#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTRT2	140625	genome.wustl.edu	37	1	2939179	2939179	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:2939179G>T	ENST00000378404.2	+	1	1134	c.929G>T	c.(928-930)gGg>gTg	p.G310V		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	310						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		CTGTTCCACGGGCTGGATGAC	0.587																																						dbGAP											0													51.0	58.0	56.0					1																	2939179		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717			24026	protein-coding gene	gene with protein product		608535				11750065, 12243744	Standard	NM_080431		Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.929G>T	1.37:g.2939179G>T	ENSP00000367658:p.Gly310Val		B1AN52|Q8NHS6|Q8TDG1	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.G310V	ENST00000378404.2	37	c.929	CCDS45.1	1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653054	0.47362	.	.	ENSG00000169717	ENST00000378404;ENST00000543312	T	0.17370	2.28	4.86	4.86	0.63082	.	0.000000	0.53938	D	0.000042	T	0.62417	0.2426	H	0.99117	4.435	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80659	-0.1284	10	0.87932	D	0	.	16.5657	0.84588	0.0:0.0:1.0:0.0	.	310	Q8TDY3	ACTT2_HUMAN	V	310	ENSP00000367658:G310V	ENSP00000367658:G310V	G	+	2	0	ACTRT2	2929039	1.000000	0.71417	0.743000	0.31040	0.013000	0.08279	9.671000	0.98627	2.248000	0.74166	0.561000	0.74099	GGG	ACTRT2	-	pfam_Actin-like,smart_Actin-like	ENSG00000169717		0.587	ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT2	HGNC	protein_coding	OTTHUMT00000001331.1	36	0.00	0	G	NM_080431		2939179	2939179	+1	no_errors	ENST00000378404	ensembl	human	known	69_37n	missense	27	30.00	12	SNP	1.000	T
ADAMTS14	140766	genome.wustl.edu	37	10	72468454	72468454	+	Silent	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr10:72468454C>T	ENST00000373207.1	+	4	790	c.790C>T	c.(790-792)Ctg>Ttg	p.L264L	ADAMTS14_ENST00000373208.1_Silent_p.L264L	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	264	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CATCGAGGTGCTGCTGGTGGT	0.607																																						dbGAP											0													140.0	111.0	121.0					10																	72468454		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.790C>T	10.37:g.72468454C>T			Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.L264	ENST00000373207.1	37	c.790	CCDS7306.1	10																																																																																			ADAMTS14	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000138316		0.607	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	HGNC	protein_coding	OTTHUMT00000048522.1	102	0.00	0	C	NM_080722		72468454	72468454	+1	no_errors	ENST00000373208	ensembl	human	known	69_37n	silent	176	39.31	114	SNP	1.000	T
ADCY10	55811	genome.wustl.edu	37	1	167823634	167823634	+	Silent	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:167823634C>G	ENST00000367851.4	-	18	2449	c.2265G>C	c.(2263-2265)acG>acC	p.T755T	ADCY10_ENST00000367848.1_Silent_p.T663T|ADCY10_ENST00000545172.1_Silent_p.T602T	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	755					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CCTCAGACTCCGTTTGTTGGA	0.433																																						dbGAP											0													172.0	161.0	165.0					1																	167823634		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.2265G>C	1.37:g.167823634C>G			B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.T755	ENST00000367851.4	37	c.2265	CCDS1265.1	1																																																																																			ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.433	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	187	0.00	0	C	NM_018417		167823634	167823634	-1	no_errors	ENST00000367851	ensembl	human	known	69_37n	silent	196	36.66	114	SNP	0.000	G
AGT	183	genome.wustl.edu	37	1	230846038	230846038	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:230846038C>A	ENST00000366667.4	-	2	773	c.559G>T	c.(559-561)Gta>Tta	p.V187L	RP11-99J16__A.2_ENST00000412344.1_RNA	NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	187					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGGCCCTGTACAGCCTGCAGG	0.637																																						dbGAP											0													39.0	34.0	36.0					1																	230846038		2203	4300	6503	-	-	-	SO:0001583	missense	0			K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.559G>T	1.37:g.230846038C>A	ENSP00000355627:p.Val187Leu		Q16358|Q16359|Q96F91	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom,prints_Angiotensngn	p.V187L	ENST00000366667.4	37	c.559	CCDS1585.1	1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.285667	0.23478	.	.	ENSG00000135744	ENST00000366667	D	0.87179	-2.22	4.87	-0.818	0.10833	Serpin domain (3);	0.280305	0.39407	N	0.001367	T	0.76478	0.3993	L	0.34521	1.04	0.09310	N	0.999998	B;B;B	0.28783	0.222;0.063;0.222	B;B;B	0.25506	0.061;0.012;0.061	T	0.63791	-0.6557	10	0.33940	T	0.23	.	10.0499	0.42210	0.0:0.3648:0.0:0.6352	.	187;187;187	B0ZBE2;B2R5S1;P01019	.;.;ANGT_HUMAN	L	187	ENSP00000355627:V187L	ENSP00000355627:V187L	V	-	1	0	AGT	228912661	0.165000	0.22948	0.961000	0.40146	0.298000	0.27526	0.147000	0.16202	-0.010000	0.14271	-0.339000	0.08088	GTA	AGT	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom,prints_Angiotensngn	ENSG00000135744		0.637	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGT	HGNC	protein_coding	OTTHUMT00000092102.1	27	0.00	0	C	NM_000029		230846038	230846038	-1	no_errors	ENST00000366667	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.164	A
AHCY	191	genome.wustl.edu	37	20	32880287	32880287	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr20:32880287C>G	ENST00000217426.2	-	4	399	c.322G>C	c.(322-324)Gag>Cag	p.E108Q	AHCY_ENST00000538132.1_Missense_Mutation_p.E80Q|AHCY_ENST00000468908.1_5'UTR	NM_000687.2	NP_000678.1	P23526	SAHH_HUMAN	adenosylhomocysteinase	108					cellular nitrogen compound metabolic process (GO:0034641)|chronic inflammatory response to antigenic stimulus (GO:0002439)|circadian sleep/wake cycle (GO:0042745)|homocysteine biosynthetic process (GO:0071268)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|S-adenosylhomocysteine catabolic process (GO:0019510)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	adenosylhomocysteinase activity (GO:0004013)|adenyl nucleotide binding (GO:0030554)|NAD binding (GO:0051287)			endometrium(6)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AGGTACTCCTCGTCCGTTTCG	0.592																																						dbGAP											0													134.0	101.0	113.0					20																	32880287		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61832	CCDS13233.1, CCDS54457.1	20q11.22	2009-06-12	2009-06-12		ENSG00000101444	ENSG00000101444	3.3.1.1		343	protein-coding gene	gene with protein product		180960	"""S-adenosylhomocysteine hydrolase"""			7079734, 6580258	Standard	NM_001161766		Approved	SAHH	uc002xai.3	P23526	OTTHUMG00000140098	ENST00000217426.2:c.322G>C	20.37:g.32880287C>G	ENSP00000217426:p.Glu108Gln		A8K307|B3KUN3|E1P5P2|F5H737|Q96A36	Missense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_IlvN,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	p.E108Q	ENST00000217426.2	37	c.322	CCDS13233.1	20	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339526	0.81911	.	.	ENSG00000101444	ENST00000217426;ENST00000538132	T;T	0.79845	-1.31;-1.31	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.85366	0.5680	M	0.61387	1.9	0.80722	D	1	D	0.53312	0.959	P	0.52957	0.714	D	0.87140	0.2202	10	0.72032	D	0.01	.	18.7558	0.91832	0.0:1.0:0.0:0.0	.	108	P23526	SAHH_HUMAN	Q	108;80	ENSP00000217426:E108Q;ENSP00000442820:E80Q	ENSP00000217426:E108Q	E	-	1	0	AHCY	32343948	1.000000	0.71417	0.983000	0.44433	0.917000	0.54804	7.818000	0.86416	2.516000	0.84829	0.561000	0.74099	GAG	AHCY	-	pfam_Adenosylhomocysteinase,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000101444		0.592	AHCY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCY	HGNC	protein_coding	OTTHUMT00000078773.2	97	0.00	0	C	NM_000687		32880287	32880287	-1	no_errors	ENST00000217426	ensembl	human	known	69_37n	missense	153	47.26	138	SNP	1.000	G
AIG1	51390	genome.wustl.edu	37	6	143486276	143486276	+	Nonsense_Mutation	SNP	A	A	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr6:143486276A>T	ENST00000275235.4	+	3	380	c.355A>T	c.(355-357)Aag>Tag	p.K119*	AIG1_ENST00000367598.5_Nonsense_Mutation_p.K119*|AIG1_ENST00000344492.5_Nonsense_Mutation_p.K67*|AIG1_ENST00000494282.2_Nonsense_Mutation_p.K119*|AIG1_ENST00000357847.4_Nonsense_Mutation_p.K119*			Q9NVV5	AIG1_HUMAN	androgen-induced 1	119						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		GATATACCCGAAGCTGCTGGA	0.353																																						dbGAP											0													137.0	147.0	143.0					6																	143486276		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF153605	CCDS5198.1, CCDS69216.1	6q24.1	2008-02-05			ENSG00000146416	ENSG00000146416			21607	protein-coding gene	gene with protein product		608514				11266118	Standard	NM_001286587		Approved	dJ95L4.1, AIG-1, FLJ10485	uc003qjh.3	Q9NVV5	OTTHUMG00000015721	ENST00000275235.4:c.355A>T	6.37:g.143486276A>T	ENSP00000275235:p.Lys119*		B4DPX2|C9J569|Q5T2H2|Q6N047|Q7Z378|Q8TB14|Q9Y3A9|Q9Y5B4	Nonsense_Mutation	SNP	pfam_Far-17a_AIG1	p.K119*	ENST00000275235.4	37	c.355		6	.	.	.	.	.	.	.	.	.	.	A	41	8.603345	0.98881	.	.	ENSG00000146416	ENST00000367601;ENST00000419072;ENST00000367598;ENST00000447498;ENST00000357847;ENST00000344492;ENST00000275235;ENST00000458219	.	.	.	5.83	5.83	0.93111	.	0.090383	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-41.8045	15.1793	0.72941	1.0:0.0:0.0:0.0	.	.	.	.	X	115;115;119;67;119;67;119;31	.	ENSP00000275235:K119X	K	+	1	0	AIG1	143527969	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.801000	0.85960	2.225000	0.72522	0.533000	0.62120	AAG	AIG1	-	pfam_Far-17a_AIG1	ENSG00000146416		0.353	AIG1-005	KNOWN	basic	protein_coding	AIG1	HGNC	protein_coding	OTTHUMT00000042510.1	168	0.00	0	A	NM_016108		143486276	143486276	+1	no_errors	ENST00000275235	ensembl	human	known	69_37n	nonsense	212	31.39	97	SNP	1.000	T
ANKRD34A	284615	genome.wustl.edu	37	1	145474686	145474686	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:145474686C>T	ENST00000323397.4	+	4	2651	c.1358C>T	c.(1357-1359)cCt>cTt	p.P453L	RP11-315I20.1_ENST00000600340.1_RNA|LIX1L_ENST00000369308.3_5'Flank	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	453	Pro-rich.					cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTGCCTGCCCCTCCTTATGCC	0.662																																						dbGAP											0													21.0	23.0	22.0					1																	145474686		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.1358C>T	1.37:g.145474686C>T	ENSP00000314103:p.Pro453Leu		B3KSU3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P453L	ENST00000323397.4	37	c.1358	CCDS30829.1	1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912065	0.52439	.	.	ENSG00000181039	ENST00000323397	T	0.15834	2.39	5.32	5.32	0.75619	.	0.523557	0.19165	N	0.121086	T	0.08846	0.0219	N	0.22421	0.69	0.47778	D	0.999511	B	0.31893	0.345	B	0.35607	0.206	T	0.10776	-1.0615	10	0.62326	D	0.03	-7.9109	16.6075	0.84834	0.0:1.0:0.0:0.0	.	453	Q69YU3	AN34A_HUMAN	L	453	ENSP00000314103:P453L	ENSP00000314103:P453L	P	+	2	0	ANKRD34A	144186043	0.934000	0.31675	0.999000	0.59377	0.856000	0.48823	0.518000	0.22847	2.770000	0.95276	0.650000	0.86243	CCT	ANKRD34A	-	NULL	ENSG00000181039		0.662	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD34A	HGNC	protein_coding	OTTHUMT00000038512.1	13	0.00	0	C			145474686	145474686	+1	no_errors	ENST00000323397	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	0.998	T
ART5	116969	genome.wustl.edu	37	11	3660979	3660980	+	Frame_Shift_Ins	INS	-	-	G	rs74708481		TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:3660979_3660980insG	ENST00000397068.3	-	2	1071_1072	c.679_680insC	c.(679-681)catfs	p.H227fs	TRPC2_ENST00000526541.1_RNA|ART5_ENST00000397067.3_Intron|ART5_ENST00000359918.4_Frame_Shift_Ins_p.H227fs	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	227					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAAGACTTCATGGGGGGGAATC	0.5																																						dbGAP											0									,	5,4259		0,5,2127					,	6.2	1.0			76	3,8251		0,3,4124	no	frameshift,frameshift	ART5	NM_053017.3,NM_001079536.1	,	0,8,6251	A1A1,A1R,RR		0.0363,0.1173,0.0639	,	,		8,12510				-	-	-	SO:0001589	frameshift_variant	0			Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.680dupC	11.37:g.3660986_3660986dupG	ENSP00000380258:p.His227fs		C9IYG7|Q6UX84|Q86W02	Frame_Shift_Ins	INS	pfam_ART,prints_ART	p.H227fs	ENST00000397068.3	37	c.680_679	CCDS7743.1	11																																																																																			ART5	-	pfam_ART,prints_ART	ENSG00000167311		0.500	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ART5	HGNC	protein_coding	OTTHUMT00000032760.2	39	0.00	0	-	NM_053017		3660979	3660980	-1	no_errors	ENST00000359918	ensembl	human	known	69_37n	frame_shift_ins	39	26.42	14	INS	0.986:0.988	G
C17orf47	284083	genome.wustl.edu	37	17	56620214	56620214	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr17:56620214G>A	ENST00000321691.3	-	1	1515	c.1334C>T	c.(1333-1335)cCg>cTg	p.P445L	RP11-112H10.4_ENST00000578022.1_RNA|RP11-112H10.4_ENST00000580769.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000412945.3_5'Flank|SEPT4_ENST00000457347.2_5'Flank	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	445										NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTCAAAATCCGGTGTTGTCAG	0.498																																						dbGAP											0													134.0	146.0	142.0					17																	56620214		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.1334C>T	17.37:g.56620214G>A	ENSP00000354874:p.Pro445Leu		Q8N821	Missense_Mutation	SNP	NULL	p.P445L	ENST00000321691.3	37	c.1334	CCDS32691.1	17	.	.	.	.	.	.	.	.	.	.	G	7.548	0.662152	0.14645	.	.	ENSG00000181013	ENST00000321691	T	0.35605	1.3	5.62	2.56	0.30785	.	0.428198	0.22519	N	0.058988	T	0.20170	0.0485	L	0.29908	0.895	0.09310	N	0.999999	P	0.42409	0.779	B	0.33799	0.17	T	0.09465	-1.0673	10	0.26408	T	0.33	-1.1153	8.6084	0.33786	0.2166:0.0:0.7834:0.0	.	445	Q8NEP4	CQ047_HUMAN	L	445	ENSP00000354874:P445L	ENSP00000354874:P445L	P	-	2	0	C17orf47	53975213	0.768000	0.28519	0.997000	0.53966	0.263000	0.26337	1.122000	0.31295	0.312000	0.23038	0.561000	0.74099	CCG	C17orf47	-	NULL	ENSG00000181013		0.498	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf47	HGNC	protein_coding	OTTHUMT00000445443.1	139	0.00	0	G	NM_001038704		56620214	56620214	-1	no_errors	ENST00000321691	ensembl	human	known	69_37n	missense	134	30.77	60	SNP	0.152	A
RBBP8NL	140893	genome.wustl.edu	37	20	60988927	60988927	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr20:60988927C>A	ENST00000252998.1	-	10	1636	c.1480G>T	c.(1480-1482)Ggc>Tgc	p.G494C		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	494	Pro-rich.					extracellular space (GO:0005615)											CCCTTGGTGCCATTGCTGAGT	0.682																																						dbGAP											0													13.0	12.0	12.0					20																	60988927		2182	4288	6470	-	-	-	SO:0001583	missense	0			AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.1480G>T	20.37:g.60988927C>A	ENSP00000252998:p.Gly494Cys		B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Missense_Mutation	SNP	pfam_CtIP_N	p.G494C	ENST00000252998.1	37	c.1480	CCDS13498.1	20	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536824	0.65085	.	.	ENSG00000130701	ENST00000252998	T	0.20881	2.04	3.58	1.54	0.23209	.	1.195990	0.05907	N	0.630977	T	0.37156	0.0993	L	0.50333	1.59	0.09310	N	1	D	0.76494	0.999	D	0.66716	0.946	T	0.15464	-1.0436	10	0.56958	D	0.05	-3.1169	6.4695	0.21999	0.2068:0.5929:0.2004:0.0	.	494	Q8NC74	CT151_HUMAN	C	494	ENSP00000252998:G494C	ENSP00000252998:G494C	G	-	1	0	C20orf151	60422322	0.001000	0.12720	0.686000	0.30086	0.650000	0.38633	0.348000	0.20031	0.300000	0.22699	0.561000	0.74099	GGC	C20orf151	-	NULL	ENSG00000130701		0.682	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf151	HGNC	protein_coding	OTTHUMT00000080029.1	23	0.00	0	C	NM_080833		60988927	60988927	-1	no_errors	ENST00000252998	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	0.166	A
C8orf17	100507249	genome.wustl.edu	37	8	140944716	140944716	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr8:140944716T>C	ENST00000507535.3	+	1	1301	c.187T>C	c.(187-189)Tca>Cca	p.S63P	TRAPPC9_ENST00000389327.3_Intron|TRAPPC9_ENST00000438773.2_Intron|TRAPPC9_ENST00000389328.4_Intron			Q9NRJ1	MOST1_HUMAN	chromosome 8 open reading frame 17	63						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											ggtagaaatgtcatgtagaca	0.562																																						dbGAP											0													78.0	73.0	74.0					8																	140944716		692	1591	2283	-	-	-	SO:0001583	missense	0			AF220264		8q24.3	2012-05-16			ENSG00000250733	ENSG00000250733			17737	protein-coding gene	gene with protein product						17143515	Standard			Approved	MOST-1		Q9NRJ1	OTTHUMG00000140391	ENST00000507535.3:c.187T>C	8.37:g.140944716T>C	ENSP00000428230:p.Ser63Pro			Missense_Mutation	SNP	NULL	p.S63P	ENST00000507535.3	37	c.187		8	.	.	.	.	.	.	.	.	.	.	T	11.40	1.628204	0.28978	.	.	ENSG00000250733	ENST00000507535	T	0.29142	1.58	1.82	-0.2	0.13216	.	.	.	.	.	T	0.22126	0.0533	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26292	-1.0107	6	0.42905	T	0.14	.	2.3673	0.04322	0.1934:0.0:0.5031:0.3035	.	.	.	.	P	63	ENSP00000428230:S63P	ENSP00000428230:S63P	S	+	1	0	C8orf17	141013898	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.397000	0.02511	-0.065000	0.13021	-0.991000	0.02546	TCA	C8orf17	-	NULL	ENSG00000250733		0.562	C8orf17-001	NOVEL	basic|appris_principal	protein_coding	C8orf17	HGNC	protein_coding	OTTHUMT00000277164.2	54	0.00	0	T			140944716	140944716	+1	no_errors	ENST00000507535	ensembl	human	novel	69_37n	missense	174	21.88	49	SNP	0.000	C
CACNA1S	779	genome.wustl.edu	37	1	201044743	201044743	+	Splice_Site	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:201044743C>T	ENST00000362061.3	-	13	2054	c.1828G>A	c.(1828-1830)Gta>Ata	p.V610I	CACNA1S_ENST00000367338.3_Splice_Site_p.V610I	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	610					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTGTCAGTACCTGTATGGAG	0.537																																						dbGAP											0													157.0	139.0	145.0					1																	201044743		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1828-1G>A	1.37:g.201044743C>T			A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.V610I	ENST00000362061.3	37	c.1828	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	C	1.415	-0.574514	0.03882	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97620	-4.46;-4.46	4.45	3.25	0.37280	Ion transport (1);	0.052902	0.64402	D	0.000001	D	0.84433	0.5471	N	0.00972	-1.085	0.35979	D	0.835876	B	0.10296	0.003	B	0.17433	0.018	T	0.81437	-0.0933	10	0.02654	T	1	.	5.8595	0.18738	0.0:0.6892:0.0:0.3108	.	610	Q13698	CAC1S_HUMAN	I	610	ENSP00000355192:V610I;ENSP00000356307:V610I	ENSP00000355192:V610I	V	-	1	0	CACNA1S	199311366	1.000000	0.71417	0.998000	0.56505	0.282000	0.26991	2.183000	0.42565	2.194000	0.70268	0.643000	0.83706	GTA	CACNA1S	-	pfam_Ion_trans_dom,prints_VDCCAlpha1	ENSG00000081248		0.537	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	84	0.00	0	C	NM_000069	Missense_Mutation	201044743	201044743	-1	no_errors	ENST00000362061	ensembl	human	known	69_37n	missense	229	19.08	54	SNP	1.000	T
CCDC144A	9720	genome.wustl.edu	37	17	16623911	16623911	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr17:16623911G>C	ENST00000360524.8	+	8	1906	c.1830G>C	c.(1828-1830)ttG>ttC	p.L610F	CCDC144A_ENST00000456009.1_Missense_Mutation_p.L330F|CCDC144A_ENST00000443444.2_Missense_Mutation_p.L610F|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.L610F|CCDC144A_ENST00000399273.1_Missense_Mutation_p.L610F	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	610																	ATTGTGAATTGTCTCACTCTG	0.368																																						dbGAP											0													32.0	33.0	32.0					17																	16623911		1816	4055	5871	-	-	-	SO:0001583	missense	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.1830G>C	17.37:g.16623911G>C	ENSP00000353717:p.Leu610Phe		O60311|Q6ZU57	Missense_Mutation	SNP	pfam_DUF3496	p.L610F	ENST00000360524.8	37	c.1830	CCDS45621.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	1.485|1.485	-0.556279|-0.556279	0.03967|0.03967	.|.	.|.	ENSG00000170160|ENSG00000170160	ENST00000328495|ENST00000399273;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000456009;ENST00000360495	.|T;T;T;T;T;T	.|0.33865	.|1.39;1.39;1.39;1.39;1.39;1.39	1.95|1.95	-0.343|-0.343	0.12632|0.12632	.|.	.|.	.|.	.|.	.|.	T|T	0.32010|0.32010	0.0815|0.0815	L|L	0.41492|0.41492	1.28|1.28	0.09310|0.09310	N|N	1|1	.|P;B	.|0.40794	.|0.729;0.409	.|P;B	.|0.46299	.|0.511;0.253	T|T	0.20773|0.20773	-1.0265|-1.0265	5|9	.|0.49607	.|T	.|0.09	.|.	5.2189|5.2189	0.15358|0.15358	0.3411:0.0:0.6589:0.0|0.3411:0.0:0.6589:0.0	.|.	.|330;610	.|A2RUR9-3;A2RUR9	.|.;C144A_HUMAN	S|F	94|610;610;610;610;330;610	.|ENSP00000382215:L610F;ENSP00000439262:L610F;ENSP00000440655:L610F;ENSP00000353717:L610F;ENSP00000394201:L330F;ENSP00000353685:L610F	.|ENSP00000353685:L610F	C|L	+|+	2|3	0|2	CCDC144A|CCDC144A	16564636|16564636	0.009000|0.009000	0.17119|0.17119	0.000000|0.000000	0.03702|0.03702	0.017000|0.017000	0.09413|0.09413	0.128000|0.128000	0.15810|0.15810	-0.342000|-0.342000	0.08363|0.08363	-1.109000|-1.109000	0.02080|0.02080	TGT|TTG	CCDC144A	-	NULL	ENSG00000170160		0.368	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	HGNC	protein_coding	OTTHUMT00000444093.1	479	0.00	0	G			16623911	16623911	+1	no_errors	ENST00000360524	ensembl	human	known	69_37n	missense	350	19.68	86	SNP	0.001	C
CCDC144B	284047	genome.wustl.edu	37	17	18498095	18498095	+	RNA	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr17:18498095C>G	ENST00000442583.1	-	0	863							Q3MJ40	C144B_HUMAN	coiled-coil domain containing 144B (pseudogene)											NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(6)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	36						CAGAGTGAGACAATTCACAAT	0.373																																						dbGAP											0													28.0	39.0	36.0					17																	18498095		1790	4044	5834	-	-	-			0			AK093811		17p11.2	2012-11-19	2011-09-02		ENSG00000154874	ENSG00000154874			26704	pseudogene	pseudogene			"""coiled-coil domain containing 144B"""			11997339	Standard	NR_036647		Approved	FLJ36492	uc002guc.2	Q3MJ40	OTTHUMG00000059531		17.37:g.18498095C>G			Q6P5Q3|Q8N200	RNA	SNP	-	NULL	ENST00000442583.1	37	NULL		17																																																																																			CCDC144B	-	-	ENSG00000154874		0.373	CCDC144B-006	KNOWN	basic	processed_transcript	CCDC144B	HGNC	pseudogene	OTTHUMT00000132102.1	75	0.00	0	C	NM_182568		18498095	18498095	-1	no_errors	ENST00000425214	ensembl	human	known	69_37n	rna	51	42.05	37	SNP	0.000	G
CDH2	1000	genome.wustl.edu	37	18	25572679	25572679	+	Silent	SNP	A	A	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr18:25572679A>G	ENST00000269141.3	-	9	1707	c.1284T>C	c.(1282-1284)acT>acC	p.T428T	CDH2_ENST00000399380.3_Silent_p.T397T	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	428	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CGAACCGTCCAGTAGGATCTC	0.527																																						dbGAP											0													205.0	159.0	175.0					18																	25572679		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1284T>C	18.37:g.25572679A>G			A8MWK3|B0YIY6|Q14923|Q8N173	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin	p.T428	ENST00000269141.3	37	c.1284	CCDS11891.1	18																																																																																			CDH2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000170558		0.527	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH2	HGNC	protein_coding	OTTHUMT00000133246.3	188	0.00	0	A	NM_001792		25572679	25572679	-1	no_errors	ENST00000269141	ensembl	human	known	69_37n	silent	358	21.18	97	SNP	0.026	G
CELF1	10658	genome.wustl.edu	37	11	47506035	47506035	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:47506035C>G	ENST00000358597.3	-	4	350	c.351G>C	c.(349-351)aaG>aaC	p.K117N	CELF1_ENST00000361904.3_Missense_Mutation_p.K117N|CELF1_ENST00000395290.2_Missense_Mutation_p.K116N|CELF1_ENST00000532048.1_Missense_Mutation_p.K143N|CELF1_ENST00000531165.1_Missense_Mutation_p.K144N|AC090559.1_ENST00000578625.1_RNA|CELF1_ENST00000310513.5_Missense_Mutation_p.K117N|CELF1_ENST00000395292.2_Missense_Mutation_p.K117N			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	117	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						CAGTGCACTTCTTGGAAATCA	0.438																																					Pancreas(163;1949 1966 9906 43218 43785)	dbGAP											0													96.0	98.0	97.0					11																	47506035		2201	4298	6499	-	-	-	SO:0001583	missense	0			U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.351G>C	11.37:g.47506035C>G	ENSP00000351409:p.Lys117Asn		B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K143N	ENST00000358597.3	37	c.429	CCDS31482.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.238698	0.95240	.	.	ENSG00000149187	ENST00000395290;ENST00000358597;ENST00000395292;ENST00000310513;ENST00000361904;ENST00000531165;ENST00000532048	T;T;T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35;2.35;2.35	5.78	5.78	0.91487	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.38558	0.1045	L	0.46885	1.475	0.80722	D	1	P;D;D;D;D;D	0.67145	0.609;0.996;0.993;0.993;0.993;0.994	P;D;D;D;D;D	0.72338	0.494;0.925;0.961;0.961;0.945;0.977	T	0.04005	-1.0985	10	0.87932	D	0	-15.617	20.0118	0.97458	0.0:1.0:0.0:0.0	.	116;144;143;117;117;117	F8W940;G5EA30;Q92879-4;Q92879-2;Q92879-3;Q92879	.;.;.;.;.;CELF1_HUMAN	N	116;117;117;117;117;144;143	ENSP00000378705:K116N;ENSP00000351409:K117N;ENSP00000378706:K117N;ENSP00000308386:K117N;ENSP00000354639:K117N;ENSP00000436864:K144N;ENSP00000435926:K143N	ENSP00000308386:K117N	K	-	3	2	CELF1	47462611	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.767000	0.85331	2.742000	0.94016	0.650000	0.86243	AAG	CELF1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000149187		0.438	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF1	HGNC	protein_coding	OTTHUMT00000398352.1	97	0.00	0	C	NM_006560		47506035	47506035	-1	no_errors	ENST00000532048	ensembl	human	known	69_37n	missense	110	29.49	46	SNP	1.000	G
CFTR	1080	genome.wustl.edu	37	7	117267576	117267576	+	Splice_Site	SNP	A	A	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr7:117267576A>T	ENST00000003084.6	+	22	3601	c.3469A>T	c.(3469-3471)Atg>Ttg	p.M1157L	CFTR_ENST00000454343.1_Splice_Site_p.M1096L|AC000111.6_ENST00000456270.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1157					cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)	p.M1157L(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TTTATTTCAGATGCGATCTGT	0.348									Cystic Fibrosis																													dbGAP											1	Substitution - Missense(1)	lung(1)											65.0	60.0	61.0					7																	117267576		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3469-1A>T	7.37:g.117267576A>T			Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.M1157L	ENST00000003084.6	37	c.3469	CCDS5773.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.62|17.62	3.434795|3.434795	0.62955|0.62955	.|.	.|.	ENSG00000001626|ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809|ENST00000468795	D;D;D|.	0.94000|.	-3.33;-3.33;-3.33|.	5.77|5.77	5.77|5.77	0.91146|0.91146	ABC transporter, transmembrane domain, type 1 (1);|.	0.034370|.	0.85682|.	D|.	0.000000|.	T|.	0.59702|.	0.2213|.	L|L	0.38692|0.38692	1.165|1.165	0.80722|0.80722	D|D	1|1	B|.	0.20164|.	0.042|.	B|.	0.25405|.	0.06|.	T|.	0.55692|.	-0.8101|.	9|.	.|.	.|.	.|.	-33.5768|-33.5768	16.3892|16.3892	0.83528|0.83528	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1157|.	P13569|.	CFTR_HUMAN|.	L|C	1157;1096;1127|98	ENSP00000003084:M1157L;ENSP00000403677:M1096L;ENSP00000389119:M1127L|.	.|.	M|X	+|+	1|3	0|0	CFTR|CFTR	117054812|117054812	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	7.781000|7.781000	0.85668|0.85668	2.330000|2.330000	0.79161|0.79161	0.477000|0.477000	0.44152|0.44152	ATG|TGA	CFTR	-	superfamily_ABC_transptrTM_dom_typ1,tigrfam_cAMP_cl_channel	ENSG00000001626		0.348	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	57	0.00	0	A	NM_000492	Missense_Mutation	117267576	117267576	+1	no_errors	ENST00000003084	ensembl	human	known	69_37n	missense	121	18.24	27	SNP	1.000	T
CNDP1	84735	genome.wustl.edu	37	18	72226583	72226583	+	Missense_Mutation	SNP	A	A	C	rs201810396	byFrequency	TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr18:72226583A>C	ENST00000358821.3	+	3	407	c.179A>C	c.(178-180)gAg>gCg	p.E60A	CNDP1_ENST00000585136.1_3'UTR|RP11-231E4.3_ENST00000583702.1_RNA|CNDP1_ENST00000582365.1_Missense_Mutation_p.E17A	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	60						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		GTGGCCATCGAGAGCGACTCT	0.642																																					Melanoma(32;1029 1042 25286 38395 44237)	dbGAP											0													97.0	83.0	88.0					18																	72226583		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.179A>C	18.37:g.72226583A>C	ENSP00000351682:p.Glu60Ala		Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Missense_Mutation	SNP	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	p.E60A	ENST00000358821.3	37	c.179	CCDS12007.1	18	.	.	.	.	.	.	.	.	.	.	A	13.81	2.348902	0.41599	.	.	ENSG00000150656	ENST00000358821	T	0.08370	3.1	5.37	4.22	0.49857	.	0.243874	0.41097	D	0.000949	T	0.09905	0.0243	L	0.55834	1.745	0.46981	D	0.999274	P	0.34724	0.465	B	0.34652	0.187	T	0.05886	-1.0858	10	0.51188	T	0.08	-39.0891	10.3567	0.43969	0.9222:0.0:0.0778:0.0	.	60	Q96KN2	CNDP1_HUMAN	A	60	ENSP00000351682:E60A	ENSP00000351682:E60A	E	+	2	0	CNDP1	70377563	1.000000	0.71417	0.975000	0.42487	0.298000	0.27526	6.471000	0.73562	2.036000	0.60181	0.523000	0.50628	GAG	CNDP1	-	pirsf_GSH_degradosome_DUG1	ENSG00000150656		0.642	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNDP1	HGNC	protein_coding	OTTHUMT00000256326.1	87	0.00	0	A	NM_032649		72226583	72226583	+1	no_errors	ENST00000358821	ensembl	human	known	69_37n	missense	113	29.45	48	SNP	1.000	C
CNTN2	6900	genome.wustl.edu	37	1	205042352	205042352	+	Missense_Mutation	SNP	G	G	C	rs369729930		TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:205042352G>C	ENST00000331830.4	+	22	3285	c.3001G>C	c.(3001-3003)Gtg>Ctg	p.V1001L		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	1001	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGTCCACATCGTGAGGAATGG	0.572																																					Melanoma(183;2548 2817 37099 41192)	dbGAP											0													68.0	66.0	67.0					1																	205042352		2203	4300	6503	-	-	-	SO:0001583	missense	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.3001G>C	1.37:g.205042352G>C	ENSP00000330633:p.Val1001Leu		P78432|Q5T054	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V1001L	ENST00000331830.4	37	c.3001	CCDS1449.1	1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.260687	0.39995	.	.	ENSG00000184144	ENST00000331830	T	0.61158	0.13	5.29	4.31	0.51392	Fibronectin, type III (1);	0.152167	0.29737	N	0.011339	T	0.33933	0.0880	N	0.04508	-0.205	0.32408	N	0.551059	B	0.06786	0.001	B	0.04013	0.001	T	0.29336	-1.0015	10	0.20519	T	0.43	.	14.5792	0.68274	0.0:0.3117:0.6883:0.0	.	1001	Q02246	CNTN2_HUMAN	L	1001	ENSP00000330633:V1001L	ENSP00000330633:V1001L	V	+	1	0	CNTN2	203308975	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.699000	0.37804	2.635000	0.89317	0.655000	0.94253	GTG	CNTN2	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000184144		0.572	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	49	0.00	0	G	NM_005076		205042352	205042352	+1	no_errors	ENST00000331830	ensembl	human	known	69_37n	missense	57	28.40	23	SNP	1.000	C
CPNE3	8895	genome.wustl.edu	37	8	87549810	87549810	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr8:87549810A>T	ENST00000521271.1	+	7	641	c.479A>T	c.(478-480)gAc>gTc	p.D160V	CPNE3_ENST00000198765.4_Missense_Mutation_p.D160V	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	160	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						GGAAAGTCAGACCCATACCTG	0.393																																						dbGAP											0													128.0	116.0	120.0					8																	87549810		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.479A>T	8.37:g.87549810A>T	ENSP00000430934:p.Asp160Val		A8KA47|Q8IYA1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting	p.D160V	ENST00000521271.1	37	c.479	CCDS6243.1	8	.	.	.	.	.	.	.	.	.	.	A	25.1	4.606609	0.87157	.	.	ENSG00000085719	ENST00000198765;ENST00000521271;ENST00000523072	T;T;T	0.60299	0.2;0.2;0.2	5.89	5.89	0.94794	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.86472	0.5941	H	0.99211	4.47	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.92221	0.5784	10	0.87932	D	0	-12.1083	16.3127	0.82898	1.0:0.0:0.0:0.0	.	160	O75131	CPNE3_HUMAN	V	160	ENSP00000198765:D160V;ENSP00000430934:D160V;ENSP00000427791:D160V	ENSP00000198765:D160V	D	+	2	0	CPNE3	87618926	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	9.339000	0.96797	2.246000	0.74042	0.533000	0.62120	GAC	CPNE3	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000085719		0.393	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE3	HGNC	protein_coding	OTTHUMT00000374994.1	154	0.00	0	A			87549810	87549810	+1	no_errors	ENST00000198765	ensembl	human	known	69_37n	missense	308	19.53	75	SNP	1.000	T
CTCF	10664	genome.wustl.edu	37	16	67645098	67645098	+	Silent	SNP	T	T	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr16:67645098T>A	ENST00000264010.4	+	3	807	c.363T>A	c.(361-363)ccT>ccA	p.P121P	CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	121					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		TACCTGTTCCTGTGACTGTAC	0.433																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											0													107.0	109.0	108.0					16																	67645098		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.363T>A	16.37:g.67645098T>A			B5MC38|Q53XI7|Q59EL8	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P121	ENST00000264010.4	37	c.363	CCDS10841.1	16																																																																																			CTCF	-	NULL	ENSG00000102974		0.433	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	105	0.00	0	T	NM_006565		67645098	67645098	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	silent	80	11.11	10	SNP	0.891	A
CXorf22	170063	genome.wustl.edu	37	X	35984726	35984726	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chrX:35984726A>T	ENST00000297866.5	+	9	1521	c.1455A>T	c.(1453-1455)aaA>aaT	p.K485N		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	485								p.K485N(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						GAGTCTTCAAAGTGAAGCAGA	0.318																																						dbGAP											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)											120.0	109.0	113.0					X																	35984726		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1455A>T	X.37:g.35984726A>T	ENSP00000297866:p.Lys485Asn		Q5JRM8|Q8N6X8	Missense_Mutation	SNP	superfamily_PapD-like	p.K485N	ENST00000297866.5	37	c.1455	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	A	14.51	2.558041	0.45590	.	.	ENSG00000165164	ENST00000297866	T	0.15834	2.39	5.7	4.52	0.55395	.	0.563207	0.19678	N	0.108596	T	0.31888	0.0811	M	0.74881	2.28	0.33702	D	0.614664	D	0.61080	0.989	P	0.57776	0.827	T	0.43491	-0.9388	10	0.19147	T	0.46	-34.982	9.4665	0.38816	0.8392:0.0:0.0:0.1608	.	485	Q6ZTR5	CX022_HUMAN	N	485	ENSP00000297866:K485N	ENSP00000297866:K485N	K	+	3	2	CXorf22	35894647	1.000000	0.71417	0.807000	0.32361	0.253000	0.25986	2.447000	0.44917	0.772000	0.33382	0.481000	0.45027	AAA	CXorf22	-	NULL	ENSG00000165164		0.318	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	198	0.00	0	A	NM_152632		35984726	35984726	+1	no_errors	ENST00000297866	ensembl	human	known	69_37n	missense	179	32.45	86	SNP	1.000	T
CYP2A7	1549	genome.wustl.edu	37	19	41384689	41384689	+	Silent	SNP	G	G	A	rs372835097		TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr19:41384689G>A	ENST00000301146.4	-	5	1348	c.807C>T	c.(805-807)gaC>gaT	p.D269D	CTC-490E21.12_ENST00000601627.1_Intron|CYP2A7_ENST00000291764.3_Silent_p.D218D	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	269						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TGAGAAAGGAGTCGATGAAGT	0.587																																						dbGAP											0													103.0	80.0	87.0					19																	41384689		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.807C>T	19.37:g.41384689G>A			Q13121	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2B-like	p.D269	ENST00000301146.4	37	c.807	CCDS12569.1	19																																																																																			CYP2A7	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000198077		0.587	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A7	HGNC	protein_coding	OTTHUMT00000463269.2	237	0.00	0	G	NM_030589		41384689	41384689	-1	no_errors	ENST00000301146	ensembl	human	known	69_37n	silent	248	32.43	119	SNP	1.000	A
DAGLA	747	genome.wustl.edu	37	11	61503794	61503794	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:61503794T>C	ENST00000257215.5	+	13	1459	c.1343T>C	c.(1342-1344)gTc>gCc	p.V448A		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	448					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CAGGAGATGGTCCTGTCCCAG	0.582																																						dbGAP											0													118.0	103.0	108.0					11																	61503794		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1343T>C	11.37:g.61503794T>C	ENSP00000257215:p.Val448Ala		A7E233|Q6WQJ0	Missense_Mutation	SNP	pfam_Lipase_3	p.V448A	ENST00000257215.5	37	c.1343	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	T	17.65	3.441140	0.63067	.	.	ENSG00000134780	ENST00000257215	T	0.26223	1.75	3.71	3.71	0.42584	.	0.063520	0.64402	D	0.000007	T	0.19604	0.0471	N	0.21373	0.66	0.53688	D	0.999971	P	0.37061	0.58	B	0.39562	0.303	T	0.06197	-1.0840	10	0.41790	T	0.15	-45.0639	12.8591	0.57903	0.0:0.0:0.0:1.0	.	448	Q9Y4D2	DGLA_HUMAN	A	448	ENSP00000257215:V448A	ENSP00000257215:V448A	V	+	2	0	DAGLA	61260370	1.000000	0.71417	0.997000	0.53966	0.852000	0.48524	7.226000	0.78060	1.688000	0.51068	0.379000	0.24179	GTC	DAGLA	-	pfam_Lipase_3	ENSG00000134780		0.582	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	HGNC	protein_coding	OTTHUMT00000398516.1	93	0.00	0	T	NM_006133		61503794	61503794	+1	no_errors	ENST00000257215	ensembl	human	known	69_37n	missense	135	26.74	50	SNP	1.000	C
DNAL1	83544	genome.wustl.edu	37	14	74125593	74125593	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr14:74125593A>C	ENST00000553645.2	+	3	127	c.86A>C	c.(85-87)aAa>aCa	p.K29T	DNAL1_ENST00000554339.1_Intron|DNAL1_ENST00000540526.1_5'UTR|DNAL1_ENST00000311089.3_Intron|DNAL1_ENST00000554871.1_5'UTR|RNU6-240P_ENST00000516098.1_RNA	NM_031427.3	NP_113615.2	Q4LDG9	DNAL1_HUMAN	dynein, axonemal, light chain 1	29										kidney(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)		AAAGAGATAAAACTTTATGCC	0.403																																						dbGAP											0													221.0	217.0	218.0					14																	74125593		1838	4097	5935	-	-	-	SO:0001583	missense	0			BC005343	CCDS45134.1, CCDS55928.1	14q24.3	2012-05-03	2006-09-04	2006-09-04	ENSG00000119661	ENSG00000119661			23247	protein-coding gene	gene with protein product		610062	"""chromosome 14 open reading frame 168"""	C14orf168		15845866	Standard	NM_031427		Approved	MGC12435, 1700010H15RiK, CILD16	uc001xoq.4	Q4LDG9		ENST00000553645.2:c.86A>C	14.37:g.74125593A>C	ENSP00000452037:p.Lys29Thr		B2RD38|Q5JPB7|Q9BS43	Missense_Mutation	SNP	NULL	p.K29T	ENST00000553645.2	37	c.86	CCDS45134.1	14	.	.	.	.	.	.	.	.	.	.	A	17.22	3.334289	0.60853	.	.	ENSG00000119661	ENST00000553645	T	0.60672	0.17	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.60702	0.2289	M	0.73430	2.235	0.80722	D	1	P	0.36048	0.534	B	0.41374	0.355	T	0.58216	-0.7675	10	0.11485	T	0.65	-13.7736	14.9616	0.71161	1.0:0.0:0.0:0.0	.	29	Q4LDG9	DNAL1_HUMAN	T	29	ENSP00000452037:K29T	ENSP00000310360:K29T	K	+	2	0	DNAL1	73195346	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.430000	0.73391	2.182000	0.69389	0.460000	0.39030	AAA	DNAL1	-	NULL	ENSG00000119661		0.403	DNAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAL1	HGNC	protein_coding	OTTHUMT00000414565.2	132	0.00	0	A	NM_031427		74125593	74125593	+1	no_errors	ENST00000553645	ensembl	human	known	69_37n	missense	61	56.43	79	SNP	1.000	C
EDA2R	60401	genome.wustl.edu	37	X	65819549	65819549	+	Missense_Mutation	SNP	G	G	C	rs141584284		TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chrX:65819549G>C	ENST00000374719.3	-	6	727	c.671C>G	c.(670-672)tCg>tGg	p.S224W	EDA2R_ENST00000451436.2_Missense_Mutation_p.S100W|EDA2R_ENST00000396050.1_Missense_Mutation_p.S224W|EDA2R_ENST00000456230.2_Missense_Mutation_p.S224W|EDA2R_ENST00000450752.1_Missense_Mutation_p.S245W|EDA2R_ENST00000253392.5_Missense_Mutation_p.S245W	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	224					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GCCACTAGTCGAGCTGCAGTC	0.587																																						dbGAP											0													72.0	49.0	57.0					X																	65819549		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.671C>G	X.37:g.65819549G>C	ENSP00000363851:p.Ser224Trp		Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_27,pfscan_TNFR/NGFR_Cys_rich_reg	p.S245W	ENST00000374719.3	37	c.734	CCDS14386.1	X	.	.	.	.	.	.	.	.	.	.	G	11.69	1.715226	0.30413	.	.	ENSG00000131080	ENST00000374719;ENST00000396050;ENST00000451436;ENST00000253392;ENST00000456230;ENST00000450752	D;D;D;D;D	0.86097	-1.91;-1.91;-2.07;-1.91;-2.07	3.59	2.71	0.32032	.	1.224160	0.06403	N	0.719229	D	0.87513	0.6196	L	0.27053	0.805	0.25185	N	0.990175	D;B;B	0.89917	1.0;0.255;0.034	D;B;B	0.83275	0.996;0.088;0.014	T	0.74748	-0.3560	10	0.66056	D	0.02	1.4839	9.1958	0.37226	0.0:0.0:0.7818:0.2182	.	100;245;224	E7EUS4;Q9HAV5-2;Q9HAV5	.;.;TNR27_HUMAN	W	224;224;100;245;224;245	ENSP00000363851:S224W;ENSP00000379365:S224W;ENSP00000253392:S245W;ENSP00000393935:S224W;ENSP00000402929:S245W	ENSP00000253392:S245W	S	-	2	0	EDA2R	65736274	0.002000	0.14202	0.330000	0.25442	0.651000	0.38670	0.789000	0.26886	0.543000	0.28864	-0.365000	0.07479	TCG	EDA2R	-	NULL	ENSG00000131080		0.587	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDA2R	HGNC	protein_coding	OTTHUMT00000057002.1	82	0.00	0	G	NM_021783		65819549	65819549	-1	no_errors	ENST00000253392	ensembl	human	known	69_37n	missense	75	27.88	29	SNP	0.186	C
ELN	2006	genome.wustl.edu	37	7	73474244	73474244	+	Silent	SNP	T	T	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr7:73474244T>A	ENST00000252034.7	+	23	1842	c.1443T>A	c.(1441-1443)ccT>ccA	p.P481P	ELN_ENST00000380576.5_Silent_p.P462P|ELN_ENST00000380562.4_Silent_p.P487P|ELN_ENST00000458204.1_Silent_p.P471P|ELN_ENST00000320492.7_Silent_p.P400P|ELN_ENST00000357036.5_Silent_p.P486P|ELN_ENST00000380553.4_Silent_p.P345P|ELN_ENST00000380584.4_Silent_p.P448P|ELN_ENST00000320399.6_Silent_p.P481P|ELN_ENST00000429192.1_Silent_p.P467P|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000445912.1_Silent_p.P481P|ELN_ENST00000358929.4_Silent_p.P516P|ELN_ENST00000414324.1_Silent_p.P457P|ELN_ENST00000380575.4_Silent_p.P452P	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GCGTGGCTCCTGGAGTTGGCG	0.577			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																															dbGAP		Dom	yes		7	7q11.23	2006	elastin	yes	L	0													236.0	226.0	230.0					7																	73474244		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1443T>A	7.37:g.73474244T>A			B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	prints_Tropoelastin	p.P516	ENST00000252034.7	37	c.1548	CCDS5562.2	7																																																																																			ELN	-	NULL	ENSG00000049540		0.577	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	HGNC	protein_coding	OTTHUMT00000316913.1	701	0.00	0	T	NM_000501		73474244	73474244	+1	no_errors	ENST00000358929	ensembl	human	known	69_37n	silent	926	17.14	195	SNP	0.001	A
ERICH6	131831	genome.wustl.edu	37	3	150387188	150387188	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr3:150387188C>T	ENST00000295910.6	-	12	1446	c.1394G>A	c.(1393-1395)gGt>gAt	p.G465D	FAM194A_ENST00000491361.1_Missense_Mutation_p.G319D	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ACAAGTAAAACCATTTACCTT	0.423																																						dbGAP											0													195.0	178.0	184.0					3																	150387188		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000295910.6:c.1394G>A	3.37:g.150387188C>T	ENSP00000295910:p.Gly465Asp			Missense_Mutation	SNP	NULL	p.G465D	ENST00000295910.6	37	c.1394	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380038	0.42207	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811	T;T	0.12984	2.63;2.63	5.36	5.36	0.76844	.	0.089585	0.48767	D	0.000168	T	0.28300	0.0699	M	0.68593	2.085	0.32182	N	0.580205	D	0.65815	0.995	D	0.62955	0.909	T	0.26710	-1.0095	10	0.36615	T	0.2	-22.5834	8.0777	0.30726	0.0:0.7547:0.1612:0.0841	.	465	Q7L0X2	F194A_HUMAN	D	465;319;423	ENSP00000295910:G465D;ENSP00000419366:G319D	ENSP00000295910:G465D	G	-	2	0	FAM194A	151869878	0.030000	0.19436	0.544000	0.28141	0.277000	0.26821	1.837000	0.39201	2.645000	0.89757	0.650000	0.86243	GGT	FAM194A	-	NULL	ENSG00000163645		0.423	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194A	HGNC	protein_coding	OTTHUMT00000257666.1	252	0.00	0	C			150387188	150387188	-1	no_errors	ENST00000295910	ensembl	human	known	69_37n	missense	362	21.13	97	SNP	0.731	T
NUTM2B	729262	genome.wustl.edu	37	10	81466030	81466030	+	Silent	SNP	C	C	A	rs61863489	byFrequency	TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr10:81466030C>A	ENST00000429828.1	+	2	998	c.615C>A	c.(613-615)gtC>gtA	p.V205V	RP11-119F19.2_ENST00000596088.1_RNA|RP11-119F19.2_ENST00000600376.1_RNA|RP11-119F19.2_ENST00000601369.1_RNA|NUTM2B_ENST00000372321.1_Silent_p.V138V|NUTM2B_ENST00000448135.1_Silent_p.V205V	NM_001278495.1	NP_001265424.1	A6NNL0	NTM2B_HUMAN	NUT family member 2B	205																	ACGTCTTTGTCCAGATGAGGA	0.667																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS60574.1	10q22.3	2014-08-13	2013-03-14	2013-03-14	ENSG00000188199	ENSG00000188199			23445	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member B"""	FAM22B			Standard	NM_001278495		Approved	bA119F19.1		A6NNL0	OTTHUMG00000018572	ENST00000429828.1:c.615C>A	10.37:g.81466030C>A			A6NM73	Silent	SNP	NULL	p.V205	ENST00000429828.1	37	c.615		10																																																																																			FAM22B	-	NULL	ENSG00000188199		0.667	NUTM2B-201	KNOWN	basic|appris_principal	protein_coding	FAM22B	HGNC	protein_coding		9	0.00	0	C	NG_012780		81466030	81466030	+1	no_errors	ENST00000429828	ensembl	human	known	69_37n	silent	24	28.57	10	SNP	0.000	A
FAM46A	55603	genome.wustl.edu	37	6	82461505	82461505	+	Silent	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr6:82461505C>A	ENST00000320172.6	-	2	668	c.354G>T	c.(352-354)gtG>gtT	p.V118V	FAM46A_ENST00000369754.3_Silent_p.V137V|FAM46A_ENST00000369756.3_Silent_p.V199V	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	118					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		CGTTGAGGCGCACGTCGCGGA	0.697																																						dbGAP											0													33.0	34.0	33.0					6																	82461505		2190	4288	6478	-	-	-	SO:0001819	synonymous_variant	0			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.354G>T	6.37:g.82461505C>A			A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	pfam_DUF1693	p.A9S	ENST00000320172.6	37	c.25	CCDS34489.1	6	.	.	.	.	.	.	.	.	.	.	C	3.297	-0.143785	0.06627	.	.	ENSG00000112773	ENST00000412306	.	.	.	5.38	4.5	0.54988	.	.	.	.	.	T	0.50582	0.1624	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52328	-0.8590	4	.	.	.	-8.9064	10.8909	0.46994	0.1469:0.7117:0.1414:0.0	.	.	.	.	S	9	.	.	A	-	1	0	FAM46A	82518224	0.984000	0.35163	1.000000	0.80357	0.118000	0.20060	0.244000	0.18124	1.476000	0.48215	-0.302000	0.09304	GCG	FAM46A	-	pfam_DUF1693	ENSG00000112773		0.697	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	HGNC	protein_coding	OTTHUMT00000041331.1	16	0.00	0	C			82461505	82461505	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000412306	ensembl	human	known	69_37n	missense	26	38.10	16	SNP	1.000	A
FARP2	9855	genome.wustl.edu	37	2	242380741	242380741	+	Nonsense_Mutation	SNP	T	T	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr2:242380741T>A	ENST00000264042.3	+	13	1351	c.1181T>A	c.(1180-1182)tTg>tAg	p.L394*	FARP2_ENST00000373287.4_Nonsense_Mutation_p.L394*|FARP2_ENST00000545004.1_Nonsense_Mutation_p.L394*	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	394					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CCCGAGGGATTGAGGACTCCT	0.493																																						dbGAP											0													109.0	102.0	104.0					2																	242380741		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.1181T>A	2.37:g.242380741T>A	ENSP00000264042:p.Leu394*		B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.L394*	ENST00000264042.3	37	c.1181	CCDS33424.1	2	.	.	.	.	.	.	.	.	.	.	T	27.5	4.841583	0.91197	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287;ENST00000413432	.	.	.	5.28	4.11	0.48088	.	1.899460	0.01938	N	0.041700	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	11.2034	0.48754	0.0:0.0736:0.0:0.9264	.	.	.	.	X	394;394;394;81	.	ENSP00000264042:L394X	L	+	2	0	FARP2	242029414	0.998000	0.40836	0.705000	0.30386	0.176000	0.22953	3.168000	0.50801	2.000000	0.58554	0.533000	0.62120	TTG	FARP2	-	NULL	ENSG00000006607		0.493	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP2	HGNC	protein_coding	OTTHUMT00000323153.1	89	0.00	0	T			242380741	242380741	+1	no_errors	ENST00000264042	ensembl	human	known	69_37n	nonsense	75	38.52	47	SNP	0.966	A
FAT3	120114	genome.wustl.edu	37	11	92531478	92531478	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:92531478C>T	ENST00000298047.6	+	9	5316	c.5299C>T	c.(5299-5301)Cca>Tca	p.P1767S	FAT3_ENST00000409404.2_Missense_Mutation_p.P1767S|FAT3_ENST00000525166.1_Missense_Mutation_p.P1617S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1767	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGATAATGCCCCAGTTTTTCT	0.438										TCGA Ovarian(4;0.039)																												dbGAP											0													45.0	44.0	44.0					11																	92531478		1888	4117	6005	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5299C>T	11.37:g.92531478C>T	ENSP00000298047:p.Pro1767Ser		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.P1767S	ENST00000298047.6	37	c.5299		11	.	.	.	.	.	.	.	.	.	.	C	28.1	4.886608	0.91814	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	D;D;D	0.85088	-1.94;-1.94;-1.94	5.93	5.93	0.95920	.	.	.	.	.	D	0.96197	0.8760	H	0.99026	4.405	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97297	0.9928	9	0.87932	D	0	.	20.3334	0.98727	0.0:1.0:0.0:0.0	.	1767	Q8TDW7-3	.	S	1767;1767;1617	ENSP00000298047:P1767S;ENSP00000387040:P1767S;ENSP00000432586:P1617S	ENSP00000298047:P1767S	P	+	1	0	FAT3	92171126	1.000000	0.71417	0.988000	0.46212	0.992000	0.81027	7.755000	0.85180	2.818000	0.97014	0.591000	0.81541	CCA	FAT3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.438	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		33	0.00	0	C	NM_001008781		92531478	92531478	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	43	29.51	18	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152284334	152284334	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:152284334C>G	ENST00000368799.1	-	3	3063	c.3028G>C	c.(3028-3030)Gca>Cca	p.A1010P	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1010	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAGTCTCTGCGTGAGGAGTT	0.582									Ichthyosis																													dbGAP											0													309.0	311.0	310.0					1																	152284334		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3028G>C	1.37:g.152284334C>G	ENSP00000357789:p.Ala1010Pro		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.A1010P	ENST00000368799.1	37	c.3028	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	4.655	0.121856	0.08931	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.00922	5.54	2.11	-0.0961	0.13638	.	.	.	.	.	T	0.00468	0.0015	M	0.62723	1.935	0.09310	N	1	P	0.45428	0.858	B	0.43155	0.41	T	0.45745	-0.9240	9	0.29301	T	0.29	.	3.5284	0.07768	0.0:0.5683:0.2627:0.1689	.	1010	P20930	FILA_HUMAN	P	1010;217	ENSP00000357789:A1010P	ENSP00000357789:A1010P	A	-	1	0	FLG	150550958	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.115000	0.03289	0.003000	0.14656	0.291000	0.19559	GCA	FLG	-	NULL	ENSG00000143631		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	408	0.00	0	C	NM_002016		152284334	152284334	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	611	10.79	74	SNP	0.000	G
MROH5	389690	genome.wustl.edu	37	8	142481219	142481219	+	RNA	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr8:142481219C>A	ENST00000430863.1	-	0	2022					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		CGCTGGGTGGCCCTGTCTGGG	0.537																																						dbGAP											0													118.0	126.0	123.0					8																	142481219		2057	4196	6253	-	-	-			0					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142481219C>A				Missense_Mutation	SNP	NULL	p.A648S	ENST00000430863.1	37	c.1942		8																																																																																			AC100803.1	-	NULL	ENSG00000226807		0.537	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	Clone_based_vega_gene	polymorphic_pseudogene	OTTHUMT00000342412.4	154	0.00	0	C	NM_207414		142481219	142481219	-1	pseudogene	ENST00000430863	ensembl	human	known	69_37n	missense	264	34.24	139	SNP	0.008	A
GPR139	124274	genome.wustl.edu	37	16	20043104	20043104	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr16:20043104C>A	ENST00000570682.1	-	2	1315	c.1015G>T	c.(1015-1017)Gtg>Ttg	p.V339L		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	339					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						TACTGGTACACCAGCATCTTG	0.453																																						dbGAP											0													157.0	154.0	155.0					16																	20043104		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.1015G>T	16.37:g.20043104C>A	ENSP00000458791:p.Val339Leu		A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.V339L	ENST00000570682.1	37	c.1015	CCDS32398.1	16	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353503	0.82243	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.59569	0.2203	N	0.19112	0.55	0.58432	D	0.999997	P	0.44690	0.841	P	0.55824	0.785	T	0.54853	-0.8231	9	0.27082	T	0.32	-22.7844	18.6978	0.91607	0.0:1.0:0.0:0.0	.	339	Q6DWJ6	GP139_HUMAN	L	339	.	ENSP00000370779:V339L	V	-	1	0	GPR139	19950605	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.652000	0.90054	0.655000	0.94253	GTG	GPR139	-	NULL	ENSG00000180269		0.453	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR139	HGNC	protein_coding	OTTHUMT00000438522.1	110	0.00	0	C	NM_001002911		20043104	20043104	-1	no_errors	ENST00000570682	ensembl	human	known	69_37n	missense	142	30.39	62	SNP	1.000	A
H2BFWT	158983	genome.wustl.edu	37	X	103267771	103267771	+	Frame_Shift_Del	DEL	G	G	-	rs139759218		TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chrX:103267771delG	ENST00000217926.5	-	1	488	c.462delC	c.(460-462)gccfs	p.A154fs	H2BFM_ENST00000243297.5_5'Flank	NM_001002916.3	NP_001002916.3	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific	154						membrane (GO:0016020)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	16						CTTCGGACTCGGCGAGCTTGC	0.662																																						dbGAP											0													32.0	33.0	32.0					X																	103267771		2200	4295	6495	-	-	-	SO:0001589	frameshift_variant	0			BC038109	CCDS35362.1	Xq22.2	2011-01-27			ENSG00000123569	ENSG00000123569		"""Histones / Replication-independent"""	27252	protein-coding gene	gene with protein product		300507				12477932	Standard	NM_001002916		Approved		uc004elr.3	Q7Z2G1	OTTHUMG00000022120	ENST00000217926.5:c.462delC	X.37:g.103267771delG	ENSP00000354723:p.Ala154fs		B1AK72|Q147W3	Frame_Shift_Del	DEL	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E155fs	ENST00000217926.5	37	c.462	CCDS35362.1	X																																																																																			H2BFWT	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000123569		0.662	H2BFWT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H2BFWT	HGNC	protein_coding	OTTHUMT00000057756.2	35	0.00	0	G	NM_001002916		103267771	103267771	-1	no_errors	ENST00000217926	ensembl	human	known	69_37n	frame_shift_del	46	25.81	16	DEL	0.988	-
HACL1	26061	genome.wustl.edu	37	3	15613244	15613244	+	Silent	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr3:15613244C>T	ENST00000321169.5	-	12	1393	c.1026G>A	c.(1024-1026)caG>caA	p.Q342Q	HACL1_ENST00000457447.2_Intron|HACL1_ENST00000435217.2_Silent_p.Q101Q|HACL1_ENST00000456194.2_Silent_p.Q315Q|HACL1_ENST00000451445.2_Silent_p.Q260Q	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	342					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)			NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						CTGGAGGATACTGCCATGGTG	0.353																																						dbGAP											0													161.0	148.0	153.0					3																	15613244		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.1026G>A	3.37:g.15613244C>T			B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Silent	SNP	pfam_Thiamin_PyroP_enz_TPP-bd_dom,pfam_Thiamin_PyroP_enz_cen_dom,pfam_TPP_enzyme-bd_C,pfam_CO_DH_CoA_synth	p.Q342	ENST00000321169.5	37	c.1026	CCDS2627.1	3																																																																																			HACL1	-	NULL	ENSG00000131373		0.353	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HACL1	HGNC	protein_coding	OTTHUMT00000252104.3	146	0.00	0	C	NM_012260		15613244	15613244	-1	no_errors	ENST00000321169	ensembl	human	known	69_37n	silent	158	38.76	100	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186115046	186115046	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:186115046G>T	ENST00000271588.4	+	93	14828	c.14599G>T	c.(14599-14601)Gca>Tca	p.A4867S	HMCN1_ENST00000367492.2_Missense_Mutation_p.A4867S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4867	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAATGTACAAGCATGTCCAGG	0.483																																						dbGAP											0													66.0	52.0	57.0					1																	186115046		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14599G>T	1.37:g.186115046G>T	ENSP00000271588:p.Ala4867Ser		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.A4867S	ENST00000271588.4	37	c.14599	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941094	0.34283	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.52526	0.66;0.66	5.5	2.6	0.31112	.	0.328215	0.36101	N	0.002797	T	0.32346	0.0826	N	0.25094	0.71	0.33252	D	0.558661	B	0.16603	0.018	B	0.23716	0.048	T	0.35375	-0.9791	10	0.28530	T	0.3	.	11.1251	0.48312	0.2037:0.0:0.7963:0.0	.	4867	Q96RW7	HMCN1_HUMAN	S	4867	ENSP00000271588:A4867S;ENSP00000356462:A4867S	ENSP00000271588:A4867S	A	+	1	0	HMCN1	184381669	0.915000	0.31059	0.991000	0.47740	0.939000	0.58152	0.458000	0.21892	0.697000	0.31718	0.591000	0.81541	GCA	HMCN1	-	pfam_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.483	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	36	0.00	0	G	NM_031935		186115046	186115046	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	98	24.03	31	SNP	0.999	T
HSPA13	6782	genome.wustl.edu	37	21	15750638	15750638	+	Silent	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr21:15750638C>T	ENST00000285667.3	-	3	529	c.462G>A	c.(460-462)aaG>aaA	p.K154K	HSPA13_ENST00000478035.1_5'Flank|HSPA13_ENST00000544452.1_Intron	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	154						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						TTTCCTTTAACTTCAACAATA	0.388																																						dbGAP											0													105.0	95.0	98.0					21																	15750638		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.462G>A	21.37:g.15750638C>T			B2R616|Q8NE40	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.K154	ENST00000285667.3	37	c.462	CCDS13567.1	21																																																																																			HSPA13	-	pfam_Hsp_70_fam,pfam_MreB_Mrl	ENSG00000155304		0.388	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA13	HGNC	protein_coding	OTTHUMT00000157815.1	120	0.00	0	C			15750638	15750638	-1	no_errors	ENST00000285667	ensembl	human	known	69_37n	silent	126	32.62	61	SNP	0.982	T
IGSF1	3547	genome.wustl.edu	37	X	130419141	130419141	+	Intron	SNP	A	A	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chrX:130419141A>G	ENST00000361420.3	-	5	747				IGSF1_ENST00000370903.3_Intron|IGSF1_ENST00000370910.1_Intron|IGSF1_ENST00000370900.1_Missense_Mutation_p.Y227H|IGSF1_ENST00000370904.1_Intron|IGSF1_ENST00000370901.4_Missense_Mutation_p.Y227H			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1						regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						CAGCAGCCATAGCCACACCCA	0.547																																						dbGAP											0													75.0	60.0	65.0					X																	130419141		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.667+11T>C	X.37:g.130419141A>G			B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.Y227H	ENST00000361420.3	37	c.679	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	A	7.152	0.583922	0.13749	.	.	ENSG00000147255	ENST00000370901;ENST00000370900	T;T	0.00576	6.45;6.45	4.4	2.27	0.28462	.	.	.	.	.	T	0.00440	0.0014	.	.	.	0.43657	D	0.996077	B	0.02656	0.0	B	0.06405	0.002	T	0.61004	-0.7150	8	0.27082	T	0.32	.	3.9802	0.09492	0.6587:0.0:0.3413:0.0	.	227	Q8N6C5-3	.	H	227	ENSP00000359938:Y227H;ENSP00000359937:Y227H	ENSP00000359937:Y227H	Y	-	1	0	IGSF1	130246822	0.418000	0.25440	0.782000	0.31804	0.524000	0.34500	0.372000	0.20467	0.437000	0.26423	-0.233000	0.12211	TAT	IGSF1	-	NULL	ENSG00000147255		0.547	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	68	0.00	0	A			130419141	130419141	-1	no_errors	ENST00000370900	ensembl	human	known	69_37n	missense	76	32.74	37	SNP	0.758	G
INTS7	25896	genome.wustl.edu	37	1	212180058	212180058	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:212180058C>T	ENST00000366994.3	-	7	906	c.802G>A	c.(802-804)Gta>Ata	p.V268I	INTS7_ENST00000440600.2_Missense_Mutation_p.V219I|INTS7_ENST00000366993.3_Missense_Mutation_p.V268I|INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366992.3_Missense_Mutation_p.V268I	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	268					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		AGTCTCTTTACTGCCTTCCTG	0.338																																						dbGAP											0													125.0	128.0	127.0					1																	212180058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.802G>A	1.37:g.212180058C>T	ENSP00000355961:p.Val268Ile		B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V268I	ENST00000366994.3	37	c.802	CCDS1501.1	1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501408	0.64298	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.73363	1.75;1.75;1.75;-0.74	5.5	4.59	0.56863	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65923	0.2738	L	0.33137	0.985	0.58432	D	0.999999	B;B;B;B	0.26602	0.154;0.154;0.154;0.08	B;B;B;B	0.29598	0.032;0.048;0.019;0.104	T	0.62812	-0.6775	10	0.36615	T	0.2	-19.557	14.8133	0.70010	0.0:0.9302:0.0:0.0698	.	219;268;268;268	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	I	268;268;268;219	ENSP00000355961:V268I;ENSP00000355960:V268I;ENSP00000355959:V268I;ENSP00000388908:V219I	ENSP00000355959:V268I	V	-	1	0	INTS7	210246681	1.000000	0.71417	0.897000	0.35233	0.975000	0.68041	5.586000	0.67503	1.451000	0.47736	0.591000	0.81541	GTA	INTS7	-	superfamily_ARM-type_fold	ENSG00000143493		0.338	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	INTS7	HGNC	protein_coding	OTTHUMT00000090142.1	261	0.00	0	C	NM_015434		212180058	212180058	-1	no_errors	ENST00000366994	ensembl	human	known	69_37n	missense	247	22.01	70	SNP	1.000	T
ITGB2	3689	genome.wustl.edu	37	21	46308699	46308699	+	Silent	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr21:46308699C>T	ENST00000397850.2	-	15	2441	c.1989G>A	c.(1987-1989)aaG>aaA	p.K663K	ITGB2_ENST00000397854.3_Silent_p.K606K|ITGB2_ENST00000397857.1_Silent_p.K663K|ITGB2_ENST00000302347.5_Silent_p.K663K|ITGB2_ENST00000355153.4_Silent_p.K663K|ITGB2_ENST00000397852.1_Silent_p.K663K			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	663					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	AGTCCCTCTCCTTGCAGGTCC	0.632																																						dbGAP											0													79.0	70.0	73.0					21																	46308699		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1989G>A	21.37:g.46308699C>T			B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.K663	ENST00000397850.2	37	c.1989	CCDS13716.1	21																																																																																			ITGB2	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_tail,superfamily_Integrin_bsu_tail	ENSG00000160255		0.632	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	52	0.00	0	C	NM_000211		46308699	46308699	-1	no_errors	ENST00000302347	ensembl	human	known	69_37n	silent	122	26.51	44	SNP	1.000	T
KHDRBS2	202559	genome.wustl.edu	37	6	62688082	62688082	+	Silent	SNP	A	A	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr6:62688082A>G	ENST00000281156.4	-	4	650	c.372T>C	c.(370-372)taT>taC	p.Y124Y		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	124	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		TCAAGTGGGCATATTTGGCTT	0.353																																						dbGAP											0													124.0	109.0	114.0					6																	62688082		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.372T>C	6.37:g.62688082A>G			A8K7M8|Q8N4I4|Q8TCZ4	Silent	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.Y124	ENST00000281156.4	37	c.372	CCDS4963.1	6																																																																																			KHDRBS2	-	smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000112232		0.353	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2	122	0.00	0	A	NM_152688		62688082	62688082	-1	no_errors	ENST00000281156	ensembl	human	known	69_37n	silent	139	31.19	63	SNP	1.000	G
LGR4	55366	genome.wustl.edu	37	11	27390302	27390302	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:27390302G>T	ENST00000379214.4	-	18	2411	c.1968C>A	c.(1966-1968)agC>agA	p.S656R	LGR4_ENST00000389858.4_Missense_Mutation_p.S632R	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	656					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						TGAGATGATTGCTCTTCCCAT	0.408																																						dbGAP											0													90.0	87.0	88.0					11																	27390302		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.1968C>A	11.37:g.27390302G>T	ENSP00000368516:p.Ser656Arg		A6NCH3|G5E9B3|Q8N537|Q9NYD1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.S656R	ENST00000379214.4	37	c.1968	CCDS31449.1	11	.	.	.	.	.	.	.	.	.	.	G	0	-2.763654	0.00082	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	T;T	0.70869	1.2;-0.52	5.81	2.92	0.33932	GPCR, rhodopsin-like superfamily (1);	0.135191	0.64402	D	0.000002	T	0.32615	0.0835	N	0.00885	-1.115	0.80722	D	1	B;B	0.12630	0.004;0.006	B;B	0.15052	0.012;0.007	T	0.37572	-0.9700	10	0.02654	T	1	.	9.3109	0.37903	0.2754:0.0:0.7246:0.0	.	632;656	G5E9B3;Q9BXB1	.;LGR4_HUMAN	R	656;632	ENSP00000368516:S656R;ENSP00000374508:S632R	ENSP00000368516:S656R	S	-	3	2	LGR4	27346878	1.000000	0.71417	0.253000	0.24343	0.045000	0.14185	3.244000	0.51399	0.360000	0.24265	0.650000	0.86243	AGC	LGR4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000205213		0.408	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR4	HGNC	protein_coding	OTTHUMT00000257467.1	100	0.00	0	G	NM_018490		27390302	27390302	-1	no_errors	ENST00000379214	ensembl	human	known	69_37n	missense	156	22.00	44	SNP	0.750	T
MADD	8567	genome.wustl.edu	37	11	47315517	47315517	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:47315517C>A	ENST00000311027.5	+	22	3664	c.3499C>A	c.(3499-3501)Ctg>Atg	p.L1167M	MADD_ENST00000405573.2_5'UTR|MADD_ENST00000407859.3_Missense_Mutation_p.L1106M|MADD_ENST00000402192.2_Missense_Mutation_p.L1129M|MADD_ENST00000349238.3_Missense_Mutation_p.L1149M|MADD_ENST00000395336.3_Missense_Mutation_p.L1167M|MADD_ENST00000395344.3_Missense_Mutation_p.L1086M|MADD_ENST00000402799.1_Missense_Mutation_p.L1086M|MADD_ENST00000406482.1_Missense_Mutation_p.L1086M|MADD_ENST00000342922.4_Missense_Mutation_p.L1129M	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TGGTGTGAGCCTGACGTCTAG	0.428																																						dbGAP											0													149.0	138.0	142.0					11																	47315517		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.3499C>A	11.37:g.47315517C>A	ENSP00000310933:p.Leu1167Met			Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.L1167M	ENST00000311027.5	37	c.3499	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	C	16.69	3.194160	0.58017	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.07800	3.31;3.16;3.16;3.32;3.17;3.16;3.18;3.16;3.31	5.56	4.64	0.57946	.	0.070468	0.64402	D	0.000018	T	0.11793	0.0287	N	0.24115	0.695	0.80722	D	1	D;P;D;D;D;D;D;D;D;D	0.60160	0.974;0.954;0.987;0.973;0.985;0.985;0.977;0.987;0.978;0.977	P;P;P;P;P;P;P;P;P;P	0.61800	0.668;0.668;0.894;0.822;0.822;0.822;0.865;0.865;0.786;0.865	T	0.01648	-1.1304	10	0.66056	D	0.02	-10.2359	6.1367	0.20237	0.0:0.6691:0.1667:0.1642	.	1086;1086;1167;1086;1086;1086;1149;1106;1167;1129	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	M	1129;1086;1086;1086;1149;1167;1106;1086;1167;1129	ENSP00000343902:L1129M;ENSP00000385585:L1086M;ENSP00000384435:L1086M;ENSP00000304505:L1149M;ENSP00000310933:L1167M;ENSP00000384204:L1106M;ENSP00000378753:L1086M;ENSP00000378745:L1167M;ENSP00000384287:L1129M	ENSP00000310933:L1167M	L	+	1	2	MADD	47272093	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.276000	0.33156	2.589000	0.87451	0.655000	0.94253	CTG	MADD	-	NULL	ENSG00000110514		0.428	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	180	0.00	0	C			47315517	47315517	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	missense	227	40.11	152	SNP	1.000	A
MFSD3	113655	genome.wustl.edu	37	8	145735356	145735356	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr8:145735356G>C	ENST00000301327.4	+	1	900	c.640G>C	c.(640-642)Ggg>Cgg	p.G214R	RECQL4_ENST00000532237.1_5'Flank|CTD-2517M22.17_ENST00000580385.1_RNA	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	214	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			AGCCGTGCCGGGGACCGTGTG	0.697											OREG0019059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													21.0	18.0	19.0					8																	145735356		2145	4181	6326	-	-	-	SO:0001583	missense	0				CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.640G>C	8.37:g.145735356G>C	ENSP00000301327:p.Gly214Arg	1696		Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G214R	ENST00000301327.4	37	c.640	CCDS6431.1	8	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250132	0.80024	.	.	ENSG00000167700	ENST00000301327	T	0.56941	0.43	5.54	5.54	0.83059	Major facilitator superfamily domain, general substrate transporter (1);	0.050943	0.85682	D	0.000000	T	0.76877	0.4049	M	0.86953	2.85	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.80939	-0.1158	10	0.87932	D	0	-17.7137	16.9535	0.86252	0.0:0.0:1.0:0.0	.	214	Q96ES6	MFSD3_HUMAN	R	214	ENSP00000301327:G214R	ENSP00000301327:G214R	G	+	1	0	MFSD3	145706164	1.000000	0.71417	0.988000	0.46212	0.021000	0.10359	6.263000	0.72521	2.601000	0.87937	0.561000	0.74099	GGG	MFSD3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000167700		0.697	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD3	HGNC	protein_coding	OTTHUMT00000382478.2	34	0.00	0	G	NM_138431		145735356	145735356	+1	no_errors	ENST00000301327	ensembl	human	known	69_37n	missense	91	22.22	26	SNP	1.000	C
MSLNL	401827	genome.wustl.edu	37	16	820069	820069	+	Silent	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr16:820069G>T	ENST00000442466.1	-	14	1862	c.1863C>A	c.(1861-1863)acC>acA	p.T621T	MIR662_ENST00000384847.1_RNA|MSLNL_ENST00000293892.3_Silent_p.T972T			Q96KJ4	MSLNL_HUMAN	mesothelin-like	621					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GCAGGCCCGAGGTGTGGACCA	0.731																																						dbGAP											0													13.0	16.0	15.0					16																	820069		1984	4038	6022	-	-	-	SO:0001819	synonymous_variant	0					16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.1863C>A	16.37:g.820069G>T				Silent	SNP	pfam_Mesothelin	p.T972	ENST00000442466.1	37	c.2916		16																																																																																			MSLNL	-	NULL	ENSG00000162006		0.731	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	HGNC	protein_coding		50	0.00	0	G	NM_001025190		820069	820069	-1	no_errors	ENST00000293892	ensembl	human	known	69_37n	silent	51	33.77	26	SNP	0.004	T
MSTN	2660	genome.wustl.edu	37	2	190924922	190924922	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr2:190924922T>G	ENST00000260950.4	-	2	745	c.613A>C	c.(613-615)Agc>Cgc	p.S205R	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	205					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			ACATCAATGCTCTGCCAAATA	0.413																																						dbGAP											0													216.0	201.0	206.0					2																	190924922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.613A>C	2.37:g.190924922T>G	ENSP00000260950:p.Ser205Arg		A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.S205R	ENST00000260950.4	37	c.613	CCDS2303.1	2	.	.	.	.	.	.	.	.	.	.	T	14.71	2.616086	0.46631	.	.	ENSG00000138379	ENST00000260950	T	0.69926	-0.44	5.24	5.24	0.73138	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	L	0.39566	1.225	0.80722	D	1	B	0.15930	0.015	B	0.26693	0.072	T	0.60530	-0.7245	10	0.59425	D	0.04	-12.4646	15.2874	0.73838	0.0:0.0:0.0:1.0	.	205	O14793	GDF8_HUMAN	R	205	ENSP00000260950:S205R	ENSP00000260950:S205R	S	-	1	0	MSTN	190633167	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.023000	0.70848	2.194000	0.70268	0.528000	0.53228	AGC	MSTN	-	pfam_TGF-b_N	ENSG00000138379		0.413	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSTN	HGNC	protein_coding	OTTHUMT00000255917.2	245	0.00	0	T	NM_005259		190924922	190924922	-1	no_errors	ENST00000260950	ensembl	human	known	69_37n	missense	264	33.33	133	SNP	1.000	G
MUC5B	727897	genome.wustl.edu	37	11	1269276	1269276	+	Silent	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:1269276C>G	ENST00000529681.1	+	31	11224	c.11166C>G	c.(11164-11166)ctC>ctG	p.L3722L	MUC5B_ENST00000447027.1_Silent_p.L3725L|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3722	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			PGTTWILTEPSTTATVTVPTGSTATASSTQAT -> QGPP (in Ref. 4; CAA96577). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTGGATCCTCACAGAGCCGA	0.647																																						dbGAP											0													38.0	45.0	42.0					11																	1269276		1892	4060	5952	-	-	-	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11166C>G	11.37:g.1269276C>G			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.L3725	ENST00000529681.1	37	c.11175	CCDS44515.2	11																																																																																			MUC5B	-	NULL	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	79	0.00	0	C	XM_001126093		1269276	1269276	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	silent	90	35.25	49	SNP	0.000	G
NAV2	89797	genome.wustl.edu	37	11	19961292	19961292	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:19961292G>T	ENST00000396087.3	+	9	2287	c.2188G>T	c.(2188-2190)Gga>Tga	p.G730*	NAV2_ENST00000349880.4_Nonsense_Mutation_p.G707*|NAV2_ENST00000527559.2_Nonsense_Mutation_p.G659*|NAV2_ENST00000360655.4_Nonsense_Mutation_p.G643*|NAV2_ENST00000396085.1_Nonsense_Mutation_p.G707*|NAV2_ENST00000540292.1_Nonsense_Mutation_p.G661*	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	730					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CACCAAGACTGGACAGCCTGC	0.532																																						dbGAP											0													137.0	105.0	116.0					11																	19961292		2199	4293	6492	-	-	-	SO:0001587	stop_gained	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.2188G>T	11.37:g.19961292G>T	ENSP00000379396:p.Gly730*		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Nonsense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.G730*	ENST00000396087.3	37	c.2188	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	G	44	10.888369	0.99483	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292	.	.	.	5.71	5.71	0.89125	.	0.094301	0.46442	D	0.000290	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8706	0.96849	0.0:0.0:1.0:0.0	.	.	.	.	X	643;707;707;730;659;661	.	.	G	+	1	0	NAV2	19917868	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.934000	0.70138	2.691000	0.91804	0.563000	0.77884	GGA	NAV2	-	NULL	ENSG00000166833		0.532	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1	115	0.00	0	G	NM_145117		19961292	19961292	+1	no_errors	ENST00000396087	ensembl	human	known	69_37n	nonsense	198	30.18	86	SNP	1.000	T
NXPE1	120400	genome.wustl.edu	37	11	114392917	114392917	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:114392917C>G	ENST00000424269.1	-	5	1416	c.1417G>C	c.(1417-1419)Gtg>Ctg	p.V473L	NXPE1_ENST00000251921.2_Missense_Mutation_p.V331L|NXPE1_ENST00000536271.1_Missense_Mutation_p.V189L			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	473						extracellular region (GO:0005576)											TTAATAATCACTTTAGTGGCT	0.398																																						dbGAP											0													150.0	151.0	151.0					11																	114392917		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.1417G>C	11.37:g.114392917C>G	ENSP00000411690:p.Val473Leu		B0YJ13	Missense_Mutation	SNP	superfamily_Ig_E-set	p.V473L	ENST00000424269.1	37	c.1417		11	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044658	0.75732	.	.	ENSG00000095110	ENST00000536271;ENST00000251921;ENST00000424269	T;T;T	0.25250	1.81;1.81;1.81	4.64	3.71	0.42584	.	0.000000	0.64402	D	0.000013	T	0.58481	0.2125	M	0.93720	3.45	0.33962	D	0.645714	D	0.76494	0.999	D	0.79784	0.993	T	0.76615	-0.2894	10	0.87932	D	0	-18.9617	11.4906	0.50379	0.0:0.9062:0.0:0.0938	.	473	Q8N323	FA55A_HUMAN	L	189;331;473	ENSP00000445200:V189L;ENSP00000251921:V331L;ENSP00000411690:V473L	ENSP00000251921:V331L	V	-	1	0	FAM55A	113898127	1.000000	0.71417	0.995000	0.50966	0.916000	0.54674	2.901000	0.48695	1.222000	0.43521	0.650000	0.86243	GTG	NXPE1	-	NULL	ENSG00000095110		0.398	NXPE1-201	KNOWN	basic	protein_coding	NXPE1	HGNC	protein_coding		230	0.00	0	C	NM_152315		114392917	114392917	-1	no_errors	ENST00000424269	ensembl	human	known	69_37n	missense	262	30.61	116	SNP	1.000	G
ODC1	4953	genome.wustl.edu	37	2	10584253	10584253	+	Silent	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr2:10584253C>T	ENST00000234111.4	-	5	927	c.417G>A	c.(415-417)ttG>ttA	p.L139L	ODC1_ENST00000446285.1_5'UTR|SNORA80B_ENST00000383906.1_RNA|ODC1_ENST00000405333.1_Silent_p.L139L	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	139					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	CAACTTTCATCAACTCAACTT	0.383																																						dbGAP											0													223.0	234.0	230.0					2																	10584253		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.417G>A	2.37:g.10584253C>T			Q53TU3|Q6LDS9	Silent	SNP	pfam_De-COase2_N,pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C,prints_Orn_de-COase,prints_Orn/DAP/Arg_de-COase	p.L139	ENST00000234111.4	37	c.417	CCDS1672.1	2																																																																																			ODC1	-	pfam_De-COase2_N,prints_Orn_de-COase	ENSG00000115758		0.383	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODC1	HGNC	protein_coding	OTTHUMT00000206896.2	163	0.00	0	C			10584253	10584253	-1	no_errors	ENST00000234111	ensembl	human	known	69_37n	silent	172	31.75	80	SNP	1.000	T
OR52A1	23538	genome.wustl.edu	37	11	5172768	5172768	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:5172768G>T	ENST00000380367.1	-	2	1249	c.832C>A	c.(832-834)Ctc>Atc	p.L278I	OR52A1_ENST00000328942.1_Missense_Mutation_p.L278I			Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A, member 1	278					sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	19		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTAGAAAAGAGAATATGGATA	0.433																																						dbGAP											0													143.0	143.0	143.0					11																	5172768		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF154673	CCDS31374.1	11p15.4	2012-08-09			ENSG00000182070	ENSG00000182070		"""GPCR / Class A : Olfactory receptors"""	8318	protein-coding gene	gene with protein product						10512676	Standard	NM_012375		Approved	HPFH1OR	uc010qyy.2	Q9UKL2	OTTHUMG00000066603	ENST00000380367.1:c.832C>A	11.37:g.5172768G>T	ENSP00000369725:p.Leu278Ile		Q6IF31	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L278I	ENST00000380367.1	37	c.832	CCDS31374.1	11	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648779	0.29336	.	.	ENSG00000182070	ENST00000380367;ENST00000328942	T;T	0.00099	8.73;8.73	5.26	4.31	0.51392	GPCR, rhodopsin-like superfamily (1);	0.164580	0.26948	N	0.021689	T	0.00241	0.0007	L	0.58101	1.795	0.09310	N	1	P	0.35944	0.529	P	0.48524	0.58	T	0.26155	-1.0111	10	0.31617	T	0.26	.	8.8151	0.34991	0.1903:0.0:0.8097:0.0	.	278	Q9UKL2	O52A1_HUMAN	I	278	ENSP00000369725:L278I;ENSP00000333684:L278I	ENSP00000333684:L278I	L	-	1	0	OR52A1	5129344	0.000000	0.05858	0.041000	0.18516	0.679000	0.39708	-2.093000	0.01353	1.369000	0.46134	0.655000	0.94253	CTC	OR52A1	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000182070		0.433	OR52A1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR52A1	HGNC	protein_coding	OTTHUMT00000142810.2	194	0.00	0	G	NM_012375		5172768	5172768	-1	no_errors	ENST00000328942	ensembl	human	known	69_37n	missense	218	26.60	79	SNP	0.015	T
OR5H2	79310	genome.wustl.edu	37	3	98002196	98002196	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr3:98002196A>C	ENST00000355273.2	+	1	465	c.465A>C	c.(463-465)ttA>ttC	p.L155F	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						TCTCATTTTTAGGTGGCTTCC	0.353																																						dbGAP											0													108.0	99.0	102.0					3																	98002196		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.465A>C	3.37:g.98002196A>C	ENSP00000347418:p.Leu155Phe		Q6IF87	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L155F	ENST00000355273.2	37	c.465	CCDS33801.1	3	.	.	.	.	.	.	.	.	.	.	A	6.989	0.552613	0.13374	.	.	ENSG00000197938	ENST00000355273	T	0.41758	0.99	3.03	-1.7	0.08159	GPCR, rhodopsin-like superfamily (1);	1.272910	0.05909	U	0.631293	T	0.32133	0.0819	L	0.33710	1.025	0.09310	N	1	B	0.18013	0.025	B	0.23852	0.049	T	0.35475	-0.9787	10	0.41790	T	0.15	.	8.1736	0.31268	0.3167:0.0:0.0:0.6833	.	155	Q8NGV7	OR5H2_HUMAN	F	155	ENSP00000347418:L155F	ENSP00000347418:L155F	L	+	3	2	OR5H2	99484886	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-1.276000	0.02815	-0.421000	0.07416	-0.871000	0.02989	TTA	OR5H2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197938		0.353	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H2	HGNC	protein_coding	OTTHUMT00000359113.2	143	0.00	0	A			98002196	98002196	+1	no_errors	ENST00000355273	ensembl	human	known	69_37n	missense	167	28.94	68	SNP	0.002	C
OR8B12	219858	genome.wustl.edu	37	11	124412667	124412667	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:124412667T>A	ENST00000306842.2	-	1	908	c.884A>T	c.(883-885)gAt>gTt	p.D295V		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		AACTTTGACATCCTTGTTCCT	0.423																																						dbGAP											0													63.0	60.0	61.0					11																	124412667		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.884A>T	11.37:g.124412667T>A	ENSP00000307159:p.Asp295Val		B2RNF6|Q6IEW8|Q96RC7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D295V	ENST00000306842.2	37	c.884	CCDS31711.1	11	.	.	.	.	.	.	.	.	.	.	T	18.62	3.664192	0.67700	.	.	ENSG00000170953	ENST00000306842	T	0.40476	1.03	3.89	3.89	0.44902	.	0.103901	0.42964	D	0.000637	T	0.72748	0.3499	H	0.96111	3.77	0.58432	D	0.999999	D	0.71674	0.998	D	0.70716	0.97	T	0.81865	-0.0736	10	0.87932	D	0	.	12.6428	0.56718	0.0:0.0:0.0:1.0	.	295	Q8NGG6	OR8BC_HUMAN	V	295	ENSP00000307159:D295V	ENSP00000307159:D295V	D	-	2	0	OR8B12	123917877	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.341000	0.65964	1.988000	0.58038	0.528000	0.53228	GAT	OR8B12	-	prints_7TM_GPCR_Rhodpsn	ENSG00000170953		0.423	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B12	HGNC	protein_coding	OTTHUMT00000387061.1	92	0.00	0	T			124412667	124412667	-1	no_errors	ENST00000306842	ensembl	human	known	69_37n	missense	100	23.66	31	SNP	1.000	A
OTOGL	283310	genome.wustl.edu	37	12	80613594	80613594	+	Splice_Site	SNP	G	G	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr12:80613594G>A	ENST00000547103.1	+	5	215	c.209G>A	c.(208-210)gGt>gAt	p.G70D	OTOGL_ENST00000458043.2_Splice_Site_p.G70D			Q3ZCN5	OTOGL_HUMAN	otogelin-like	70					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TCCCCCTCAGGTTCTTGTCCT	0.358																																						dbGAP											0													52.0	48.0	49.0					12																	80613594		1798	4081	5879	-	-	-	SO:0001630	splice_region_variant	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.209-1G>A	12.37:g.80613594G>A			F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.G70D	ENST00000547103.1	37	c.209		12	.	.	.	.	.	.	.	.	.	.	G	20.4	3.980146	0.74474	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.15487	2.42;2.42	5.96	5.96	0.96718	.	.	.	.	.	T	0.27731	0.0682	L	0.38175	1.15	0.42668	D	0.993505	.	.	.	.	.	.	T	0.00199	-1.1928	6	.	.	.	.	20.4173	0.99028	0.0:0.0:1.0:0.0	.	.	.	.	D	70	ENSP00000447211:G70D;ENSP00000400895:G70D	.	G	+	2	0	OTOGL	79137725	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.877000	0.63086	2.826000	0.97356	0.637000	0.83480	GGT	OTOGL	-	NULL	ENSG00000165899		0.358	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	74	0.00	0	G	NM_173591	Missense_Mutation	80613594	80613594	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	52	53.45	62	SNP	1.000	A
PARP14	54625	genome.wustl.edu	37	3	122414437	122414437	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr3:122414437G>C	ENST00000474629.2	+	5	1029	c.763G>C	c.(763-765)Ggg>Cgg	p.G255R		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CTATAATGGAGGGGGAAGAGT	0.378																																						dbGAP											0													41.0	39.0	40.0					3																	122414437		1811	4083	5894	-	-	-	SO:0001583	missense	0			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.763G>C	3.37:g.122414437G>C	ENSP00000418194:p.Gly255Arg		B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	pfam_A1pp,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_A1pp,pfscan_A1pp,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.G255R	ENST00000474629.2	37	c.763	CCDS46894.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.66|15.66	2.900395|2.900395	0.52227|0.52227	.|.	.|.	ENSG00000173193|ENSG00000173193	ENST00000474629;ENST00000398162|ENST00000494811	T|.	0.75050|.	-0.9|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.000000|.	0.64402|.	D|.	0.000007|.	T|T	0.75606|0.75606	0.3872|0.3872	M|M	0.72894|0.72894	2.215|2.215	0.58432|0.58432	D|D	0.99999|0.99999	D|.	0.89917|.	1.0|.	D|.	0.81914|.	0.995|.	T|T	0.74031|0.74031	-0.3795|-0.3795	10|5	0.87932|.	D|.	0|.	.|.	17.9711|17.9711	0.89113|0.89113	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	255|.	Q460N5|.	PAR14_HUMAN|.	R|T	255;174|182	ENSP00000418194:G255R|.	ENSP00000381228:G174R|.	G|R	+|+	1|2	0|0	PARP14|PARP14	123897127|123897127	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.307000|0.307000	0.27823|0.27823	5.085000|5.085000	0.64468|0.64468	2.831000|2.831000	0.97527|0.97527	0.561000|0.561000	0.74099|0.74099	GGG|AGG	PARP14	-	NULL	ENSG00000173193		0.378	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	HGNC	protein_coding	OTTHUMT00000356173.2	60	0.00	0	G	NM_017554		122414437	122414437	+1	no_errors	ENST00000474629	ensembl	human	known	69_37n	missense	80	14.89	14	SNP	1.000	C
PCDHA7	56141	genome.wustl.edu	37	5	140214974	140214974	+	Missense_Mutation	SNP	G	G	C	rs149493398	byFrequency	TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr5:140214974G>C	ENST00000525929.1	+	1	1006	c.1006G>C	c.(1006-1008)Gtt>Ctt	p.V336L	PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.V336L|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	336	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCATTGTACAGTTCTTGTGGA	0.488																																					NSCLC(160;258 2013 5070 22440 28951)	dbGAP											0													215.0	181.0	192.0					5																	140214974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1006G>C	5.37:g.140214974G>C	ENSP00000436426:p.Val336Leu		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V336L	ENST00000525929.1	37	c.1006	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	G	8.188	0.795267	0.16327	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.57107	0.42;0.42	4.04	1.07	0.20283	Cadherin (4);Cadherin-like (1);	0.000000	0.29080	U	0.013211	T	0.48409	0.1498	L	0.52823	1.66	0.09310	N	1	B;B	0.25904	0.123;0.137	B;B	0.38194	0.174;0.267	T	0.48019	-0.9071	10	0.49607	T	0.09	.	6.1566	0.20340	0.2341:0.0:0.6326:0.1333	.	336;336	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	L	336	ENSP00000436426:V336L;ENSP00000367365:V336L	ENSP00000367365:V336L	V	+	1	0	PCDHA7	140195158	0.108000	0.22018	0.339000	0.25562	0.619000	0.37552	0.389000	0.20751	0.268000	0.21939	0.305000	0.20034	GTT	PCDHA7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204963		0.488	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	217	0.00	0	G	NM_018910		140214974	140214974	+1	no_errors	ENST00000525929	ensembl	human	known	69_37n	missense	138	36.99	81	SNP	0.265	C
PHLDB1	23187	genome.wustl.edu	37	11	118498583	118498583	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:118498583G>T	ENST00000361417.2	+	7	1455	c.1044G>T	c.(1042-1044)gaG>gaT	p.E348D	PHLDB1_ENST00000356063.5_Missense_Mutation_p.E348D	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	348										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GAGCCACTGAGAGCCCCCGGC	0.662																																						dbGAP											0													22.0	25.0	24.0					11																	118498583		2198	4288	6486	-	-	-	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1044G>T	11.37:g.118498583G>T	ENSP00000354498:p.Glu348Asp		B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E348D	ENST00000361417.2	37	c.1044	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	G	12.44	1.937238	0.34189	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000543207;ENST00000356063	T;T	0.34667	1.37;1.35	5.13	4.22	0.49857	.	0.822089	0.11527	N	0.555064	T	0.31918	0.0812	L	0.36672	1.1	0.80722	D	1	P;P;B;P	0.49783	0.928;0.898;0.318;0.649	P;B;B;B	0.46975	0.533;0.265;0.073;0.253	T	0.01951	-1.1241	10	0.14252	T	0.57	-31.5997	9.3125	0.37915	0.0969:0.0:0.9031:0.0	.	347;348;348;348	B4DIX4;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	D	348;107;347;348	ENSP00000354498:E348D;ENSP00000348359:E348D	ENSP00000348359:E348D	E	+	3	2	PHLDB1	118003793	0.167000	0.22975	1.000000	0.80357	0.996000	0.88848	0.273000	0.18662	1.381000	0.46364	0.563000	0.77884	GAG	PHLDB1	-	NULL	ENSG00000019144		0.662	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	13	0.00	0	G	NM_015157		118498583	118498583	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	1.000	T
PLEKHB2	55041	genome.wustl.edu	37	2	132110630	132110630	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr2:132110630C>T	ENST00000404460.1	+	7	515	c.461C>T	c.(460-462)aCg>aTg	p.T154M	PLEKHB2_ENST00000303908.3_Missense_Mutation_p.T154M			Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	0						endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		CACACCACCACGAGTGCAAAA	0.458																																						dbGAP											0													12.0	17.0	16.0					2																	132110630		691	1590	2281	-	-	-	SO:0001583	missense	0				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000404460.1:c.461C>T	2.37:g.132110630C>T	ENSP00000385609:p.Thr154Met		B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T154M	ENST00000404460.1	37	c.461		2	.	.	.	.	.	.	.	.	.	.	.	7.847	0.723090	0.15439	.	.	ENSG00000115762	ENST00000404460;ENST00000303908	.	.	.	0.438	0.438	0.16560	.	.	.	.	.	T	0.19805	0.0476	.	.	.	0.80722	D	1	D	0.60160	0.987	B	0.31812	0.136	T	0.08513	-1.0718	7	0.38643	T	0.18	-7.0876	4.2362	0.10627	1.0E-4:0.5577:0.4422:0.0	.	154	B7WPA5	.	M	154	.	ENSP00000306852:T154M	T	+	2	0	PLEKHB2	131827100	0.626000	0.27120	0.828000	0.32881	0.111000	0.19643	-1.542000	0.02196	0.494000	0.27859	0.134000	0.15878	ACG	PLEKHB2	-	NULL	ENSG00000115762		0.458	PLEKHB2-002	KNOWN	basic	protein_coding	PLEKHB2	HGNC	protein_coding	OTTHUMT00000318943.2	158	0.00	0	C	NM_017958		132110630	132110630	+1	no_errors	ENST00000303908	ensembl	human	known	69_37n	missense	169	31.58	78	SNP	1.000	T
PPP1R3A	5506	genome.wustl.edu	37	7	113558810	113558810	+	Frame_Shift_Del	DEL	T	T	-	rs139730639		TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr7:113558810delT	ENST00000284601.3	-	1	310	c.242delA	c.(241-243)gatfs	p.D81fs		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	81					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTCCCAGCAATCAAATTCTTT	0.403																																						dbGAP											0													88.0	84.0	85.0					7																	113558810		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.242delA	7.37:g.113558810delT	ENSP00000284601:p.Asp81fs		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Frame_Shift_Del	DEL	pfam_CBM_21,pfscan_CBM_21	p.D81fs	ENST00000284601.3	37	c.242	CCDS5759.1	7																																																																																			PPP1R3A	-	NULL	ENSG00000154415		0.403	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	61	0.00	0	T	NM_002711		113558810	113558810	-1	no_errors	ENST00000284601	ensembl	human	known	69_37n	frame_shift_del	72	20.83	20	DEL	1.000	-
PPP1R3A	5506	genome.wustl.edu	37	7	113558812	113558812	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr7:113558812A>C	ENST00000284601.3	-	1	308	c.240T>G	c.(238-240)ttT>ttG	p.F80L		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	80					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						CCCAGCAATCAAATTCTTTAA	0.398																																						dbGAP											0													86.0	82.0	84.0					7																	113558812		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.240T>G	7.37:g.113558812A>C	ENSP00000284601:p.Phe80Leu		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.F80L	ENST00000284601.3	37	c.240	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	A	23.9	4.470818	0.84533	.	.	ENSG00000154415	ENST00000284601	T	0.31510	1.49	6.17	5.03	0.67393	.	0.055509	0.64402	D	0.000001	T	0.48059	0.1479	M	0.62723	1.935	0.80722	D	1	D	0.53885	0.963	P	0.59546	0.859	T	0.48352	-0.9043	10	0.72032	D	0.01	-0.1224	12.3382	0.55079	0.9347:0.0:0.0653:0.0	.	80	Q16821	PPR3A_HUMAN	L	80	ENSP00000284601:F80L	ENSP00000284601:F80L	F	-	3	2	PPP1R3A	113346048	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.064000	0.49986	1.161000	0.42604	0.533000	0.62120	TTT	PPP1R3A	-	NULL	ENSG00000154415		0.398	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	63	0.00	0	A	NM_002711		113558812	113558812	-1	no_errors	ENST00000284601	ensembl	human	known	69_37n	missense	74	23.71	23	SNP	1.000	C
PRMT3	10196	genome.wustl.edu	37	11	20417383	20417383	+	Silent	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:20417383C>T	ENST00000331079.6	+	6	652	c.435C>T	c.(433-435)ccC>ccT	p.P145P	PRMT3_ENST00000437750.2_Silent_p.P83P	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	145					histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						TGTCAGTACCCTTCTCATACC	0.373																																						dbGAP											0													113.0	109.0	111.0					11																	20417383		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.435C>T	11.37:g.20417383C>T			B4DUC7	Silent	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_mo5U34_MeTrfase,pfam_Methyltransf_11,pfam_Arg_MeTrfase,pfam_Small_mtfrase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.P145	ENST00000331079.6	37	c.435	CCDS7853.1	11																																																																																			PRMT3	-	NULL	ENSG00000185238		0.373	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT3	HGNC	protein_coding	OTTHUMT00000387489.1	129	0.00	0	C	NM_005788		20417383	20417383	+1	no_errors	ENST00000331079	ensembl	human	known	69_37n	silent	169	36.94	99	SNP	0.340	T
RAD21	5885	genome.wustl.edu	37	8	117862992	117862992	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr8:117862992C>A	ENST00000297338.2	-	12	1772	c.1485G>T	c.(1483-1485)gaG>gaT	p.E495D	RAD21_ENST00000517749.1_5'Flank|RAD21_ENST00000523986.1_5'UTR|RAD21_ENST00000518055.1_Missense_Mutation_p.E40D	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	495	Pro-rich.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TTTCCATCTGCTCTACCTGCT	0.368																																						dbGAP											0													112.0	110.0	111.0					8																	117862992		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.1485G>T	8.37:g.117862992C>A	ENSP00000297338:p.Glu495Asp		A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu,pfam_ScpA	p.E495D	ENST00000297338.2	37	c.1485	CCDS6321.1	8	.	.	.	.	.	.	.	.	.	.	C	9.823	1.186332	0.21870	.	.	ENSG00000164754	ENST00000297338;ENST00000518055	T;T	0.64085	0.68;-0.08	5.36	2.62	0.31277	.	0.286883	0.40385	N	0.001116	T	0.45637	0.1352	L	0.35723	1.085	0.36848	D	0.88774	B	0.12013	0.005	B	0.10450	0.005	T	0.32079	-0.9920	10	0.17832	T	0.49	-12.4749	7.4749	0.27369	0.0:0.5322:0.0:0.4678	.	495	O60216	RAD21_HUMAN	D	495;40	ENSP00000297338:E495D;ENSP00000428003:E40D	ENSP00000297338:E495D	E	-	3	2	RAD21	117932173	0.987000	0.35691	1.000000	0.80357	0.994000	0.84299	0.103000	0.15292	0.250000	0.21479	0.467000	0.42956	GAG	RAD21	-	NULL	ENSG00000164754		0.368	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21	HGNC	protein_coding	OTTHUMT00000381184.1	193	0.00	0	C	NM_006265		117862992	117862992	-1	no_errors	ENST00000297338	ensembl	human	known	69_37n	missense	390	19.38	94	SNP	1.000	A
RAG2	5897	genome.wustl.edu	37	11	36614637	36614637	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr11:36614637G>A	ENST00000311485.3	-	2	1243	c.1082C>T	c.(1081-1083)aCa>aTa	p.T361I	C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000534635.1_5'Flank|C11orf74_ENST00000446510.2_5'Flank|RAG2_ENST00000528428.1_5'Flank|C11orf74_ENST00000347206.4_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	361					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				GTTTGTGAATGTTGTCTGCTC	0.363									Familial Hemophagocytic Lymphohistiocytosis																													dbGAP											0													173.0	166.0	168.0					11																	36614637		2202	4298	6500	-	-	-	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.1082C>T	11.37:g.36614637G>A	ENSP00000308620:p.Thr361Ile		A8K9E9|Q8TBL4	Missense_Mutation	SNP	pfam_RAG2,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_Znf_FYVE_PHD	p.T361I	ENST00000311485.3	37	c.1082	CCDS7903.1	11	.	.	.	.	.	.	.	.	.	.	G	2.167	-0.390843	0.04932	.	.	ENSG00000175097	ENST00000311485	D	0.90324	-2.65	5.31	3.01	0.34805	.	0.640941	0.16223	N	0.223941	D	0.86855	0.6033	L	0.59436	1.845	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.76929	-0.2777	10	0.48119	T	0.1	-0.6369	7.7602	0.28948	0.3048:0.0:0.6952:0.0	.	361	P55895	RAG2_HUMAN	I	361	ENSP00000308620:T361I	ENSP00000308620:T361I	T	-	2	0	RAG2	36571213	0.912000	0.30974	0.168000	0.22838	0.393000	0.30537	2.904000	0.48719	0.466000	0.27193	0.650000	0.86243	ACA	RAG2	-	pfam_RAG2	ENSG00000175097		0.363	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG2	HGNC	protein_coding	OTTHUMT00000389536.1	236	0.00	0	G	NM_000536		36614637	36614637	-1	no_errors	ENST00000311485	ensembl	human	known	69_37n	missense	290	30.12	125	SNP	0.059	A
RASL12	51285	genome.wustl.edu	37	15	65350882	65350882	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr15:65350882C>T	ENST00000220062.4	-	4	584	c.308G>A	c.(307-309)cGc>cAc	p.R103H	RASL12_ENST00000434605.2_Missense_Mutation_p.R92H|RASL12_ENST00000421977.3_Missense_Mutation_p.R84H	NM_016563.2	NP_057647.1	Q9NYN1	RASLC_HUMAN	RAS-like, family 12	103					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			lung(1)|ovary(1)|skin(1)|urinary_tract(1)	4						AAAGCTCTGGCGGCTGTCGAC	0.637																																						dbGAP											0													61.0	56.0	58.0					15																	65350882		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF233588	CCDS10200.1	15q11.2-q22.33	2014-05-09			ENSG00000103710	ENSG00000103710			30289	protein-coding gene	gene with protein product	"""Ras family member Ris"""					12107412	Standard	NM_016563		Approved	RIS	uc002aoi.1	Q9NYN1	OTTHUMG00000133115	ENST00000220062.4:c.308G>A	15.37:g.65350882C>T	ENSP00000220062:p.Arg103His		B2RC29|B4DJW2|B4DU82	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R103H	ENST00000220062.4	37	c.308	CCDS10200.1	15	.	.	.	.	.	.	.	.	.	.	C	21.7	4.187503	0.78789	.	.	ENSG00000103710	ENST00000220062;ENST00000421977;ENST00000434605	T;T;T	0.78364	-1.17;-1.17;-1.17	5.34	4.42	0.53409	Small GTP-binding protein domain (1);	0.198125	0.38381	N	0.001708	D	0.85344	0.5675	M	0.75085	2.285	0.43852	D	0.996443	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71184	0.972;0.963;0.949	D	0.86244	0.1645	10	0.87932	D	0	.	9.7515	0.40478	0.0:0.8465:0.0:0.1535	.	92;84;103	B4DU82;B4DJW2;Q9NYN1	.;.;RASLC_HUMAN	H	103;84;92	ENSP00000220062:R103H;ENSP00000390028:R84H;ENSP00000412787:R92H	ENSP00000220062:R103H	R	-	2	0	RASL12	63137935	0.997000	0.39634	1.000000	0.80357	0.992000	0.81027	2.056000	0.41355	2.477000	0.83638	0.561000	0.74099	CGC	RASL12	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000103710		0.637	RASL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL12	HGNC	protein_coding	OTTHUMT00000256782.2	47	0.00	0	C	NM_016563		65350882	65350882	-1	no_errors	ENST00000220062	ensembl	human	known	69_37n	missense	80	36.51	46	SNP	1.000	T
RFC4	5984	genome.wustl.edu	37	3	186518913	186518913	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr3:186518913C>G	ENST00000392481.2	-	3	484	c.203G>C	c.(202-204)gGa>gCa	p.G68A	RFC4_ENST00000433496.1_Missense_Mutation_p.G68A|RFC4_ENST00000296273.2_Missense_Mutation_p.G68A	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	68					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		CACATCTGCTCCTTCTAAAGA	0.403																																						dbGAP											0													117.0	122.0	120.0					3																	186518913		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.203G>C	3.37:g.186518913C>G	ENSP00000376272:p.Gly68Ala		B4DM41|D3DNV2|Q6FHX7	Missense_Mutation	SNP	pfam_Rep_factorC_C_dom,pfam_ATPase_AAA_core,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.G68A	ENST00000392481.2	37	c.203	CCDS3283.1	3	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459759	0.63401	.	.	ENSG00000163918	ENST00000433496;ENST00000392481;ENST00000296273;ENST00000418288;ENST00000447345;ENST00000427785;ENST00000448497	T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;2.46	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.53417	0.1795	L	0.33710	1.025	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.70016	0.947;0.967	T	0.37009	-0.9724	10	0.27082	T	0.32	.	17.9158	0.88950	0.0:1.0:0.0:0.0	.	68;68	B4DM41;P35249	.;RFC4_HUMAN	A	68	ENSP00000399769:G68A;ENSP00000376272:G68A;ENSP00000296273:G68A;ENSP00000411300:G68A;ENSP00000413065:G68A;ENSP00000407982:G68A;ENSP00000415099:G68A	ENSP00000296273:G68A	G	-	2	0	RFC4	188001607	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.276000	0.78559	2.832000	0.97577	0.655000	0.94253	GGA	RFC4	-	NULL	ENSG00000163918		0.403	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC4	HGNC	protein_coding	OTTHUMT00000344471.1	108	0.00	0	C	NM_002916		186518913	186518913	-1	no_errors	ENST00000296273	ensembl	human	known	69_37n	missense	136	36.57	79	SNP	1.000	G
RIC8B	55188	genome.wustl.edu	37	12	107208904	107208904	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr12:107208904G>T	ENST00000392839.2	+	3	669	c.563G>T	c.(562-564)gGa>gTa	p.G188V	RIC8B_ENST00000392837.4_Missense_Mutation_p.G188V|RIC8B_ENST00000549643.1_Intron|RIC8B_ENST00000355478.2_Missense_Mutation_p.G148V	NM_018157.2	NP_060627.2	Q9NVN3	RIC8B_HUMAN	RIC8 guanine nucleotide exchange factor B	188					regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	G-protein alpha-subunit binding (GO:0001965)|guanyl-nucleotide exchange factor activity (GO:0005085)			kidney(2)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	19						GAGCTCCAGGGACTACCGCTG	0.468																																						dbGAP											0													143.0	126.0	132.0					12																	107208904		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK128102	CCDS9109.2	12q23.3	2013-08-05	2013-08-05		ENSG00000111785	ENSG00000111785			25555	protein-coding gene	gene with protein product		609147	"""resistance to inhibitors of cholinesterase 8 homolog B (C. elegans)"""				Standard	XM_005268998		Approved	FLJ10620, hSyn, RIC8	uc001tlx.3	Q9NVN3	OTTHUMG00000144188	ENST00000392839.2:c.563G>T	12.37:g.107208904G>T	ENSP00000376583:p.Gly188Val		A2RTZ0|Q4G103|Q6ZRN4|Q86WD3	Missense_Mutation	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn	p.G188V	ENST00000392839.2	37	c.563	CCDS9109.2	12	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324858	0.81580	.	.	ENSG00000111785	ENST00000392837;ENST00000392839;ENST00000355478	T;T;T	0.48201	0.82;0.82;0.82	5.91	5.91	0.95273	Armadillo-type fold (1);	0.093168	0.85682	D	0.000000	T	0.71134	0.3304	M	0.79614	2.46	0.80722	D	1	D;D;D	0.76494	0.986;0.999;0.999	P;D;D	0.71184	0.843;0.961;0.972	T	0.70156	-0.4949	10	0.49607	T	0.09	-6.9928	20.2963	0.98556	0.0:0.0:1.0:0.0	.	148;188;188	Q9NVN3-3;Q9NVN3;B7WPL0	.;RIC8B_HUMAN;.	V	188;188;148	ENSP00000376582:G188V;ENSP00000376583:G188V;ENSP00000347662:G148V	ENSP00000347662:G148V	G	+	2	0	RIC8B	105733034	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.776000	0.75023	2.813000	0.96785	0.655000	0.94253	GGA	RIC8B	-	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold	ENSG00000111785		0.468	RIC8B-006	KNOWN	basic|exp_conf|CCDS	protein_coding	RIC8B	HGNC	protein_coding	OTTHUMT00000291398.2	153	0.00	0	G	NM_018157		107208904	107208904	+1	no_errors	ENST00000392837	ensembl	human	known	69_37n	missense	126	45.73	107	SNP	1.000	T
RPH3A	22895	genome.wustl.edu	37	12	113314597	113314597	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr12:113314597C>G	ENST00000389385.4	+	13	1594	c.1097C>G	c.(1096-1098)cCt>cGt	p.P366R	RPH3A_ENST00000420983.2_Missense_Mutation_p.P366R|RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000415485.3_Missense_Mutation_p.P366R|RPH3A_ENST00000548866.1_Missense_Mutation_p.P317R|RPH3A_ENST00000447659.2_Missense_Mutation_p.P317R|RPH3A_ENST00000543106.2_Missense_Mutation_p.P366R|RPH3A_ENST00000551052.1_Missense_Mutation_p.P362R	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	366	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GCCCCCCAGCCTGCTGCAGCC	0.627																																						dbGAP											0													33.0	34.0	34.0					12																	113314597		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1097C>G	12.37:g.113314597C>G	ENSP00000374036:p.Pro366Arg		B7Z3C3|Q96AE0	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Rabphilin3A_effector_Zn-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.P366R	ENST00000389385.4	37	c.1097	CCDS44979.1	12	.	.	.	.	.	.	.	.	.	.	C	16.19	3.051876	0.55218	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913;ENST00000552755	T;T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29;2.29	4.99	4.09	0.47781	.	0.500458	0.18206	N	0.148329	T	0.14700	0.0355	L	0.46157	1.445	0.28137	N	0.929955	B;P;P;P	0.47677	0.046;0.838;0.838;0.899	B;B;B;B	0.42422	0.021;0.296;0.296;0.387	T	0.05566	-1.0877	10	0.13470	T	0.59	.	8.9892	0.36012	0.0:0.8253:0.0:0.1747	.	317;366;366;362	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	R	366;366;317;362;366;317;366;18;18	ENSP00000440384:P366R;ENSP00000374036:P366R;ENSP00000413254:P317R;ENSP00000448297:P362R;ENSP00000405357:P366R;ENSP00000450347:P317R;ENSP00000408889:P366R	ENSP00000374036:P366R	P	+	2	0	RPH3A	111798980	0.210000	0.23517	0.250000	0.24296	0.313000	0.28021	2.033000	0.41136	1.081000	0.41110	0.511000	0.50034	CCT	RPH3A	-	NULL	ENSG00000089169		0.627	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	32	0.00	0	C	NM_014954		113314597	113314597	+1	no_errors	ENST00000389385	ensembl	human	known	69_37n	missense	31	33.33	16	SNP	0.001	G
RPS6KA6	27330	genome.wustl.edu	37	X	83319326	83319326	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chrX:83319326G>T	ENST00000262752.2	-	22	2204	c.2197C>A	c.(2197-2199)Cag>Aag	p.Q733K	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.Q733K	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	733					axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						CTCCGTCGCTGGGCTAAGCTT	0.448																																						dbGAP											0													99.0	80.0	86.0					X																	83319326		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.2197C>A	X.37:g.83319326G>T	ENSP00000262752:p.Gln733Lys		B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	p.Q733K	ENST00000262752.2	37	c.2197	CCDS14451.1	X	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849074	0.32699	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.66995	-0.24;-0.22	5.11	5.11	0.69529	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.56529	0.1991	L	0.37750	1.13	0.80722	D	1	B;B	0.20550	0.046;0.046	B;B	0.21360	0.023;0.034	T	0.53606	-0.8415	10	0.10377	T	0.69	.	17.7189	0.88344	0.0:0.0:1.0:0.0	.	733;733	B7ZL90;Q9UK32	.;KS6A6_HUMAN	K	733	ENSP00000262752:Q733K;ENSP00000440830:Q733K	ENSP00000262752:Q733K	Q	-	1	0	RPS6KA6	83205982	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.130000	0.94437	2.114000	0.64651	0.600000	0.82982	CAG	RPS6KA6	-	superfamily_Kinase-like_dom,pirsf_Ribosomal_S6_kinase_II	ENSG00000072133		0.448	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	HGNC	protein_coding	OTTHUMT00000057372.1	212	0.00	0	G	NM_014496		83319326	83319326	-1	no_errors	ENST00000262752	ensembl	human	known	69_37n	missense	239	29.82	102	SNP	1.000	T
RTKN	6242	genome.wustl.edu	37	2	74659725	74659725	+	Silent	SNP	T	T	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr2:74659725T>C	ENST00000233330.6	-	2	347	c.30A>G	c.(28-30)gcA>gcG	p.A10A	RTKN_ENST00000484453.1_5'UTR|RTKN_ENST00000272430.5_Silent_p.A60A|RTKN_ENST00000305557.5_Silent_p.A47A	NM_001015056.1	NP_001015056.1			rhotekin											endometrium(3)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	16						GGGAGCAGGCTGCCAGCAGCT	0.622																																						dbGAP											0													70.0	63.0	65.0					2																	74659725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF049227	CCDS1941.1, CCDS33226.1, CCDS42699.1	2p13.1	2013-01-10			ENSG00000114993	ENSG00000114993		"""Pleckstrin homology (PH) domain containing"""	10466	protein-coding gene	gene with protein product		602288				9073523, 10940294	Standard	XM_005264478		Approved	B5	uc002sle.3	Q9BST9	OTTHUMG00000129955	ENST00000233330.6:c.30A>G	2.37:g.74659725T>C				Silent	SNP	pfam_Pleckstrin_homology,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A60	ENST00000233330.6	37	c.180	CCDS42699.1	2																																																																																			RTKN	-	pfam_HR1_rho-bd,superfamily_HR1_rho-bd,smart_HR1_rho-bd	ENSG00000114993		0.622	RTKN-004	NOVEL	basic|exp_conf|CCDS	protein_coding	RTKN	HGNC	protein_coding	OTTHUMT00000328236.3	34	0.00	0	T	NM_001015055		74659725	74659725	-1	no_errors	ENST00000272430	ensembl	human	known	69_37n	silent	36	45.59	31	SNP	0.385	C
SLC10A3	8273	genome.wustl.edu	37	X	153716008	153716008	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chrX:153716008C>A	ENST00000393587.4	-	3	1535	c.1272G>T	c.(1270-1272)caG>caT	p.Q424H	UBL4A_ENST00000369660.4_5'Flank|SLC10A3_ENST00000263512.4_Missense_Mutation_p.Q424H|UBL4A_ENST00000369653.4_5'Flank|UBL4A_ENST00000477777.1_5'Flank|SLC10A3_ENST00000393586.1_Missense_Mutation_p.Q479H|SLC10A3_ENST00000369649.4_Missense_Mutation_p.Q395H	NM_001142391.1|NM_001142392.1	NP_001135863.1|NP_001135864.1	P09131	P3_HUMAN	solute carrier family 10, member 3	424					response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)	p.Q424H(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCAGGCTGTTCTGCACCCCTA	0.652																																						dbGAP											1	Substitution - Missense(1)	lung(1)											58.0	48.0	51.0					X																	153716008		2203	4300	6503	-	-	-	SO:0001583	missense	0			X12458	CCDS14755.1, CCDS48195.1	Xq28	2013-07-18	2013-07-18		ENSG00000126903	ENSG00000126903		"""Solute carriers"""	22979	protein-coding gene	gene with protein product		312090				8733135	Standard	NM_019848		Approved	P3, DXS253E	uc004flq.3	P09131	OTTHUMG00000013369	ENST00000393587.4:c.1272G>T	X.37:g.153716008C>A	ENSP00000377212:p.Gln424His		Q5HY79|Q9BSL2	Missense_Mutation	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.Q424H	ENST00000393587.4	37	c.1272	CCDS14755.1	X	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450738	0.43531	.	.	ENSG00000126903	ENST00000369649;ENST00000393586;ENST00000263512;ENST00000393587	T;T;T;T	0.22336	2.18;1.96;1.96;1.96	5.4	0.74	0.18330	.	0.000000	0.64402	U	0.000001	T	0.26955	0.0660	M	0.67953	2.075	0.47183	D	0.999342	P;P	0.45212	0.853;0.76	B;P	0.45195	0.376;0.473	T	0.05835	-1.0861	10	0.72032	D	0.01	-15.542	12.2474	0.54578	0.0:0.802:0.0:0.198	.	395;424	Q9BSL2;P09131	.;P3_HUMAN	H	395;479;424;424	ENSP00000358663:Q395H;ENSP00000377211:Q479H;ENSP00000263512:Q424H;ENSP00000377212:Q424H	ENSP00000263512:Q424H	Q	-	3	2	SLC10A3	153369202	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	1.002000	0.29796	-0.290000	0.09025	-0.503000	0.04515	CAG	SLC10A3	-	tigrfam_Bil_ac_transpt	ENSG00000126903		0.652	SLC10A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A3	HGNC	protein_coding	OTTHUMT00000037235.3	33	0.00	0	C	NM_019848		153716008	153716008	-1	no_errors	ENST00000263512	ensembl	human	known	69_37n	missense	51	22.73	15	SNP	1.000	A
SLC24A2	25769	genome.wustl.edu	37	9	19786554	19786554	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr9:19786554G>T	ENST00000341998.2	-	1	372	c.311C>A	c.(310-312)tCt>tAt	p.S104Y	SLC24A2_ENST00000286344.3_Missense_Mutation_p.S104Y	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	104					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		GCCTTCCTTAGAAAGAGGTGG	0.453																																						dbGAP											0													98.0	103.0	102.0					9																	19786554		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.311C>A	9.37:g.19786554G>T	ENSP00000344801:p.Ser104Tyr		B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.S104Y	ENST00000341998.2	37	c.311	CCDS6493.1	9	.	.	.	.	.	.	.	.	.	.	G	4.034	0.003872	0.07866	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.75704	-0.96;-0.96	5.23	2.36	0.29203	.	1.000740	0.08062	N	0.998454	T	0.64897	0.2640	L	0.38175	1.15	0.34385	D	0.693582	B;P	0.35714	0.013;0.517	B;B	0.34931	0.014;0.192	T	0.62081	-0.6929	9	.	.	.	.	10.8269	0.46638	0.2035:0.0:0.7965:0.0	.	104;104	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	Y	104	ENSP00000344801:S104Y;ENSP00000286344:S104Y	.	S	-	2	0	SLC24A2	19776554	0.996000	0.38824	0.229000	0.23960	0.010000	0.07245	2.765000	0.47621	0.781000	0.33589	0.655000	0.94253	TCT	SLC24A2	-	NULL	ENSG00000155886		0.453	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A2	HGNC	protein_coding	OTTHUMT00000051866.2	73	0.00	0	G	NM_020344		19786554	19786554	-1	no_errors	ENST00000341998	ensembl	human	known	69_37n	missense	78	33.90	40	SNP	0.885	T
SLC25A15	10166	genome.wustl.edu	37	13	41373296	41373296	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr13:41373296G>T	ENST00000338625.4	+	3	395	c.159G>T	c.(157-159)aaG>aaT	p.K53N	SLC25A15_ENST00000478827.1_3'UTR	NM_014252.3	NP_055067.1	Q9Y619	ORNT1_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15	53					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|L-ornithine transmembrane transport (GO:1903352)|mitochondrial ornithine transport (GO:0000066)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	L-ornithine transmembrane transporter activity (GO:0000064)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|stomach(1)|urinary_tract(1)	14		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.48e-08)|Epithelial(112;7.51e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000191)|GBM - Glioblastoma multiforme(144;0.00231)|BRCA - Breast invasive adenocarcinoma(63;0.0704)	L-Ornithine(DB00129)	GCTGCCTGAAGACTTACTCCC	0.552																																						dbGAP											0													140.0	125.0	130.0					13																	41373296		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112968	CCDS9373.1	13q14	2013-05-22			ENSG00000102743	ENSG00000102743		"""Solute carriers"""	10985	protein-coding gene	gene with protein product	"""ornithine transporter 1"""	603861		ORNT1, HHH		10369256	Standard	NM_014252		Approved	ORC1, D13S327	uc001uxn.3	Q9Y619	OTTHUMG00000016776	ENST00000338625.4:c.159G>T	13.37:g.41373296G>T	ENSP00000342267:p.Lys53Asn		Q5VZD8|Q9HC45	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.K53N	ENST00000338625.4	37	c.159	CCDS9373.1	13	.	.	.	.	.	.	.	.	.	.	G	7.726	0.698143	0.15106	.	.	ENSG00000102743	ENST00000338625;ENST00000379523;ENST00000417731	T;T	0.80566	-1.39;-1.39	4.67	3.82	0.43975	Mitochondrial carrier domain (2);	0.361912	0.31685	N	0.007240	T	0.79251	0.4414	M	0.69463	2.115	0.38544	D	0.949292	B	0.27140	0.169	B	0.35727	0.209	T	0.77504	-0.2563	10	0.52906	T	0.07	.	8.5991	0.33734	0.1983:0.0:0.8017:0.0	.	53	Q9Y619	ORNT1_HUMAN	N	53	ENSP00000342267:K53N;ENSP00000415826:K53N	ENSP00000342267:K53N	K	+	3	2	SLC25A15	40271296	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	1.810000	0.38932	0.935000	0.37341	-0.136000	0.14681	AAG	SLC25A15	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000102743		0.552	SLC25A15-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A15	HGNC	protein_coding	OTTHUMT00000276149.2	145	0.00	0	G	NM_014252		41373296	41373296	+1	no_errors	ENST00000338625	ensembl	human	known	69_37n	missense	208	32.03	98	SNP	0.979	T
SPAG17	200162	genome.wustl.edu	37	1	118582015	118582015	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:118582015A>C	ENST00000336338.5	-	23	3284	c.3219T>G	c.(3217-3219)atT>atG	p.I1073M		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1073						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CATTTAAATGAATCATAAAAT	0.383																																						dbGAP											0													103.0	99.0	100.0					1																	118582015		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3219T>G	1.37:g.118582015A>C	ENSP00000337804:p.Ile1073Met		Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.I1073M	ENST00000336338.5	37	c.3219	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204839	0.38905	.	.	ENSG00000155761	ENST00000336338	T	0.29655	1.56	5.84	1.06	0.20224	.	0.302345	0.30639	N	0.009195	T	0.29945	0.0749	L	0.56769	1.78	0.26211	N	0.979295	D	0.71674	0.998	D	0.69142	0.962	T	0.09618	-1.0666	10	0.87932	D	0	.	8.4973	0.33136	0.717:0.0:0.283:0.0	.	1073	Q6Q759	SPG17_HUMAN	M	1073	ENSP00000337804:I1073M	ENSP00000337804:I1073M	I	-	3	3	SPAG17	118383538	1.000000	0.71417	0.999000	0.59377	0.164000	0.22412	2.219000	0.42899	0.144000	0.18951	-0.250000	0.11733	ATT	SPAG17	-	NULL	ENSG00000155761		0.383	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	200	0.00	0	A	NM_206996		118582015	118582015	-1	no_errors	ENST00000336338	ensembl	human	known	69_37n	missense	263	29.87	112	SNP	1.000	C
SMG5	23381	genome.wustl.edu	37	1	156236362	156236362	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:156236362G>C	ENST00000361813.5	-	11	1369	c.1225C>G	c.(1225-1227)Ccc>Gcc	p.P409A	SMG5_ENST00000489907.2_5'UTR|SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	409					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GCCGGGACGGGATTCTCGCCC	0.567																																						dbGAP											0													106.0	96.0	100.0					1																	156236362		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.1225C>G	1.37:g.156236362G>C	ENSP00000355261:p.Pro409Ala		D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	pfam_EST1,smart_PINc_nuc-bd	p.P409A	ENST00000361813.5	37	c.1225	CCDS1137.1	1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.090760	0.55968	.	.	ENSG00000198952	ENST00000361813	T	0.29142	1.58	5.36	4.44	0.53790	.	0.579127	0.18986	N	0.125749	T	0.19327	0.0464	L	0.49778	1.585	0.41718	D	0.989499	P	0.42735	0.788	B	0.40702	0.338	T	0.02424	-1.1161	10	0.51188	T	0.08	-19.2586	14.7853	0.69800	0.0:0.1454:0.8546:0.0	.	409	Q9UPR3	SMG5_HUMAN	A	409	ENSP00000355261:P409A	ENSP00000355261:P409A	P	-	1	0	SMG5	154502986	1.000000	0.71417	0.914000	0.36105	0.738000	0.42128	4.206000	0.58473	1.243000	0.43853	-0.176000	0.13171	CCC	SMG5	-	NULL	ENSG00000198952		0.567	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1	217	0.00	0	G	NM_015327		156236362	156236362	-1	no_errors	ENST00000361813	ensembl	human	known	69_37n	missense	277	30.42	122	SNP	0.244	C
SSC4D	136853	genome.wustl.edu	37	7	76019578	76019578	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr7:76019578A>T	ENST00000275560.3	-	11	1873	c.1526T>A	c.(1525-1527)gTc>gAc	p.V509D	SRCRB4D_ENST00000492979.2_5'UTR	NM_080744.1	NP_542782.1														autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						GCGGCACAGGACACCGGCTGC	0.657																																						dbGAP											0													41.0	40.0	40.0					7																	76019578		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000275560.3:c.1526T>A	7.37:g.76019578A>T	ENSP00000275560:p.Val509Asp			Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.V509D	ENST00000275560.3	37	c.1526	CCDS5585.1	7	.	.	.	.	.	.	.	.	.	.	A	31	5.090636	0.94149	.	.	ENSG00000146700	ENST00000275560	T	0.49720	0.77	5.81	5.81	0.92471	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.000000	0.85682	D	0.000000	T	0.79464	0.4450	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86487	0.1795	10	0.87932	D	0	.	15.3415	0.74300	1.0:0.0:0.0:0.0	.	509	Q8WTU2	SRB4D_HUMAN	D	509	ENSP00000275560:V509D	ENSP00000275560:V509D	V	-	2	0	SRCRB4D	75857514	1.000000	0.71417	0.986000	0.45419	0.994000	0.84299	9.289000	0.96061	2.228000	0.72767	0.533000	0.62120	GTC	SRCRB4D	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000146700		0.657	SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCRB4D	HGNC	protein_coding	OTTHUMT00000253001.3	39	0.00	0	A			76019578	76019578	-1	no_errors	ENST00000275560	ensembl	human	known	69_37n	missense	33	37.50	21	SNP	1.000	T
SRRM5	100170229	genome.wustl.edu	37	19	44117665	44117665	+	Silent	SNP	T	T	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr19:44117665T>A	ENST00000607544.1	+	3	1714	c.1392T>A	c.(1390-1392)tcT>tcA	p.S464S	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000417606.1_Silent_p.S464S|SRRM5_ENST00000526798.1_Silent_p.S479S			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	464	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						ATAGCCGATCTAGAAGTCCCA	0.527																																						dbGAP											0													102.0	106.0	105.0					19																	44117665		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1392T>A	19.37:g.44117665T>A			B4DNF0	Silent	SNP	NULL	p.S479	ENST00000607544.1	37	c.1437	CCDS46095.1	19																																																																																			SRRM5	-	NULL	ENSG00000226763		0.527	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	SRRM5	HGNC	protein_coding	OTTHUMT00000384398.2	118	0.00	0	T	NM_001145641		44117665	44117665	+1	no_errors	ENST00000526798	ensembl	human	known	69_37n	silent	141	26.56	51	SNP	0.001	A
STXBP5	134957	genome.wustl.edu	37	6	147556463	147556463	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr6:147556463A>G	ENST00000321680.6	+	3	326	c.326A>G	c.(325-327)aAt>aGt	p.N109S	STXBP5_ENST00000367480.3_Missense_Mutation_p.N109S|STXBP5_ENST00000179882.6_5'UTR|STXBP5_ENST00000367481.3_Missense_Mutation_p.N109S|STXBP5_ENST00000546097.1_Missense_Mutation_p.N109S	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	109					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TTCCTGATTAATGAGGTTAGT	0.363																																						dbGAP											0													101.0	101.0	101.0					6																	147556463		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.326A>G	6.37:g.147556463A>G	ENSP00000321826:p.Asn109Ser		Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.N109S	ENST00000321680.6	37	c.326	CCDS47499.1	6	.	.	.	.	.	.	.	.	.	.	A	28.7	4.940566	0.92526	.	.	ENSG00000164506	ENST00000367481;ENST00000546097;ENST00000321680;ENST00000367480	T;T;T;T	0.66280	1.56;5.0;1.56;-0.2	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	M	0.82630	2.6	0.80722	D	1	D;D	0.71674	0.998;0.993	D;P	0.76071	0.987;0.864	T	0.77664	-0.2503	10	0.42905	T	0.14	.	16.0498	0.80749	1.0:0.0:0.0:0.0	.	109;109	Q5T5C0-2;Q5T5C0	.;STXB5_HUMAN	S	109	ENSP00000356451:N109S;ENSP00000441479:N109S;ENSP00000321826:N109S;ENSP00000356450:N109S	ENSP00000321826:N109S	N	+	2	0	STXBP5	147598156	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	8.883000	0.92426	2.186000	0.69663	0.482000	0.46254	AAT	STXBP5	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000164506		0.363	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP5	HGNC	protein_coding	OTTHUMT00000042606.1	87	0.00	0	A			147556463	147556463	+1	no_errors	ENST00000321680	ensembl	human	known	69_37n	missense	104	32.03	49	SNP	1.000	G
SULT6B1	391365	genome.wustl.edu	37	2	37402347	37402347	+	Silent	SNP	A	A	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr2:37402347A>G	ENST00000535679.1	-	5	551	c.552T>C	c.(550-552)gaT>gaC	p.D184D	SULT6B1_ENST00000407963.1_Silent_p.D146D|SULT6B1_ENST00000260637.3_Silent_p.D146D|SULT6B1_ENST00000379149.2_Intron			Q6IMI4	ST6B1_HUMAN	sulfotransferase family, cytosolic, 6B, member 1	184						cytoplasm (GO:0005737)	sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(1)	12		all_hematologic(82;0.248)				TGATTGCAAAATCAAAATACC	0.303																																						dbGAP											0													49.0	47.0	48.0					2																	37402347		2201	4290	6491	-	-	-	SO:0001819	synonymous_variant	0			AY289770, AY289774	CCDS33182.1	2p22.2	2007-07-26			ENSG00000138068	ENSG00000138068		"""Sulfotransferases, cytosolic"""	33433	protein-coding gene	gene with protein product						14676822	Standard	XM_005264307		Approved		uc002rpu.3	Q6IMI4	OTTHUMG00000152160	ENST00000535679.1:c.552T>C	2.37:g.37402347A>G			B2RTS7	Silent	SNP	pfam_Sulfotransferase_dom	p.D184	ENST00000535679.1	37	c.552		2																																																																																			SULT6B1	-	pfam_Sulfotransferase_dom	ENSG00000138068		0.303	SULT6B1-203	KNOWN	basic|appris_principal	protein_coding	SULT6B1	HGNC	protein_coding		54	0.00	0	A	NM_001032377		37402347	37402347	-1	no_errors	ENST00000535679	ensembl	human	known	69_37n	silent	173	17.54	37	SNP	0.991	G
TAGLN3	29114	genome.wustl.edu	37	3	111730662	111730662	+	Silent	SNP	A	A	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr3:111730662A>C	ENST00000393917.2	+	4	960	c.408A>C	c.(406-408)gcA>gcC	p.A136A	TAGLN3_ENST00000273368.4_Silent_p.A136A|TAGLN3_ENST00000455401.2_Silent_p.A136A|TAGLN3_ENST00000486460.1_Silent_p.A52A|TAGLN3_ENST00000478951.1_Silent_p.A136A	NM_013259.2	NP_037391.2	Q9UI15	TAGL3_HUMAN	transgelin 3	136	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				central nervous system development (GO:0007417)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)				endometrium(2)|lung(5)|urinary_tract(1)	8						GCAGCGTTGCAGTCACCAAGG	0.547																																						dbGAP											0													107.0	95.0	99.0					3																	111730662		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF303058	CCDS33816.1	3q13.2	2008-02-05			ENSG00000144834	ENSG00000144834			29868	protein-coding gene	gene with protein product		607953				8015377, 11238712	Standard	NM_013259		Approved	NP25, NP22	uc003dyo.3	Q9UI15	OTTHUMG00000159281	ENST00000393917.2:c.408A>C	3.37:g.111730662A>C			D3DN64|Q96A74	Silent	SNP	pfam_CH-domain,pfam_Calponin_repeat,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,pfscan_Calponin_repeat,prints_SM22_calponin,prints_Transgelin	p.A136	ENST00000393917.2	37	c.408	CCDS33816.1	3																																																																																			TAGLN3	-	superfamily_CH-domain,pfscan_CH-domain,prints_SM22_calponin,prints_Transgelin	ENSG00000144834		0.547	TAGLN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TAGLN3	HGNC	protein_coding	OTTHUMT00000354331.1	128	0.78	1	A	NM_013259		111730662	111730662	+1	no_errors	ENST00000273368	ensembl	human	known	69_37n	silent	178	27.24	67	SNP	0.989	C
TBC1D8B	54885	genome.wustl.edu	37	X	106065364	106065364	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chrX:106065364C>A	ENST00000357242.5	+	4	692	c.518C>A	c.(517-519)cCt>cAt	p.P173H	TBC1D8B_ENST00000481617.2_Missense_Mutation_p.P173H|TBC1D8B_ENST00000310452.2_Missense_Mutation_p.P173H|TBC1D8B_ENST00000276175.3_Missense_Mutation_p.P173H	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	173	GRAM 1.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GGACGGGTTCCTTGTCAGGGT	0.383																																						dbGAP											0													178.0	149.0	159.0					X																	106065364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.518C>A	X.37:g.106065364C>A	ENSP00000349781:p.Pro173His		B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_HAND_2,pfscan_Rab-GTPase-TBC_dom	p.P173H	ENST00000357242.5	37	c.518	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473955	0.84640	.	.	ENSG00000133138	ENST00000357242;ENST00000310452;ENST00000481617;ENST00000276175	D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61	5.33	5.33	0.75918	GRAM (2);	0.190625	0.46758	D	0.000272	D	0.95940	0.8678	M	0.93854	3.465	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.83275	0.976;0.996;0.977	D	0.96908	0.9665	10	0.66056	D	0.02	-3.9208	16.6139	0.84901	0.0:1.0:0.0:0.0	.	173;173;173	Q0IIM8;B9A6K6;D6RFZ2	TBC8B_HUMAN;.;.	H	173	ENSP00000349781:P173H;ENSP00000310675:P173H;ENSP00000421375:P173H;ENSP00000276175:P173H	ENSP00000276175:P173H	P	+	2	0	TBC1D8B	105952020	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.787000	0.85759	2.231000	0.72958	0.523000	0.50628	CCT	TBC1D8B	-	pfam_GRAM,smart_GRAM	ENSG00000133138		0.383	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	HGNC	protein_coding	OTTHUMT00000057807.2	221	0.00	0	C	NM_017752		106065364	106065364	+1	no_errors	ENST00000357242	ensembl	human	known	69_37n	missense	253	25.59	87	SNP	1.000	A
TEK	7010	genome.wustl.edu	37	9	27109613	27109613	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr9:27109613C>T	ENST00000380036.4	+	1	467	c.25C>T	c.(25-27)Ctc>Ttc	p.L9F	TEK_ENST00000406359.4_Missense_Mutation_p.L9F|TEK_ENST00000519097.1_Missense_Mutation_p.L9F	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	9					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	CAGCTTAGTTCTCTGTGGAGT	0.423																																						dbGAP											0													259.0	237.0	245.0					9																	27109613		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.25C>T	9.37:g.27109613C>T	ENSP00000369375:p.Leu9Phe		A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L9F	ENST00000380036.4	37	c.25	CCDS6519.1	9	.	.	.	.	.	.	.	.	.	.	C	14.10	2.434680	0.43224	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000346448;ENST00000406359;ENST00000519080	T;T;T;T	0.77489	-0.88;-0.96;-1.1;2.79	5.5	5.5	0.81552	.	0.000000	0.42053	D	0.000768	T	0.64853	0.2636	N	0.19112	0.55	0.42162	D	0.991602	B;B;B;B;B	0.25904	0.009;0.009;0.137;0.009;0.009	B;B;B;B;B	0.23852	0.012;0.012;0.049;0.008;0.012	T	0.62053	-0.6935	10	0.36615	T	0.2	.	14.0054	0.64461	0.0:0.9276:0.0:0.0724	.	9;42;9;9;9	E7EWI2;Q59HG2;B5A953;E5RIV9;Q02763	.;.;.;.;TIE2_HUMAN	F	9	ENSP00000430686:L9F;ENSP00000369375:L9F;ENSP00000383977:L9F;ENSP00000428337:L9F	ENSP00000343716:L9F	L	+	1	0	TEK	27099613	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.527000	0.53517	2.758000	0.94735	0.563000	0.77884	CTC	TEK	-	NULL	ENSG00000120156		0.423	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	236	0.00	0	C			27109613	27109613	+1	no_errors	ENST00000380036	ensembl	human	known	69_37n	missense	335	29.71	142	SNP	1.000	T
TLE3	7090	genome.wustl.edu	37	15	70350527	70350527	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr15:70350527G>C	ENST00000558939.1	-	12	2399	c.1022C>G	c.(1021-1023)cCg>cGg	p.P341R	TLE3_ENST00000558379.1_Missense_Mutation_p.P341R|TLE3_ENST00000560589.1_Missense_Mutation_p.P285R|TLE3_ENST00000451782.2_Missense_Mutation_p.P341R|TLE3_ENST00000558201.1_Missense_Mutation_p.P347R|TLE3_ENST00000559929.1_Missense_Mutation_p.P351R|TLE3_ENST00000440567.3_Missense_Mutation_p.P334R|TLE3_ENST00000557997.1_Missense_Mutation_p.P341R|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000539550.1_Missense_Mutation_p.P285R|TLE3_ENST00000560939.1_Missense_Mutation_p.P346R|TLE3_ENST00000559048.1_Missense_Mutation_p.P346R|TLE3_ENST00000557907.1_Missense_Mutation_p.P341R|TLE3_ENST00000317509.8_Missense_Mutation_p.P341R|TLE3_ENST00000442299.2_Missense_Mutation_p.P341R	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	341	Pro/Ser-rich.				Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGGTTTACCCGGCATCGACCT	0.617																																						dbGAP											0													115.0	118.0	117.0					15																	70350527		1992	4149	6141	-	-	-	SO:0001583	missense	0			M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.1022C>G	15.37:g.70350527G>C	ENSP00000452871:p.Pro341Arg		B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.P341R	ENST00000558939.1	37	c.1022	CCDS45293.1	15	.	.	.	.	.	.	.	.	.	.	G	8.856	0.945827	0.18356	.	.	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550	T;T;T;T;T	0.53857	0.87;0.92;0.94;0.92;0.6	5.44	5.44	0.79542	.	0.427152	0.26244	N	0.025484	T	0.46718	0.1407	L	0.50333	1.59	0.35821	D	0.824594	B;B;P;B;B;B;B;B	0.40144	0.162;0.101;0.704;0.051;0.409;0.003;0.162;0.052	B;B;B;B;B;B;B;B	0.41917	0.136;0.064;0.37;0.063;0.136;0.013;0.209;0.068	T	0.51356	-0.8716	10	0.21540	T	0.41	-0.8164	9.6147	0.39685	0.1534:0.0:0.8466:0.0	.	334;341;341;341;341;341;346;285	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	R	341;341;341;334;285	ENSP00000390007:P341R;ENSP00000394717:P341R;ENSP00000319233:P341R;ENSP00000415057:P334R;ENSP00000442594:P285R	ENSP00000319233:P341R	P	-	2	0	TLE3	68137581	0.952000	0.32445	0.888000	0.34837	0.060000	0.15804	2.790000	0.47821	2.837000	0.97791	0.655000	0.94253	CCG	TLE3	-	NULL	ENSG00000140332		0.617	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE3	HGNC	protein_coding	OTTHUMT00000416913.1	281	0.00	0	G	NM_005078		70350527	70350527	-1	no_errors	ENST00000558939	ensembl	human	known	69_37n	missense	189	65.77	365	SNP	0.787	C
TMEM132C	92293	genome.wustl.edu	37	12	129190322	129190322	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr12:129190322G>A	ENST00000435159.2	+	9	2809	c.2809G>A	c.(2809-2811)Gcc>Acc	p.A937T	TMEM132C_ENST00000537538.1_Missense_Mutation_p.A322T|TMEM132C_ENST00000315208.8_Missense_Mutation_p.A553T	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	937						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GTTCTGCCTGGCCATCCTCGT	0.617																																						dbGAP											0													18.0	24.0	22.0					12																	129190322		692	1591	2283	-	-	-	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2809G>A	12.37:g.129190322G>A	ENSP00000410852:p.Ala937Thr		Q69YX8	Missense_Mutation	SNP	NULL	p.A937T	ENST00000435159.2	37	c.2809		12	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363172	0.82353	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.23950	1.88;1.88;1.88	4.45	4.45	0.53987	.	0.000000	0.64402	D	0.000013	T	0.57548	0.2061	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68236	-0.5462	10	0.87932	D	0	.	17.1037	0.86656	0.0:0.0:1.0:0.0	.	937	Q8N3T6	T132C_HUMAN	T	937;553;322	ENSP00000410852:A937T;ENSP00000324458:A553T;ENSP00000438477:A322T	ENSP00000324458:A553T	A	+	1	0	TMEM132C	127756275	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.510000	0.98004	2.027000	0.59764	0.561000	0.74099	GCC	TMEM132C	-	NULL	ENSG00000181234		0.617	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		19	0.00	0	G	XM_044062		129190322	129190322	+1	no_errors	ENST00000435159	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	155	0.00	0	C	NM_000546		7577120	7577120	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	105	48.28	98	SNP	0.864	T
TSEN2	80746	genome.wustl.edu	37	3	12531408	12531408	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr3:12531408T>C	ENST00000284995.6	+	2	496	c.109T>C	c.(109-111)Ttc>Ctc	p.F37L	TSEN2_ENST00000415684.1_Missense_Mutation_p.F37L|TSEN2_ENST00000444864.1_Missense_Mutation_p.F37L|TSEN2_ENST00000314571.7_Missense_Mutation_p.F37L|TSEN2_ENST00000402228.3_Missense_Mutation_p.F37L|TSEN2_ENST00000454502.2_Missense_Mutation_p.F37L|TSEN2_ENST00000383797.5_Missense_Mutation_p.F37L	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	37					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						TCTGAAAGAATTCAAGATATT	0.453																																						dbGAP											0													112.0	106.0	108.0					3																	12531408		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.109T>C	3.37:g.12531408T>C	ENSP00000284995:p.Phe37Leu		B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	pfam_tRNA_intron_Endonuc_cat-like,pfam_tRNA_intron_Endonuc_N,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN2	p.F37L	ENST00000284995.6	37	c.109	CCDS2611.1	3	.	.	.	.	.	.	.	.	.	.	.	12.80	2.047022	0.36085	.	.	ENSG00000154743	ENST00000446004;ENST00000314571;ENST00000454502;ENST00000383797;ENST00000402228;ENST00000284995;ENST00000444864;ENST00000537959;ENST00000415684	T;T;T;T;T;T;T;T	0.56611	0.47;0.47;0.51;0.45;0.49;0.49;0.46;0.47	5.7	5.7	0.88788	.	0.267312	0.39146	N	0.001454	T	0.53658	0.1810	M	0.62723	1.935	0.19300	N	0.999978	P;P;P;P	0.42456	0.658;0.78;0.658;0.528	B;B;B;B	0.43623	0.425;0.247;0.286;0.105	T	0.52548	-0.8561	10	0.30078	T	0.28	-16.3448	13.4978	0.61436	0.0:0.0:0.0:1.0	.	37;37;37;37	G5E9Q3;Q8NCE0;Q8NCE0-3;C9IZI7	.;SEN2_HUMAN;.;.	L	37	ENSP00000406238:F37L;ENSP00000323188:F37L;ENSP00000392029:F37L;ENSP00000373307:F37L;ENSP00000385976:F37L;ENSP00000284995:F37L;ENSP00000407974:F37L;ENSP00000416510:F37L	ENSP00000284995:F37L	F	+	1	0	TSEN2	12506408	0.923000	0.31300	0.015000	0.15790	0.012000	0.07955	2.387000	0.44389	2.168000	0.68352	0.533000	0.62120	TTC	TSEN2	-	pirsf_tRNA_splic_SEN2	ENSG00000154743		0.453	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN2	HGNC	protein_coding	OTTHUMT00000251981.1	114	0.00	0	T	NM_025265		12531408	12531408	+1	no_errors	ENST00000284995	ensembl	human	known	69_37n	missense	142	34.40	75	SNP	0.186	C
TTC9	23508	genome.wustl.edu	37	14	71109059	71109059	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr14:71109059G>T	ENST00000256367.2	+	1	556	c.213G>T	c.(211-213)aaG>aaT	p.K71N	CTD-2540L5.6_ENST00000500016.1_lincRNA|CTD-2540L5.5_ENST00000553982.1_lincRNA	NM_015351.1	NP_056166.1	Q92623	TTC9A_HUMAN	tetratricopeptide repeat domain 9	71										skin(1)	1				all cancers(60;0.00545)|BRCA - Breast invasive adenocarcinoma(234;0.00747)|OV - Ovarian serous cystadenocarcinoma(108;0.0538)		ACAAGGACAAGAAATTCCGTG	0.692																																						dbGAP											0													11.0	12.0	12.0					14																	71109059		1881	4097	5978	-	-	-	SO:0001583	missense	0			D86980	CCDS45132.1	14q24.2	2014-08-12			ENSG00000133985			"""Tetratricopeptide (TTC) repeat domain containing"""	20267	protein-coding gene	gene with protein product		610488					Standard	NM_015351		Approved	KIAA0227, TTC9A	uc001xmi.2	Q92623	OTTHUMG00000172133	ENST00000256367.2:c.213G>T	14.37:g.71109059G>T	ENSP00000256367:p.Lys71Asn		Q86WT2	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K71N	ENST00000256367.2	37	c.213	CCDS45132.1	14	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598400	0.66332	.	.	ENSG00000133985	ENST00000256367	T	0.20598	2.06	3.84	1.98	0.26296	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.41373	0.1156	M	0.75085	2.285	0.53688	D	0.999975	D	0.89917	1.0	D	0.78314	0.991	T	0.26780	-1.0093	10	0.44086	T	0.13	-8.3229	10.2888	0.43584	0.1755:0.0:0.8245:0.0	.	71	Q92623	TTC9A_HUMAN	N	71	ENSP00000256367:K71N	ENSP00000256367:K71N	K	+	3	2	TTC9	70178812	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	3.693000	0.54735	0.968000	0.38212	-0.391000	0.06502	AAG	TTC9	-	smart_TPR_repeat	ENSG00000133985		0.692	TTC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC9	HGNC	protein_coding	OTTHUMT00000417024.1	10	0.00	0	G	XM_027236		71109059	71109059	+1	no_errors	ENST00000256367	ensembl	human	known	69_37n	missense	7	56.25	9	SNP	1.000	T
UBE2Q1	55585	genome.wustl.edu	37	1	154525280	154525280	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:154525280G>A	ENST00000292211.4	-	6	825	c.746C>T	c.(745-747)tCg>tTg	p.S249L	UBE2Q1-AS1_ENST00000441613.1_RNA|UBE2Q1_ENST00000497453.1_5'UTR	NM_017582.6	NP_060052.3	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q family member 1	249					embryo implantation (GO:0007566)|fertilization (GO:0009566)|mating behavior (GO:0007617)|prolactin secretion (GO:0070459)|protein ubiquitination (GO:0016567)|reproductive system development (GO:0061458)|suckling behavior (GO:0001967)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGCCTGCACCGAGCCAGACAC	0.552																																						dbGAP											0													51.0	55.0	54.0					1																	154525280		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ243666	CCDS1069.1	1q22	2008-05-02	2008-05-02	2005-08-05	ENSG00000160714	ENSG00000160714		"""Ubiquitin-conjugating enzymes E2"""	15698	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2Q (putative)"""	UBE2Q			Standard	NM_017582		Approved	PRO3094, NICE-5	uc001fff.1	Q7Z7E8	OTTHUMG00000037265	ENST00000292211.4:c.746C>T	1.37:g.154525280G>A	ENSP00000292211:p.Ser249Leu		B4DF92|Q3B841|Q5I0X2|Q6IS04|Q6P7P2|Q96MV4|Q9BVX5|Q9UGL6	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.S249L	ENST00000292211.4	37	c.746	CCDS1069.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.305086	0.95601	.	.	ENSG00000160714	ENST00000292211	.	.	.	5.18	5.18	0.71444	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.85682	D	0.000000	T	0.77054	0.4074	M	0.81179	2.53	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.79829	-0.1638	9	0.87932	D	0	-1.3625	17.4393	0.87561	0.0:0.0:1.0:0.0	.	249	Q7Z7E8	UB2Q1_HUMAN	L	249	.	ENSP00000292211:S249L	S	-	2	0	UBE2Q1	152791904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.419000	0.97397	2.701000	0.92244	0.563000	0.77884	TCG	UBE2Q1	-	superfamily_UBQ-conjugating_enzyme/RWD	ENSG00000160714		0.552	UBE2Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2Q1	HGNC	protein_coding	OTTHUMT00000090704.1	72	0.00	0	G	NM_017582		154525280	154525280	-1	no_errors	ENST00000292211	ensembl	human	known	69_37n	missense	85	34.62	45	SNP	1.000	A
UNC13C	440279	genome.wustl.edu	37	15	54590072	54590073	+	Frame_Shift_Ins	INS	-	-	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr15:54590072_54590073insG	ENST00000260323.11	+	11	4052_4053	c.4052_4053insG	c.(4051-4056)aaaggafs	p.G1352fs	UNC13C_ENST00000537900.1_Frame_Shift_Ins_p.G1350fs|UNC13C_ENST00000545554.1_Frame_Shift_Ins_p.G1352fs	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1352					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GTGGAGATAAAAGGAGAAGAGA	0.332																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	Exception_encountered	15.37:g.54590072_54590073insG	ENSP00000260323:p.Gly1352fs		Q0P613|Q8ND48|Q96NP3	Frame_Shift_Ins	INS	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.G1352fs	ENST00000260323.11	37	c.4052_4053	CCDS45264.1	15																																																																																			UNC13C	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000137766		0.332	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	126	0.00	0	-	NM_173166		54590072	54590073	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	frame_shift_ins	94	56.88	124	INS	1.000:1.000	G
UNC13C	440279	genome.wustl.edu	37	15	54590073	54590073	+	Silent	SNP	A	A	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr15:54590073A>G	ENST00000260323.11	+	11	4053	c.4053A>G	c.(4051-4053)aaA>aaG	p.K1351K	UNC13C_ENST00000537900.1_Silent_p.K1349K|UNC13C_ENST00000545554.1_Silent_p.K1351K	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1351					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGGAGATAAAAGGAGAAGAGA	0.328																																						dbGAP											0													74.0	72.0	72.0					15																	54590073		1840	4080	5920	-	-	-	SO:0001819	synonymous_variant	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4053A>G	15.37:g.54590073A>G			Q0P613|Q8ND48|Q96NP3	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.K1351	ENST00000260323.11	37	c.4053	CCDS45264.1	15																																																																																			UNC13C	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000137766		0.328	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	127	0.00	0	A	NM_173166		54590073	54590073	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	silent	75	66.06	146	SNP	1.000	G
ZC3H11A	9877	genome.wustl.edu	37	1	203787708	203787708	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:203787708G>A	ENST00000545588.1	+	3	3892	c.65G>A	c.(64-66)tGc>tAc	p.C22Y	ZC3H11A_ENST00000367212.3_Missense_Mutation_p.C22Y|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.C22Y|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.C22Y|ZC3H11A_ENST00000332127.4_Missense_Mutation_p.C22Y	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	22					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGTGACAGCTGCCCATTCCGT	0.428																																						dbGAP											0													98.0	87.0	91.0					1																	203787708		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.65G>A	1.37:g.203787708G>A	ENSP00000438527:p.Cys22Tyr		Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	smart_Znf_CCCH	p.C22Y	ENST00000545588.1	37	c.65	CCDS30978.1	1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.555718	0.86231	.	.	ENSG00000058673	ENST00000432282;ENST00000453771;ENST00000367214;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;D;D;D;D;D	0.92545	-0.68;-3.06;-3.06;-3.06;-3.06;-3.06	5.42	5.42	0.78866	Zinc finger, CCCH-type (2);	0.000000	0.85682	D	0.000000	D	0.96595	0.8889	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97183	0.9852	10	0.87932	D	0	-6.7334	16.133	0.81458	0.0:0.0:1.0:0.0	.	22	O75152	ZC11A_HUMAN	Y	22	ENSP00000406531:C22Y;ENSP00000356183:C22Y;ENSP00000356181:C22Y;ENSP00000333253:C22Y;ENSP00000438527:C22Y;ENSP00000356179:C22Y	ENSP00000333253:C22Y	C	+	2	0	ZC3H11A	202054331	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.011000	0.93618	2.550000	0.86006	0.650000	0.86243	TGC	ZC3H11A	-	smart_Znf_CCCH	ENSG00000058673		0.428	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H11A	HGNC	protein_coding	OTTHUMT00000087471.3	133	0.00	0	G	NM_014827		203787708	203787708	+1	no_errors	ENST00000332127	ensembl	human	known	69_37n	missense	310	21.61	86	SNP	1.000	A
USH2A	7399	genome.wustl.edu	37	1	216348807	216348807	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr1:216348807G>T	ENST00000307340.3	-	21	4800	c.4414C>A	c.(4414-4416)Cca>Aca	p.P1472T	USH2A_ENST00000366943.2_Missense_Mutation_p.P1472T|USH2A_ENST00000366942.3_Missense_Mutation_p.P1472T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1472					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACCAGAGGTGGCCTCAGTTGT	0.393										HNSCC(13;0.011)																												dbGAP											0													117.0	108.0	111.0					1																	216348807		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4414C>A	1.37:g.216348807G>T	ENSP00000305941:p.Pro1472Thr		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.P1472T	ENST00000307340.3	37	c.4414	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.521766	0.27211	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.54279	0.58;0.58;0.58	5.38	-1.3	0.09259	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.379769	0.18639	U	0.135359	T	0.40694	0.1127	L	0.56769	1.78	0.18873	N	0.999983	P;P	0.39424	0.673;0.666	B;B	0.39706	0.307;0.252	T	0.23583	-1.0184	10	0.33940	T	0.23	.	3.2355	0.06763	0.2618:0.385:0.2638:0.0895	.	1472;1472	O75445-2;O75445	.;USH2A_HUMAN	T	1472	ENSP00000305941:P1472T;ENSP00000355910:P1472T;ENSP00000355909:P1472T	ENSP00000305941:P1472T	P	-	1	0	USH2A	214415430	0.254000	0.23992	0.006000	0.13384	0.204000	0.24138	0.458000	0.21892	-0.181000	0.10619	0.544000	0.68410	CCA	USH2A	-	superfamily_Fibronectin_type3	ENSG00000042781		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	193	0.00	0	G	NM_007123		216348807	216348807	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	187	35.07	101	SNP	0.019	T
ZMIZ1	57178	genome.wustl.edu	37	10	81067225	81067225	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr10:81067225T>G	ENST00000334512.5	+	23	3304	c.2732T>G	c.(2731-2733)aTg>aGg	p.M911R	ZMIZ1_ENST00000446377.2_Missense_Mutation_p.M64R	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	911	Pro-rich.				artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GGGACATCCATGAATGACTTC	0.622																																						dbGAP											0													66.0	66.0	66.0					10																	81067225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.2732T>G	10.37:g.81067225T>G	ENSP00000334474:p.Met911Arg		Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.M911R	ENST00000334512.5	37	c.2732	CCDS7357.1	10	.	.	.	.	.	.	.	.	.	.	T	16.40	3.111719	0.56398	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347;ENST00000446377	T	0.30714	1.52	4.57	4.57	0.56435	.	0.000000	0.50627	D	0.000116	T	0.43277	0.1240	L	0.60455	1.87	0.80722	D	1	P;P	0.48694	0.914;0.729	P;B	0.55345	0.774;0.391	T	0.20042	-1.0287	10	0.22706	T	0.39	-13.7298	14.3227	0.66496	0.0:0.0:0.0:1.0	.	64;911	B4DSG4;Q9ULJ6	.;ZMIZ1_HUMAN	R	911;841;812;64	ENSP00000334474:M911R	ENSP00000334474:M911R	M	+	2	0	ZMIZ1	80737231	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.661000	0.83786	1.842000	0.53543	0.529000	0.55759	ATG	ZMIZ1	-	NULL	ENSG00000108175		0.622	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ1	HGNC	protein_coding	OTTHUMT00000048944.2	93	0.00	0	T	NM_020338		81067225	81067225	+1	no_errors	ENST00000334512	ensembl	human	known	69_37n	missense	109	34.73	58	SNP	1.000	G
ZNF491	126069	genome.wustl.edu	37	19	11917733	11917733	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr19:11917733C>T	ENST00000323169.5	+	3	1296	c.965C>T	c.(964-966)aCt>aTt	p.T322I	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						AGGACTCACACTGGAGAGAAA	0.448																																						dbGAP											0													52.0	53.0	53.0					19																	11917733		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.965C>T	19.37:g.11917733C>T	ENSP00000313443:p.Thr322Ile		Q3MJ35|Q8NAT8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T322I	ENST00000323169.5	37	c.965	CCDS12267.1	19	.	.	.	.	.	.	.	.	.	.	c	11.69	1.714156	0.30413	.	.	ENSG00000177599	ENST00000323169;ENST00000455048	T	0.25749	1.78	0.89	-0.275	0.12906	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38241	0.1033	M	0.67625	2.065	0.27523	N	0.951332	P	0.52061	0.95	P	0.56127	0.792	T	0.27905	-1.0060	9	0.72032	D	0.01	.	8.4111	0.32644	0.0:0.7591:0.2409:0.0	.	322	Q8N8L2	ZN491_HUMAN	I	322;294	ENSP00000313443:T322I	ENSP00000313443:T322I	T	+	2	0	ZNF491	11778733	0.203000	0.23435	0.019000	0.16419	0.026000	0.11368	0.701000	0.25616	-0.061000	0.13110	-1.307000	0.01316	ACT	ZNF491	-	pfscan_Znf_C2H2	ENSG00000177599		0.448	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF491	HGNC	protein_coding	OTTHUMT00000344518.1	109	0.00	0	C	NM_152356		11917733	11917733	+1	no_errors	ENST00000323169	ensembl	human	known	69_37n	missense	88	29.60	37	SNP	0.991	T
ZNF418	147686	genome.wustl.edu	37	19	58437810	58437810	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A134-01A-11D-A10Y-09	TCGA-C8-A134-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3e8738b-2456-4f08-bb3d-5debb4265f85	b25af510-abd7-402a-96bf-6532cb18ec71	g.chr19:58437810T>C	ENST00000396147.1	-	4	2030	c.1739A>G	c.(1738-1740)gAa>gGa	p.E580G	ZNF418_ENST00000599852.1_Missense_Mutation_p.E495G|ZNF418_ENST00000595830.1_Missense_Mutation_p.E580G|ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000425570.3_Missense_Mutation_p.E601G|ZNF418_ENST00000600989.1_Intron	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	580					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		TCTCCTGTGTTCAAGGAGACT	0.433																																						dbGAP											0													76.0	79.0	78.0					19																	58437810		2202	4298	6500	-	-	-	SO:0001583	missense	0			AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.1739A>G	19.37:g.58437810T>C	ENSP00000379451:p.Glu580Gly		Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E601G	ENST00000396147.1	37	c.1802	CCDS42642.1	19	.	.	.	.	.	.	.	.	.	.	.	10.41	1.343148	0.24339	.	.	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	T;T	0.19532	2.14;2.14	2.39	-2.13	0.07144	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11410	0.0278	L	0.39692	1.235	0.09310	N	1	P	0.38565	0.637	B	0.31812	0.136	T	0.24728	-1.0152	9	0.23891	T	0.37	.	4.2523	0.10700	0.0:0.2622:0.1725:0.5653	.	580	Q8TF45	ZN418_HUMAN	G	580;601;546	ENSP00000379451:E580G;ENSP00000407039:E601G	ENSP00000379451:E580G	E	-	2	0	ZNF418	63129622	0.000000	0.05858	0.001000	0.08648	0.315000	0.28087	-1.990000	0.01479	-0.232000	0.09811	0.383000	0.25322	GAA	ZNF418	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196724		0.433	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZNF418	HGNC	protein_coding	OTTHUMT00000466693.1	132	0.00	0	T	NM_133460		58437810	58437810	-1	no_errors	ENST00000425570	ensembl	human	known	69_37n	missense	146	30.48	64	SNP	0.016	C
