SELT	Clone_based_vega_gene	protein_coding	OTTHUMT00000357629.1	79	0.00	0	G			150340928	150340928	+1	no_errors	ENST00000477889	ensembl	human	putative	69_37n	missense	69	34.91	37	SNP	1.000	T
SLC40A1	30061	genome.wustl.edu	37	2	190430090	190430090	+	Silent	SNP	A	A	G			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr2:190430090A>G	ENST00000261024.2	-	6	1176	c.750T>C	c.(748-750)aaT>aaC	p.N250N		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	250					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			CTTTGTGTAAATTCAGCTGTT	0.393																																						dbGAP											0													73.0	69.0	70.0					2																	190430090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.750T>C	2.37:g.190430090A>G			Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Silent	SNP	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	p.N250	ENST00000261024.2	37	c.750	CCDS2299.1	2																																																																																			SLC40A1	-	pfam_Ferroportin-1,superfamily_MFS_dom_general_subst_transpt	ENSG00000138449		0.393	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC40A1	HGNC	protein_coding	OTTHUMT00000255916.2	135	0.00	0	A			190430090	190430090	-1	no_errors	ENST00000261024	ensembl	human	known	69_37n	silent	110	11.29	14	SNP	0.912	G
TADA2A	6871	genome.wustl.edu	37	17	35837018	35837018	+	Silent	SNP	G	G	A			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr17:35837018G>A	ENST00000394395.2	+	16	1436	c.1263G>A	c.(1261-1263)aaG>aaA	p.K421K	TADA2A_ENST00000225396.6_Silent_p.K421K	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	421	SWIRM. {ECO:0000255|PROSITE- ProRule:PRU00247}.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						CACTCATCAAGATAGATGTGA	0.438																																						dbGAP											0													169.0	172.0	171.0					17																	35837018		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.1263G>A	17.37:g.35837018G>A			A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Silent	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_SWIRM,pfscan_Myb-like_dom	p.K421	ENST00000394395.2	37	c.1263	CCDS11319.1	17																																																																																			TADA2A	-	pfam_SWIRM,superfamily_Homeodomain-like,pirsf_Transcriptional_adaptor_2,pfscan_SWIRM	ENSG00000108264		0.438	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2A	HGNC	protein_coding	OTTHUMT00000256677.3	241	0.00	0	G	NM_001488		35837018	35837018	+1	no_errors	ENST00000225396	ensembl	human	known	69_37n	silent	225	32.63	109	SNP	1.000	A
TAS2R16	50833	genome.wustl.edu	37	7	122634847	122634847	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr7:122634847G>A	ENST00000249284.2	-	1	907	c.842C>T	c.(841-843)cCt>cTt	p.P281L		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	281					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTTCAACGTAGGGCTGCTCAG	0.418																																						dbGAP											0													114.0	116.0	115.0					7																	122634847		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.842C>T	7.37:g.122634847G>A	ENSP00000249284:p.Pro281Leu		A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.P281L	ENST00000249284.2	37	c.842	CCDS5785.1	7	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801830	0.50315	.	.	ENSG00000128519	ENST00000249284	T	0.00784	5.7	4.34	3.46	0.39613	.	0.466021	0.19141	N	0.121695	T	0.01835	0.0058	L	0.38175	1.15	0.09310	N	0.999999	D	0.76494	0.999	D	0.72982	0.979	T	0.54951	-0.8216	10	0.25751	T	0.34	.	8.3634	0.32372	0.1092:0.0:0.8908:0.0	.	281	Q9NYV7	T2R16_HUMAN	L	281	ENSP00000249284:P281L	ENSP00000249284:P281L	P	-	2	0	TAS2R16	122422083	0.089000	0.21612	0.018000	0.16275	0.025000	0.11179	2.371000	0.44248	1.182000	0.42928	0.591000	0.81541	CCT	TAS2R16	-	pfam_TAS2_rcpt	ENSG00000128519		0.418	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R16	HGNC	protein_coding	OTTHUMT00000347409.1	297	0.00	0	G	NM_016945		122634847	122634847	-1	no_errors	ENST00000249284	ensembl	human	known	69_37n	missense	217	33.02	107	SNP	0.016	A
TRMT61B	55006	genome.wustl.edu	37	2	29092602	29092602	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr2:29092602delT	ENST00000306108.5	-	1	565	c.542delA	c.(541-543)aatfs	p.N181fs		NM_017910.3	NP_060380.3	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B (S. cerevisiae)	181					mitochondrial tRNA methylation (GO:0070901)|protein homooligomerization (GO:0051260)	mitochondrion (GO:0005739)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	13						CCAGTTACTATTTAAGAGTCC	0.493																																						dbGAP											0													71.0	78.0	76.0					2																	29092602		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC010365	CCDS1768.1	2p23.2	2009-01-09			ENSG00000171103	ENSG00000171103			26070	protein-coding gene	gene with protein product						11230166	Standard	NM_017910		Approved	FLJ20628	uc002rmm.3	Q9BVS5	OTTHUMG00000128433	ENST00000306108.5:c.542delA	2.37:g.29092602delT	ENSP00000302801:p.Asn181fs		Q9H0Q9|Q9NWS7	Frame_Shift_Del	DEL	pfam_tRNA_MeTrfase_GCD14,pfam_PCMT	p.N181fs	ENST00000306108.5	37	c.542	CCDS1768.1	2																																																																																			TRMT61B	-	pfam_tRNA_MeTrfase_GCD14	ENSG00000171103		0.493	TRMT61B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT61B	HGNC	protein_coding	OTTHUMT00000250224.1	275	0.00	0	T	NM_017910		29092602	29092602	-1	no_errors	ENST00000306108	ensembl	human	known	69_37n	frame_shift_del	161	34.01	84	DEL	0.713	-
USF1	7391	genome.wustl.edu	37	1	161011928	161011928	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr1:161011928G>C	ENST00000368021.3	-	5	458	c.254C>G	c.(253-255)cCt>cGt	p.P85R	USF1_ENST00000368019.1_Missense_Mutation_p.P85R|USF1_ENST00000435396.1_Missense_Mutation_p.P26R|USF1_ENST00000368020.1_Missense_Mutation_p.P85R	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	85					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TTGAGTGGCAGGGTAGCCACT	0.542																																						dbGAP											0													70.0	63.0	66.0					1																	161011928		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.254C>G	1.37:g.161011928G>C	ENSP00000357000:p.Pro85Arg		B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.P85R	ENST00000368021.3	37	c.254	CCDS1214.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566041	0.86439	.	.	ENSG00000158773	ENST00000368020;ENST00000368021;ENST00000435396;ENST00000368019;ENST00000531842;ENST00000534633	D;D;D;D;D	0.92911	-3.05;-3.05;-3.13;-3.13;-2.75	5.1	5.1	0.69264	.	0.281034	0.41097	D	0.000959	D	0.88555	0.6468	M	0.67397	2.05	0.80722	D	1	P	0.34562	0.457	B	0.33846	0.171	D	0.90161	0.4228	10	0.72032	D	0.01	-7.9796	16.0723	0.80943	0.0:0.0:1.0:0.0	.	85	P22415	USF1_HUMAN	R	85;85;26;85;85;26	ENSP00000356999:P85R;ENSP00000357000:P85R;ENSP00000390109:P26R;ENSP00000356998:P85R;ENSP00000435005:P85R	ENSP00000356998:P85R	P	-	2	0	USF1	159278552	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.803000	0.85983	2.655000	0.90218	0.655000	0.94253	CCT	USF1	-	NULL	ENSG00000158773		0.542	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USF1	HGNC	protein_coding	OTTHUMT00000077050.1	100	0.00	0	G	NM_007122		161011928	161011928	-1	no_errors	ENST00000368020	ensembl	human	known	69_37n	missense	137	13.84	22	SNP	1.000	C
YLPM1	56252	genome.wustl.edu	37	14	75247171	75247171	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr14:75247171C>T	ENST00000552421.1	+	3	1298	c.1174C>T	c.(1174-1176)Cag>Tag	p.Q392*	YLPM1_ENST00000238571.3_Nonsense_Mutation_p.Q392*|YLPM1_ENST00000325680.7_Nonsense_Mutation_p.Q392*			P49750	YLPM1_HUMAN	YLP motif containing 1	392	Gln-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		ACACTGGCAGCAGCACCAGCA	0.463																																						dbGAP											0													118.0	122.0	121.0					14																	75247171		2021	4189	6210	-	-	-	SO:0001587	stop_gained	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.1174C>T	14.37:g.75247171C>T	ENSP00000447921:p.Gln392*		P49752|Q96I64|Q9P1V7	Nonsense_Mutation	SNP	superfamily_FH2_actin-bd	p.Q392*	ENST00000552421.1	37	c.1174		14	.	.	.	.	.	.	.	.	.	.	C	37	6.623639	0.97714	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-7.4521	18.8731	0.92324	0.0:1.0:0.0:0.0	.	.	.	.	X	392;392;392;105	.	ENSP00000238571:Q392X	Q	+	1	0	YLPM1	74316924	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.080000	0.64437	2.455000	0.83008	0.655000	0.94253	CAG	YLPM1	-	NULL	ENSG00000119596		0.463	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404450.1	387	0.00	0	C	NM_019589		75247171	75247171	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	nonsense	170	46.75	151	SNP	1.000	T
ZNF688	146542	genome.wustl.edu	37	16	30581301	30581301	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0GZ-01A-11W-A071-09	TCGA-BH-A0GZ-10A-01W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	068bd892-6fee-46c2-945f-34a6c6804070	907908c6-b11c-4e36-980e-f4aa6a132057	g.chr16:30581301C>G	ENST00000223459.6	-	3	1871	c.767G>C	c.(766-768)cGa>cCa	p.R256P	AC002310.7_ENST00000492040.1_RNA|ZNF688_ENST00000395219.1_Missense_Mutation_p.R242P|AC002310.7_ENST00000486926.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CCGGTCACCTCGGACGGGGGC	0.706																																						dbGAP											0													17.0	20.0	19.0					16																	30581301		2124	4160	6284	-	-	-	SO:0001583	missense	0			AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.767G>C	16.37:g.30581301C>G	ENSP00000223459:p.Arg256Pro		A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R256P	ENST00000223459.6	37	c.767	CCDS10684.1	16	.	.	.	.	.	.	.	.	.	.	C	15.94	2.980319	0.53827	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.03982	3.74;3.97	4.42	3.45	0.39498	.	.	.	.	.	T	0.04003	0.0112	N	0.19112	0.55	0.09310	N	0.999998	B;B	0.22800	0.016;0.075	B;B	0.18263	0.01;0.021	T	0.39623	-0.9605	9	0.38643	T	0.18	.	10.4934	0.44764	0.0:0.803:0.197:0.0	.	256;242	P0C7X2;A8MV39	ZN688_HUMAN;.	P	242;256	ENSP00000378645:R242P;ENSP00000223459:R256P	ENSP00000223459:R256P	R	-	2	0	ZNF688	30488802	0.002000	0.14202	0.190000	0.23270	0.836000	0.47400	0.836000	0.27545	1.184000	0.42957	0.467000	0.42956	CGA	ZNF688	-	NULL	ENSG00000229809		0.706	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF688	HGNC	protein_coding	OTTHUMT00000255544.2	10	0.00	0	C	NM_145271		30581301	30581301	-1	no_errors	ENST00000223459	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	0.200	G
