#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AASS	10157	genome.wustl.edu	37	7	121741712	121741712	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr7:121741712G>A	ENST00000393376.1	-	11	1396	c.1301C>T	c.(1300-1302)cCt>cTt	p.P434L	AASS_ENST00000417368.2_Missense_Mutation_p.P434L|AASS_ENST00000473553.1_5'UTR			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	434	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						ACTTTCAAGAGGCTGTGTCGC	0.333																																						dbGAP											0													49.0	52.0	51.0					7																	121741712		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.1301C>T	7.37:g.121741712G>A	ENSP00000377040:p.Pro434Leu		O95462	Missense_Mutation	SNP	pfam_Saccharopine_DH/HSpermid_syn,pfam_AlaDH/PNT_NAD(H)-bd,pfam_AlaDH/PNT_N	p.P434L	ENST00000393376.1	37	c.1301	CCDS5783.1	7	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830439	0.91036	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	5.67	5.67	0.87782	.	0.195111	0.56097	D	0.000037	D	0.83792	0.5331	M	0.87180	2.865	0.80722	D	1	D	0.69078	0.997	D	0.63283	0.913	D	0.85571	0.1234	9	0.66056	D	0.02	-19.5475	19.7222	0.96147	0.0:0.0:1.0:0.0	.	434	Q9UDR5	AASS_HUMAN	L	434	.	ENSP00000351834:P434L	P	-	2	0	AASS	121528948	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	7.066000	0.76734	2.828000	0.97474	0.655000	0.94253	CCT	AASS	-	NULL	ENSG00000008311		0.333	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AASS	HGNC	protein_coding	OTTHUMT00000347300.1	151	0.00	0	G	NM_005763		121741712	121741712	-1	no_errors	ENST00000393376	ensembl	human	known	69_37n	missense	151	15.64	28	SNP	1.000	A
ACIN1	22985	genome.wustl.edu	37	14	23530619	23530619	+	Silent	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr14:23530619C>T	ENST00000262710.1	-	17	3813	c.3486G>A	c.(3484-3486)gaG>gaA	p.E1162E	ACIN1_ENST00000357481.2_Silent_p.E404E|ACIN1_ENST00000557515.1_Silent_p.E403E|ACIN1_ENST00000457657.1_Silent_p.E1122E|ACIN1_ENST00000605057.1_Silent_p.E1104E|ACIN1_ENST00000555053.1_Silent_p.E1149E|ACIN1_ENST00000397341.3_Silent_p.E404E|ACIN1_ENST00000338631.6_Silent_p.E435E	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1162	Arg/Asp/Glu/Lys-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		CCCATTCACGCTCTGATCGAG	0.627																																						dbGAP											0													91.0	92.0	92.0					14																	23530619		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.3486G>A	14.37:g.23530619C>T			B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Silent	SNP	pfam_SAP_DNA-bd,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.E1162	ENST00000262710.1	37	c.3486	CCDS9587.1	14																																																																																			ACIN1	-	NULL	ENSG00000100813		0.627	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACIN1	HGNC	protein_coding	OTTHUMT00000071707.3	142	0.70	1	C	NM_014977		23530619	23530619	-1	no_errors	ENST00000262710	ensembl	human	known	69_37n	silent	122	13.99	20	SNP	1.000	T
AHSA1	10598	genome.wustl.edu	37	14	77935581	77935581	+	Missense_Mutation	SNP	C	C	T	rs147994825		TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr14:77935581C>T	ENST00000216479.3	+	9	1166	c.1006C>T	c.(1006-1008)Cgc>Tgc	p.R336C	SNORA46_ENST00000391069.1_RNA|AHSA1_ENST00000555457.1_3'UTR	NM_012111.2	NP_036243.1	O95433	AHSA1_HUMAN	AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)	336					positive regulation of ATPase activity (GO:0032781)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)			endometrium(1)|kidney(3)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		CTATGGCGCACGCTTATTTTA	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18330	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													127.0	120.0	123.0					14																	77935581		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ243310	CCDS9863.1	14q	2008-02-05	2003-04-04	2003-04-11		ENSG00000100591			1189	protein-coding gene	gene with protein product		608466	"""chromosome 14 open reading frame 3"""	C14orf3			Standard	NM_012111		Approved	p38	uc001xtw.3	O95433		ENST00000216479.3:c.1006C>T	14.37:g.77935581C>T	ENSP00000216479:p.Arg336Cys		B2R9L2|B4DUR9|Q96IL6|Q9P060	Missense_Mutation	SNP	pfam_AHSA1_N,pfam_Activator_of_Hsp90_ATPase,superfamily_AHSA1_N	p.R336C	ENST00000216479.3	37	c.1006	CCDS9863.1	14	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	C|C	17.84|17.84	3.488711|3.488711	0.64074|0.64074	.|.	.|.	ENSG00000100591|ENSG00000100591	ENST00000555133;ENST00000216479;ENST00000557476|ENST00000555729	T|.	0.45668|.	0.89|.	5.99|5.99	5.99|5.99	0.97316|0.97316	.|.	0.054135|.	0.85682|.	D|.	0.000000|.	T|T	0.72969|0.72969	0.3527|0.3527	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	P|.	0.35155|.	0.487|.	B|.	0.22152|.	0.038|.	T|T	0.71708|0.71708	-0.4511|-0.4511	10|5	0.37606|.	T|.	0.19|.	-8.4623|-8.4623	13.6356|13.6356	0.62221|0.62221	0.0:0.9294:0.0:0.0706|0.0:0.9294:0.0:0.0706	.|.	336|.	O95433|.	AHSA1_HUMAN|.	C|M	201;336;118|130	ENSP00000451474:R118C|.	ENSP00000216479:R336C|.	R|T	+|+	1|2	0|0	AHSA1|AHSA1	77005334|77005334	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.997000|0.997000	0.91878|0.91878	4.285000|4.285000	0.58989|0.58989	2.843000|2.843000	0.97960|0.97960	0.591000|0.591000	0.81541|0.81541	CGC|ACG	AHSA1	-	NULL	ENSG00000100591		0.597	AHSA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHSA1	HGNC	protein_coding	OTTHUMT00000414017.1	205	0.00	0	C	NM_012111		77935581	77935581	+1	no_errors	ENST00000216479	ensembl	human	known	69_37n	missense	109	32.72	53	SNP	1.000	T
HID1	283987	genome.wustl.edu	37	17	72951890	72951890	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr17:72951890C>G	ENST00000425042.2	-	13	1710	c.1633G>C	c.(1633-1635)Gat>Cat	p.D545H		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	545					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											GCCTCACCATCAAACTGGTAC	0.612																																						dbGAP											0													88.0	70.0	76.0					17																	72951890		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.1633G>C	17.37:g.72951890C>G	ENSP00000413520:p.Asp545His		Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	pfam_Dymeclin	p.D545H	ENST00000425042.2	37	c.1633	CCDS32726.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974879	0.74360	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565	.	.	.	4.86	4.86	0.63082	.	0.052740	0.64402	D	0.000001	T	0.77857	0.4193	M	0.82323	2.585	0.80722	D	1	D	0.56287	0.975	P	0.56823	0.807	T	0.81521	-0.0895	9	0.54805	T	0.06	.	17.9666	0.89101	0.0:1.0:0.0:0.0	.	545	Q8IV36	CQ028_HUMAN	H	317;545;317	.	ENSP00000317795:D317H	D	-	1	0	C17orf28	70463485	1.000000	0.71417	0.991000	0.47740	0.845000	0.48019	5.864000	0.69575	2.220000	0.72140	0.557000	0.71058	GAT	C17orf28	-	NULL	ENSG00000167861		0.612	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf28	HGNC	protein_coding	OTTHUMT00000390011.2	240	0.00	0	C	NM_030630		72951890	72951890	-1	no_errors	ENST00000425042	ensembl	human	known	69_37n	missense	559	18.01	123	SNP	1.000	G
C17orf74	201243	genome.wustl.edu	37	17	7329370	7329370	+	Splice_Site	SNP	G	G	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr17:7329370G>C	ENST00000333870.3	+	2	270		c.e2+1		RP11-104H15.7_ENST00000575310.1_RNA|C17orf74_ENST00000574034.1_Splice_Site	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74							integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				ACTCAGAAAAGTAAGTGTGGC	0.582																																						dbGAP											0													69.0	72.0	71.0					17																	7329370		1984	4150	6134	-	-	-	SO:0001630	splice_region_variant	0			BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.196+1G>C	17.37:g.7329370G>C				Splice_Site	SNP	-	e2+1	ENST00000333870.3	37	c.196+1	CCDS42255.1	17	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933261	0.34096	.	.	ENSG00000184560	ENST00000333870	.	.	.	3.58	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8598	0.46821	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C17orf74	7270094	1.000000	0.71417	0.908000	0.35775	0.161000	0.22273	4.023000	0.57211	1.972000	0.57404	0.478000	0.44815	.	C17orf74	-	-	ENSG00000184560		0.582	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf74	HGNC	protein_coding	OTTHUMT00000440933.2	147	0.00	0	G	NM_175734	Intron	7329370	7329370	+1	no_errors	ENST00000333870	ensembl	human	known	69_37n	splice_site	84	16.00	16	SNP	0.927	C
HID1	283987	genome.wustl.edu	37	17	72952020	72952020	+	Silent	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr17:72952020C>T	ENST00000425042.2	-	13	1580	c.1503G>A	c.(1501-1503)gtG>gtA	p.V501V		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	501					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											TGTTGGCAGTCACCATGGACA	0.627																																						dbGAP											0													126.0	119.0	121.0					17																	72952020		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.1503G>A	17.37:g.72952020C>T			Q8N5L6|Q8TE83|Q9NT34	Silent	SNP	pfam_Dymeclin	p.V501	ENST00000425042.2	37	c.1503	CCDS32726.1	17																																																																																			C17orf28	-	pfam_Dymeclin	ENSG00000167861		0.627	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf28	HGNC	protein_coding	OTTHUMT00000390011.2	262	0.00	0	C	NM_030630		72952020	72952020	-1	no_errors	ENST00000425042	ensembl	human	known	69_37n	silent	606	17.33	127	SNP	1.000	T
CNGA3	1261	genome.wustl.edu	37	2	99013403	99013403	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr2:99013403G>T	ENST00000272602.2	+	7	1809	c.1770G>T	c.(1768-1770)gaG>gaT	p.E590D	CNGA3_ENST00000436404.2_Missense_Mutation_p.E572D|CNGA3_ENST00000409937.1_Missense_Mutation_p.E594D|CNGA3_ENST00000393504.1_Missense_Mutation_p.E590D			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	590			E -> K (in ACHM2; also found in patients with cone-rod dystrophy; the dose- response relationship for cGMP-activation is shifted toward a lower cGMP concentration). {ECO:0000269|PubMed:15712225, ECO:0000269|PubMed:24903488}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						CCCTCACCGAGTACCCCGAAG	0.612																																						dbGAP											0													53.0	53.0	53.0					2																	99013403		2203	4300	6503	-	-	-	SO:0001583	missense	0			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1770G>T	2.37:g.99013403G>T	ENSP00000272602:p.Glu590Asp		E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.E590D	ENST00000272602.2	37	c.1770	CCDS2034.1	2	.	.	.	.	.	.	.	.	.	.	G	10.07	1.250783	0.22880	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.42	-6.28	0.02020	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.90147	0.6921	L	0.28504	0.86	0.53688	D	0.999977	B;P;B	0.45212	0.338;0.853;0.203	B;P;B	0.53062	0.313;0.717;0.255	D	0.86610	0.1872	10	0.33940	T	0.23	.	14.9148	0.70789	0.7176:0.0:0.2824:0.0	.	594;572;590	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	D	590;572;590;594	ENSP00000377140:E590D;ENSP00000410070:E572D;ENSP00000272602:E590D;ENSP00000386761:E594D	ENSP00000272602:E590D	E	+	3	2	CNGA3	98379835	0.046000	0.20272	0.580000	0.28601	0.581000	0.36288	-0.975000	0.03790	-1.065000	0.03168	-0.471000	0.05019	GAG	CNGA3	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000144191		0.612	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	HGNC	protein_coding	OTTHUMT00000252986.1	115	0.86	1	G	NM_001298		99013403	99013403	+1	no_errors	ENST00000272602	ensembl	human	known	69_37n	missense	51	28.17	20	SNP	0.713	T
CYB5R4	51167	genome.wustl.edu	37	6	84644368	84644368	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr6:84644368C>T	ENST00000369681.5	+	11	1009	c.869C>T	c.(868-870)aCg>aTg	p.T290M	CYB5R4_ENST00000479164.1_3'UTR	NM_016230.3	NP_057314.2	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	290	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cell development (GO:0048468)|detection of oxygen (GO:0003032)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NAD(P)H oxidase activity (GO:0016174)|NADPH-hemoprotein reductase activity (GO:0003958)|oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor (GO:0016653)			breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	23		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		ACTCATGATACGAGGCTTTTC	0.373																																					Esophageal Squamous(86;1289 1332 25971 40349 52675)	dbGAP											0													131.0	128.0	129.0					6																	84644368		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169803	CCDS5000.2	6q14.2	2012-09-19		2005-07-13	ENSG00000065615	ENSG00000065615	1.6.2.2		20147	protein-coding gene	gene with protein product		608343	"""NADPH cytochrome B5 oxidoreductase"""	NCB5OR		10611283	Standard	NM_016230		Approved	b5+b5R, dJ676J13.1	uc003pkf.3	Q7L1T6	OTTHUMG00000015118	ENST00000369681.5:c.869C>T	6.37:g.84644368C>T	ENSP00000358695:p.Thr290Met		B1AEM2|Q5TGI9|Q9NUE4|Q9UHI9	Missense_Mutation	SNP	pfam_Cyt_B5,pfam_OxRdtase_FAD-bd_dom,pfam_OxRdtase_FAD/NAD-bd,pfam_CS_domain,superfamily_Cyt_B5,superfamily_Riboflavin_synthase-like_b-brl,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain,pfscan_Cyt_B5,prints_NADH-Cyt_B5_reductase,prints_Cyt_B5	p.T290M	ENST00000369681.5	37	c.869	CCDS5000.2	6	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081929	0.76528	.	.	ENSG00000065615	ENST00000369681	D	0.85629	-2.01	5.94	5.94	0.96194	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);Oxidoreductase, FAD-binding domain (1);	0.087918	0.85682	D	0.000000	D	0.93657	0.7974	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.93660	0.6981	10	0.66056	D	0.02	.	19.9682	0.97276	0.0:1.0:0.0:0.0	.	290	Q7L1T6	NB5R4_HUMAN	M	290	ENSP00000358695:T290M	ENSP00000358695:T290M	T	+	2	0	CYB5R4	84701087	0.999000	0.42202	0.973000	0.42090	0.764000	0.43329	3.526000	0.53509	2.829000	0.97493	0.650000	0.86243	ACG	CYB5R4	-	pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl	ENSG00000065615		0.373	CYB5R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R4	HGNC	protein_coding	OTTHUMT00000041362.4	450	0.00	0	C	NM_016230		84644368	84644368	+1	no_errors	ENST00000369681	ensembl	human	known	69_37n	missense	313	20.96	83	SNP	0.998	T
CYP2S1	29785	genome.wustl.edu	37	19	41711922	41711922	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr19:41711922C>A	ENST00000310054.4	+	8	1440	c.1224C>A	c.(1222-1224)caC>caA	p.H408Q	CYP2S1_ENST00000542619.1_Missense_Mutation_p.H133Q	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1	408					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						TCTTCAAGCACCCAGAAGAGT	0.542																																						dbGAP											0													101.0	92.0	95.0					19																	41711922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.1224C>A	19.37:g.41711922C>A	ENSP00000308032:p.His408Gln		Q9BZ66	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450_E_grp-I_CYP2B-like,prints_Cyt_P450_B	p.H408Q	ENST00000310054.4	37	c.1224	CCDS12573.1	19	.	.	.	.	.	.	.	.	.	.	C	10.64	1.406753	0.25378	.	.	ENSG00000167600	ENST00000301173;ENST00000310054;ENST00000542619	T;T	0.01246	5.11;5.11	4.68	-4.75	0.03239	.	1.185250	0.05991	N	0.646114	T	0.01124	0.0037	N	0.16478	0.41	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.49881	-0.8892	10	0.52906	T	0.07	.	7.7447	0.28862	0.084:0.5946:0.2088:0.1126	.	133;408	B4DJI0;Q96SQ9	.;CP2S1_HUMAN	Q	408;408;133	ENSP00000308032:H408Q;ENSP00000445299:H133Q	ENSP00000301173:H408Q	H	+	3	2	CYP2S1	46403762	0.000000	0.05858	0.006000	0.13384	0.147000	0.21601	-0.990000	0.03732	-0.193000	0.10415	-0.256000	0.11100	CAC	CYP2S1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	ENSG00000167600		0.542	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2S1	HGNC	protein_coding	OTTHUMT00000463287.1	256	0.00	0	C			41711922	41711922	+1	no_errors	ENST00000310054	ensembl	human	known	69_37n	missense	181	21.70	51	SNP	0.012	A
DEFB129	140881	genome.wustl.edu	37	20	210400	210402	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr20:210400_210402delAGA	ENST00000246105.4	+	2	571_573	c.540_542delAGA	c.(538-543)gcagaa>gca	p.E182del		NM_080831.3	NP_543021.1	Q9H1M3	DB129_HUMAN	defensin, beta 129	182					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|stomach(1)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			TAGAGGAAGCAGAAGAGCAGTAA	0.448																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AY358186	CCDS12992.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125903	ENSG00000125903		"""Defensins, beta"""	16218	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 87"""	C20orf87		11854508	Standard	NM_080831		Approved	bA530N10.3, DEFB-29	uc002wda.3	Q9H1M3	OTTHUMG00000031618	ENST00000246105.4:c.540_542delAGA	20.37:g.210403_210405delAGA	ENSP00000246105:p.Glu182del		Q8NES7	In_Frame_Del	DEL	NULL	p.E182in_frame_del	ENST00000246105.4	37	c.540_542	CCDS12992.1	20																																																																																			DEFB129	-	NULL	ENSG00000125903		0.448	DEFB129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB129	HGNC	protein_coding	OTTHUMT00000077430.2	511	0.00	0	AGA	NM_080831		210400	210402	+1	no_errors	ENST00000246105	ensembl	human	known	69_37n	in_frame_del	320	23.93	101	DEL	0.002:0.000:0.000	-
DUSP10	11221	genome.wustl.edu	37	1	221912365	221912365	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr1:221912365T>C	ENST00000366899.3	-	2	960	c.722A>G	c.(721-723)aAt>aGt	p.N241S	DUSP10_ENST00000468085.1_5'Flank|DUSP10_ENST00000544095.1_5'Flank|DUSP10_ENST00000323825.3_Intron	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	241	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		GCTTGGTTCATTGGTATTCTC	0.458																																						dbGAP											0													133.0	138.0	136.0					1																	221912365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.722A>G	1.37:g.221912365T>C	ENSP00000355866:p.Asn241Ser		D3DTB4|Q6GSI4|Q9H9Z5	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_Blood-coag_inhib_Disintegrin,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.N241S	ENST00000366899.3	37	c.722	CCDS1528.1	1	.	.	.	.	.	.	.	.	.	.	T	4.978	0.181724	0.09495	.	.	ENSG00000143507	ENST00000366899;ENST00000418487	T	0.23348	1.91	5.76	4.64	0.57946	Rhodanese-like (5);	0.245617	0.44688	D	0.000432	T	0.09069	0.0224	N	0.02539	-0.55	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15665	-1.0429	10	0.05525	T	0.97	.	11.4716	0.50272	0.0:0.07:0.0:0.93	.	241	Q9Y6W6	DUS10_HUMAN	S	241;186	ENSP00000355866:N241S	ENSP00000355866:N241S	N	-	2	0	DUSP10	219978988	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.842000	0.48230	1.027000	0.39758	0.482000	0.46254	AAT	DUSP10	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	ENSG00000143507		0.458	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1	245	0.00	0	T	NM_007207		221912365	221912365	-1	no_errors	ENST00000366899	ensembl	human	known	69_37n	missense	213	30.16	92	SNP	1.000	C
EMR2	30817	genome.wustl.edu	37	19	14863285	14863285	+	Silent	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr19:14863285C>T	ENST00000315576.3	-	15	2095	c.1644G>A	c.(1642-1644)ctG>ctA	p.L548L	EMR2_ENST00000392964.3_Missense_Mutation_p.A213T|EMR2_ENST00000596991.2_Silent_p.L537L|EMR2_ENST00000594294.1_Silent_p.L499L|EMR2_ENST00000353005.1_Silent_p.L406L|EMR2_ENST00000392967.2_Silent_p.L537L|EMR2_ENST00000595839.1_Silent_p.L406L|EMR2_ENST00000601345.1_Silent_p.L537L|EMR2_ENST00000353876.1_Silent_p.L455L|EMR2_ENST00000392965.3_Silent_p.L490L|EMR2_ENST00000594076.1_Silent_p.L455L|EMR2_ENST00000346057.1_Silent_p.L499L	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	548					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GGAGGCACAGCAGAGAGACGC	0.577																																						dbGAP											0													96.0	84.0	88.0					19																	14863285		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.1644G>A	19.37:g.14863285C>T			B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,prints_GPCR_2_CD97	p.A367T	ENST00000315576.3	37	c.1099	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	C	11.19	1.565949	0.27915	.	.	ENSG00000127507	ENST00000392964;ENST00000392962	T;T	0.79247	1.12;-1.25	4.22	0.487	0.16842	.	.	.	.	.	T	0.79885	0.4523	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76394	-0.2975	6	0.56958	D	0.05	.	8.8604	0.35253	0.1587:0.3763:0.465:0.0	.	.	.	.	T	213;367	ENSP00000376691:A213T;ENSP00000376689:A367T	ENSP00000376689:A367T	A	-	1	0	EMR2	14724285	0.211000	0.23529	0.497000	0.27552	0.113000	0.19764	0.564000	0.23563	-0.006000	0.14370	0.508000	0.49915	GCT	EMR2	-	NULL	ENSG00000127507		0.577	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	296	0.00	0	C			14863285	14863285	-1	no_errors	ENST00000392962	ensembl	human	known	69_37n	missense	151	34.35	79	SNP	0.997	T
FOXN3	1112	genome.wustl.edu	37	14	89878525	89878525	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr14:89878525G>A	ENST00000345097.4	-	2	412	c.296C>T	c.(295-297)gCc>gTc	p.A99V	RP11-33N16.3_ENST00000555070.1_RNA|RP11-33N16.2_ENST00000556383.1_RNA|FOXN3_ENST00000261302.5_Missense_Mutation_p.A99V|FOXN3_ENST00000555353.1_Missense_Mutation_p.A99V|FOXN3_ENST00000557258.1_Missense_Mutation_p.A99V	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	99					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTCAGAGTGGGCAGGGGATGG	0.592																																						dbGAP											0													56.0	54.0	55.0					14																	89878525		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.296C>T	14.37:g.89878525G>A	ENSP00000343288:p.Ala99Val		Q96II7|Q9UIE7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A99V	ENST00000345097.4	37	c.296	CCDS41977.1	14	.	.	.	.	.	.	.	.	.	.	G	15.80	2.940371	0.52972	.	.	ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353;ENST00000555855	D;D;D;D;D	0.95377	-3.53;-3.53;-3.33;-3.33;-3.69	5.15	5.15	0.70609	.	0.065502	0.64402	D	0.000012	D	0.94205	0.8140	L	0.57536	1.79	0.80722	D	1	B;B	0.30914	0.128;0.3	B;B	0.33454	0.071;0.164	D	0.92670	0.6149	10	0.30078	T	0.28	.	18.6345	0.91372	0.0:0.0:1.0:0.0	.	99;99	O00409;O00409-2	FOXN3_HUMAN;.	V	99	ENSP00000343288:A99V;ENSP00000261302:A99V;ENSP00000452005:A99V;ENSP00000452227:A99V;ENSP00000451135:A99V	ENSP00000261302:A99V	A	-	2	0	FOXN3	88948278	1.000000	0.71417	0.997000	0.53966	0.223000	0.24884	9.869000	0.99810	2.416000	0.81992	0.555000	0.69702	GCC	FOXN3	-	NULL	ENSG00000053254		0.592	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN3	HGNC	protein_coding	OTTHUMT00000410902.2	101	0.00	0	G	NM_005197		89878525	89878525	-1	no_errors	ENST00000261302	ensembl	human	known	69_37n	missense	67	21.18	18	SNP	1.000	A
GATA3	2625	genome.wustl.edu	37	10	8115952	8115953	+	Frame_Shift_Ins	INS	-	-	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr10:8115952_8115953insC	ENST00000346208.3	+	6	1753_1754	c.1298_1299insC	c.(1297-1302)caccacfs	p.H434fs	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Frame_Shift_Ins_p.H435fs			P23771	GATA3_HUMAN	GATA binding protein 3	434					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TTTGGACCACACCACCCCTCCA	0.624			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	0																																										-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1300dupC	10.37:g.8115954_8115954dupC	ENSP00000341619:p.His434fs		Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.H435fs	ENST00000346208.3	37	c.1301_1302	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.624	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	159	0.00	0	-	NM_001002295		8115952	8115953	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	103	11.21	13	INS	1.000:0.946	C
HCFC1	3054	genome.wustl.edu	37	X	153215007	153215007	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chrX:153215007T>C	ENST00000310441.7	-	25	7031	c.6065A>G	c.(6064-6066)gAa>gGa	p.E2022G	HCFC1_ENST00000369984.4_Missense_Mutation_p.E2067G|HCFC1_ENST00000354233.3_Missense_Mutation_p.E1953G	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	2022					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGCTTACATTTCTGGAGAGGA	0.562																																						dbGAP											0													101.0	99.0	99.0					X																	153215007		1942	4115	6057	-	-	-	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.6065A>G	X.37:g.153215007T>C	ENSP00000309555:p.Glu2022Gly		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.E2022G	ENST00000310441.7	37	c.6065	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	T	27.9	4.876639	0.91664	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.03301	3.98;3.98;3.98	5.43	5.43	0.79202	.	0.050906	0.85682	D	0.000000	T	0.02455	0.0075	N	0.08118	0	0.42039	D	0.991063	P	0.40970	0.734	B	0.34824	0.19	T	0.61138	-0.7123	10	0.56958	D	0.05	.	13.4656	0.61251	0.0:0.0:0.0:1.0	.	2022	P51610	HCFC1_HUMAN	G	2022;2067;1953	ENSP00000309555:E2022G;ENSP00000359001:E2067G;ENSP00000346174:E1953G	ENSP00000309555:E2022G	E	-	2	0	HCFC1	152868201	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.762000	0.74950	1.823000	0.53134	0.430000	0.28490	GAA	HCFC1	-	NULL	ENSG00000172534		0.562	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	337	0.00	0	T	NM_005334		153215007	153215007	-1	no_errors	ENST00000310441	ensembl	human	known	69_37n	missense	204	33.01	101	SNP	1.000	C
IL20RB	53833	genome.wustl.edu	37	3	136699172	136699172	+	Intron	SNP	G	G	A			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr3:136699172G>A	ENST00000329582.4	+	2	337				IL20RB_ENST00000484501.1_Intron|IL20RB-AS1_ENST00000462176.2_RNA|IL20RB_ENST00000309741.5_Splice_Site	NM_144717.3	NP_653318.2	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta						homeostasis of number of cells within a tissue (GO:0048873)|immune response-inhibiting signal transduction (GO:0002765)|inflammatory response to antigenic stimulus (GO:0002437)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of type IV hypersensitivity (GO:0001808)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-4 production (GO:0032753)	integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14						ctgttgtctaggctggagtgc	0.408																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC033292	CCDS3093.1	3q22.3	2013-02-11			ENSG00000174564	ENSG00000174564		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	6004	protein-coding gene	gene with protein product		605621	"""fibronectin type III domain containing 6"""	FNDC6		11163236, 16703417	Standard	NM_144717		Approved	DIRS1, IL-20R2, MGC34923	uc003eri.2	Q6UXL0	OTTHUMG00000159779	ENST00000329582.4:c.89-136G>A	3.37:g.136699172G>A			B4DL40|Q6P438|Q8IYY5|Q8TAJ7	Splice_Site	SNP	-	e1-1	ENST00000329582.4	37	c.1-1	CCDS3093.1	3																																																																																			IL20RB	-	-	ENSG00000174564		0.408	IL20RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20RB	HGNC	protein_coding	OTTHUMT00000357277.2	67	0.00	0	G	NM_144717		136699172	136699172	+1	no_errors	ENST00000309741	ensembl	human	known	69_37n	splice_site	59	25.93	21	SNP	0.001	A
KIAA1024	23251	genome.wustl.edu	37	15	79749073	79749073	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr15:79749073T>C	ENST00000305428.3	+	2	659	c.584T>C	c.(583-585)tTg>tCg	p.L195S		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	195						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CTGGACAGGTTGCAGGCCCTG	0.562																																						dbGAP											0													58.0	60.0	59.0					15																	79749073		2196	4293	6489	-	-	-	SO:0001583	missense	0			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.584T>C	15.37:g.79749073T>C	ENSP00000307461:p.Leu195Ser		A7MD43	Missense_Mutation	SNP	pfam_UPF0258	p.L195S	ENST00000305428.3	37	c.584	CCDS32306.1	15	.	.	.	.	.	.	.	.	.	.	T	15.40	2.821314	0.50633	.	.	ENSG00000169330	ENST00000305428	T	0.69175	-0.38	5.51	5.51	0.81932	.	0.074011	0.64402	D	0.000018	T	0.80138	0.4568	M	0.67953	2.075	0.48395	D	0.999647	D	0.89917	1.0	D	0.83275	0.996	T	0.80374	-0.1409	9	.	.	.	.	15.6239	0.76833	0.0:0.0:0.0:1.0	.	195	Q9UPX6	K1024_HUMAN	S	195	ENSP00000307461:L195S	.	L	+	2	0	KIAA1024	77536128	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	5.445000	0.66594	2.089000	0.63090	0.482000	0.46254	TTG	KIAA1024	-	NULL	ENSG00000169330		0.562	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1024	HGNC	protein_coding	OTTHUMT00000416718.1	110	0.00	0	T	NM_015206		79749073	79749073	+1	no_errors	ENST00000305428	ensembl	human	known	69_37n	missense	77	28.70	31	SNP	1.000	C
KIF19	124602	genome.wustl.edu	37	17	72350926	72350926	+	Silent	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr17:72350926C>T	ENST00000389916.4	+	19	2850	c.2712C>T	c.(2710-2712)tcC>tcT	p.S904S	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	904					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CACAGCTCTCCCACCCCAAGA	0.632																																						dbGAP											0													29.0	31.0	30.0					17																	72350926		1979	4092	6071	-	-	-	SO:0001819	synonymous_variant	0			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2712C>T	17.37:g.72350926C>T			A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S904	ENST00000389916.4	37	c.2712	CCDS32718.2	17																																																																																			KIF19	-	NULL	ENSG00000196169		0.632	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2	169	0.00	0	C	NM_153209		72350926	72350926	+1	no_errors	ENST00000389916	ensembl	human	known	69_37n	silent	415	12.63	60	SNP	0.054	T
KLK4	9622	genome.wustl.edu	37	19	51410279	51410279	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr19:51410279C>A	ENST00000324041.1	-	5	675	c.676G>T	c.(676-678)Gcc>Tcc	p.A226S	KLK4_ENST00000597441.1_5'Flank|KLK4_ENST00000431178.2_3'UTR	NM_004917.3	NP_004908.3	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4	226	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amelogenesis (GO:0097186)|extracellular matrix disassembly (GO:0022617)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(8)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		CCACACGGGGCTTTTCCGAAA	0.542																																						dbGAP											0													80.0	78.0	79.0					19																	51410279		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113141	CCDS12809.1	19q13.41	2014-09-04	2006-10-27		ENSG00000167749	ENSG00000167749		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6365	protein-coding gene	gene with protein product		603767	"""kallikrein 4 (prostase, enamel matrix, prostate)"""	PRSS17		10077646, 10438493, 16800724, 10863090, 9465170	Standard	XM_005259441		Approved	EMSP, EMSP1, PSTS, KLK-L1	uc002pua.1	Q9Y5K2	OTTHUMG00000182964	ENST00000324041.1:c.676G>T	19.37:g.51410279C>A	ENSP00000326159:p.Ala226Ser		Q4VB16|Q96RU5|Q9GZL6|Q9UBJ6	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.A226S	ENST00000324041.1	37	c.676	CCDS12809.1	19	.	.	.	.	.	.	.	.	.	.	c	6.424	0.446316	0.12164	.	.	ENSG00000167749	ENST00000324041	D	0.88201	-2.35	3.63	-5.91	0.02269	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.403990	0.05193	N	0.503415	T	0.73822	0.3636	N	0.11818	0.18	0.09310	N	1	B	0.11235	0.004	B	0.17433	0.018	T	0.60571	-0.7237	10	0.21540	T	0.41	.	4.3089	0.10960	0.5308:0.2018:0.0:0.2674	.	226	Q9Y5K2	KLK4_HUMAN	S	226	ENSP00000326159:A226S	ENSP00000326159:A226S	A	-	1	0	KLK4	56102091	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.253000	0.18296	-1.124000	0.02936	-0.873000	0.02984	GCC	KLK4	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000167749		0.542	KLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK4	HGNC	protein_coding	OTTHUMT00000464449.1	146	0.00	0	C	NM_004917		51410279	51410279	-1	no_errors	ENST00000324041	ensembl	human	known	69_37n	missense	98	20.80	26	SNP	0.000	A
LMTK2	22853	genome.wustl.edu	37	7	97823713	97823713	+	Silent	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr7:97823713C>T	ENST00000297293.5	+	11	4229	c.3936C>T	c.(3934-3936)gaC>gaT	p.D1312D		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1312					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					AGTCGGAGGACGAGACCGAGC	0.642																																						dbGAP											0													118.0	111.0	113.0					7																	97823713		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.3936C>T	7.37:g.97823713C>T			A4D272|Q75MG7|Q9UPS3	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D1312	ENST00000297293.5	37	c.3936	CCDS5654.1	7																																																																																			LMTK2	-	NULL	ENSG00000164715		0.642	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	126	0.00	0	C	NM_014916		97823713	97823713	+1	no_errors	ENST00000297293	ensembl	human	known	69_37n	silent	57	31.33	26	SNP	0.373	T
MRPL38	64978	genome.wustl.edu	37	17	73898161	73898161	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr17:73898161G>C	ENST00000309352.3	-	3	859	c.322C>G	c.(322-324)Cag>Gag	p.Q108E	MRPL38_ENST00000585475.1_5'UTR|MRPL38_ENST00000409963.3_5'UTR|RP11-552F3.10_ENST00000587267.1_RNA	NM_032478.3	NP_115867.2	Q96DV4	RM38_HUMAN	mitochondrial ribosomal protein L38	108						mitochondrion (GO:0005739)|ribosome (GO:0005840)				ovary(1)|pancreas(1)|prostate(2)|skin(1)	5			all cancers(21;0.000154)|Epithelial(20;0.000156)|BRCA - Breast invasive adenocarcinoma(9;0.00936)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGGATGGCCTGTTTCCGTTCC	0.587																																						dbGAP											0													84.0	76.0	79.0					17																	73898161		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB051345	CCDS11733.2	17q23-q25	2012-09-13			ENSG00000204316	ENSG00000204316		"""Mitochondrial ribosomal proteins / large subunits"""	14033	protein-coding gene	gene with protein product		611844				11543634	Standard	NM_032478		Approved	RPML3, MRP-L3, HSPC262, MGC4810	uc010wso.1	Q96DV4	OTTHUMG00000152977	ENST00000309352.3:c.322C>G	17.37:g.73898161G>C	ENSP00000308275:p.Gln108Glu		B3KN96|Q96Q66|Q9P0B9	Missense_Mutation	SNP	pfam_PtdEtn-bd_prot_PEBP,superfamily_PtdEtn-bd_prot_PEBP	p.Q108E	ENST00000309352.3	37	c.322	CCDS11733.2	17	.	.	.	.	.	.	.	.	.	.	G	0.054	-1.240761	0.01493	.	.	ENSG00000204316	ENST00000309352	T	0.21543	2.0	5.15	1.8	0.24995	.	0.891435	0.09533	N	0.789291	T	0.11410	0.0278	N	0.17474	0.49	0.19300	N	0.999978	B	0.06786	0.001	B	0.04013	0.001	T	0.34129	-0.9841	10	0.12103	T	0.63	.	8.2804	0.31898	0.0:0.1969:0.4501:0.3531	.	108	Q96DV4	RM38_HUMAN	E	108	ENSP00000308275:Q108E	ENSP00000308275:Q108E	Q	-	1	0	MRPL38	71409756	0.134000	0.22483	0.213000	0.23690	0.011000	0.07611	1.095000	0.30964	1.095000	0.41419	-0.284000	0.09977	CAG	MRPL38	-	NULL	ENSG00000204316		0.587	MRPL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL38	HGNC	protein_coding	OTTHUMT00000328829.1	376	0.00	0	G	NM_032478		73898161	73898161	-1	no_errors	ENST00000309352	ensembl	human	known	69_37n	missense	267	28.23	105	SNP	0.029	C
MTERF2	80298	genome.wustl.edu	37	12	107371529	107371529	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr12:107371529C>T	ENST00000552029.1	-	2	3032	c.964G>A	c.(964-966)Gtt>Att	p.V322I	MTERFD3_ENST00000392830.2_Missense_Mutation_p.V322I|MTERFD3_ENST00000240050.4_Missense_Mutation_p.V322I|C12orf23_ENST00000551237.1_Intron			Q49AM1	MTEF2_HUMAN		322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	transcription regulatory region DNA binding (GO:0044212)			breast(1)|kidney(1)|large_intestine(2)|lung(3)	7						AATTCAAGAACCATTGGCGTC	0.378																																						dbGAP											0													201.0	206.0	204.0					12																	107371529		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000552029.1:c.964G>A	12.37:g.107371529C>T	ENSP00000447651:p.Val322Ile		Q53HM2|Q9H4L6|Q9H7Y9	Missense_Mutation	SNP	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	p.V322I	ENST00000552029.1	37	c.964	CCDS9111.1	12	.	.	.	.	.	.	.	.	.	.	C	20.1	3.931445	0.73442	.	.	ENSG00000120832	ENST00000392830;ENST00000240050;ENST00000552029	T;T;T	0.14893	2.47;2.47;2.47	5.81	4.92	0.64577	.	0.056069	0.64402	D	0.000001	T	0.21468	0.0517	M	0.72894	2.215	0.54753	D	0.999984	B	0.29162	0.235	B	0.28916	0.096	T	0.03148	-1.1067	10	0.18276	T	0.48	-9.2485	14.8703	0.70450	0.0:0.9312:0.0:0.0688	.	322	Q49AM1	MTER3_HUMAN	I	322	ENSP00000376575:V322I;ENSP00000240050:V322I;ENSP00000447651:V322I	ENSP00000240050:V322I	V	-	1	0	MTERFD3	105895659	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	5.765000	0.68834	1.466000	0.48025	0.460000	0.39030	GTT	MTERFD3	-	pfam_Mit_transcrip_term-rel	ENSG00000120832		0.378	MTERFD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MTERFD3	HGNC	protein_coding	OTTHUMT00000406835.1	433	0.00	0	C			107371529	107371529	-1	no_errors	ENST00000240050	ensembl	human	known	69_37n	missense	398	25.88	139	SNP	1.000	T
NCKAP5	344148	genome.wustl.edu	37	2	133539971	133539971	+	Silent	SNP	T	T	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr2:133539971T>C	ENST00000409261.1	-	14	4786	c.4413A>G	c.(4411-4413)acA>acG	p.T1471T	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Silent_p.T1471T|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1471										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TTTCTTCGATTGTGGGTGAGA	0.502																																						dbGAP											0													64.0	62.0	62.0					2																	133539971		1899	4121	6020	-	-	-	SO:0001819	synonymous_variant	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4413A>G	2.37:g.133539971T>C			B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	NULL	p.T1471	ENST00000409261.1	37	c.4413	CCDS46418.1	2																																																																																			NCKAP5	-	NULL	ENSG00000176771		0.502	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	244	0.00	0	T	NM_207481		133539971	133539971	-1	no_errors	ENST00000317721	ensembl	human	known	69_37n	silent	141	26.18	50	SNP	0.969	C
OR7A5	26659	genome.wustl.edu	37	19	14938267	14938267	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr19:14938267C>A	ENST00000322301.3	-	2	874	c.787G>T	c.(787-789)Gct>Tct	p.A263S	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Missense_Mutation_p.A263S			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	263					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						CGGGTGGCAGCAGAACTAAGG	0.483																																						dbGAP											0													92.0	79.0	83.0					19																	14938267		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.787G>T	19.37:g.14938267C>A	ENSP00000316955:p.Ala263Ser		B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A263S	ENST00000322301.3	37	c.787	CCDS12318.1	19	.	.	.	.	.	.	.	.	.	.	c	12.57	1.978080	0.34942	.	.	ENSG00000188269	ENST00000322301	T	0.00063	8.78	3.12	1.95	0.26073	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.02674	-0.535	0.09310	N	1	B	0.33826	0.427	B	0.40940	0.344	T	0.13150	-1.0520	9	0.41790	T	0.15	.	3.4324	0.07433	0.2525:0.608:0.0:0.1396	.	263	Q15622	OR7A5_HUMAN	S	263	ENSP00000316955:A263S	ENSP00000316955:A263S	A	-	1	0	OR7A5	14799267	0.000000	0.05858	0.136000	0.22124	0.240000	0.25518	-1.030000	0.03581	1.803000	0.52742	0.121000	0.15741	GCT	OR7A5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000188269		0.483	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A5	HGNC	protein_coding	OTTHUMT00000466518.1	285	0.00	0	C	NM_017506		14938267	14938267	-1	no_errors	ENST00000322301	ensembl	human	known	69_37n	missense	203	23.40	62	SNP	0.020	A
SLC7A7	9056	genome.wustl.edu	37	14	23239475	23239475	+	IGR	SNP	C	C	G			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr14:23239475C>G	ENST00000397532.3	-	0	2447				OXA1L_ENST00000285848.5_Silent_p.L279L|OXA1L_ENST00000412791.1_Silent_p.L219L|OXA1L_ENST00000358043.5_Silent_p.L203L|OXA1L_ENST00000604262.1_Silent_p.L219L			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		CTCTCATTCTCCCTGTGACTC	0.418																																						dbGAP											0													67.0	63.0	64.0					14																	23239475		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692		14.37:g.23239475C>G			B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Silent	SNP	pfam_Membrane_insertion_OxaA/YidC,tigrfam_Membrane_insertion_OxaA/YidC	p.L279	ENST00000397532.3	37	c.837	CCDS9574.1	14																																																																																			OXA1L	-	pfam_Membrane_insertion_OxaA/YidC,tigrfam_Membrane_insertion_OxaA/YidC	ENSG00000155463		0.418	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OXA1L	HGNC	protein_coding	OTTHUMT00000071636.3	226	0.00	0	C			23239475	23239475	+1	no_errors	ENST00000285848	ensembl	human	known	69_37n	silent	169	26.41	61	SNP	0.951	G
PHC2	1912	genome.wustl.edu	37	1	33795722	33795722	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr1:33795722G>A	ENST00000257118.5	-	12	2148	c.2095C>T	c.(2095-2097)Cgg>Tgg	p.R699W	PHC2_ENST00000373418.3_Missense_Mutation_p.R164W|PHC2_ENST00000373416.1_Missense_Mutation_p.R164W|MIR3605_ENST00000583214.1_RNA|PHC2_ENST00000373422.3_Missense_Mutation_p.R305W|PHC2_ENST00000431992.1_Missense_Mutation_p.R670W|PHC2_ENST00000419414.2_Missense_Mutation_p.R700W|PHC2_ENST00000485928.1_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	699					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TTGCTGGCCCGACGGCGGTTG	0.597																																						dbGAP											0													133.0	104.0	114.0					1																	33795722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.2095C>T	1.37:g.33795722G>A	ENSP00000257118:p.Arg699Trp		A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.R700W	ENST00000257118.5	37	c.2098	CCDS378.1	1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612650	0.87258	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000373422;ENST00000373418;ENST00000307890;ENST00000419414;ENST00000373416	T;T;T;T	0.52983	1.65;1.21;0.64;1.62	6.04	5.11	0.69529	.	0.102129	0.64402	D	0.000005	T	0.65565	0.2703	M	0.65975	2.015	0.49483	D	0.999794	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.998;0.999	T	0.68659	-0.5350	10	0.72032	D	0.01	-26.7663	12.1469	0.54028	0.0:0.0:0.6884:0.3116	.	700;671;699;114	A8KA40;B7ZLY0;Q8IXK0;Q8IXK0-3	.;.;PHC2_HUMAN;.	W	670;699;305;164;277;700;164	ENSP00000389436:R670W;ENSP00000257118:R699W;ENSP00000362521:R305W;ENSP00000391440:R700W	ENSP00000257118:R699W	R	-	1	2	PHC2	33568309	0.962000	0.33011	0.925000	0.36789	0.990000	0.78478	1.571000	0.36450	1.531000	0.49152	0.561000	0.74099	CGG	PHC2	-	NULL	ENSG00000134686		0.597	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1	481	0.00	0	G	NM_198040		33795722	33795722	-1	no_errors	ENST00000419414	ensembl	human	known	69_37n	missense	282	15.48	52	SNP	0.979	A
PITPNM1	9600	genome.wustl.edu	37	11	67261512	67261512	+	Silent	SNP	C	C	A			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr11:67261512C>A	ENST00000534749.1	-	19	3077	c.2889G>T	c.(2887-2889)ctG>ctT	p.L963L	PITPNM1_ENST00000526450.1_5'UTR|PITPNM1_ENST00000436757.2_Silent_p.L962L|PITPNM1_ENST00000356404.3_Silent_p.L963L			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	963					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						ACTTGCCCGACAGCGGCTGCG	0.647																																					GBM(28;144 709 4607 5525)	dbGAP											0													45.0	46.0	45.0					11																	67261512		2199	4293	6492	-	-	-	SO:0001819	synonymous_variant	0			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2889G>T	11.37:g.67261512C>A			A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.L963	ENST00000534749.1	37	c.2889	CCDS31620.1	11																																																																																			PITPNM1	-	NULL	ENSG00000110697		0.647	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	59	0.00	0	C	NM_004910		67261512	67261512	-1	no_errors	ENST00000356404	ensembl	human	known	69_37n	silent	33	17.50	7	SNP	0.996	A
POTEA	340441	genome.wustl.edu	37	8	43152259	43152259	+	RNA	SNP	G	G	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr8:43152259G>T	ENST00000522175.2	+	0	398							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ACAGCAAAAAGAGGACAGCTC	0.378																																						dbGAP											0													92.0	90.0	91.0					8																	43152259		2173	4287	6460	-	-	-			0			AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43152259G>T			A6ND17|A6ND71|Q6S8J6	RNA	SNP	-	NULL	ENST00000522175.2	37	NULL		8																																																																																			POTEA	-	-	ENSG00000188877		0.378	POTEA-003	KNOWN	basic	processed_transcript	POTEA	HGNC	pseudogene	OTTHUMT00000383492.1	594	0.00	0	G	NM_001002920		43152259	43152259	+1	no_errors	ENST00000522175	ensembl	human	known	69_37n	rna	350	32.95	174	SNP	0.996	T
RAPGEF4	11069	genome.wustl.edu	37	2	173825508	173825508	+	Silent	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr2:173825508C>T	ENST00000397081.3	+	7	701	c.558C>T	c.(556-558)caC>caT	p.H186H	RAPGEF4_ENST00000539331.1_Silent_p.H33H|RAPGEF4_ENST00000473043.1_Intron|RAPGEF4_ENST00000538974.1_Intron|RAPGEF4_ENST00000397087.3_Silent_p.H42H|RAPGEF4_ENST00000540783.1_Silent_p.H33H|RAPGEF4_ENST00000409036.1_Silent_p.H186H|RAPGEF4_ENST00000535187.1_Intron|RAPGEF4_ENST00000264111.6_Silent_p.H185H	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	186					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TTGAACCTCACGTTCCTCTTC	0.398																																						dbGAP											0													83.0	76.0	78.0					2																	173825508		1866	4105	5971	-	-	-	SO:0001819	synonymous_variant	0			U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.558C>T	2.37:g.173825508C>T			B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Silent	SNP	pfam_RasGRF_CDC25,pfam_cNMP-bd_dom,pfam_DEP_dom,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_DEP_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_DEP_dom,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_cAMP/cGMP_kin	p.H186	ENST00000397081.3	37	c.558	CCDS42775.1	2																																																																																			RAPGEF4	-	NULL	ENSG00000091428		0.398	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	HGNC	protein_coding	OTTHUMT00000257864.2	381	0.26	1	C	NM_007023		173825508	173825508	+1	no_errors	ENST00000397081	ensembl	human	known	69_37n	silent	264	15.11	47	SNP	1.000	T
RBM19	9904	genome.wustl.edu	37	12	114296632	114296632	+	Missense_Mutation	SNP	G	G	T	rs149095460		TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr12:114296632G>T	ENST00000545145.2	-	22	2706	c.2628C>A	c.(2626-2628)ttC>ttA	p.F876L	RBM19_ENST00000261741.5_Missense_Mutation_p.F876L|RBM19_ENST00000392561.3_Missense_Mutation_p.F876L	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	876	RRM 6. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CCACAAAGCCGAAGCCTCTGT	0.542																																						dbGAP											0													145.0	134.0	138.0					12																	114296632		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2628C>A	12.37:g.114296632G>T	ENSP00000442053:p.Phe876Leu		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.F876L	ENST00000545145.2	37	c.2628	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232896	0.79688	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.20463	2.07;2.07;2.07	5.2	1.95	0.26073	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.47451	0.1446	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.46735	-0.9170	10	0.87932	D	0	-16.2688	6.9055	0.24307	0.4803:0.0:0.5197:0.0	.	876	Q9Y4C8	RBM19_HUMAN	L	876	ENSP00000442053:F876L;ENSP00000376344:F876L;ENSP00000261741:F876L	ENSP00000261741:F876L	F	-	3	2	RBM19	112781015	0.993000	0.37304	0.996000	0.52242	0.997000	0.91878	0.432000	0.21461	0.582000	0.29556	0.655000	0.94253	TTC	RBM19	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122965		0.542	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	300	0.33	1	G	NM_016196		114296632	114296632	-1	no_errors	ENST00000261741	ensembl	human	known	69_37n	missense	234	27.47	89	SNP	1.000	T
SERPINE1	5054	genome.wustl.edu	37	7	100777176	100777176	+	Splice_Site	SNP	T	T	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr7:100777176T>C	ENST00000223095.4	+	5	1056		c.e5+2		SERPINE1_ENST00000445463.2_Splice_Site	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1						angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TCTGCCCAAGTAAGCCACCCC	0.597																																						dbGAP											0													92.0	80.0	84.0					7																	100777176		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.899+2T>C	7.37:g.100777176T>C			B7Z4S0|F8WD53	Splice_Site	SNP	-	e4+2	ENST00000223095.4	37	c.899+2	CCDS5711.1	7	.	.	.	.	.	.	.	.	.	.	T	22.3	4.274247	0.80580	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000536888	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8028	0.63212	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SERPINE1	100563896	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	6.417000	0.73337	2.200000	0.70718	0.459000	0.35465	.	SERPINE1	-	-	ENSG00000106366		0.597	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINE1	HGNC	protein_coding	OTTHUMT00000347458.1	145	0.00	0	T	NM_000602	Intron	100777176	100777176	+1	no_errors	ENST00000223095	ensembl	human	known	69_37n	splice_site	89	27.20	34	SNP	1.000	C
TCF7L2	6934	genome.wustl.edu	37	10	114910812	114910812	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr10:114910812C>T	ENST00000355995.4	+	9	1438	c.931C>T	c.(931-933)Cat>Tat	p.H311Y	TCF7L2_ENST00000538897.1_Missense_Mutation_p.H311Y|TCF7L2_ENST00000369386.1_5'Flank|TCF7L2_ENST00000355717.4_Missense_Mutation_p.H335Y|TCF7L2_ENST00000369397.4_Missense_Mutation_p.H288Y|TCF7L2_ENST00000536810.1_Missense_Mutation_p.H311Y|TCF7L2_ENST00000369389.1_Missense_Mutation_p.H22Y|TCF7L2_ENST00000534894.1_Missense_Mutation_p.H311Y|TCF7L2_ENST00000542695.1_Missense_Mutation_p.H27Y|TCF7L2_ENST00000352065.5_Missense_Mutation_p.H288Y|TCF7L2_ENST00000543371.1_Missense_Mutation_p.H311Y|TCF7L2_ENST00000545257.1_Missense_Mutation_p.H311Y			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	311	Mediates interaction with MAD2L2.|Pro-rich.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GGGCATTCCGCATCCGGCCAT	0.483			T	VTI1A	colorectal																																	dbGAP		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	0													249.0	194.0	212.0					10																	114910812		2203	4300	6503	-	-	-	SO:0001583	missense	0			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.931C>T	10.37:g.114910812C>T	ENSP00000348274:p.His311Tyr		B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	pfam_CTNNB1-bd_N,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.H311Y	ENST00000355995.4	37	c.931		10	.	.	.	.	.	.	.	.	.	.	c	27.6	4.843211	0.91197	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000352065;ENST00000542695;ENST00000369389;ENST00000277945	D;D;D;D;D;D;D;D;D;D;D;D	0.99388	-5.23;-5.24;-5.28;-5.29;-5.76;-5.81;-5.76;-5.24;-5.76;-5.17;-5.71;-5.73	5.17	5.17	0.71159	.	0.097507	0.64402	D	0.000002	D	0.99486	0.9817	M	0.88105	2.93	0.80722	D	1	D;D;D;D;D;P;D;D;D;D;P;D;D;D;P;D;P;D;D	0.89917	0.999;1.0;0.992;0.999;1.0;0.841;0.998;1.0;0.974;0.999;0.821;0.999;0.999;0.997;0.906;0.997;0.511;1.0;1.0	D;D;P;D;D;P;D;D;P;D;P;D;D;D;P;D;P;D;D	0.87578	0.99;0.98;0.864;0.998;0.998;0.635;0.993;0.991;0.638;0.99;0.723;0.987;0.987;0.993;0.615;0.946;0.648;0.994;0.998	D	0.99113	1.0847	10	0.40728	T	0.16	-13.2894	18.6683	0.91501	0.0:1.0:0.0:0.0	.	168;128;210;311;182;226;284;288;288;254;311;288;288;293;335;288;311;284;288	B4DJZ2;B7Z9Z6;B4DWD5;Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ9;F8W742;B4DRJ8;C6ZRK2;B9X074;C6ZRJ8;C6ZRK1;C6ZRJ7;F8W7T5;C6ZRK5;Q9NQB0-7;Q9NQB0-10;Q6FHW4	.;.;.;TF7L2_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	Y	311;311;311;311;335;311;311;288;288;27;22;28	ENSP00000348274:H311Y;ENSP00000440547:H311Y;ENSP00000444972:H311Y;ENSP00000446238:H311Y;ENSP00000347949:H335Y;ENSP00000446172:H311Y;ENSP00000443626:H311Y;ENSP00000358404:H288Y;ENSP00000344823:H288Y;ENSP00000443883:H27Y;ENSP00000358396:H22Y;ENSP00000277945:H28Y	ENSP00000277945:H28Y	H	+	1	0	TCF7L2	114900802	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.814000	0.86154	2.413000	0.81919	0.655000	0.94253	CAT	TCF7L2	-	NULL	ENSG00000148737		0.483	TCF7L2-203	KNOWN	basic	protein_coding	TCF7L2	HGNC	protein_coding		360	0.00	0	C	NM_030756		114910812	114910812	+1	no_errors	ENST00000355995	ensembl	human	known	69_37n	missense	213	21.03	57	SNP	1.000	T
TMA16	55319	genome.wustl.edu	37	4	164428259	164428259	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr4:164428259A>T	ENST00000358572.5	+	2	419	c.78A>T	c.(76-78)caA>caT	p.Q26H	TMA16_ENST00000513134.1_Missense_Mutation_p.Q26H|TMA16_ENST00000508268.1_Missense_Mutation_p.Q26H|TMA16_ENST00000513272.1_Missense_Mutation_p.Q26H|TMA16_ENST00000511562.1_3'UTR	NM_018352.2	NP_060822.2	Q96EY4	TMA16_HUMAN	translation machinery associated 16 homolog (S. cerevisiae)	26						nucleus (GO:0005634)											AAGCAGCTCAAATTACGAGAG	0.358																																						dbGAP											0													50.0	44.0	46.0					4																	164428259		1826	4074	5900	-	-	-	SO:0001583	missense	0				CCDS43278.1	4q32.3	2012-03-02	2012-03-02	2012-03-02	ENSG00000198498	ENSG00000198498			25638	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 43"""	C4orf43		12477932	Standard	NM_018352		Approved	FLJ11184	uc003iqq.4	Q96EY4	OTTHUMG00000161528	ENST00000358572.5:c.78A>T	4.37:g.164428259A>T	ENSP00000351380:p.Gln26His		Q0P6E4|Q0P6J1|Q9NUR7	Missense_Mutation	SNP	pfam_DUF2962	p.Q26H	ENST00000358572.5	37	c.78	CCDS43278.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.15|18.15	3.559309|3.559309	0.65538|0.65538	.|.	.|.	ENSG00000198498|ENSG00000198498	ENST00000509657|ENST00000358572;ENST00000513272;ENST00000513134;ENST00000508268	.|T;T;T;T	.|0.36157	.|1.27;1.27;1.27;1.27	5.85|5.85	1.24|1.24	0.21308|0.21308	.|.	.|0.156973	.|0.64402	.|N	.|0.000016	T|T	0.56156|0.56156	0.1966|0.1966	M|M	0.81942|0.81942	2.565|2.565	0.41812|0.41812	D|D	0.989973|0.989973	.|D	.|0.76494	.|0.999	.|D	.|0.72982	.|0.979	T|T	0.57556|0.57556	-0.7791|-0.7791	5|10	.|0.66056	.|D	.|0.02	-17.4168|-17.4168	9.3814|9.3814	0.38316|0.38316	0.4224:0.0:0.5776:0.0|0.4224:0.0:0.5776:0.0	.|.	.|26	.|Q96EY4	.|CD043_HUMAN	Y|H	65|26	.|ENSP00000351380:Q26H;ENSP00000426933:Q26H;ENSP00000423901:Q26H;ENSP00000423375:Q26H	.|ENSP00000351380:Q26H	N|Q	+|+	1|3	0|2	C4orf43|C4orf43	164647709|164647709	0.791000|0.791000	0.28800|0.28800	0.997000|0.997000	0.53966|0.53966	0.996000|0.996000	0.88848|0.88848	-0.197000|-0.197000	0.09518|0.09518	0.265000|0.265000	0.21872|0.21872	0.523000|0.523000	0.50628|0.50628	AAT|CAA	TMA16	-	pfam_DUF2962	ENSG00000198498		0.358	TMA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMA16	HGNC	protein_coding	OTTHUMT00000365208.1	346	0.00	0	A	NM_018352		164428259	164428259	+1	no_errors	ENST00000358572	ensembl	human	known	69_37n	missense	228	18.21	51	SNP	0.997	T
TMEM246	84302	genome.wustl.edu	37	9	104238875	104238875	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr9:104238875C>T	ENST00000374851.1	-	4	1647	c.500G>A	c.(499-501)cGc>cAc	p.R167H	RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000450109.1_RNA|TMEM246_ENST00000374848.3_Missense_Mutation_p.R167H|RP11-490D19.6_ENST00000431507.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.R167H|RP11-490D19.6_ENST00000425734.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	167						integral component of membrane (GO:0016021)											GCCCTCATAGCGATTGGCCAC	0.527																																						dbGAP											0													110.0	96.0	101.0					9																	104238875		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.500G>A	9.37:g.104238875C>T	ENSP00000363984:p.Arg167His		Q49AQ4	Missense_Mutation	SNP	NULL	p.R167H	ENST00000374851.1	37	c.500	CCDS6757.1	9	.	.	.	.	.	.	.	.	.	.	C	17.42	3.386121	0.61956	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.44623	0.1302	L	0.54323	1.7	0.58432	D	0.999999	P	0.42409	0.779	B	0.36186	0.219	T	0.35101	-0.9802	9	0.15066	T	0.55	-24.9373	14.2964	0.66316	0.0:0.9269:0.0:0.073	.	167	Q9BRR3	CI125_HUMAN	H	167	.	ENSP00000363980:R167H	R	-	2	0	C9orf125	103278696	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.633000	0.46519	2.747000	0.94245	0.650000	0.86243	CGC	TMEM246	-	NULL	ENSG00000165152		0.527	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM246	HGNC	protein_coding	OTTHUMT00000053444.1	117	0.00	0	C	NM_032342		104238875	104238875	-1	no_errors	ENST00000374847	ensembl	human	known	69_37n	missense	86	25.86	30	SNP	1.000	T
TMEM59	9528	genome.wustl.edu	37	1	54509100	54509100	+	Silent	SNP	G	G	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr1:54509100G>C	ENST00000234831.5	-	4	738	c.489C>G	c.(487-489)acC>acG	p.T163T	TMEM59_ENST00000371341.1_Silent_p.T32T|TMEM59_ENST00000371348.1_Silent_p.T32T|TMEM59_ENST00000371344.1_Silent_p.T32T	NM_004872.3	NP_004863.2	Q9BXS4	TMM59_HUMAN	transmembrane protein 59	163					autophagy (GO:0006914)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of protein glycosylation in Golgi (GO:0090285)|negative regulation of protein processing (GO:0010955)|positive regulation of autophagy (GO:0010508)	extracellular vesicular exosome (GO:0070062)|Golgi cis cisterna (GO:0000137)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			kidney(3)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7						TCCATGAAGAGGTTATGAAGC	0.413																																						dbGAP											0													80.0	82.0	81.0					1																	54509100		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF047439	CCDS586.1	1p32.3	2008-05-14	2005-07-22	2005-07-22	ENSG00000116209	ENSG00000116209			1239	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 8"""	C1orf8		9653160	Standard	NM_004872		Approved	HSPC001	uc001cwp.3	Q9BXS4	OTTHUMG00000008437	ENST00000234831.5:c.489C>G	1.37:g.54509100G>C			B3KQL7|O75393|Q4VBP9|Q5T705|Q96KX7	Silent	SNP	pfam_Uncharacterised_TMEM59,superfamily_Prot_inh_Kunz-m	p.T163	ENST00000234831.5	37	c.489	CCDS586.1	1																																																																																			TMEM59	-	pfam_Uncharacterised_TMEM59	ENSG00000116209		0.413	TMEM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM59	HGNC	protein_coding	OTTHUMT00000023254.2	172	0.00	0	G	NM_004872		54509100	54509100	-1	no_errors	ENST00000234831	ensembl	human	known	69_37n	silent	123	16.33	24	SNP	1.000	C
VPS33B	26276	genome.wustl.edu	37	15	91551102	91551102	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr15:91551102G>C	ENST00000333371.3	-	7	849	c.496C>G	c.(496-498)Ctg>Gtg	p.L166V	VPS33B_ENST00000535843.1_Missense_Mutation_p.L75V|VPS33B_ENST00000535906.1_Missense_Mutation_p.L139V	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	166					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					GCATTTACCAGAAAGTAATCC	0.483																																						dbGAP											0													134.0	133.0	134.0					15																	91551102		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.496C>G	15.37:g.91551102G>C	ENSP00000327650:p.Leu166Val		B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.L166V	ENST00000333371.3	37	c.496	CCDS10369.1	15	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174906	0.38413	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.76839	-1.05;-1.05;-1.05	5.34	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.66858	0.2832	L	0.39514	1.22	0.80722	D	1	B;B	0.29612	0.211;0.251	B;B	0.29942	0.066;0.109	T	0.60722	-0.7207	10	0.14656	T	0.56	-37.4129	11.2665	0.49114	0.1506:0.0:0.8494:0.0	.	139;166	F5H008;Q9H267	.;VP33B_HUMAN	V	166;139;75;121	ENSP00000327650:L166V;ENSP00000444053:L139V;ENSP00000446267:L75V	ENSP00000327650:L166V	L	-	1	2	VPS33B	89352106	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.502000	0.45398	1.495000	0.48549	0.655000	0.94253	CTG	VPS33B	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000184056		0.483	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33B	HGNC	protein_coding	OTTHUMT00000313496.1	248	0.00	0	G	NM_018668		91551102	91551102	-1	no_errors	ENST00000333371	ensembl	human	known	69_37n	missense	179	12.25	25	SNP	1.000	C
XPO6	23214	genome.wustl.edu	37	16	28167638	28167638	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HI-01A-11D-A135-09	TCGA-C8-A1HI-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	75dc3bff-75da-4734-b930-a18fd3d1ebfe	6944644c-a43b-4a5b-b506-7427227f3eb0	g.chr16:28167638C>T	ENST00000304658.5	-	7	1354	c.854G>A	c.(853-855)cGg>cAg	p.R285Q	XPO6_ENST00000565698.1_Missense_Mutation_p.R271Q|XPO6_ENST00000561488.1_5'UTR	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	285					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						CTTTCTGGCCCGGATGTCACA	0.582																																						dbGAP											0													72.0	76.0	75.0					16																	28167638		2013	4170	6183	-	-	-	SO:0001583	missense	0			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.854G>A	16.37:g.28167638C>T	ENSP00000302790:p.Arg285Gln		A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.R285Q	ENST00000304658.5	37	c.854	CCDS42135.1	16	.	.	.	.	.	.	.	.	.	.	C	17.22	3.334422	0.60853	.	.	ENSG00000169180	ENST00000304658	T	0.68331	-0.32	5.87	5.87	0.94306	Armadillo-type fold (1);	0.049052	0.85682	D	0.000000	T	0.55114	0.1900	L	0.36672	1.1	0.58432	D	0.999999	B;P	0.49358	0.088;0.923	B;B	0.36092	0.025;0.217	T	0.55780	-0.8087	10	0.29301	T	0.29	-23.5006	18.0718	0.89410	0.0:1.0:0.0:0.0	.	285;285	B7ZM10;Q96QU8	.;XPO6_HUMAN	Q	285	ENSP00000302790:R285Q	ENSP00000302790:R285Q	R	-	2	0	XPO6	28075139	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.740000	0.55082	2.941000	0.99782	0.655000	0.94253	CGG	XPO6	-	superfamily_ARM-type_fold	ENSG00000169180		0.582	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1	279	0.00	0	C	XM_055195		28167638	28167638	-1	no_errors	ENST00000304658	ensembl	human	known	69_37n	missense	184	49.87	185	SNP	1.000	T
