#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ASB13	79754	genome.wustl.edu	37	10	5680896	5680896	+	3'UTR	SNP	A	A	G	rs1573	byFrequency	TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr10:5680896A>G	ENST00000357700.6	-	0	2633				ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		TAAGTGCTCTACTGTGAGACA	0.453													A|||	1420	0.283546	0.3147	0.1801	5008	,	,		21235	0.4375		0.1839	False		,,,				2504	0.2587					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.*1770T>C	10.37:g.5680896A>G			A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	RNA	SNP	-	NULL	ENST00000357700.6	37	NULL	CCDS7070.1	10																																																																																			ASB13	-	-	ENSG00000196372		0.453	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB13	HGNC	protein_coding	OTTHUMT00000046564.1	12	0.00	0	A			5680896	5680896	-1	no_errors	ENST00000479033	ensembl	human	known	69_37n	rna	3	66.67	6	SNP	0.000	G
ASB13	79754	genome.wustl.edu	37	10	5680914	5680914	+	3'UTR	SNP	T	T	A	rs2386648	byFrequency	TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr10:5680914T>A	ENST00000357700.6	-	0	2615				ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		ACATCACAGGTTGTCATTGCT	0.453													A|||	1418	0.283147	0.3139	0.1801	5008	,	,		20950	0.4365		0.1839	False		,,,				2504	0.2587					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.*1752A>T	10.37:g.5680914T>A			A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	RNA	SNP	-	NULL	ENST00000357700.6	37	NULL	CCDS7070.1	10																																																																																			ASB13	-	-	ENSG00000196372		0.453	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB13	HGNC	protein_coding	OTTHUMT00000046564.1	9	0.00	0	T			5680914	5680914	-1	no_errors	ENST00000479033	ensembl	human	known	69_37n	rna	2	71.43	5	SNP	0.000	A
BACH2	60468	genome.wustl.edu	37	6	90642501	90642501	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr6:90642501G>T	ENST00000257749.4	-	9	2859	c.2152C>A	c.(2152-2154)Cag>Aag	p.Q718K	BACH2_ENST00000537989.1_Missense_Mutation_p.Q718K|BACH2_ENST00000343122.3_Missense_Mutation_p.Q718K	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	718						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.Q718*(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		TCGGGGCTCTGGATGTCTCGG	0.557																																						dbGAP											2	Substitution - Nonsense(2)	lung(2)											61.0	65.0	63.0					6																	90642501		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.2152C>A	6.37:g.90642501G>T	ENSP00000257749:p.Gln718Lys		E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_bZIP_1,pfam_bZIP_2,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.Q718K	ENST00000257749.4	37	c.2152	CCDS5026.1	6	.	.	.	.	.	.	.	.	.	.	G	14.46	2.541920	0.45280	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.38560	1.13;1.13;1.13	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.30166	0.0756	L	0.56769	1.78	0.58432	D	0.99999	P	0.39665	0.682	B	0.35182	0.197	T	0.17319	-1.0373	10	0.41790	T	0.15	-22.3301	19.1166	0.93343	0.0:0.0:1.0:0.0	.	718	Q9BYV9	BACH2_HUMAN	K	718	ENSP00000257749:Q718K;ENSP00000437473:Q718K;ENSP00000345642:Q718K	ENSP00000257749:Q718K	Q	-	1	0	BACH2	90699222	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	9.743000	0.98849	2.579000	0.87056	0.561000	0.74099	CAG	BACH2	-	NULL	ENSG00000112182		0.557	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	HGNC	protein_coding	OTTHUMT00000041522.2	55	0.00	0	G	NM_021813		90642501	90642501	-1	no_errors	ENST00000257749	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
BOLA1	51027	genome.wustl.edu	37	1	149871795	149871795	+	Silent	SNP	G	G	T			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr1:149871795G>T	ENST00000369153.2	+	3	847	c.183G>T	c.(181-183)ccG>ccT	p.P61P	BOLA1_ENST00000369150.1_Silent_p.P61P|BOLA1_ENST00000369152.5_Silent_p.P61P|BOLA1_ENST00000476344.1_3'UTR			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	61						extracellular region (GO:0005576)|mitochondrion (GO:0005739)		p.P61P(2)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			ACGCGGTCCCGCCTGGCAGTG	0.677																																						dbGAP											2	Substitution - coding silent(2)	lung(1)|kidney(1)											36.0	35.0	35.0					1																	149871795		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.183G>T	1.37:g.149871795G>T			B2R7K2|D3DUZ4|Q5QNY0	Silent	SNP	pfam_BolA,superfamily_BolA	p.P61	ENST00000369153.2	37	c.183	CCDS939.1	1																																																																																			BOLA1	-	pfam_BolA,superfamily_BolA	ENSG00000178096		0.677	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BOLA1	HGNC	protein_coding	OTTHUMT00000033443.2	114	0.00	0	G	NM_016074		149871795	149871795	+1	no_errors	ENST00000369150	ensembl	human	known	69_37n	silent	60	28.57	24	SNP	0.479	T
C11orf86	254439	genome.wustl.edu	37	11	66742867	66742867	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr11:66742867G>A	ENST00000308963.4	+	1	120	c.34G>A	c.(34-36)Gag>Aag	p.E12K		NM_001136485.1	NP_001129957.1	A6NJI1	CK086_HUMAN	chromosome 11 open reading frame 86	12										NS(1)|skin(1)	2						GTCCTTGCGAGAGCCCCGACC	0.667																																						dbGAP											0													13.0	18.0	16.0					11																	66742867		690	1590	2280	-	-	-	SO:0001583	missense	0			AK026328, AP003176	CCDS44656.1	11q13.1	2012-08-10			ENSG00000173237	ENSG00000173237			34442	protein-coding gene	gene with protein product							Standard	NM_001136485		Approved	FLJ22675	uc010rpm.2	A6NJI1	OTTHUMG00000153671	ENST00000308963.4:c.34G>A	11.37:g.66742867G>A	ENSP00000311479:p.Glu12Lys			Missense_Mutation	SNP	NULL	p.E12K	ENST00000308963.4	37	c.34	CCDS44656.1	11	.	.	.	.	.	.	.	.	.	.	.	1.555	-0.538292	0.04082	.	.	ENSG00000173237	ENST00000308963	.	.	.	4.82	1.78	0.24846	.	0.498138	0.18213	N	0.148137	T	0.17152	0.0412	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.15838	-1.0423	9	0.29301	T	0.29	-4.7444	3.5506	0.07844	0.0941:0.1678:0.5647:0.1734	.	12	A6NJI1	CK086_HUMAN	K	12	.	ENSP00000311479:E12K	E	+	1	0	C11orf86	66499443	0.555000	0.26530	0.007000	0.13788	0.768000	0.43524	1.344000	0.33941	0.163000	0.19507	0.298000	0.19748	GAG	C11orf86	-	NULL	ENSG00000173237		0.667	C11orf86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf86	HGNC	protein_coding	OTTHUMT00000332022.2	39	0.00	0	G	NM_001136485		66742867	66742867	+1	no_errors	ENST00000308963	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.004	A
CLINT1	9685	genome.wustl.edu	37	5	157230702	157230702	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr5:157230702G>A	ENST00000411809.2	-	8	1172	c.968C>T	c.(967-969)tCt>tTt	p.S323F	CLINT1_ENST00000296951.5_Missense_Mutation_p.S305F|CLINT1_ENST00000523908.1_Missense_Mutation_p.S323F|CLINT1_ENST00000523094.1_Missense_Mutation_p.S305F|CLINT1_ENST00000530742.1_Missense_Mutation_p.S305F	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	323					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAGGTCACCAGATGACTTGCT	0.398																																					Colon(22;427 587 2170 6147 14291)	dbGAP											0													45.0	47.0	47.0					5																	157230702		1867	4107	5974	-	-	-	SO:0001583	missense	0			AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.968C>T	5.37:g.157230702G>A	ENSP00000388340:p.Ser323Phe		B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.S305F	ENST00000411809.2	37	c.914	CCDS47330.1	5	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810646	0.70797	.	.	ENSG00000113282	ENST00000523094;ENST00000530742;ENST00000411809;ENST00000296951;ENST00000523908	T;T;T;T;T	0.50548	0.75;0.75;0.74;0.75;0.76	5.65	5.65	0.86999	.	0.273247	0.41605	D	0.000858	T	0.66944	0.2841	L	0.59436	1.845	0.48511	D	0.999669	D;D	0.76494	0.999;0.998	D;D	0.70487	0.969;0.953	T	0.66716	-0.5853	10	0.59425	D	0.04	-14.6409	19.7904	0.96454	0.0:0.0:1.0:0.0	.	323;323	B7Z6F8;Q14677	.;EPN4_HUMAN	F	305;305;323;305;323	ENSP00000429345:S305F;ENSP00000433419:S305F;ENSP00000388340:S323F;ENSP00000296951:S305F;ENSP00000429824:S323F	ENSP00000296951:S305F	S	-	2	0	CLINT1	157163280	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.587000	0.74071	2.691000	0.91804	0.650000	0.86243	TCT	CLINT1	-	NULL	ENSG00000113282		0.398	CLINT1-001	KNOWN	basic|CCDS	protein_coding	CLINT1	HGNC	protein_coding	OTTHUMT00000374001.1	38	0.00	0	G	NM_014666		157230702	157230702	-1	no_errors	ENST00000296951	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	A
EFR3B	22979	genome.wustl.edu	37	2	25354712	25354712	+	Missense_Mutation	SNP	G	G	T	rs200151921		TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr2:25354712G>T	ENST00000403714.3	+	10	1262	c.1079G>T	c.(1078-1080)aGc>aTc	p.S360I	EFR3B_ENST00000402191.1_Missense_Mutation_p.S325I|EFR3B_ENST00000405108.1_Missense_Mutation_p.S212I|EFR3B_ENST00000401432.3_Missense_Mutation_p.S360I	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	360										endometrium(1)	1						GGGGCGGTCAGCCTCGGCACC	0.682																																						dbGAP											0													26.0	31.0	30.0					2																	25354712		692	1591	2283	-	-	-	SO:0001583	missense	0			AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.1079G>T	2.37:g.25354712G>T	ENSP00000384081:p.Ser360Ile		B7WPL8|Q86XU6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S360I	ENST00000403714.3	37	c.1079	CCDS46231.1	2	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826470	0.50739	.	.	ENSG00000084710	ENST00000401432;ENST00000403714;ENST00000402191;ENST00000545169;ENST00000405108;ENST00000264719	T;T;T;T;T	0.67698	1.43;1.43;-0.28;3.47;1.44	4.13	3.2	0.36748	Armadillo-type fold (1);	0.115789	0.64402	D	0.000009	T	0.50086	0.1595	L	0.32530	0.975	0.37953	D	0.932706	B;B	0.22414	0.028;0.069	B;B	0.21151	0.033;0.033	T	0.52975	-0.8503	10	0.39692	T	0.17	-20.5454	6.8116	0.23807	0.0986:0.1799:0.7215:0.0	.	360;360	Q9Y2G0;Q9Y2G0-3	EFR3B_HUMAN;.	I	360;360;325;325;212;239	ENSP00000386082:S360I;ENSP00000384081:S360I;ENSP00000385832:S325I;ENSP00000384454:S212I;ENSP00000264719:S239I	ENSP00000264719:S239I	S	+	2	0	EFR3B	25208216	1.000000	0.71417	0.988000	0.46212	0.836000	0.47400	1.825000	0.39081	2.143000	0.66587	0.655000	0.94253	AGC	EFR3B	-	superfamily_ARM-type_fold	ENSG00000084710		0.682	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFR3B	HGNC	protein_coding	OTTHUMT00000324808.1	41	0.00	0	G	NM_014971		25354712	25354712	+1	no_errors	ENST00000403714	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.999	T
FAM138B	654412	genome.wustl.edu	37	2	114336326	114336326	+	lincRNA	SNP	T	T	C			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr2:114336326T>C	ENST00000432583.2	+	0	1129									family with sequence similarity 138, member B																		agattagtgatggcagaacca	0.493																																						dbGAP											0																																										-	-	-			0					2q13	2013-01-30			ENSG00000226516	ENSG00000226516		"""Long non-coding RNAs"""	33582	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026821		Approved	F379	uc002tjz.3		OTTHUMG00000047820		2.37:g.114336326T>C				RNA	SNP	-	NULL	ENST00000432583.2	37	NULL		2																																																																																			FAM138B	-	-	ENSG00000226516		0.493	FAM138B-002	KNOWN	basic	lincRNA	FAM138B	HGNC	lincRNA	OTTHUMT00000109027.3	12	0.00	0	T	NR_026821		114336326	114336326	+1	no_errors	ENST00000432583	ensembl	human	known	69_37n	rna	16	27.27	6	SNP	0.001	C
DOCK10	55619	genome.wustl.edu	37	2	225811581	225811581	+	Intron	SNP	T	T	A	rs13021295	byFrequency	TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr2:225811581T>A	ENST00000258390.7	-	2	191				DOCK10_ENST00000409592.3_Missense_Mutation_p.I30F|DOCK10_ENST00000474102.1_5'UTR	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10						regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AATCTGTGGATTTCTTCTTGG	0.373													T|||	1246	0.248802	0.1112	0.2522	5008	,	,		16987	0.3244		0.2674	False		,,,				2504	0.3354					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.124-15196A>T	2.37:g.225811581T>A			B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.I30F	ENST00000258390.7	37	c.88	CCDS46528.1	2	537	0.24587912087912087	63	0.12804878048780488	99	0.27348066298342544	165	0.28846153846153844	210	0.2770448548812665	T	14.25	2.478080	0.44044	.	.	ENSG00000135905	ENST00000409592	T	0.20463	2.07	5.91	3.43	0.39272	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999218	B	0.20052	0.041	B	0.21360	0.034	T	0.44952	-0.9294	7	0.15499	T	0.54	.	7.143	0.25566	0.0:0.0763:0.1462:0.7776	rs13021295;rs13021295	30	B3FL70	.	F	30	ENSP00000386694:I30F	ENSP00000386694:I30F	I	-	1	0	DOCK10	225519825	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.601000	0.36773	1.056000	0.40484	-0.290000	0.09829	ATC	DOCK10	-	NULL	ENSG00000135905		0.373	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	52	0.00	0	T			225811581	225811581	-1	no_errors	ENST00000409592	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	A
FAM155A	728215	genome.wustl.edu	37	13	108518687	108518689	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr13:108518687_108518689delCTG	ENST00000375915.2	-	1	394_396	c.256_258delCAG	c.(256-258)cagdel	p.Q86del		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	86	Poly-Gln.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						gccgctgcctctgctgctgctgc	0.719																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.256_258delCAG	13.37:g.108518696_108518698delCTG	ENSP00000365080:p.Gln86del		B2RUV1|B7Z334	In_Frame_Del	DEL	NULL	p.Q86in_frame_del	ENST00000375915.2	37	c.258_256	CCDS32006.1	13																																																																																			FAM155A	-	NULL	ENSG00000204442		0.719	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	41	0.00	0	CTG	NM_001080396		108518687	108518689	-1	no_errors	ENST00000375915	ensembl	human	known	69_37n	in_frame_del	18	14.29	3	DEL	1.000:0.992:0.987	-
GREB1L	80000	genome.wustl.edu	37	18	18975382	18975382	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr18:18975382C>T	ENST00000580732.2	+	5	773	c.392C>T	c.(391-393)tCa>tTa	p.S131L	RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000400483.4_Missense_Mutation_p.S131L|GREB1L_ENST00000424526.1_Missense_Mutation_p.S131L|GREB1L_ENST00000431264.1_Missense_Mutation_p.S131L|GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000269218.6_Missense_Mutation_p.S131L			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	131						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						CGTTTGGTATCACTGTGTATG	0.418																																						dbGAP											0													115.0	101.0	105.0					18																	18975382		692	1591	2283	-	-	-	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.392C>T	18.37:g.18975382C>T	ENSP00000464162:p.Ser131Leu		A4QN17|Q9H8F1	Missense_Mutation	SNP	NULL	p.S131L	ENST00000580732.2	37	c.392	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379274	0.82682	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.20069	2.87;2.79;2.1;2.1	4.99	4.99	0.66335	.	.	.	.	.	T	0.31231	0.0790	M	0.72118	2.19	0.51482	D	0.999928	P;P	0.42296	0.775;0.573	B;B	0.41412	0.356;0.272	T	0.22556	-1.0213	9	0.87932	D	0	.	18.4659	0.90755	0.0:1.0:0.0:0.0	.	131;131	Q9C091;Q9C091-2	GRB1L_HUMAN;.	L	131	ENSP00000412060:S131L;ENSP00000269218:S131L;ENSP00000383331:S131L;ENSP00000393125:S131L	ENSP00000269218:S131L	S	+	2	0	GREB1L	17229380	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.651000	0.83577	2.590000	0.87494	0.563000	0.77884	TCA	GREB1L	-	NULL	ENSG00000141449		0.418	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	49	0.00	0	C	NM_024935		18975382	18975382	+1	no_errors	ENST00000424526	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	1.000	T
HIST1H3B	8358	genome.wustl.edu	37	6	26031895	26031895	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr6:26031895G>A	ENST00000244661.2	-	1	393	c.394C>T	c.(394-396)Cgc>Tgc	p.R132C		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	132					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						CTTTCTCCGCGAATGCGGCGA	0.478																																						dbGAP											0													62.0	65.0	64.0					6																	26031895		2203	4300	6503	-	-	-	SO:0001583	missense	0			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.394C>T	6.37:g.26031895G>A	ENSP00000244661:p.Arg132Cys		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R132C	ENST00000244661.2	37	c.394	CCDS4573.1	6	.	.	.	.	.	.	.	.	.	.	g	15.69	2.908868	0.52439	.	.	ENSG00000124693	ENST00000244661	T	0.70164	-0.46	5.17	5.17	0.71159	.	.	.	.	.	T	0.74465	0.3720	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.75668	-0.3238	6	0.52906	T	0.07	.	18.0207	0.89253	0.0:0.0:1.0:0.0	.	.	.	.	C	132	ENSP00000244661:R132C	ENSP00000244661:R132C	R	-	1	0	HIST1H3B	26139874	1.000000	0.71417	1.000000	0.80357	0.222000	0.24845	9.444000	0.97578	2.545000	0.85829	0.561000	0.74099	CGC	HIST1H3B	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000124693		0.478	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3B	HGNC	protein_coding	OTTHUMT00000040077.1	63	0.00	0	G	NM_003537		26031895	26031895	-1	no_errors	ENST00000244661	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	1.000	A
PPA1	5464	genome.wustl.edu	37	10	71978549	71978549	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr10:71978549C>A	ENST00000373232.3	-	3	247	c.148G>T	c.(148-150)Gta>Tta	p.V50L	PPA1_ENST00000495346.1_5'UTR|PPA1_ENST00000608321.1_Missense_Mutation_p.V50L	NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	50					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						CAGCGTGGTACTTCAACTACC	0.393																																						dbGAP											0													97.0	83.0	88.0					10																	71978549		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.148G>T	10.37:g.71978549C>A	ENSP00000362329:p.Val50Leu		Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	p.V50L	ENST00000373232.3	37	c.148	CCDS7299.1	10	.	.	.	.	.	.	.	.	.	.	C	31	5.068531	0.93950	.	.	ENSG00000180817	ENST00000373232;ENST00000373230	T;T	0.47177	0.85;0.85	6.06	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.72653	0.3487	H	0.95043	3.615	0.80722	D	1	P	0.44281	0.831	P	0.53360	0.724	T	0.81002	-0.1130	10	0.87932	D	0	-27.3679	14.0604	0.64797	0.0:0.9276:0.0:0.0724	.	50	Q15181	IPYR_HUMAN	L	50	ENSP00000362329:V50L;ENSP00000362327:V50L	ENSP00000362327:V50L	V	-	1	0	PPA1	71648555	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	4.727000	0.61993	1.584000	0.49913	0.655000	0.94253	GTA	PPA1	-	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	ENSG00000180817		0.393	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPA1	HGNC	protein_coding	OTTHUMT00000048490.2	25	0.00	0	C	NM_021129		71978549	71978549	-1	no_errors	ENST00000373232	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	1.000	A
TAS1R1	80835	genome.wustl.edu	37	1	6637090	6637090	+	Silent	SNP	G	G	A			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr1:6637090G>A	ENST00000333172.6	+	5	1747	c.1554G>A	c.(1552-1554)gaG>gaA	p.E518E	TAS1R1_ENST00000351136.3_Silent_p.E264E|TAS1R1_ENST00000328191.4_Intron	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	518					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GCTGCTTTGAGTGTGTGCCCT	0.607																																						dbGAP											0													137.0	126.0	130.0					1																	6637090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.1554G>A	1.37:g.6637090G>A			B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Missense_Mutation	SNP	pfam_GPCR_3_9-Cys_dom,pfam_ANF_lig-bd_rcpt,prints_GPCR_3	p.S190N	ENST00000333172.6	37	c.569	CCDS81.1	1	.	.	.	.	.	.	.	.	.	.	G	8.187	0.795031	0.16327	.	.	ENSG00000173662	ENST00000415267	.	.	.	4.67	2.46	0.29980	.	.	.	.	.	T	0.48502	0.1503	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42224	-0.9464	4	.	.	.	.	5.3493	0.16026	0.1244:0.3451:0.5304:0.0	.	.	.	.	N	190	.	.	S	+	2	0	TAS1R1	6559677	0.450000	0.25697	0.948000	0.38648	0.869000	0.49853	0.747000	0.26290	2.116000	0.64780	0.491000	0.48974	AGT	TAS1R1	-	pfam_GPCR_3_9-Cys_dom	ENSG00000173662		0.607	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R1	HGNC	protein_coding	OTTHUMT00000004211.1	98	0.00	0	G			6637090	6637090	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000415267	ensembl	human	putative	69_37n	missense	62	10.14	7	SNP	0.994	A
RGSL1	353299	genome.wustl.edu	37	1	182520289	182520289	+	Silent	SNP	C	C	T			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr1:182520289C>T	ENST00000294854.8	+	18	3008	c.2988C>T	c.(2986-2988)ttC>ttT	p.F996F	RGSL1_ENST00000542961.1_3'UTR	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	996					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						GGAAGAAGTTCAAGGACAGAA	0.502																																					Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)	dbGAP											0													70.0	67.0	68.0					1																	182520289		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.2988C>T	1.37:g.182520289C>T			A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Silent	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam	p.F996	ENST00000294854.8	37	c.2988	CCDS58049.1	1																																																																																			RGSL1	-	NULL	ENSG00000121446		0.502	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	RGSL1	HGNC	protein_coding	OTTHUMT00000320710.3	44	0.00	0	C	NM_181572		182520289	182520289	+1	no_errors	ENST00000294854	ensembl	human	known	69_37n	silent	26	18.18	6	SNP	0.017	T
UBR2	23304	genome.wustl.edu	37	6	42644577	42644577	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A42U-01A-12D-A243-09	TCGA-BH-A42U-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	6af9d417-48dc-412f-9d58-370d9f313cd6	89a8b467-4e8c-4ec4-b357-c90f425c712a	g.chr6:42644577G>T	ENST00000372899.1	+	40	4702	c.4444G>T	c.(4444-4446)Gct>Tct	p.A1482S	UBR2_ENST00000372883.3_3'UTR|UBR2_ENST00000372901.1_Missense_Mutation_p.A1482S	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	1482					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AGCAGTTCTTGCTTTGTATAA	0.358																																						dbGAP											0													135.0	123.0	127.0					6																	42644577		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.4444G>T	6.37:g.42644577G>T	ENSP00000361990:p.Ala1482Ser		O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.A1482S	ENST00000372899.1	37	c.4444	CCDS4870.1	6	.	.	.	.	.	.	.	.	.	.	G	4.032	0.003446	0.07866	.	.	ENSG00000024048	ENST00000372899;ENST00000372901	T;T	0.54479	0.57;0.57	4.53	2.63	0.31362	.	0.564975	0.19792	N	0.105945	T	0.05823	0.0152	N	0.01576	-0.805	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.43212	-0.9405	10	0.02654	T	1	-10.321	4.6244	0.12470	0.1516:0.0:0.4994:0.349	.	1482;1482	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	S	1482	ENSP00000361990:A1482S;ENSP00000361992:A1482S	ENSP00000361990:A1482S	A	+	1	0	UBR2	42752555	0.995000	0.38212	1.000000	0.80357	0.991000	0.79684	0.527000	0.22987	0.961000	0.38030	0.650000	0.86243	GCT	UBR2	-	NULL	ENSG00000024048		0.358	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	HGNC	protein_coding	OTTHUMT00000040558.2	26	0.00	0	G	NM_015255		42644577	42644577	+1	no_errors	ENST00000372899	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.998	T
