#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACPP	55	genome.wustl.edu	37	3	132047117	132047117	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr3:132047117C>T	ENST00000336375.5	+	2	217	c.127C>T	c.(127-129)Cgg>Tgg	p.R43W	ACPP_ENST00000351273.7_Missense_Mutation_p.R43W|ACPP_ENST00000489084.1_3'UTR|ACPP_ENST00000475741.1_Missense_Mutation_p.R43W	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	43					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TCAGGTGTTTCGGCATGGAGA	0.443																																						dbGAP											0													78.0	68.0	71.0					3																	132047117		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.127C>T	3.37:g.132047117C>T	ENSP00000337471:p.Arg43Trp		D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.R43W	ENST00000336375.5	37	c.127	CCDS3073.1	3	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940883	0.73557	.	.	ENSG00000014257	ENST00000336375;ENST00000495911;ENST00000475741;ENST00000351273	D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24	5.72	4.8	0.61643	.	0.000000	0.64402	D	0.000006	D	0.97748	0.9261	H	0.96833	3.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.98376	1.0556	10	0.87932	D	0	.	13.1682	0.59583	0.2078:0.7922:0.0:0.0	.	43;43;43	P15309;P15309-2;Q5FBY0	PPAP_HUMAN;.;.	W	43	ENSP00000337471:R43W;ENSP00000418366:R43W;ENSP00000417744:R43W;ENSP00000323036:R43W	ENSP00000337471:R43W	R	+	1	2	ACPP	133529807	1.000000	0.71417	0.990000	0.47175	0.812000	0.45895	3.460000	0.53028	1.271000	0.44313	0.655000	0.94253	CGG	ACPP	-	pfam_His_Pase_superF_clade-2	ENSG00000014257		0.443	ACPP-001	KNOWN	basic|CCDS	protein_coding	ACPP	HGNC	protein_coding	OTTHUMT00000356699.2	63	0.00	0	C	NM_001099		132047117	132047117	+1	no_errors	ENST00000351273	ensembl	human	known	69_37n	missense	79	15.05	14	SNP	1.000	T
AKAP6	9472	genome.wustl.edu	37	14	33004940	33004940	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr14:33004940C>A	ENST00000280979.4	+	3	675	c.505C>A	c.(505-507)Ctg>Atg	p.L169M	AKAP6_ENST00000557272.1_Missense_Mutation_p.L169M|AKAP6_ENST00000557354.1_Missense_Mutation_p.L169M	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	169					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TCTGCAAGGTCTGCAGGACGC	0.512																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											0													98.0	89.0	92.0					14																	33004940		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.505C>A	14.37:g.33004940C>A	ENSP00000280979:p.Leu169Met		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.L169M	ENST00000280979.4	37	c.505	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	21.4	4.138021	0.77775	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.38077	2.42;1.18;1.16	5.68	3.54	0.40534	.	0.000000	0.56097	D	0.000026	T	0.56558	0.1993	M	0.66939	2.045	0.44247	D	0.997097	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.61941	-0.6959	10	0.87932	D	0	-5.6951	13.1385	0.59423	0.0:0.8489:0.0:0.1511	.	169;169	A7E242;Q13023	.;AKAP6_HUMAN	M	169	ENSP00000280979:L169M;ENSP00000450531:L169M;ENSP00000451247:L169M	ENSP00000280979:L169M	L	+	1	2	AKAP6	32074691	0.993000	0.37304	0.995000	0.50966	0.996000	0.88848	3.118000	0.50414	1.404000	0.46819	0.591000	0.81541	CTG	AKAP6	-	NULL	ENSG00000151320		0.512	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	162	0.00	0	C	NM_004274		33004940	33004940	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense	172	27.73	66	SNP	0.993	A
ALPK2	115701	genome.wustl.edu	37	18	56203182	56203182	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr18:56203182C>G	ENST00000361673.3	-	5	4450	c.4237G>C	c.(4237-4239)Gag>Cag	p.E1413Q	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1413						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CTGGTGTACTCTATCACACTT	0.488																																						dbGAP											0													65.0	66.0	66.0					18																	56203182		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.4237G>C	18.37:g.56203182C>G	ENSP00000354991:p.Glu1413Gln		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.E1413Q	ENST00000361673.3	37	c.4237	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793477	0.50102	.	.	ENSG00000198796	ENST00000361673	T	0.57436	0.4	5.06	4.19	0.49359	.	.	.	.	.	T	0.64193	0.2576	L	0.50333	1.59	0.09310	N	1	D;D	0.76494	0.999;0.983	D;P	0.72075	0.976;0.799	T	0.53136	-0.8481	9	0.62326	D	0.03	-4.405	9.4076	0.38471	0.0:0.9034:0.0:0.0966	.	1408;1413	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	Q	1413	ENSP00000354991:E1413Q	ENSP00000354991:E1413Q	E	-	1	0	ALPK2	54354162	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.238000	0.18004	1.355000	0.45865	0.563000	0.77884	GAG	ALPK2	-	NULL	ENSG00000198796		0.488	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1	132	0.00	0	C	NM_052947		56203182	56203182	-1	no_errors	ENST00000361673	ensembl	human	known	69_37n	missense	103	18.90	24	SNP	0.003	G
BACH2	60468	genome.wustl.edu	37	6	90660896	90660896	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr6:90660896T>G	ENST00000257749.4	-	7	1636	c.929A>C	c.(928-930)gAc>gCc	p.D310A	RP3-512E2.2_ENST00000445838.1_RNA|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000343122.3_Missense_Mutation_p.D310A|BACH2_ENST00000537989.1_Missense_Mutation_p.D310A	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	310						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CTGTTTCCGGTCCATCTCGAC	0.647																																						dbGAP											0													45.0	43.0	44.0					6																	90660896		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.929A>C	6.37:g.90660896T>G	ENSP00000257749:p.Asp310Ala		E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_bZIP_1,pfam_bZIP_2,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.D310A	ENST00000257749.4	37	c.929	CCDS5026.1	6	.	.	.	.	.	.	.	.	.	.	T	12.30	1.897402	0.33535	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.47528	0.84;0.84;0.84	5.03	3.85	0.44370	.	0.374731	0.32608	N	0.005871	T	0.16514	0.0397	L	0.27053	0.805	0.44104	D	0.996875	P	0.35745	0.518	B	0.32149	0.141	T	0.06807	-1.0806	10	0.72032	D	0.01	-12.0771	7.373	0.26813	0.1434:0.0:0.1501:0.7065	.	310	Q9BYV9	BACH2_HUMAN	A	310	ENSP00000257749:D310A;ENSP00000437473:D310A;ENSP00000345642:D310A	ENSP00000257749:D310A	D	-	2	0	BACH2	90717617	1.000000	0.71417	0.992000	0.48379	0.941000	0.58515	4.583000	0.60964	0.917000	0.36895	0.533000	0.62120	GAC	BACH2	-	NULL	ENSG00000112182		0.647	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	HGNC	protein_coding	OTTHUMT00000041522.2	93	0.00	0	T	NM_021813		90660896	90660896	-1	no_errors	ENST00000257749	ensembl	human	known	69_37n	missense	37	45.59	31	SNP	1.000	G
BAX	581	genome.wustl.edu	37	19	49458970	49458971	+	Frame_Shift_Ins	INS	-	-	G	rs141306106|rs398122842|rs398122841|rs398122840		TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr19:49458970_49458971insG	ENST00000345358.7	+	3	165_166	c.113_114insG	c.(112-117)atggggfs	p.MG38fs	BAX_ENST00000539787.1_Frame_Shift_Ins_p.MG38fs|BAX_ENST00000293288.8_Frame_Shift_Ins_p.MG38fs|BAX_ENST00000354470.3_Intron|BAX_ENST00000415969.2_Frame_Shift_Ins_p.MG38fs|BAX_ENST00000391871.3_Frame_Shift_Ins_p.W21fs	NM_138761.3|NM_138764.4	NP_620116.1|NP_620119.2	Q07812	BAX_HUMAN	BCL2-associated X protein	38					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell homeostatic proliferation (GO:0002358)|B cell negative selection (GO:0002352)|B cell receptor apoptotic signaling pathway (GO:1990117)|blood vessel remodeling (GO:0001974)|cellular response to organic substance (GO:0071310)|cellular response to UV (GO:0034644)|cerebral cortex development (GO:0021987)|development of secondary sexual characteristics (GO:0045136)|ectopic germ cell programmed cell death (GO:0035234)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells within a tissue (GO:0048873)|hypothalamus development (GO:0021854)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein binding (GO:0032091)|neuron apoptotic process (GO:0051402)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic DNA fragmentation (GO:1902512)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of developmental pigmentation (GO:0048087)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-embryonic camera-type eye morphogenesis (GO:0048597)|protein homooligomerization (GO:0051260)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)|protein oligomerization (GO:0051259)|regulation of cell cycle (GO:0051726)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|release of matrix enzymes from mitochondria (GO:0032976)|response to axon injury (GO:0048678)|response to gamma radiation (GO:0010332)|response to salt stress (GO:0009651)|response to toxic substance (GO:0009636)|retina development in camera-type eye (GO:0060041)|retinal cell apoptotic process (GO:1990009)|retinal cell programmed cell death (GO:0046666)|Sertoli cell proliferation (GO:0060011)|spermatid differentiation (GO:0048515)|T cell homeostatic proliferation (GO:0001777)|thymocyte apoptotic process (GO:0070242)|transformed cell apoptotic process (GO:0006927)|vagina development (GO:0060068)|viral process (GO:0016032)	BAX complex (GO:0097144)|Bcl-2 family protein complex (GO:0097136)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrial permeability transition pore complex (GO:0005757)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.E41fs*19(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(4)	17		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		GCAGGGCGAATGGGGGGGGAGG	0.594																																						dbGAP											1	Deletion - Frameshift(1)	lung(1)							,,,	38,4226		0,38,2094					,,,	4.0	0.3			58	42,8212		0,42,4085	no	frameshift,intron,frameshift,frameshift	BAX	NM_138764.4,NM_138763.3,NM_138761.3,NM_004324.3	,,,	0,80,6179	A1A1,A1R,RR		0.5088,0.8912,0.6391	,,,	,,,		80,12438				-	-	-	SO:0001589	frameshift_variant	0				CCDS12742.1, CCDS12743.1, CCDS12744.1, CCDS12745.1, CCDS12745.2	19q13.3-q13.4	2014-03-07			ENSG00000087088	ENSG00000087088			959	protein-coding gene	gene with protein product		600040				8358790	Standard	NM_138761		Approved	BCL2L4	uc002plf.1	Q07812	OTTHUMG00000160476	ENST00000345358.7:c.121dupG	19.37:g.49458978_49458978dupG	ENSP00000263262:p.Met38fs		A8K4W1|P55269|Q07814|Q07815|Q8WZ49|Q9NR76|Q9NYG7|Q9UCZ6|Q9UCZ7|Q9UQD6	Frame_Shift_Ins	INS	pfam_Bcl2_BH,smart_Bcl2_BH,pfscan_Bcl2-like_apoptosis,prints_Bcl2_BH	p.E41fs	ENST00000345358.7	37	c.113_114	CCDS12742.1	19																																																																																			BAX	-	NULL	ENSG00000087088		0.594	BAX-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BAX	HGNC	protein_coding	OTTHUMT00000360767.1	23	0.00	0	-	NM_138763		49458970	49458971	+1	no_errors	ENST00000293288	ensembl	human	known	69_37n	frame_shift_ins	17	15.00	3	INS	0.585:0.588	G
TLDC2	140711	genome.wustl.edu	37	20	35507557	35507558	+	Frame_Shift_Ins	INS	-	-	T	rs3748460|rs537916614	byFrequency	TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr20:35507557_35507558insT	ENST00000217320.3	+	3	347_348	c.303_304insT	c.(304-306)gggfs	p.G102fs	TLDC2_ENST00000602922.1_Frame_Shift_Ins_p.G102fs	NM_080628.1	NP_542195.1	A0PJX2	TLDC2_HUMAN	TBC/LysM-associated domain containing 2	102	TLD.		G -> R (in dbSNP:rs3748460).														AGGGCTGCAGCGGGCCAGTGCT	0.678																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL079335	CCDS33465.1	20q11.23	2013-03-14	2013-03-14	2013-03-14	ENSG00000101342	ENSG00000101342			16112	protein-coding gene	gene with protein product	"""hypothetical protein LOC140711"", ""TLD domain containing 2"""		"""chromosome 20 open reading frame 118"""	C20orf118			Standard	NM_080628		Approved	dJ132F21.2	uc002xgg.1	A0PJX2	OTTHUMG00000032400	Exception_encountered	20.37:g.35507557_35507558insT	ENSP00000217320:p.Gly102fs		B3KVU8	Frame_Shift_Ins	INS	pfam_TLDc,smart_TLDc	p.G101fs	ENST00000217320.3	37	c.303_304	CCDS33465.1	20																																																																																			C20orf118	-	pfam_TLDc,smart_TLDc	ENSG00000101342		0.678	TLDC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf118	HGNC	protein_coding	OTTHUMT00000079060.2	38	0.00	0	-	NM_080628		35507557	35507558	+1	no_errors	ENST00000217320	ensembl	human	known	69_37n	frame_shift_ins	53	15.87	10	INS	0.114:0.856	T
C2orf47	79568	genome.wustl.edu	37	2	200820884	200820884	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr2:200820884G>T	ENST00000392290.1	+	1	559	c.363G>T	c.(361-363)tgG>tgT	p.W121C	TYW5_ENST00000354611.4_5'Flank|C2orf47_ENST00000295079.2_Missense_Mutation_p.W121C|TYW5_ENST00000452512.2_5'Flank			Q8WWC4	CB047_HUMAN	chromosome 2 open reading frame 47	121						mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|large_intestine(1)|lung(5)	9						CCATCAACTGGGTTAGGACTC	0.527																																						dbGAP											0													71.0	74.0	73.0					2																	200820884		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017959	CCDS2329.1	2q33.1	2011-03-08			ENSG00000162972	ENSG00000162972			26198	protein-coding gene	gene with protein product						12477932	Standard	NM_024520		Approved	DKFZp666A212, FLJ22555	uc002uvm.3	Q8WWC4	OTTHUMG00000132771	ENST00000392290.1:c.363G>T	2.37:g.200820884G>T	ENSP00000376111:p.Trp121Cys		Q658V9|Q9H671	Missense_Mutation	SNP	NULL	p.W121C	ENST00000392290.1	37	c.363	CCDS2329.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.736048|4.736048	0.89482|0.89482	.|.	.|.	ENSG00000162972|ENSG00000162972	ENST00000435773|ENST00000295079;ENST00000392290	.|T;T	.|0.25085	.|1.82;1.82	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52661|0.52661	0.1748|0.1748	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.70935	.|0.971	T|T	0.47824|0.47824	-0.9087|-0.9087	5|10	.|0.72032	.|D	.|0.01	-14.5407|-14.5407	20.6593|20.6593	0.99626|0.99626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|121	.|Q8WWC4	.|CB047_HUMAN	V|C	114|121	.|ENSP00000295079:W121C;ENSP00000376111:W121C	.|ENSP00000295079:W121C	G|W	+|+	2|3	0|0	C2orf47|C2orf47	200529129|200529129	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.801000|0.801000	0.45260|0.45260	8.608000|8.608000	0.90895|0.90895	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	GGG|TGG	C2orf47	-	NULL	ENSG00000162972		0.527	C2orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf47	HGNC	protein_coding	OTTHUMT00000256146.1	72	0.00	0	G	NM_024520		200820884	200820884	+1	no_errors	ENST00000295079	ensembl	human	known	69_37n	missense	41	52.81	47	SNP	1.000	T
CDH18	1016	genome.wustl.edu	37	5	19483502	19483502	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr5:19483502A>C	ENST00000507958.1	-	14	2780	c.1790T>G	c.(1789-1791)gTg>gGg	p.V597G	CDH18_ENST00000382275.1_Missense_Mutation_p.V597G|CDH18_ENST00000506372.1_Missense_Mutation_p.C562G|CDH18_ENST00000274170.4_Missense_Mutation_p.V597G|CDH18_ENST00000502796.1_Missense_Mutation_p.C561G			Q13634	CAD18_HUMAN	cadherin 18, type 2	597	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GCAGGTCCGCACACGCCCATC	0.522																																						dbGAP											0													80.0	69.0	73.0					5																	19483502		2203	4300	6503	-	-	-	SO:0001583	missense	0			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1790T>G	5.37:g.19483502A>C	ENSP00000425093:p.Val597Gly		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V597G	ENST00000507958.1	37	c.1790	CCDS3889.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.51|16.51	3.142944|3.142944	0.57044|0.57044	.|.	.|.	ENSG00000145526|ENSG00000145526	ENST00000506372;ENST00000502796;ENST00000515257|ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	T;T;T|T;T;T	0.57752|0.55930	0.38;0.38;0.55|0.49;0.49;0.49	5.54|5.54	5.54|5.54	0.83059|0.83059	.|Cadherin (1);	.|0.290799	.|0.33253	.|N	.|0.005110	T|T	0.58380|0.58380	0.2118|0.2118	M|M	0.79693|0.79693	2.465|2.465	0.58432|0.58432	D|D	0.999999|0.999999	B|B	0.25667|0.27068	0.131|0.167	B|B	0.19666|0.32677	0.026|0.15	T|T	0.57539|0.57539	-0.7794|-0.7794	8|9	.|.	.|.	.|.	.|.	14.505|14.505	0.67746|0.67746	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	561|597	B4DHG6|Q13634	.|CAD18_HUMAN	G|G	562;561;428|597	ENSP00000424931:C562G;ENSP00000422138:C561G;ENSP00000427383:C428G|ENSP00000371710:V597G;ENSP00000425093:V597G;ENSP00000274170:V597G	.|.	C|V	-|-	1|2	0|0	CDH18|CDH18	19519259|19519259	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.701000|8.701000	0.91331|0.91331	2.113000|2.113000	0.64589|0.64589	0.533000|0.533000	0.62120|0.62120	TGC|GTG	CDH18	-	pfscan_Cadherin	ENSG00000145526		0.522	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	HGNC	protein_coding	OTTHUMT00000366747.1	48	0.00	0	A	NM_004934		19483502	19483502	-1	no_errors	ENST00000274170	ensembl	human	known	69_37n	missense	72	16.28	14	SNP	1.000	C
CHD4	1108	genome.wustl.edu	37	12	6697539	6697539	+	Silent	SNP	G	G	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr12:6697539G>A	ENST00000357008.2	-	23	3553	c.3390C>T	c.(3388-3390)ggC>ggT	p.G1130G	CHD4_ENST00000309577.6_Silent_p.G1130G|CHD4_ENST00000540960.1_5'Flank|CHD4_ENST00000544040.1_Silent_p.G1123G|CHD4_ENST00000544484.1_Silent_p.G1127G	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1130	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TGATTCCAAGGCCCCCAGCTC	0.478																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													79.0	77.0	78.0					12																	6697539		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3390C>T	12.37:g.6697539G>A			Q8IXZ5	Silent	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G1130	ENST00000357008.2	37	c.3390	CCDS8552.1	12																																																																																			CHD4	-	pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,smart_Helicase_C,pfscan_Helicase_C	ENSG00000111642		0.478	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		160	0.00	0	G	NM_001273		6697539	6697539	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	silent	118	30.99	53	SNP	1.000	A
CXorf66	347487	genome.wustl.edu	37	X	139038667	139038667	+	Silent	SNP	T	T	C			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chrX:139038667T>C	ENST00000370540.1	-	3	497	c.474A>G	c.(472-474)ccA>ccG	p.P158P		NM_001013403.2	NP_001013421.1	Q5JRM2	CX066_HUMAN	chromosome X open reading frame 66	158	Ser-rich.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|skin(1)|stomach(1)	26						TTGGATATGATGGCCTAGTTA	0.403																																						dbGAP											0													356.0	310.0	326.0					X																	139038667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS35411.1	Xq27.1	2014-05-30			ENSG00000203933	ENSG00000203933			33743	protein-coding gene	gene with protein product	"""secreted glycoprotein, X-linked"""					24709545	Standard	NM_001013403		Approved	RP11-35F15.2, SGPX	uc004fbb.3	Q5JRM2	OTTHUMG00000022539	ENST00000370540.1:c.474A>G	X.37:g.139038667T>C				Silent	SNP	NULL	p.P158	ENST00000370540.1	37	c.474	CCDS35411.1	X																																																																																			CXorf66	-	NULL	ENSG00000203933		0.403	CXorf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf66	HGNC	protein_coding	OTTHUMT00000058572.1	548	0.00	0	T	NM_001013403		139038667	139038667	-1	no_errors	ENST00000370540	ensembl	human	known	69_37n	silent	376	46.91	334	SNP	0.000	C
DCAF11	80344	genome.wustl.edu	37	14	24586486	24586486	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr14:24586486C>T	ENST00000446197.3	+	4	1022	c.295C>T	c.(295-297)Cct>Tct	p.P99S	NRL_ENST00000561028.1_5'Flank|DCAF11_ENST00000396941.4_Missense_Mutation_p.P73S|DCAF11_ENST00000560171.1_Intron|DCAF11_ENST00000396936.1_Silent_p.P20P|DCAF11_ENST00000559115.1_Missense_Mutation_p.P99S	NM_025230.4	NP_079506.3	Q8TEB1	DCA11_HUMAN	DDB1 and CUL4 associated factor 11	99					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)											GGATGCTACCCCTGACACCCG	0.577																																						dbGAP											0													49.0	50.0	50.0					14																	24586486		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF130070	CCDS9610.1, CCDS41929.1	14q11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000100897	ENSG00000100897		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20258	protein-coding gene	gene with protein product		613317	"""WD repeat domain 23"""	WDR23			Standard	NM_025230		Approved	PRO2389, GL014	uc001wlv.3	Q8TEB1	OTTHUMG00000028793	ENST00000446197.3:c.295C>T	14.37:g.24586486C>T	ENSP00000415556:p.Pro99Ser		B3KQ83|D3DS56|Q5D039|Q86U00|Q86U39|Q8NDN2|Q9H2J0|Q9H3A3|Q9H5C9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p23,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P99S	ENST00000446197.3	37	c.295	CCDS9610.1	14	.	.	.	.	.	.	.	.	.	.	c	14.38	2.517103	0.44763	.	.	ENSG00000100897	ENST00000326009;ENST00000446197;ENST00000396941	T	0.41065	1.01	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.56381	0.1981	M	0.64997	1.995	0.80722	D	1	P;P;D	0.69078	0.827;0.651;0.997	B;B;P	0.56042	0.346;0.266;0.79	T	0.50294	-0.8845	10	0.34782	T	0.22	-13.707	17.6312	0.88108	0.0:1.0:0.0:0.0	.	73;99;99	Q8TEB1-2;A8K9T2;Q8TEB1	.;.;DCA11_HUMAN	S	99;73;73	ENSP00000380146:P73S	ENSP00000323680:P99S	P	+	1	0	DCAF11	23656326	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.235000	0.72332	2.763000	0.94921	0.563000	0.77884	CCT	DCAF11	-	pirsf_WD_repeat_p23	ENSG00000100897		0.577	DCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF11	HGNC	protein_coding	OTTHUMT00000071907.4	57	0.00	0	C			24586486	24586486	+1	no_errors	ENST00000446197	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	1.000	T
EIF2B4	8890	genome.wustl.edu	37	2	27591877	27591877	+	Silent	SNP	G	G	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr2:27591877G>A	ENST00000347454.4	-	4	585	c.414C>T	c.(412-414)ccC>ccT	p.P138P	EIF2B4_ENST00000493344.2_Silent_p.P159P|SNX17_ENST00000537606.1_5'Flank|EIF2B4_ENST00000451130.2_Silent_p.P158P|EIF2B4_ENST00000445933.2_Silent_p.P137P|SNX17_ENST00000542478.1_5'Flank|SNX17_ENST00000543024.1_5'Flank|AC074117.10_ENST00000412749.1_RNA|SNX17_ENST00000233575.2_5'Flank	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	138					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGATACCTGAGGGGGTTTCTC	0.547																																						dbGAP											0													73.0	72.0	73.0					2																	27591877		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.414C>T	2.37:g.27591877G>A			Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Silent	SNP	pfam_IF-2B-related	p.P138	ENST00000347454.4	37	c.414	CCDS33164.1	2																																																																																			EIF2B4	-	NULL	ENSG00000115211		0.547	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2B4	HGNC	protein_coding	OTTHUMT00000324448.1	49	0.00	0	G			27591877	27591877	-1	no_errors	ENST00000347454	ensembl	human	known	69_37n	silent	72	18.18	16	SNP	0.941	A
EXOC3L1	283849	genome.wustl.edu	37	16	67219149	67219149	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr16:67219149delC	ENST00000314586.6	-	11	1879	c.1639delG	c.(1639-1641)gatfs	p.D547fs	KIAA0895L_ENST00000563902.1_5'Flank|EXOC3L1_ENST00000562887.1_5'Flank|KIAA0895L_ENST00000563831.2_5'Flank|KIAA0895L_ENST00000290881.7_5'Flank|KIAA0895L_ENST00000561621.1_5'Flank	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	547					exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						GAGGGCAGATCCGCGAACAGG	0.642																																						dbGAP											0													48.0	59.0	55.0					16																	67219149		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0			AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1639delG	16.37:g.67219149delC	ENSP00000325674:p.Asp547fs		A8K7I9|Q8NAD2|Q8TEN2	Frame_Shift_Del	DEL	pfam_Sec6	p.D547fs	ENST00000314586.6	37	c.1639	CCDS10832.1	16																																																																																			EXOC3L1	-	pfam_Sec6	ENSG00000179044		0.642	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L1	HGNC	protein_coding	OTTHUMT00000268827.2	9	0.00	0	C	NM_178516		67219149	67219149	-1	no_errors	ENST00000314586	ensembl	human	known	69_37n	frame_shift_del	10	33.33	5	DEL	0.000	-
FAM217B	63939	genome.wustl.edu	37	20	58519658	58519658	+	Silent	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr20:58519658C>T	ENST00000358293.3	+	5	1075	c.660C>T	c.(658-660)agC>agT	p.S220S	FAM217B_ENST00000469084.1_3'UTR|FAM217B_ENST00000360816.3_Silent_p.S220S	NM_001190826.1	NP_001177755.1	Q9NTX9	F217B_HUMAN	family with sequence similarity 217, member B	220																	CACTGAAAAGCCCTGGGAGAA	0.552																																						dbGAP											0													37.0	43.0	41.0					20																	58519658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL109928	CCDS13484.1	20q13.33	2012-02-07	2012-02-07	2012-02-07	ENSG00000196227	ENSG00000196227			16170	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 177"""	C20orf177			Standard	NM_022106		Approved	dJ551D2.5	uc002ybc.3	Q9NTX9	OTTHUMG00000032873	ENST00000358293.3:c.660C>T	20.37:g.58519658C>T			B3KWH1|Q9NTA3	Silent	SNP	NULL	p.S220	ENST00000358293.3	37	c.660	CCDS13484.1	20																																																																																			FAM217B	-	NULL	ENSG00000196227		0.552	FAM217B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217B	HGNC	protein_coding	OTTHUMT00000268139.1	39	0.00	0	C	NM_022106		58519658	58519658	+1	no_errors	ENST00000358293	ensembl	human	known	69_37n	silent	49	20.97	13	SNP	1.000	T
GEMIN5	25929	genome.wustl.edu	37	5	154282237	154282237	+	Splice_Site	SNP	C	C	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr5:154282237C>A	ENST00000285873.7	-	20	2804		c.e20-1			NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGACCTTTTCCTGTTTGAAAG	0.408																																						dbGAP											0													147.0	143.0	144.0					5																	154282237		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.2729-1G>T	5.37:g.154282237C>A			Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Splice_Site	SNP	-	e20-1	ENST00000285873.7	37	c.2729-1	CCDS4330.1	5	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764702	0.90020	.	.	ENSG00000082516	ENST00000285873	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GEMIN5	154262430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.822000	0.75277	2.873000	0.98535	0.563000	0.77884	.	GEMIN5	-	-	ENSG00000082516		0.408	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN5	HGNC	protein_coding	OTTHUMT00000252507.1	149	0.00	0	C		Intron	154282237	154282237	-1	no_errors	ENST00000285873	ensembl	human	known	69_37n	splice_site	136	27.66	52	SNP	1.000	A
GORAB	92344	genome.wustl.edu	37	1	170521254	170521254	+	Missense_Mutation	SNP	C	C	T	rs200615427		TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr1:170521254C>T	ENST00000367763.3	+	5	856	c.836C>T	c.(835-837)aCg>aTg	p.T279M		NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	279	Necessary for interaction with RCHY1.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						CACCTTTGTACGATCATACAG	0.458																																						dbGAP											0													88.0	84.0	85.0					1																	170521254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.836C>T	1.37:g.170521254C>T	ENSP00000356737:p.Thr279Met		Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Missense_Mutation	SNP	pfam_Golgin_RAB6-interacting	p.T279M	ENST00000367763.3	37	c.836	CCDS1289.1	1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867982	0.91587	.	.	ENSG00000120370	ENST00000367763	T	0.64803	-0.12	5.36	5.36	0.76844	.	0.052144	0.85682	D	0.000000	T	0.75258	0.3825	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	T	0.78401	-0.2218	10	0.87932	D	0	-24.3792	18.7074	0.91644	0.0:1.0:0.0:0.0	.	279	Q5T7V8	GORAB_HUMAN	M	279	ENSP00000356737:T279M	ENSP00000356737:T279M	T	+	2	0	GORAB	168787878	1.000000	0.71417	0.932000	0.37286	0.996000	0.88848	7.487000	0.81328	2.516000	0.84829	0.655000	0.94253	ACG	GORAB	-	pfam_Golgin_RAB6-interacting	ENSG00000120370		0.458	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GORAB	HGNC	protein_coding	OTTHUMT00000085226.1	156	0.00	0	C	NM_152281		170521254	170521254	+1	no_errors	ENST00000367763	ensembl	human	known	69_37n	missense	236	14.49	40	SNP	1.000	T
HECW2	57520	genome.wustl.edu	37	2	197080599	197080599	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr2:197080599C>A	ENST00000260983.3	-	28	4779	c.4597G>T	c.(4597-4599)Gct>Tct	p.A1533S	snoU13_ENST00000459047.1_RNA|HECW2_ENST00000409111.1_Missense_Mutation_p.A1177S	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1533	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CTGGGAAGAGCAGTGATTTTC	0.373																																						dbGAP											0													70.0	71.0	71.0					2																	197080599		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4597G>T	2.37:g.197080599C>A	ENSP00000260983:p.Ala1533Ser		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.A1533S	ENST00000260983.3	37	c.4597	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	C	6.210	0.406842	0.11754	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.57107	0.42;0.42	5.35	5.35	0.76521	HECT (4);	0.115762	0.64402	D	0.000012	T	0.27697	0.0681	N	0.03967	-0.31	0.52099	D	0.999941	B	0.20550	0.046	B	0.27796	0.083	T	0.19192	-1.0313	10	0.02654	T	1	.	14.1323	0.65263	0.1499:0.8501:0.0:0.0	.	1533	Q9P2P5	HECW2_HUMAN	S	1177;1533	ENSP00000386775:A1177S;ENSP00000260983:A1533S	ENSP00000260983:A1533S	A	-	1	0	HECW2	196788844	1.000000	0.71417	0.955000	0.39395	0.995000	0.86356	4.646000	0.61411	2.780000	0.95670	0.655000	0.94253	GCT	HECW2	-	pfam_HECT,smart_HECT,pfscan_HECT	ENSG00000138411		0.373	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3	121	0.00	0	C	NM_020760		197080599	197080599	-1	no_errors	ENST00000260983	ensembl	human	known	69_37n	missense	83	29.06	34	SNP	0.980	A
HTR2A	3356	genome.wustl.edu	37	13	47466593	47466593	+	Missense_Mutation	SNP	T	T	C	rs372673346		TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr13:47466593T>C	ENST00000378688.4	-	2	676	c.545A>G	c.(544-546)cAc>cGc	p.H182R	HTR2A_ENST00000542664.1_Missense_Mutation_p.H182R|HTR2A_ENST00000543956.1_Missense_Mutation_p.H98R			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	182					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GCGGCTGTGGTGGATGGGATT	0.507																																						dbGAP											0													262.0	258.0	259.0					13																	47466593		2203	4300	6503	-	-	-	SO:0001583	missense	0			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.545A>G	13.37:g.47466593T>C	ENSP00000367959:p.His182Arg		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT2A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	p.H182R	ENST00000378688.4	37	c.545	CCDS9405.1	13	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447210	0.43429	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.34275	1.37;1.37;1.37	6.16	6.16	0.99307	GPCR, rhodopsin-like superfamily (1);	0.104643	0.64402	D	0.000004	T	0.15435	0.0372	N	0.02202	-0.64	0.58432	D	0.999999	B;B	0.12013	0.004;0.005	B;B	0.15870	0.012;0.014	T	0.17592	-1.0364	10	0.02654	T	1	.	15.9872	0.80168	0.0:0.0:0.0:1.0	.	98;182	F5GWE8;P28223	.;5HT2A_HUMAN	R	182;98;182	ENSP00000367959:H182R;ENSP00000441861:H98R;ENSP00000437737:H182R	ENSP00000367959:H182R	H	-	2	0	HTR2A	46364594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.033000	0.88852	2.367000	0.80283	0.528000	0.53228	CAC	HTR2A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000102468		0.507	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2A	HGNC	protein_coding	OTTHUMT00000044835.3	313	0.31	1	T	NM_000621		47466593	47466593	-1	no_errors	ENST00000378688	ensembl	human	known	69_37n	missense	217	47.88	203	SNP	1.000	C
KDM2B	84678	genome.wustl.edu	37	12	121878692	121878692	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr12:121878692delA	ENST00000377071.4	-	21	3609	c.3537delT	c.(3535-3537)gatfs	p.D1179fs	KDM2B_ENST00000377069.4_Frame_Shift_Del_p.D1110fs|KDM2B_ENST00000536437.1_Intron|KDM2B_ENST00000542973.1_Frame_Shift_Del_p.D547fs	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1179					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CCCACTGGACATCCAGGGTCC	0.637																																						dbGAP											0													35.0	43.0	40.0					12																	121878692		2113	4241	6354	-	-	-	SO:0001589	frameshift_variant	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3537delT	12.37:g.121878692delA	ENSP00000366271:p.Asp1179fs		A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Frame_Shift_Del	DEL	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.D1179fs	ENST00000377071.4	37	c.3537	CCDS41850.1	12																																																																																			KDM2B	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000089094		0.637	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	21	0.00	0	A	NM_032590		121878692	121878692	-1	no_errors	ENST00000377071	ensembl	human	known	69_37n	frame_shift_del	21	26.67	8	DEL	1.000	-
LILRA2	11027	genome.wustl.edu	37	19	55086420	55086420	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr19:55086420C>T	ENST00000251377.3	+	5	708	c.575C>T	c.(574-576)tCg>tTg	p.S192L	LILRA2_ENST00000391738.3_Missense_Mutation_p.S192L|LILRA2_ENST00000251376.3_Missense_Mutation_p.S192L|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391737.1_Missense_Mutation_p.S180L|LILRB1_ENST00000396321.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	192	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.S192L(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CGCAGGTGGTCGTACAGGTGC	0.572																																						dbGAP											1	Substitution - Missense(1)	lung(1)											163.0	158.0	160.0					19																	55086420		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.575C>T	19.37:g.55086420C>T	ENSP00000251377:p.Ser192Leu		O75020	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.S192L	ENST00000251377.3	37	c.575	CCDS46179.1	19	.	.	.	.	.	.	.	.	.	.	C	11.20	1.569007	0.28003	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.03035	4.07;4.07;4.07;4.07;4.07	2.93	-0.438	0.12268	Immunoglobulin-like fold (1);	1.036410	0.07651	N	0.931932	T	0.05135	0.0137	M	0.76002	2.32	0.09310	N	1	B;B;B;B	0.31837	0.005;0.202;0.342;0.09	B;B;B;B	0.24006	0.005;0.032;0.05;0.03	T	0.38001	-0.9681	9	.	.	.	.	5.0494	0.14501	0.0:0.5603:0.0:0.4397	.	192;180;192;192	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	L	192;192;192;192;180	ENSP00000388131:S192L;ENSP00000251377:S192L;ENSP00000375618:S192L;ENSP00000251376:S192L;ENSP00000375617:S180L	.	S	+	2	0	LILRA2	59778232	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-2.629000	0.00872	0.121000	0.18284	0.508000	0.49915	TCG	LILRA2	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000239998		0.572	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRA2	HGNC	protein_coding	OTTHUMT00000140813.2	136	0.00	0	C			55086420	55086420	+1	no_errors	ENST00000251377	ensembl	human	known	69_37n	missense	37	53.75	43	SNP	0.000	T
MAMDC2	256691	genome.wustl.edu	37	9	72723399	72723399	+	Splice_Site	SNP	G	G	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr9:72723399G>T	ENST00000377182.4	+	3	1037		c.e3+1		MAMDC2-AS1_ENST00000414515.3_RNA|MAMDC2-AS1_ENST00000591368.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2						peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						GAAATTCAAGGTAGGTGGAGT	0.388																																						dbGAP											0													59.0	61.0	60.0					9																	72723399		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.420+1G>T	9.37:g.72723399G>T			Q5VW47|Q8WX43|Q96BM4	Splice_Site	SNP	-	e3+1	ENST00000377182.4	37	c.420+1	CCDS6631.1	9	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709377	0.68615	.	.	ENSG00000165072	ENST00000377182	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.136	0.98031	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAMDC2	71913219	1.000000	0.71417	0.992000	0.48379	0.718000	0.41266	8.758000	0.91663	2.756000	0.94617	0.655000	0.94253	.	MAMDC2	-	-	ENSG00000165072		0.388	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAMDC2	HGNC	protein_coding	OTTHUMT00000052600.1	150	0.00	0	G	NM_153267	Intron	72723399	72723399	+1	no_errors	ENST00000377182	ensembl	human	known	69_37n	splice_site	181	16.59	36	SNP	1.000	T
MMP16	4325	genome.wustl.edu	37	8	89086840	89086840	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr8:89086840G>T	ENST00000286614.6	-	7	1496	c.1215C>A	c.(1213-1215)ttC>ttA	p.F405L	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	405					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TACCTTTAAAGAACACAAAAT	0.393																																						dbGAP											0													98.0	98.0	98.0					8																	89086840		2203	4300	6503	-	-	-	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1215C>A	8.37:g.89086840G>T	ENSP00000286614:p.Phe405Leu		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.F405L	ENST00000286614.6	37	c.1215	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001599	0.74818	.	.	ENSG00000156103	ENST00000286614	T	0.06142	3.34	4.64	4.64	0.57946	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.16342	0.0393	L	0.47078	1.49	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.71656	0.971;0.974	T	0.00394	-1.1767	10	0.46703	T	0.11	.	11.416	0.49951	0.0834:0.0:0.9166:0.0	.	405;405	P51512-2;P51512	.;MMP16_HUMAN	L	405	ENSP00000286614:F405L	ENSP00000286614:F405L	F	-	3	2	MMP16	89155956	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.585000	0.46111	2.280000	0.76307	0.650000	0.86243	TTC	MMP16	-	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000156103		0.393	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	189	0.00	0	G	NM_005941		89086840	89086840	-1	no_errors	ENST00000286614	ensembl	human	known	69_37n	missense	279	20.74	73	SNP	1.000	T
MST1L	11223	genome.wustl.edu	37	1	17085995	17085996	+	RNA	INS	-	-	C	rs528252461	byFrequency	TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr1:17085995_17085996insC	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CCCAACGCCCGCCCCCCCGCCC	0.658													|||unknown(NO_COVERAGE)	266	0.053115	0.0492	0.0821	5008	,	,		18719	0.002		0.0408	False		,,,				2504	0.1033					dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17086002_17086002dupC			B7WPB1|Q13209	Frame_Shift_Ins	INS	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.A301fs	ENST00000455405.2	37	c.902_901		1																																																																																			MST1P9	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000186715		0.658	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	11	0.00	0	-	NM_001271733		17085995	17085996	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.980:0.979	C
MYH11	4629	genome.wustl.edu	37	16	15853452	15853452	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr16:15853452G>T	ENST00000300036.5	-	12	1491	c.1382C>A	c.(1381-1383)gCt>gAt	p.A461D	MYH11_ENST00000396324.3_Missense_Mutation_p.A468D|MYH11_ENST00000576790.2_Missense_Mutation_p.A461D|MYH11_ENST00000452625.2_Missense_Mutation_p.A468D	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	461	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTCAAATCCAGCTATATCCAG	0.517			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													150.0	140.0	144.0					16																	15853452		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1382C>A	16.37:g.15853452G>T	ENSP00000300036:p.Ala461Asp		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A468D	ENST00000300036.5	37	c.1403	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027784	0.93518	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	5.75	5.75	0.90469	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.91161	0.7216	H	0.99042	4.41	0.80722	D	1	D;D;D;D;D;D	0.65815	0.974;0.995;0.995;0.995;0.995;0.974	D;D;D;D;D;D	0.72625	0.978;0.978;0.978;0.978;0.978;0.978	D	0.94306	0.7541	10	0.87932	D	0	.	18.932	0.92570	0.0:0.0:1.0:0.0	.	468;461;461;468;461;468	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	D	461;461;468;468;468	ENSP00000300036:A461D;ENSP00000345136:A461D;ENSP00000379616:A468D;ENSP00000407821:A468D	ENSP00000300036:A461D	A	-	2	0	MYH11	15760953	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.706000	0.92434	0.561000	0.74099	GCT	MYH11	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000133392		0.517	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	261	0.00	0	G	NM_001040113		15853452	15853452	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	195	27.78	75	SNP	1.000	T
NSD1	64324	genome.wustl.edu	37	5	176721812	176721812	+	Silent	SNP	G	G	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr5:176721812G>A	ENST00000439151.2	+	23	7488	c.7443G>A	c.(7441-7443)gaG>gaA	p.E2481E	NSD1_ENST00000347982.4_Silent_p.E2212E|NSD1_ENST00000361032.4_Silent_p.E2378E|NSD1_ENST00000354179.4_Silent_p.E2212E	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2481					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AGGCTGATGAGAAGATGCCAG	0.517			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												dbGAP		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													101.0	97.0	98.0					5																	176721812		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7443G>A	5.37:g.176721812G>A			Q96PD8|Q96RN7	Silent	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.E2481	ENST00000439151.2	37	c.7443	CCDS4412.1	5																																																																																			NSD1	-	NULL	ENSG00000165671		0.517	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	66	0.00	0	G	NM_172349		176721812	176721812	+1	no_errors	ENST00000439151	ensembl	human	known	69_37n	silent	91	25.41	31	SNP	0.991	A
NUP160	23279	genome.wustl.edu	37	11	47861966	47861966	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr11:47861966C>A	ENST00000378460.2	-	3	535	c.489G>T	c.(487-489)agG>agT	p.R163S	NUP160_ENST00000530326.1_Missense_Mutation_p.R49S|NUP160_ENST00000526870.1_Missense_Mutation_p.R163S|NUP160_ENST00000532747.1_Intron|NUP160_ENST00000528071.1_Missense_Mutation_p.R49S	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	163					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						GTAAAAGTAACCTGTGCACTG	0.398																																						dbGAP											0													141.0	128.0	133.0					11																	47861966		2201	4298	6499	-	-	-	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.489G>T	11.37:g.47861966C>A	ENSP00000367721:p.Arg163Ser		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.R163S	ENST00000378460.2	37	c.489	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	C	15.33	2.801671	0.50315	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071;ENST00000526870	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	4.38	-0.91	0.10511	.	0.000000	0.85682	D	0.000000	T	0.59211	0.2177	M	0.72894	2.215	0.30630	N	0.757623	D;P	0.89917	1.0;0.855	D;P	0.91635	0.999;0.689	T	0.58092	-0.7697	10	0.66056	D	0.02	.	6.3403	0.21319	0.0:0.4242:0.1223:0.4535	.	163;163	Q12769-2;Q12769	.;NU160_HUMAN	S	163;49;49;163	ENSP00000367721:R163S;ENSP00000433590:R49S;ENSP00000432367:R49S;ENSP00000431495:R163S	ENSP00000367721:R163S	R	-	3	2	NUP160	47818542	0.000000	0.05858	0.182000	0.23118	0.980000	0.70556	-2.167000	0.01271	-0.096000	0.12329	-0.214000	0.12660	AGG	NUP160	-	pfam_Nucleoporin_Nup160	ENSG00000030066		0.398	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	519	0.00	0	C	NM_015231		47861966	47861966	-1	no_errors	ENST00000378460	ensembl	human	known	69_37n	missense	319	10.36	37	SNP	0.004	A
TENM1	10178	genome.wustl.edu	37	X	123615597	123615597	+	Silent	SNP	G	G	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chrX:123615597G>A	ENST00000371130.3	-	21	3976	c.3913C>T	c.(3913-3915)Ctg>Ttg	p.L1305L	TENM1_ENST00000461429.1_5'UTR|TENM1_ENST00000422452.2_Silent_p.L1312L	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1305					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGGCTATTCAGTGAAGCTTCC	0.388																																						dbGAP											0													67.0	54.0	58.0					X																	123615597		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3913C>T	X.37:g.123615597G>A			B2RTR5|Q5JZ17	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.L1312	ENST00000371130.3	37	c.3934	CCDS14609.1	X																																																																																			ODZ1	-	NULL	ENSG00000009694		0.388	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	177	0.00	0	G	NM_014253		123615597	123615597	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	silent	173	22.42	50	SNP	0.972	A
OR2L5	81466	genome.wustl.edu	37	1	248185375	248185375	+	Silent	SNP	A	A	G			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr1:248185375A>G	ENST00000355281.1	+	1	126	c.126A>G	c.(124-126)ctA>ctG	p.L42L	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										TTGGAAACCTATCCATGATTC	0.413																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.126A>G	1.37:g.248185375A>G			Q6IF04	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L42	ENST00000355281.1	37	c.126	CCDS58068.1	1																																																																																			OR2L5	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000197454		0.413	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L5	HGNC	protein_coding	OTTHUMT00000096851.1	706	0.00	0	A			248185375	248185375	+1	no_errors	ENST00000355281	ensembl	human	known	69_37n	silent	849	17.07	175	SNP	0.000	G
OR4C16	219428	genome.wustl.edu	37	11	55340113	55340113	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr11:55340113T>A	ENST00000314634.3	+	1	510	c.510T>A	c.(508-510)aaT>aaA	p.N170K		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				GTGGCCCCAATGTGATCAATC	0.483																																						dbGAP											0													122.0	114.0	117.0					11																	55340113		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.510T>A	11.37:g.55340113T>A	ENSP00000324913:p.Asn170Lys		Q6IEV8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N170K	ENST00000314634.3	37	c.510	CCDS31502.1	11	.	.	.	.	.	.	.	.	.	.	T	17.76	3.469483	0.63625	.	.	ENSG00000181935	ENST00000314634	T	0.00216	8.53	4.98	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.083154	0.52532	D	0.000072	T	0.00524	0.0017	M	0.85041	2.73	0.29518	N	0.853709	D	0.62365	0.991	D	0.68039	0.955	T	0.14309	-1.0477	10	0.72032	D	0.01	.	8.5864	0.33660	0.0:0.0914:0.0:0.9086	.	170	Q8NGL9	OR4CG_HUMAN	K	170	ENSP00000324913:N170K	ENSP00000324913:N170K	N	+	3	2	OR4C16	55096689	0.000000	0.05858	0.977000	0.42913	0.770000	0.43624	-0.126000	0.10563	0.934000	0.37316	0.448000	0.29417	AAT	OR4C16	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181935		0.483	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	210	0.00	0	T	NM_001004701		55340113	55340113	+1	no_errors	ENST00000314634	ensembl	human	known	69_37n	missense	210	17.00	43	SNP	0.998	A
OSBPL7	114881	genome.wustl.edu	37	17	45895952	45895952	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr17:45895952C>T	ENST00000007414.3	-	6	591	c.400G>A	c.(400-402)Gtg>Atg	p.V134M	OSBPL7_ENST00000392507.3_Missense_Mutation_p.V134M	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	134	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						AGCTGCGCCACCCAGCTCTGG	0.612																																						dbGAP											0													27.0	30.0	29.0					17																	45895952		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.400G>A	17.37:g.45895952C>T	ENSP00000007414:p.Val134Met		D3DTT6|Q6PIV6	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V134M	ENST00000007414.3	37	c.400	CCDS11515.1	17	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882335	0.51908	.	.	ENSG00000006025	ENST00000007414;ENST00000392507	T;T	0.24350	1.86;1.86	5.97	4.98	0.66077	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.194622	0.43110	D	0.000607	T	0.43809	0.1264	M	0.81614	2.55	0.50171	D	0.999857	P	0.51537	0.946	P	0.51487	0.671	T	0.49652	-0.8917	10	0.56958	D	0.05	-23.4392	14.2893	0.66265	0.0:0.851:0.149:0.0	.	134	Q9BZF2	OSBL7_HUMAN	M	134	ENSP00000007414:V134M;ENSP00000376295:V134M	ENSP00000007414:V134M	V	-	1	0	OSBPL7	43250951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.264000	0.65513	1.497000	0.48584	0.655000	0.94253	GTG	OSBPL7	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000006025		0.612	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL7	HGNC	protein_coding	OTTHUMT00000441367.1	21	0.00	0	C	NM_017731		45895952	45895952	-1	no_errors	ENST00000007414	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	T
PCDHA4	56144	genome.wustl.edu	37	5	140187582	140187582	+	Silent	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr5:140187582C>T	ENST00000530339.1	+	1	810	c.810C>T	c.(808-810)gaC>gaT	p.D270D	PCDHA4_ENST00000356878.4_Silent_p.D270D|PCDHA4_ENST00000512229.2_Silent_p.D270D|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	270	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGATTTAGACGAAGGATTGA	0.343																																						dbGAP											0													61.0	65.0	64.0					5																	140187582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.810C>T	5.37:g.140187582C>T			O75285|Q2M253	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D270	ENST00000530339.1	37	c.810	CCDS54916.1	5																																																																																			PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000204967		0.343	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	93	0.00	0	C	NM_018907		140187582	140187582	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	silent	130	20.00	33	SNP	0.989	T
PKLR	5313	genome.wustl.edu	37	1	155265012	155265012	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr1:155265012C>T	ENST00000342741.4	-	5	627	c.589G>A	c.(589-591)Gcg>Acg	p.A197T	PKLR_ENST00000392414.3_Missense_Mutation_p.A166T	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	197					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	ACGGTGTTCGCGTTCCCCCGC	0.642																																						dbGAP											0													77.0	85.0	82.0					1																	155265012		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.589G>A	1.37:g.155265012C>T	ENSP00000339933:p.Ala197Thr		O75758|P11973	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.A197T	ENST00000342741.4	37	c.589	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795275	0.50208	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99353	-5.77;-5.77	4.2	1.16	0.20824	Pyruvate/Phosphoenolpyruvate kinase (1);Pyruvate kinase, beta-barrel insert domain (1);Pyruvate kinase-like, insert domain (1);Pyruvate kinase, barrel (1);	0.486670	0.22266	N	0.062333	D	0.93074	0.7795	N	0.25201	0.72	0.35562	D	0.804735	B;B	0.19200	0.034;0.034	B;B	0.19666	0.026;0.026	D	0.86952	0.2086	10	0.28530	T	0.3	-15.366	4.0912	0.09970	0.164:0.5846:0.1589:0.0925	.	197;188	P30613;B1AVT1	KPYR_HUMAN;.	T	222;166;197;111	ENSP00000376214:A166T;ENSP00000339933:A197T	ENSP00000271946:A111T	A	-	1	0	PKLR	153531636	0.931000	0.31567	0.205000	0.23548	0.960000	0.62799	1.829000	0.39121	0.138000	0.18790	0.460000	0.39030	GCG	PKLR	-	pfam_Pyrv_Knase_brl,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase-like_insert_dom,tigrfam_Pyr_Knase	ENSG00000143627		0.642	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	79	0.00	0	C	NM_000298		155265012	155265012	-1	no_errors	ENST00000342741	ensembl	human	known	69_37n	missense	117	20.67	31	SNP	0.995	T
PKP2	5318	genome.wustl.edu	37	12	32955486	32955486	+	Missense_Mutation	SNP	G	G	A	rs144018320	byFrequency	TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr12:32955486G>A	ENST00000070846.6	-	11	2174	c.2150C>T	c.(2149-2151)cCg>cTg	p.P717L	PKP2_ENST00000340811.4_Missense_Mutation_p.P673L	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	717					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CACTGATGTCGGCATCTGTTT	0.423													G|||	3	0.000599042	0.0	0.0	5008	,	,		18579	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													110.0	100.0	104.0					12																	32955486		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.2150C>T	12.37:g.32955486G>A	ENSP00000070846:p.Pro717Leu		A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.P717L	ENST00000070846.6	37	c.2150	CCDS8731.1	12	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	25.5	4.644184	0.87859	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	T;T	0.43688	0.94;0.94	4.75	4.75	0.60458	Armadillo-like helical (1);Armadillo-type fold (1);	0.260438	0.38778	N	0.001574	T	0.55000	0.1893	M	0.65975	2.015	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.69479	0.964;0.921;0.961	T	0.65001	-0.6274	10	0.72032	D	0.01	-4.4199	17.7253	0.88363	0.0:0.0:1.0:0.0	.	673;673;717	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	L	673;717;717	ENSP00000342800:P673L;ENSP00000070846:P717L	ENSP00000070846:P717L	P	-	2	0	PKP2	32846753	1.000000	0.71417	0.937000	0.37676	0.914000	0.54420	6.453000	0.73488	2.339000	0.79563	0.643000	0.83706	CCG	PKP2	-	superfamily_ARM-type_fold	ENSG00000057294		0.423	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	HGNC	protein_coding	OTTHUMT00000404449.1	192	0.00	0	G	NM_004572		32955486	32955486	-1	no_errors	ENST00000070846	ensembl	human	known	69_37n	missense	136	29.17	56	SNP	0.993	A
PPIP5K2	23262	genome.wustl.edu	37	5	102502945	102502945	+	Silent	SNP	G	G	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr5:102502945G>A	ENST00000358359.3	+	18	2492	c.1983G>A	c.(1981-1983)aaG>aaA	p.K661K	PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Silent_p.K661K|PPIP5K2_ENST00000414217.1_Silent_p.K661K	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	661					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						ACCCTGTGAAGACCTGTGATA	0.303																																						dbGAP											0													79.0	87.0	84.0					5																	102502945		2202	4289	6491	-	-	-	SO:0001819	synonymous_variant	0			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.1983G>A	5.37:g.102502945G>A			A1NI53|A6NGS8|Q8TB50	Silent	SNP	pfam_His_Pase_superF_clade-2	p.K661	ENST00000358359.3	37	c.1983		5																																																																																			PPIP5K2	-	pfam_His_Pase_superF_clade-2	ENSG00000145725		0.303	PPIP5K2-003	KNOWN	basic	protein_coding	PPIP5K2	HGNC	protein_coding	OTTHUMT00000370487.1	157	0.00	0	G	NM_015216		102502945	102502945	+1	no_errors	ENST00000358359	ensembl	human	known	69_37n	silent	111	31.06	50	SNP	1.000	A
PTHLH	5744	genome.wustl.edu	37	12	28114898	28114898	+	Intron	DEL	T	T	-	rs377014358		TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr12:28114898delT	ENST00000545234.1	-	5	1065				PTHLH_ENST00000538310.1_Frame_Shift_Del_p.K186fs|RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000354417.3_Frame_Shift_Del_p.K186fs|PTHLH_ENST00000395872.1_Intron|PTHLH_ENST00000539239.1_Intron			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					GTTGTTTTCCTTTTTTTTTTT	0.333																																						dbGAP											0													16.0	16.0	16.0					12																	28114898		875	1991	2866	-	-	-	SO:0001627	intron_variant	0				CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382A>-	12.37:g.28114898delT			Q15251|Q6FH74	Frame_Shift_Del	DEL	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.K186fs	ENST00000545234.1	37	c.557	CCDS44853.1	12																																																																																			PTHLH	-	NULL	ENSG00000087494		0.333	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	HGNC	protein_coding	OTTHUMT00000402913.1	14	0.00	0	T	NM_198965		28114898	28114898	-1	no_errors	ENST00000354417	ensembl	human	known	69_37n	frame_shift_del	29	12.12	4	DEL	0.135	-
RBM8A	9939	genome.wustl.edu	37	1	145507682	145507682	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr1:145507682G>A	ENST00000330165.8	+	1	85	c.16G>A	c.(16-18)Gat>Aat	p.D6N	RP11-315I20.1_ENST00000600340.1_RNA|GNRHR2_ENST00000312753.5_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000447686.2_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000596355.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RBM8A_ENST00000369307.3_Missense_Mutation_p.D6N|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA	NM_005105.3	NP_005096.1	Q9Y5S9	RBM8A_HUMAN	RNA binding motif protein 8A	6					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGACGTGCTAGATCTTCACGA	0.602											OREG0013748	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													45.0	34.0	37.0					1																	145507682		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF127761	CCDS72872.1	1q21.1	2013-02-12			ENSG00000131795			"""RNA binding motif (RRM) containing"""	9905	protein-coding gene	gene with protein product		605313		RBM8		11004516, 11013075	Standard	NM_005105		Approved	ZNRP, BOV-1A, BOV-1B, BOV-1C, RBM8B, Y14	uc001ent.2	Q9Y5S9	OTTHUMG00000013736	ENST00000330165.8:c.16G>A	1.37:g.145507682G>A	ENSP00000333001:p.Asp6Asn	1695	B3KQI9|Q6FHD1|Q6IQ40|Q9GZX8|Q9NZI4	Missense_Mutation	SNP	pfam_RRM_dom,pfam_RRM_3,smart_RRM_dom,pfscan_RRM_dom,prints_RNA-bd_8	p.D6N	ENST00000330165.8	37	c.16	CCDS916.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.770317	0.96914	.	.	ENSG00000131795	ENST00000330165;ENST00000369307	T;T	0.20200	2.12;2.09	4.83	4.83	0.62350	.	0.054850	0.64402	D	0.000001	T	0.44561	0.1299	M	0.86651	2.83	0.58432	D	0.999998	D;D	0.76494	0.999;0.996	D;P	0.72982	0.979;0.859	T	0.49570	-0.8926	10	0.62326	D	0.03	-5.0478	15.7957	0.78409	0.0:0.0:1.0:0.0	.	6;6	Q9Y5S9-2;Q9Y5S9	.;RBM8A_HUMAN	N	6	ENSP00000333001:D6N;ENSP00000358313:D6N	ENSP00000333001:D6N	D	+	1	0	RBM8A	144219039	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.867000	0.87062	2.682000	0.91365	0.650000	0.86243	GAT	RBM8A	-	NULL	ENSG00000131795		0.602	RBM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM8A	HGNC	protein_coding	OTTHUMT00000038503.2	17	0.00	0	G	NM_005105		145507682	145507682	+1	no_errors	ENST00000330165	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	A
REG1A	5967	genome.wustl.edu	37	2	79349250	79349250	+	Splice_Site	SNP	A	A	C			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr2:79349250A>C	ENST00000233735.1	+	4	423	c.320A>C	c.(319-321)aAg>aCg	p.K107T		NM_002909.4	NP_002900.2	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha	107	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(26)|prostate(1)|upper_aerodigestive_tract(1)	39						GACCCCAAAAAGGTAGGCTGC	0.483																																						dbGAP											0													97.0	88.0	91.0					2																	79349250		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS1964.1	2p12	2008-09-04	2008-06-04		ENSG00000115386	ENSG00000115386			9951	protein-coding gene	gene with protein product	"""pancreatic stone protein"", ""pancreatic thread protein"""	167770	"""regenerating islet-derived 1 alpha (pancreatic stone protein, pancreatic thread protein)"""	REG		2332435, 8333731	Standard	NM_002909		Approved	PSP, PTP, PSPS, PSPS1	uc002snz.3	P05451	OTTHUMG00000130016	ENST00000233735.1:c.321+1A>C	2.37:g.79349250A>C			P11379|Q4ZG28	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Pancreatis_ac,prints_AntifreezeII	p.K107T	ENST00000233735.1	37	c.320	CCDS1964.1	2	.	.	.	.	.	.	.	.	.	.	a	13.59	2.283909	0.40394	.	.	ENSG00000115386	ENST00000233735	T	0.19394	2.15	3.51	2.26	0.28386	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.662503	0.12429	N	0.469731	T	0.14399	0.0348	L	0.37697	1.125	0.27759	N	0.943885	B	0.02656	0.0	B	0.06405	0.002	T	0.27640	-1.0068	10	0.24483	T	0.36	.	5.8789	0.18844	0.8706:0.0:0.1294:0.0	.	107	P05451	REG1A_HUMAN	T	107	ENSP00000233735:K107T	ENSP00000233735:K107T	K	+	2	0	REG1A	79202758	0.039000	0.19947	0.862000	0.33874	0.809000	0.45718	0.430000	0.21428	0.479000	0.27511	0.460000	0.39030	AAG	REG1A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000115386		0.483	REG1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REG1A	HGNC	protein_coding	OTTHUMT00000252289.1	129	0.00	0	A	NM_002909	Missense_Mutation	79349250	79349250	+1	no_errors	ENST00000233735	ensembl	human	known	69_37n	missense	43	40.28	29	SNP	0.953	C
RICTOR	253260	genome.wustl.edu	37	5	39002728	39002728	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr5:39002728C>T	ENST00000357387.3	-	5	331	c.301G>A	c.(301-303)Gca>Aca	p.A101T	RICTOR_ENST00000296782.5_Missense_Mutation_p.A101T	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					AGCCCTGCTGCTCGCACTTCT	0.373																																						dbGAP											0													117.0	124.0	122.0					5																	39002728		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.301G>A	5.37:g.39002728C>T	ENSP00000349959:p.Ala101Thr			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A101T	ENST00000357387.3	37	c.301	CCDS34148.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.687455	0.96784	.	.	ENSG00000164327	ENST00000357387;ENST00000296782;ENST00000514735	T;T;T	0.65364	-0.15;-0.15;-0.15	5.6	5.6	0.85130	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77909	0.4201	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.71674	0.998;0.996;0.982;0.996	D;D;P;D	0.81914	0.995;0.987;0.885;0.993	T	0.78523	-0.2171	10	0.87932	D	0	-17.1554	19.9773	0.97314	0.0:1.0:0.0:0.0	.	101;101;101;101	Q8N6M7;E7ETT0;Q6R327;Q6R327-3	.;.;RICTR_HUMAN;.	T	101;101;85	ENSP00000349959:A101T;ENSP00000296782:A101T;ENSP00000423162:A85T	ENSP00000296782:A101T	A	-	1	0	RICTOR	39038485	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.362000	0.79507	2.797000	0.96272	0.650000	0.86243	GCA	RICTOR	-	superfamily_ARM-type_fold	ENSG00000164327		0.373	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	326	0.00	0	C	NM_152756		39002728	39002728	-1	no_errors	ENST00000296782	ensembl	human	known	69_37n	missense	581	14.43	98	SNP	1.000	T
RRP1	8568	genome.wustl.edu	37	21	45213278	45213278	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr21:45213278T>G	ENST00000497547.1	+	4	470	c.353T>G	c.(352-354)tTc>tGc	p.F118C		NM_003683.5	NP_003674.1	P05386	RLA1_HUMAN	ribosomal RNA processing 1	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|lung(4)|stomach(2)	8				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		CTGGATAAATTCTACATGGTG	0.632																																						dbGAP											0													55.0	58.0	57.0					21																	45213278		1934	4126	6060	-	-	-	SO:0001583	missense	0			U79775	CCDS42951.1	21q22.3	2013-07-02	2013-07-02		ENSG00000160214	ENSG00000160214			18785	protein-coding gene	gene with protein product	"""DNA segment on chromosome 21 (unique) 2056 expressed sequence"", ""Nnp1 homolog, nucleolar protein (Drosophila)"""	610653	"""ribosomal RNA processing 1 homolog (S. cerevisiae)"""			10830953, 10341208	Standard	NM_003683		Approved	NNP-1, Nop52, NOP52, RRP1A, D21S2056E	uc002zds.2	P56182	OTTHUMG00000086884	ENST00000497547.1:c.353T>G	21.37:g.45213278T>G	ENSP00000417464:p.Phe118Cys		A6NIB2	Missense_Mutation	SNP	pfam_Nop52	p.F118C	ENST00000497547.1	37	c.353	CCDS42951.1	21	.	.	.	.	.	.	.	.	.	.	T	16.62	3.174055	0.57692	.	.	ENSG00000160214	ENST00000497547;ENST00000400387	T	0.56103	0.48	4.38	1.54	0.23209	.	0.150441	0.64402	D	0.000010	T	0.72977	0.3528	M	0.93016	3.37	0.58432	D	0.999996	D;D	0.76494	0.999;0.994	D;P	0.66716	0.946;0.905	T	0.72653	-0.4228	10	0.87932	D	0	.	7.9145	0.29810	0.4037:0.0:0.0:0.5963	.	118;118	B4DZM3;P56182	.;RRP1_HUMAN	C	118	ENSP00000417464:F118C	ENSP00000383237:F118C	F	+	2	0	RRP1	44037706	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	1.071000	0.30666	0.064000	0.16427	0.418000	0.28097	TTC	RRP1	-	pfam_Nop52	ENSG00000160214		0.632	RRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP1	HGNC	protein_coding	OTTHUMT00000195680.1	18	0.00	0	T	NM_003683		45213278	45213278	+1	no_errors	ENST00000497547	ensembl	human	known	69_37n	missense	8	50.00	8	SNP	1.000	G
SAGE1	55511	genome.wustl.edu	37	X	134990730	134990730	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chrX:134990730T>G	ENST00000370709.3	+	11	1395	c.1395T>G	c.(1393-1395)atT>atG	p.I465M	SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000535938.1_Missense_Mutation_p.I465M|SAGE1_ENST00000324447.3_Missense_Mutation_p.I465M			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	465						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					CCGGGCTTATTAATATGGCAG	0.413																																						dbGAP											0													150.0	147.0	148.0					X																	134990730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.1395T>G	X.37:g.134990730T>G	ENSP00000359743:p.Ile465Met		Q5JNW0	Missense_Mutation	SNP	NULL	p.I465M	ENST00000370709.3	37	c.1395	CCDS14652.1	X	.	.	.	.	.	.	.	.	.	.	T	10.44	1.351059	0.24512	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.32988	1.43;1.43;1.43	0.843	-0.296	0.12824	.	0.170495	0.37955	U	0.001873	T	0.28764	0.0713	N	0.24115	0.695	0.09310	N	1	D	0.64830	0.994	P	0.62560	0.904	T	0.17018	-1.0383	9	0.29301	T	0.29	.	.	.	.	.	465	Q9NXZ1	SAGE1_HUMAN	M	465	ENSP00000323191:I465M;ENSP00000445959:I465M;ENSP00000359743:I465M	ENSP00000323191:I465M	I	+	3	3	SAGE1	134818396	0.752000	0.28338	0.005000	0.12908	0.025000	0.11179	0.325000	0.19628	-0.176000	0.10707	0.222000	0.17777	ATT	SAGE1	-	NULL	ENSG00000181433		0.413	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	264	0.00	0	T	NM_018666		134990730	134990730	+1	no_errors	ENST00000324447	ensembl	human	known	69_37n	missense	212	22.74	63	SNP	0.005	G
SERPINI1	5274	genome.wustl.edu	37	3	167510446	167510446	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr3:167510446G>T	ENST00000295777.5	+	4	981	c.550G>T	c.(550-552)Gtc>Ttc	p.V184F	SERPINI1_ENST00000446050.2_Missense_Mutation_p.V184F	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	184					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						CATTAATGCTGTCTATTTCAA	0.368																																						dbGAP											0													102.0	102.0	102.0					3																	167510446		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.550G>T	3.37:g.167510446G>T	ENSP00000295777:p.Val184Phe		A8K217|D3DNP1|Q6AHZ4	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.V184F	ENST00000295777.5	37	c.550	CCDS3203.1	3	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101380	0.56183	.	.	ENSG00000163536	ENST00000446050;ENST00000295777;ENST00000472747	D;D;D	0.86164	-2.08;-2.08;-2.08	5.68	1.87	0.25490	Serpin domain (3);	0.345168	0.34362	N	0.004040	D	0.89543	0.6745	M	0.87269	2.87	0.80722	D	1	D	0.61080	0.989	P	0.53593	0.73	D	0.86522	0.1816	10	0.87932	D	0	.	3.7795	0.08674	0.4311:0.1819:0.3869:0.0	.	184	Q99574	NEUS_HUMAN	F	184	ENSP00000397373:V184F;ENSP00000295777:V184F;ENSP00000420561:V184F	ENSP00000295777:V184F	V	+	1	0	SERPINI1	168993140	1.000000	0.71417	0.999000	0.59377	0.715000	0.41141	1.185000	0.32065	0.328000	0.23435	-0.499000	0.04595	GTC	SERPINI1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000163536		0.368	SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINI1	HGNC	protein_coding	OTTHUMT00000351056.1	120	0.00	0	G			167510446	167510446	+1	no_errors	ENST00000295777	ensembl	human	known	69_37n	missense	150	15.73	28	SNP	0.998	T
SF3B1	23451	genome.wustl.edu	37	2	198266542	198266542	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr2:198266542T>C	ENST00000335508.6	-	16	2385	c.2294A>G	c.(2293-2295)tAt>tGt	p.Y765C	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	765					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTCTCTAGTATAGTAGTTGGC	0.323			Mis		myelodysplastic syndrome																																	dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	0													85.0	91.0	89.0					2																	198266542		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2294A>G	2.37:g.198266542T>C	ENSP00000335321:p.Tyr765Cys		E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.Y765C	ENST00000335508.6	37	c.2294	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	21.6	4.173236	0.78452	.	.	ENSG00000115524	ENST00000335508	T	0.66460	-0.21	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87665	0.6234	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.91572	0.5272	10	0.87932	D	0	.	15.9781	0.80086	0.0:0.0:0.0:1.0	.	765	O75533	SF3B1_HUMAN	C	765	ENSP00000335321:Y765C	ENSP00000335321:Y765C	Y	-	2	0	SF3B1	197974787	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	7.980000	0.88113	2.171000	0.68590	0.533000	0.62120	TAT	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.323	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	211	0.00	0	T			198266542	198266542	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	219	24.74	72	SNP	1.000	C
SLC38A9	153129	genome.wustl.edu	37	5	54931405	54931405	+	Silent	SNP	A	A	G			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr5:54931405A>G	ENST00000396865.2	-	13	1839	c.1248T>C	c.(1246-1248)ccT>ccC	p.P416P	SLC38A9_ENST00000512595.1_Silent_p.P353P|SLC38A9_ENST00000318672.3_Silent_p.P416P|SLC38A9_ENST00000515629.1_Silent_p.P353P|SLC38A9_ENST00000539768.1_Silent_p.P416P|SLC38A9_ENST00000416547.2_Silent_p.P292P	NM_173514.3	NP_775785.2	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9	416					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				ATGGTGGTGAAGGAAATGAAG	0.398																																						dbGAP											0													105.0	97.0	100.0					5																	54931405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3968.1, CCDS58947.1, CCDS58948.1, CCDS75243.1	5q11.2	2013-05-22			ENSG00000177058	ENSG00000177058		"""Solute carriers"""	26907	protein-coding gene	gene with protein product							Standard	NM_173514		Approved	FLJ90709	uc003jqf.3	Q8NBW4	OTTHUMG00000131189	ENST00000396865.2:c.1248T>C	5.37:g.54931405A>G			B3KXV1|B7Z7D0|Q0P5S0|Q6MZJ8	Silent	SNP	pfam_AA_transpt_TM	p.P416	ENST00000396865.2	37	c.1248	CCDS3968.1	5																																																																																			SLC38A9	-	pfam_AA_transpt_TM	ENSG00000177058		0.398	SLC38A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC38A9	HGNC	protein_coding	OTTHUMT00000253912.2	72	0.00	0	A	NM_173514		54931405	54931405	-1	no_errors	ENST00000318672	ensembl	human	known	69_37n	silent	43	14.00	7	SNP	0.901	G
SLC4A1AP	22950	genome.wustl.edu	37	2	27910885	27910885	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr2:27910885C>A	ENST00000326019.6	+	11	2483	c.2201C>A	c.(2200-2202)tCa>tAa	p.S734*		NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	734						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					GCAGGACCCTCAGGCAAGTAG	0.473																																						dbGAP											0													69.0	62.0	64.0					2																	27910885		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.2201C>A	2.37:g.27910885C>A	ENSP00000323837:p.Ser734*		A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Nonsense_Mutation	SNP	pfam_FHA_dom,pfam_Ds-RNA-bd,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S734*	ENST00000326019.6	37	c.2201	CCDS33166.1	2	.	.	.	.	.	.	.	.	.	.	C	39	7.893640	0.98548	.	.	ENSG00000163798	ENST00000326019	.	.	.	5.22	5.22	0.72569	.	0.553731	0.19603	N	0.110357	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.5117	14.4799	0.67573	0.0:1.0:0.0:0.0	.	.	.	.	X	734	.	ENSP00000323837:S734X	S	+	2	0	SLC4A1AP	27764389	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	3.229000	0.51278	2.866000	0.98385	0.650000	0.86243	TCA	SLC4A1AP	-	NULL	ENSG00000163798		0.473	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1AP	HGNC	protein_coding	OTTHUMT00000324550.1	107	0.00	0	C	NM_018158		27910885	27910885	+1	no_errors	ENST00000326019	ensembl	human	known	69_37n	nonsense	87	17.14	18	SNP	1.000	A
SLC9A7	84679	genome.wustl.edu	37	X	46491044	46491044	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chrX:46491044C>T	ENST00000328306.4	-	14	1739	c.1714G>A	c.(1714-1716)Gac>Aac	p.D572N	SLC9A7_ENST00000464933.1_5'UTR	NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	572					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						TGAAAGCTGTCGTTGTTGGGT	0.488																																					Pancreas(118;454 1696 1930 13865 39976)	dbGAP											0													126.0	100.0	109.0					X																	46491044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.1714G>A	X.37:g.46491044C>T	ENSP00000330320:p.Asp572Asn		O75827|Q5JXP9	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.D572N	ENST00000328306.4	37	c.1714	CCDS14269.1	X	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020466	0.54576	.	.	ENSG00000065923	ENST00000328306	T	0.55234	0.53	6.08	6.08	0.98989	.	0.058058	0.64402	D	0.000002	T	0.37293	0.0998	L	0.34521	1.04	0.54753	D	0.999985	P	0.41643	0.758	B	0.29077	0.098	T	0.27054	-1.0085	10	0.31617	T	0.26	.	14.7421	0.69464	0.0:1.0:0.0:0.0	.	572	Q96T83	SL9A7_HUMAN	N	572	ENSP00000330320:D572N	ENSP00000330320:D572N	D	-	1	0	SLC9A7	46375988	0.998000	0.40836	0.998000	0.56505	0.978000	0.69477	4.821000	0.62679	2.562000	0.86427	0.600000	0.82982	GAC	SLC9A7	-	NULL	ENSG00000065923		0.488	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A7	HGNC	protein_coding	OTTHUMT00000056370.1	68	0.00	0	C	NM_032591		46491044	46491044	-1	no_errors	ENST00000328306	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	1.000	T
TBC1D5	9779	genome.wustl.edu	37	3	17415993	17415993	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr3:17415993C>T	ENST00000253692.7	-	12	2456	c.792G>A	c.(790-792)tgG>tgA	p.W264*	TBC1D5_ENST00000429383.4_Nonsense_Mutation_p.W264*|TBC1D5_ENST00000446818.2_Nonsense_Mutation_p.W264*|TBC1D5_ENST00000414318.2_Intron|TBC1D5_ENST00000429924.2_Nonsense_Mutation_p.W216*	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	264	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						AAGTTGAAAACCAAGGTTCAG	0.299																																						dbGAP											0													66.0	66.0	66.0					3																	17415993		2202	4296	6498	-	-	-	SO:0001587	stop_gained	0			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.792G>A	3.37:g.17415993C>T	ENSP00000253692:p.Trp264*		A6NP25|C9JP52	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.W264*	ENST00000253692.7	37	c.792	CCDS33714.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.260140	0.98171	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.9065	19.6391	0.95749	0.0:1.0:0.0:0.0	.	.	.	.	X	264;264;264;216	.	ENSP00000253692:W264X	W	-	3	0	TBC1D5	17390997	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.344000	0.79328	2.715000	0.92844	0.655000	0.94253	TGG	TBC1D5	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000131374		0.299	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D5	HGNC	protein_coding	OTTHUMT00000340301.3	56	0.00	0	C	NM_014744		17415993	17415993	-1	no_errors	ENST00000253692	ensembl	human	known	69_37n	nonsense	87	17.14	18	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	T	rs121912656|rs397516437		TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr17:7577547C>T	ENST00000269305.4	-	7	923	c.734G>A	c.(733-735)gGc>gAc	p.G245D	TP53_ENST00000420246.2_Missense_Mutation_p.G245D|TP53_ENST00000445888.2_Missense_Mutation_p.G245D|TP53_ENST00000455263.2_Missense_Mutation_p.G245D|TP53_ENST00000413465.2_Missense_Mutation_p.G245D|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	GRCh37	CM010464|CM900209	TP53	M	rs121912656						151.0	113.0	126.0					17																	7577547		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>A	17.37:g.7577547C>T	ENSP00000269305:p.Gly245Asp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G245D	ENST00000269305.4	37	c.734	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838149	0.91117	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	A	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0;1.0	D	0.96045	0.9027	9	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245D;ENSP00000352610:G245D;ENSP00000269305:G245D;ENSP00000398846:G245D;ENSP00000391127:G245D;ENSP00000391478:G245D;ENSP00000425104:G113D;ENSP00000423862:G152D	ENSP00000269305:G245D	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	67	0.00	0	C	NM_000546		7577547	7577547	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	T
TPPP	11076	genome.wustl.edu	37	5	677867	677867	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr5:677867G>C	ENST00000360578.5	-	2	430	c.309C>G	c.(307-309)atC>atG	p.I103M	CTD-2589H19.6_ENST00000607068.1_RNA	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	103	Mediates interaction with LIMK1.				microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.I103M(1)		kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		GCACTCACTTGATCTTGCTGA	0.632																																						dbGAP											1	Substitution - Missense(1)	lung(1)											120.0	87.0	98.0					5																	677867		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.309C>G	5.37:g.677867G>C	ENSP00000353785:p.Ile103Met			Missense_Mutation	SNP	pfam_P25-alpha	p.I103M	ENST00000360578.5	37	c.309	CCDS3856.1	5	.	.	.	.	.	.	.	.	.	.	g	16.70	3.196039	0.58126	.	.	ENSG00000171368	ENST00000360578	T	0.51325	0.71	5.32	5.32	0.75619	EF-hand-like domain (1);	0.061378	0.64402	D	0.000003	T	0.53802	0.1819	L	0.43152	1.355	0.52099	D	0.999946	P	0.52316	0.952	P	0.54815	0.761	T	0.55848	-0.8076	10	0.66056	D	0.02	-22.5826	13.5508	0.61730	0.0:0.0:0.844:0.156	.	103	O94811	TPPP_HUMAN	M	103	ENSP00000353785:I103M	ENSP00000353785:I103M	I	-	3	3	TPPP	730867	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.925000	0.56484	2.485000	0.83878	0.561000	0.74099	ATC	TPPP	-	pfam_P25-alpha	ENSG00000171368		0.632	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPPP	HGNC	protein_coding	OTTHUMT00000253645.3	8	0.00	0	G	NM_007030		677867	677867	-1	no_errors	ENST00000360578	ensembl	human	known	69_37n	missense	1	80.00	4	SNP	1.000	C
TRAPPC10	7109	genome.wustl.edu	37	21	45513998	45513998	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr21:45513998G>A	ENST00000291574.4	+	20	3227	c.3052G>A	c.(3052-3054)Gag>Aag	p.E1018K	TRAPPC10_ENST00000483973.1_3'UTR	NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1018					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						GTGGACAGAAGAGCCTCCCCC	0.502																																						dbGAP											0													154.0	139.0	144.0					21																	45513998		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.3052G>A	21.37:g.45513998G>A	ENSP00000291574:p.Glu1018Lys		Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	NULL	p.E1018K	ENST00000291574.4	37	c.3052	CCDS13704.1	21	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587471	0.28268	.	.	ENSG00000160218	ENST00000291574;ENST00000542855	T	0.22743	1.94	5.11	5.11	0.69529	.	0.312268	0.34268	N	0.004106	T	0.19644	0.0472	L	0.34521	1.04	0.37772	D	0.926703	P;P;B	0.43578	0.811;0.695;0.222	B;B;B	0.41135	0.348;0.173;0.082	T	0.05937	-1.0855	10	0.19147	T	0.46	.	18.911	0.92485	0.0:0.0:1.0:0.0	.	123;277;1018	B4DV34;B4DI17;P48553	.;.;TPC10_HUMAN	K	1018;149	ENSP00000291574:E1018K	ENSP00000291574:E1018K	E	+	1	0	TRAPPC10	44338426	1.000000	0.71417	0.949000	0.38748	0.327000	0.28475	5.020000	0.64066	2.529000	0.85273	0.655000	0.94253	GAG	TRAPPC10	-	NULL	ENSG00000160218		0.502	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TRAPPC10	HGNC	protein_coding	OTTHUMT00000195737.1	94	0.00	0	G	NM_003274		45513998	45513998	+1	no_errors	ENST00000291574	ensembl	human	known	69_37n	missense	61	15.28	11	SNP	0.992	A
TSPAN8	7103	genome.wustl.edu	37	12	71519153	71519153	+	Silent	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr12:71519153C>T	ENST00000393330.2	-	12	1227	c.675G>A	c.(673-675)gtG>gtA	p.V225V	TSPAN8_ENST00000247829.3_Silent_p.V225V|TSPAN8_ENST00000546561.1_Silent_p.V225V|TSPAN8_ENST00000552128.1_Silent_p.V142V			P19075	TSN8_HUMAN	tetraspanin 8	225					negative regulation of blood coagulation (GO:0030195)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(7)|skin(3)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)			CCATAGAAAACACCAAACCCA	0.358																																						dbGAP											0													121.0	113.0	116.0					12																	71519153		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M35252	CCDS8999.1	12q14.1-q21.1	2013-02-14	2005-03-21	2005-03-21		ENSG00000127324		"""Tetraspanins"""	11855	protein-coding gene	gene with protein product		600769	"""transmembrane 4 superfamily member 3"""	TM4SF3		2395876	Standard	NM_004616		Approved	CO-029	uc001swj.1	P19075		ENST00000393330.2:c.675G>A	12.37:g.71519153C>T			B2R7T7|Q9BS78	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V225	ENST00000393330.2	37	c.675	CCDS8999.1	12																																																																																			TSPAN8	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000127324		0.358	TSPAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN8	HGNC	protein_coding	OTTHUMT00000404737.1	164	0.00	0	C	NM_004616		71519153	71519153	-1	no_errors	ENST00000247829	ensembl	human	known	69_37n	silent	276	13.75	44	SNP	0.998	T
UBD	10537	genome.wustl.edu	37	6	29523762	29523762	+	Silent	SNP	A	A	G			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr6:29523762A>G	ENST00000377050.4	-	2	616	c.393T>C	c.(391-393)atT>atC	p.I131I	GABBR1_ENST00000355973.3_3'UTR	NM_006398.3	NP_006389.2	O15205	UBD_HUMAN	ubiquitin D	131	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				aggresome assembly (GO:0070842)|myeloid dendritic cell differentiation (GO:0043011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein modification by small protein conjugation (GO:0032446)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to organonitrogen compound (GO:0010243)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	proteasome binding (GO:0070628)			kidney(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						TGCAAGTCACAATCTGGGTCT	0.488																																						dbGAP											0													176.0	145.0	156.0					6																	29523762		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			Y12653	CCDS4662.1	6p21.3	2008-04-11			ENSG00000213886	ENSG00000213886			18795	protein-coding gene	gene with protein product		606050				9368598, 8662070	Standard	NM_006398		Approved	FAT10	uc003nmo.3	O15205	OTTHUMG00000031289	ENST00000377050.4:c.393T>C	6.37:g.29523762A>G			B0UZT6|Q5STL2|Q5SUK2|Q96EC7	Silent	SNP	pfam_Ubiquitin,smart_Ubiquitin,prints_Ubiquitin_subgr,pfscan_Ubiquitin_supergroup	p.I131	ENST00000377050.4	37	c.393	CCDS4662.1	6																																																																																			UBD	-	pfam_Ubiquitin,smart_Ubiquitin,prints_Ubiquitin_subgr,pfscan_Ubiquitin_supergroup	ENSG00000213886		0.488	UBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBD	HGNC	protein_coding	OTTHUMT00000076628.3	238	0.00	0	A			29523762	29523762	-1	no_errors	ENST00000377050	ensembl	human	known	69_37n	silent	253	16.50	50	SNP	0.182	G
ZFHX4	79776	genome.wustl.edu	37	8	77767190	77767190	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr8:77767190C>T	ENST00000521891.2	+	10	8481	c.8033C>T	c.(8032-8034)cCg>cTg	p.P2678L	ZFHX4_ENST00000050961.6_Missense_Mutation_p.P2633L|ZFHX4_ENST00000455469.2_Missense_Mutation_p.P2633L|ZFHX4_ENST00000518282.1_Missense_Mutation_p.P2652L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2633					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.P2662Q(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAACGGTGTCCGTTTTGCCGA	0.542										HNSCC(33;0.089)																												dbGAP											1	Substitution - Missense(1)	lung(1)											57.0	58.0	58.0					8																	77767190		1944	4142	6086	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8033C>T	8.37:g.77767190C>T	ENSP00000430497:p.Pro2678Leu		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.P2678L	ENST00000521891.2	37	c.8033	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	13.16	2.153851	0.38021	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	4.99	4.99	0.66335	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.44285	U	0.000473	T	0.53384	0.1793	L	0.59436	1.845	0.80722	D	1	D;D;D	0.76494	0.999;0.989;0.999	D;D;D	0.77004	0.989;0.972;0.972	T	0.53322	-0.8455	10	0.56958	D	0.05	.	18.4467	0.90686	0.0:1.0:0.0:0.0	.	2633;2633;2678	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	L	2678;2662;2633;2633;2652	ENSP00000430497:P2678L;ENSP00000399605:P2633L;ENSP00000050961:P2633L;ENSP00000430848:P2652L	ENSP00000050961:P2633L	P	+	2	0	ZFHX4	77929745	1.000000	0.71417	0.895000	0.35142	0.233000	0.25261	7.651000	0.83577	2.591000	0.87537	0.455000	0.32223	CCG	ZFHX4	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000091656		0.542	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	70	0.00	0	C	NM_024721		77767190	77767190	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	78	17.89	17	SNP	1.000	T
ZNF280C	55609	genome.wustl.edu	37	X	129349834	129349834	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chrX:129349834T>C	ENST00000370978.4	-	14	1922	c.1769A>G	c.(1768-1770)aAa>aGa	p.K590R		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	590					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						GTAAGAGGGTTTTGCTTTGGA	0.373																																						dbGAP											0													303.0	271.0	281.0					X																	129349834		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.1769A>G	X.37:g.129349834T>C	ENSP00000360017:p.Lys590Arg		A8K2V8|Q9NXR3	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.K590R	ENST00000370978.4	37	c.1769	CCDS14622.1	X	.	.	.	.	.	.	.	.	.	.	T	17.45	3.392349	0.62066	.	.	ENSG00000056277	ENST00000066465;ENST00000370978;ENST00000447817	T;T	0.05925	4.21;3.37	4.57	3.38	0.38709	.	.	.	.	.	T	0.13713	0.0332	M	0.70275	2.135	0.09310	N	1	D;P	0.55605	0.972;0.955	P;P	0.57468	0.754;0.821	T	0.16808	-1.0390	9	0.18710	T	0.47	.	4.0729	0.09891	0.0:0.1087:0.21:0.6813	.	541;590	Q9UJJ2;Q8ND82	.;Z280C_HUMAN	R	541;590;541	ENSP00000360017:K590R;ENSP00000408521:K541R	ENSP00000066465:K541R	K	-	2	0	ZNF280C	129177515	0.726000	0.28059	0.023000	0.16930	0.307000	0.27823	1.715000	0.37971	0.586000	0.29626	0.350000	0.21858	AAA	ZNF280C	-	NULL	ENSG00000056277		0.373	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280C	HGNC	protein_coding	OTTHUMT00000058251.1	696	0.00	0	T	NM_017666		129349834	129349834	-1	no_errors	ENST00000370978	ensembl	human	known	69_37n	missense	378	47.43	341	SNP	0.069	C
ZNF425	155054	genome.wustl.edu	37	7	148802088	148802088	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr7:148802088delT	ENST00000378061.2	-	4	1007	c.875delA	c.(874-876)cacfs	p.H292fs		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	292					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TAGACACAGGTGCTTCTTCAG	0.667																																						dbGAP											0													56.0	52.0	53.0					7																	148802088		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.875delA	7.37:g.148802088delT	ENSP00000367300:p.His292fs		B3KPM1|Q08AG3	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.H292fs	ENST00000378061.2	37	c.875	CCDS34773.1	7																																																																																			ZNF425	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204947		0.667	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1	33	0.00	0	T	XM_088140		148802088	148802088	-1	no_errors	ENST00000378061	ensembl	human	known	69_37n	frame_shift_del	50	32.91	26	DEL	0.997	-
ZNF467	168544	genome.wustl.edu	37	7	149467612	149467613	+	Frame_Shift_Ins	INS	-	-	G	rs371781113		TCGA-BH-A0HY-01A-11W-A071-09	TCGA-BH-A0HY-10A-02W-A071-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a63c2000-9e41-4897-8b01-4723c382096e	79cfdba0-e06f-488c-bd73-fbb1a87fb0b3	g.chr7:149467612_149467613insG	ENST00000302017.3	-	3	480_481	c.67_68insC	c.(67-69)caafs	p.Q23fs	ZNF467_ENST00000484747.1_Frame_Shift_Ins_p.Q23fs	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	23					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGGCTCACTTTGGGGGGCCATC	0.554																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.68dupC	7.37:g.149467618_149467618dupG	ENSP00000304769:p.Gln23fs			Frame_Shift_Ins	INS	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q23fs	ENST00000302017.3	37	c.68_67	CCDS5899.1	7																																																																																			ZNF467	-	NULL	ENSG00000181444		0.554	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	HGNC	protein_coding	OTTHUMT00000349833.1	11	0.00	0	-	NM_207336		149467612	149467613	-1	no_errors	ENST00000302017	ensembl	human	known	69_37n	frame_shift_ins	11	15.38	2	INS	1.000:1.000	G
