#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA3	21	genome.wustl.edu	37	16	2339579	2339579	+	Silent	SNP	G	G	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr16:2339579G>T	ENST00000301732.5	-	20	3256	c.2556C>A	c.(2554-2556)atC>atA	p.I852I	ABCA3_ENST00000382381.3_Silent_p.I794I	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	852					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CAGGGAGCTGGATGGCCTGGA	0.667																																						dbGAP											0													33.0	26.0	28.0					16																	2339579		2183	4275	6458	-	-	-	SO:0001819	synonymous_variant	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2556C>A	16.37:g.2339579G>T			B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I852	ENST00000301732.5	37	c.2556	CCDS10466.1	16																																																																																			ABCA3	-	NULL	ENSG00000167972		0.667	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	12	0.00	0	G	NM_001089		2339579	2339579	-1	no_errors	ENST00000301732	ensembl	human	known	69_37n	silent	8	38.46	5	SNP	1.000	T
ABI3BP	25890	genome.wustl.edu	37	3	100471647	100471647	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:100471647C>G	ENST00000284322.5	-	33	3082	c.2973G>C	c.(2971-2973)ttG>ttC	p.L991F	ABI3BP_ENST00000383691.4_Missense_Mutation_p.L945F|ABI3BP_ENST00000471714.1_Missense_Mutation_p.L1693F	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	991					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						GGGAGTCGCTCAAGTAAATCT	0.413																																						dbGAP											0													127.0	120.0	122.0					3																	100471647		1869	4111	5980	-	-	-	SO:0001583	missense	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.2973G>C	3.37:g.100471647C>G	ENSP00000284322:p.Leu991Phe		B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L991F	ENST00000284322.5	37	c.2973	CCDS46880.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.23|18.23	3.578510|3.578510	0.65878|0.65878	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000383692;ENST00000429331;ENST00000383691|ENST00000495591	T;T;T|.	0.60797|.	0.16;0.16;0.16|.	6.02|6.02	3.15|3.15	0.36227|0.36227	.|.	0.066864|.	0.64402|.	D|.	0.000009|.	T|.	0.62490|.	0.2432|.	M|M	0.78801|0.78801	2.425|2.425	0.58432|0.58432	D|D	0.999991|0.999991	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.997;0.998;0.997;0.999|.	T|.	0.61202|.	-0.7110|.	10|.	0.87932|.	D|.	0|.	-6.3322|-6.3322	3.023|3.023	0.06082|0.06082	0.1159:0.5113:0.2145:0.1583|0.1159:0.5113:0.2145:0.1583	.|.	945;991;1693;700|.	B4DSV9;Q7Z7G0;D3YTG3;D3YTD6|.	.;TARSH_HUMAN;.;.|.	F|S	1693;991;700;402;945|1047	ENSP00000420524:L1693F;ENSP00000284322:L991F;ENSP00000373189:L945F|.	ENSP00000284322:L991F|.	L|X	-|-	3|2	2|2	ABI3BP|ABI3BP	101954337|101954337	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.974000|0.974000	0.67602|0.67602	1.707000|1.707000	0.37888|0.37888	0.885000|0.885000	0.36088|0.36088	0.650000|0.650000	0.86243|0.86243	TTG|TGA	ABI3BP	-	NULL	ENSG00000154175		0.413	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	48	0.00	0	C			100471647	100471647	-1	no_errors	ENST00000284322	ensembl	human	known	69_37n	missense	74	15.91	14	SNP	1.000	G
ABR	29	genome.wustl.edu	37	17	953383	953383	+	Silent	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:953383C>T	ENST00000302538.5	-	16	1844	c.1698G>A	c.(1696-1698)agG>agA	p.R566R	ABR_ENST00000291107.2_Silent_p.R529R|ABR_ENST00000544583.2_Silent_p.R520R|ABR_ENST00000536794.2_Silent_p.R348R|ABR_ENST00000574437.1_Silent_p.R520R	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	566	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		AGCACAGGATCCTCAGGGACT	0.552																																					Esophageal Squamous(197;2016 2115 4129 29033 46447)	dbGAP											0													245.0	195.0	212.0					17																	953383		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1698G>A	17.37:g.953383C>T			B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.G24E	ENST00000302538.5	37	c.71	CCDS10999.1	17																																																																																			ABR	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000159842		0.552	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	HGNC	protein_coding	OTTHUMT00000206675.4	53	0.00	0	C			953383	953383	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000572152	ensembl	human	known	69_37n	missense	39	37.10	23	SNP	1.000	T
ACADVL	37	genome.wustl.edu	37	17	7125548	7125548	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:7125548G>C	ENST00000356839.5	+	9	984	c.805G>C	c.(805-807)Gat>Cat	p.D269H	ACADVL_ENST00000543245.2_Missense_Mutation_p.D292H|ACADVL_ENST00000350303.5_Missense_Mutation_p.D247H|MIR324_ENST00000362183.1_RNA|DLG4_ENST00000399510.2_5'Flank	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	269	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						ACCAGTTACAGATCCAGCCAC	0.557																																						dbGAP											0													52.0	51.0	51.0					17																	7125548		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.805G>C	17.37:g.7125548G>C	ENSP00000349297:p.Asp269His		B4DEB6|F5H2A9|O76056|Q8WUL0	Missense_Mutation	SNP	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C	p.D269H	ENST00000356839.5	37	c.805	CCDS11090.1	17	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008800	0.75046	.	.	ENSG00000072778	ENST00000543245;ENST00000356839;ENST00000350303;ENST00000322910;ENST00000542255	D;D	0.99032	-5.35;-5.35	5.22	4.25	0.50352	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.106867	0.64402	D	0.000008	D	0.99211	0.9726	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.67725	0.953;0.953;0.953	D	0.99379	1.0922	10	0.87932	D	0	.	11.3425	0.49541	0.0885:0.0:0.9115:0.0	.	292;247;269	F5H2A9;P49748-2;P49748	.;.;ACADV_HUMAN	H	292;315;247;269;315	ENSP00000438689:D292H;ENSP00000344152:D247H	ENSP00000325395:D269H	D	+	1	0	ACADVL	7066272	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	5.296000	0.65698	1.191000	0.43056	0.655000	0.94253	GAT	ACADVL	-	superfamily_AcylCoA_DH/oxidase	ENSG00000072778		0.557	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	HGNC	protein_coding	OTTHUMT00000220001.5	15	0.00	0	G	NM_000018		7125548	7125548	+1	no_errors	ENST00000356839	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	C
ACLY	47	genome.wustl.edu	37	17	40030139	40030139	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:40030139C>G	ENST00000352035.2	-	23	2697	c.2567G>C	c.(2566-2568)gGc>gCc	p.G856A	ACLY_ENST00000537919.1_Missense_Mutation_p.G585A|ACLY_ENST00000590151.1_Missense_Mutation_p.G856A|ACLY_ENST00000393896.2_Missense_Mutation_p.G846A|ACLY_ENST00000353196.1_Missense_Mutation_p.G846A	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	856					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				GATGGGCATGCCCGCGTAGAT	0.572																																					Colon(64;807 1396 15971 30971)	dbGAP											0													62.0	60.0	60.0					17																	40030139		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.2567G>C	17.37:g.40030139C>G	ENSP00000253792:p.Gly856Ala		B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	pfam_Citrate_synthase-like,pfam_CoA_ligase,pfam_CoA-bd,pfam_ATP-grasp_succ-CoA_synth-type,superfamily_Citrate_synthase-like_core,superfamily_Succinyl-CoA_synth-like,smart_CoA-bd,pirsf_ATP-citrate_synthase	p.G856A	ENST00000352035.2	37	c.2567	CCDS11412.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.248893	0.95305	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.93	5.93	0.95920	Citrate synthase-like, core (1);	0.000000	0.85682	D	0.000000	T	0.64638	0.2616	M	0.93678	3.445	0.80722	D	1	P;D;D;D;D	0.65815	0.841;0.994;0.994;0.995;0.966	B;P;P;D;P	0.73708	0.262;0.769;0.769;0.981;0.479	T	0.72849	-0.4168	10	0.87932	D	0	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	585;900;910;846;856	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	A	856;910;846;585;846	ENSP00000253792:G856A;ENSP00000345398:G846A;ENSP00000445349:G585A;ENSP00000377474:G846A	ENSP00000253792:G856A	G	-	2	0	ACLY	37283665	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.712000	0.84684	2.814000	0.96858	0.655000	0.94253	GGC	ACLY	-	superfamily_Citrate_synthase-like_core,pirsf_ATP-citrate_synthase	ENSG00000131473		0.572	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACLY	HGNC	protein_coding	OTTHUMT00000257465.1	20	0.00	0	C	NM_001096		40030139	40030139	-1	no_errors	ENST00000352035	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	G
ACLY	47	genome.wustl.edu	37	17	40030212	40030212	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:40030212C>G	ENST00000352035.2	-	23	2624	c.2494G>C	c.(2494-2496)Ggt>Cgt	p.G832R	ACLY_ENST00000537919.1_Missense_Mutation_p.G561R|ACLY_ENST00000590151.1_Missense_Mutation_p.G832R|ACLY_ENST00000393896.2_Missense_Mutation_p.G822R|ACLY_ENST00000353196.1_Missense_Mutation_p.G822R	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	832					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				CGGATCAAACCAAGCTCCTGG	0.567																																					Colon(64;807 1396 15971 30971)	dbGAP											0													43.0	39.0	40.0					17																	40030212		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.2494G>C	17.37:g.40030212C>G	ENSP00000253792:p.Gly832Arg		B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	pfam_Citrate_synthase-like,pfam_CoA_ligase,pfam_CoA-bd,pfam_ATP-grasp_succ-CoA_synth-type,superfamily_Citrate_synthase-like_core,superfamily_Succinyl-CoA_synth-like,smart_CoA-bd,pirsf_ATP-citrate_synthase	p.G832R	ENST00000352035.2	37	c.2494	CCDS11412.1	17	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709632	0.89018	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	5.93	3.93	0.45458	Citrate synthase-like, core (1);	0.047103	0.85682	D	0.000000	T	0.61565	0.2357	H	0.95816	3.725	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	T	0.73757	-0.3882	10	0.72032	D	0.01	.	12.8409	0.57802	0.0:0.8666:0.0:0.1334	.	561;876;886;822;832	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	R	832;886;822;561;822	ENSP00000253792:G832R;ENSP00000345398:G822R;ENSP00000445349:G561R;ENSP00000377474:G822R	ENSP00000253792:G832R	G	-	1	0	ACLY	37283738	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.977000	0.70492	1.521000	0.48983	0.655000	0.94253	GGT	ACLY	-	superfamily_Citrate_synthase-like_core,pirsf_ATP-citrate_synthase	ENSG00000131473		0.567	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACLY	HGNC	protein_coding	OTTHUMT00000257465.1	21	0.00	0	C	NM_001096		40030212	40030212	-1	no_errors	ENST00000352035	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	1.000	G
ACSBG2	81616	genome.wustl.edu	37	19	6183146	6183146	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr19:6183146C>G	ENST00000586696.1	+	10	1461	c.1185C>G	c.(1183-1185)atC>atG	p.I395M	ACSBG2_ENST00000591403.1_Missense_Mutation_p.I395M|ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000252669.5_Missense_Mutation_p.I395M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.I208M|ACSBG2_ENST00000588304.1_Missense_Mutation_p.I345M			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	395					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ACTCTTTTATCAGTGGGACTG	0.502																																						dbGAP											0													107.0	100.0	102.0					19																	6183146		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1185C>G	19.37:g.6183146C>G	ENSP00000465589:p.Ile395Met		B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.I395M	ENST00000586696.1	37	c.1185	CCDS12159.1	19	.	.	.	.	.	.	.	.	.	.	C	13.11	2.139904	0.37728	.	.	ENSG00000130377	ENST00000252669	T	0.44482	0.92	5.16	-2.85	0.05734	AMP-dependent synthetase/ligase (1);	0.391711	0.18822	N	0.130219	T	0.33265	0.0857	L	0.53729	1.69	0.26768	N	0.96986	B;B	0.25667	0.068;0.131	B;B	0.32393	0.145;0.102	T	0.28681	-1.0036	10	0.33141	T	0.24	-9.9077	7.6082	0.28113	0.1148:0.377:0.4415:0.0668	.	395;395	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	395	ENSP00000252669:I395M	ENSP00000252669:I395M	I	+	3	3	ACSBG2	6134146	1.000000	0.71417	0.001000	0.08648	0.001000	0.01503	1.961000	0.40432	-0.673000	0.05259	-0.157000	0.13467	ATC	ACSBG2	-	pfam_AMP-dep_Synth/Lig	ENSG00000130377		0.502	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG2	HGNC	protein_coding	OTTHUMT00000452898.1	26	0.00	0	C	NM_030924		6183146	6183146	+1	no_errors	ENST00000252669	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	0.955	G
ADAMTSL4	54507	genome.wustl.edu	37	1	150525701	150525701	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:150525701G>A	ENST00000369038.2	+	3	607	c.406G>A	c.(406-408)Gag>Aag	p.E136K	MIR4257_ENST00000581735.1_RNA|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.E136K|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.E136K|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.E136K			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	136					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			AGGGAGAGAGGAGACCCAGGA	0.632																																						dbGAP											0													24.0	27.0	26.0					1																	150525701		2194	4287	6481	-	-	-	SO:0001583	missense	0			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.406G>A	1.37:g.150525701G>A	ENSP00000358034:p.Glu136Lys		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.E136K	ENST00000369038.2	37	c.406	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376988	0.61735	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.62105	0.15;0.05;0.34;0.05	4.46	4.46	0.54185	.	.	.	.	.	T	0.41743	0.1172	L	0.51422	1.61	0.22666	N	0.99888	B;B;B;B	0.19583	0.012;0.008;0.022;0.037	B;B;B;B	0.22386	0.006;0.009;0.018;0.039	T	0.45702	-0.9243	9	0.59425	D	0.04	.	12.603	0.56506	0.0:0.0:1.0:0.0	.	136;136;136;136	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	K	136	ENSP00000358037:E136K;ENSP00000271643:E136K;ENSP00000358035:E136K;ENSP00000358034:E136K	ENSP00000271643:E136K	E	+	1	0	ADAMTSL4	148792325	1.000000	0.71417	0.655000	0.29622	0.619000	0.37552	2.230000	0.42999	2.029000	0.59856	0.561000	0.74099	GAG	ADAMTSL4	-	pfscan_Thrombospondin_1_rpt	ENSG00000143382		0.632	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ADAMTSL4	HGNC	protein_coding	OTTHUMT00000084395.4	10	0.00	0	G	NM_019032		150525701	150525701	+1	no_errors	ENST00000369039	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.455	A
ADCY10	55811	genome.wustl.edu	37	1	167865858	167865858	+	Silent	SNP	A	A	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:167865858A>G	ENST00000367851.4	-	7	898	c.714T>C	c.(712-714)caT>caC	p.H238H	ADCY10_ENST00000367848.1_Silent_p.H146H|ADCY10_ENST00000545172.1_Silent_p.H85H	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	238					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AAGGATAATAATGCATGAAGG	0.378																																						dbGAP											0													196.0	211.0	206.0					1																	167865858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.714T>C	1.37:g.167865858A>G			B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.H238	ENST00000367851.4	37	c.714	CCDS1265.1	1																																																																																			ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.378	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	38	0.00	0	A	NM_018417		167865858	167865858	-1	no_errors	ENST00000367851	ensembl	human	known	69_37n	silent	62	11.43	8	SNP	0.720	G
ADORA2A	135	genome.wustl.edu	37	22	24837096	24837096	+	Missense_Mutation	SNP	G	G	C	rs201025926		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr22:24837096G>C	ENST00000337539.7	+	3	1337	c.878G>C	c.(877-879)cGc>cCc	p.R293P	ADORA2A_ENST00000496497.1_3'UTR|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|ADORA2A-AS1_ENST00000326341.4_RNA|ADORA2A-AS1_ENST00000427813.2_RNA|ADORA2A-AS1_ENST00000543438.1_RNA	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	293					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	TACCGTATCCGCGAGTTCCGC	0.602																																						dbGAP											0													76.0	69.0	71.0					22																	24837096		2203	4300	6503	-	-	-	SO:0001583	missense	0			X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.878G>C	22.37:g.24837096G>C	ENSP00000336630:p.Arg293Pro		B2R7E0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adeno_A2A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.R293P	ENST00000337539.7	37	c.878	CCDS13826.1	22	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415011	0.62511	.	.	ENSG00000128271	ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596	T;T	0.38077	1.16;1.16	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.57961	0.2089	M	0.66939	2.045	0.58432	D	0.999998	D	0.76494	0.999	D	0.69307	0.963	T	0.54649	-0.8262	10	0.35671	T	0.21	-27.3898	17.8809	0.88840	0.0:0.0:1.0:0.0	.	293	P29274	AA2AR_HUMAN	P	293	ENSP00000414802:R293P;ENSP00000336630:R293P	ENSP00000336630:R293P	R	+	2	0	ADORA2A	23167096	1.000000	0.71417	0.963000	0.40424	0.971000	0.66376	7.777000	0.85628	2.473000	0.83533	0.462000	0.41574	CGC	ADORA2A	-	pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn	ENSG00000128271		0.602	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A	HGNC	protein_coding	OTTHUMT00000319971.2	14	0.00	0	G	NM_000675		24837096	24837096	+1	no_errors	ENST00000337539	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.999	C
AGAP5	729092	genome.wustl.edu	37	10	75435124	75435124	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr10:75435124C>G	ENST00000374094.4	-	8	1334	c.1294G>C	c.(1294-1296)Gat>Cat	p.D432H	RP11-464F9.21_ENST00000607450.1_RNA|AGAP5_ENST00000443782.2_Missense_Mutation_p.D409H|RP11-464F9.1_ENST00000399449.3_RNA	NM_001144000.1	NP_001137472.1	A6NIR3	AGAP5_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 5	432	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(5)|skin(1)	12						ACCCAGGCATCCCGCTCCTCA	0.522																																						dbGAP											0													3.0	3.0	3.0					10																	75435124		652	1505	2157	-	-	-	SO:0001583	missense	0				CCDS44439.1	10q22.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000172650	ENSG00000172650		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23467	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 2"""	CTGLF2			Standard	NM_001144000		Approved	Em:AC073389.1	uc009xri.3	A6NIR3	OTTHUMG00000018473	ENST00000374094.4:c.1294G>C	10.37:g.75435124C>G	ENSP00000363207:p.Asp432His		A8MSN5	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.D432H	ENST00000374094.4	37	c.1294	CCDS44439.1	10	.	.	.	.	.	.	.	.	.	.	c	12.65	2.000766	0.35320	.	.	ENSG00000172650	ENST00000374094;ENST00000443782	T;T	0.75589	-0.95;-0.95	.	.	.	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.107759	0.64402	D	0.000011	T	0.78710	0.4326	L	0.55990	1.75	0.54753	D	0.999987	D	0.89917	1.0	D	0.87578	0.998	T	0.75246	-0.3385	9	0.87932	D	0	.	5.89	0.18904	0.0:0.9992:0.0:8.0E-4	.	432	A6NIR3	AGAP5_HUMAN	H	432;409	ENSP00000363207:D432H;ENSP00000402792:D409H	ENSP00000363207:D432H	D	-	1	0	AGAP5	75105130	0.990000	0.36364	0.077000	0.20336	0.077000	0.17291	3.622000	0.54217	0.107000	0.17824	0.109000	0.15622	GAT	AGAP5	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000172650		0.522	AGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGAP5	HGNC	protein_coding		20	0.00	0	C	XM_001132585		75435124	75435124	-1	no_errors	ENST00000374094	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	1.000	G
ALAS2	212	genome.wustl.edu	37	X	55046843	55046843	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chrX:55046843C>T	ENST00000330807.5	-	6	870	c.733G>A	c.(733-735)Gag>Aag	p.E245K	ALAS2_ENST00000396198.3_Missense_Mutation_p.E232K|ALAS2_ENST00000335854.4_Missense_Mutation_p.E208K|ALAS2_ENST00000498636.1_5'UTR	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	245					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	TGGTGCAGCTCAGCCAGCTCC	0.577																																						dbGAP											0													65.0	46.0	53.0					X																	55046843		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.733G>A	X.37:g.55046843C>T	ENSP00000332369:p.Glu245Lys		A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,pfam_5aminolev_synth_preseq,pfam_Aminotrans_V/Cys_dSase,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4pyrrol_synth_NH2levulA_synth	p.E245K	ENST00000330807.5	37	c.733	CCDS14366.1	X	.	.	.	.	.	.	.	.	.	.	c	14.02	2.409850	0.42715	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.89681	-2.55;-2.55;-2.55	5.01	5.01	0.66863	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.277711	0.40144	N	0.001169	T	0.79470	0.4451	N	0.16903	0.455	0.36892	D	0.88995	B;B;B	0.13594	0.003;0.008;0.001	B;B;B	0.16722	0.016;0.016;0.016	T	0.76547	-0.2919	10	0.28530	T	0.3	-9.2654	10.8313	0.46663	0.0:0.9049:0.0:0.0951	.	208;232;245	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	K	245;232;208	ENSP00000332369:E245K;ENSP00000379501:E232K;ENSP00000337131:E208K	ENSP00000332369:E245K	E	-	1	0	ALAS2	55063568	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.696000	0.37773	2.245000	0.73994	0.519000	0.50382	GAG	ALAS2	-	pfam_Aminotransferase_I/II,pfam_Aminotrans_V/Cys_dSase,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_4pyrrol_synth_NH2levulA_synth	ENSG00000158578		0.577	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAS2	HGNC	protein_coding	OTTHUMT00000056843.3	23	0.00	0	C	NM_000032		55046843	55046843	-1	no_errors	ENST00000330807	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	0.999	T
ANKRD29	147463	genome.wustl.edu	37	18	21197771	21197771	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr18:21197771C>G	ENST00000592179.1	-	8	802	c.648G>C	c.(646-648)ttG>ttC	p.L216F	ANKRD29_ENST00000284207.7_Missense_Mutation_p.L216F|ANKRD29_ENST00000322980.9_Missense_Mutation_p.L216F|ANKRD29_ENST00000586511.1_5'Flank	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	216										breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TGGCTGCTTTCAATAATGCTG	0.338																																						dbGAP											0													125.0	113.0	117.0					18																	21197771		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.648G>C	18.37:g.21197771C>G	ENSP00000468354:p.Leu216Phe		B2R972|Q6ZWE8|Q96LU9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L216F	ENST00000592179.1	37	c.648	CCDS11879.1	18	.	.	.	.	.	.	.	.	.	.	C	6.850	0.526123	0.13066	.	.	ENSG00000154065	ENST00000322980;ENST00000284207	T;T	0.64803	-0.12;-0.12	5.49	0.0547	0.14311	Ankyrin repeat-containing domain (4);	0.065145	0.64402	D	0.000006	T	0.32376	0.0827	N	0.17379	0.485	0.39689	D	0.971018	B;B	0.16396	0.001;0.017	B;B	0.20955	0.004;0.032	T	0.05818	-1.0862	10	0.10111	T	0.7	.	0.4422	0.00488	0.2203:0.2956:0.2375:0.2465	.	216;216	Q8N6D5-3;Q8N6D5	.;ANR29_HUMAN	F	216	ENSP00000323387:L216F;ENSP00000284207:L216F	ENSP00000284207:L216F	L	-	3	2	ANKRD29	19451769	1.000000	0.71417	0.963000	0.40424	0.939000	0.58152	0.834000	0.27518	0.061000	0.16311	0.462000	0.41574	TTG	ANKRD29	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000154065		0.338	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD29	HGNC	protein_coding	OTTHUMT00000254825.1	62	0.00	0	C	NM_173505		21197771	21197771	-1	no_errors	ENST00000592179	ensembl	human	known	69_37n	missense	86	19.63	21	SNP	0.993	G
ANKRD30BL	554226	genome.wustl.edu	37	2	133015252	133015252	+	5'UTR	SNP	G	G	A	rs112577594		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr2:133015252G>A	ENST00000470729.1	-	0	290				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						ACCGAGGGTGGGTCACACTCC	0.657																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1135C>T	2.37:g.133015252G>A			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.657	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	23	0.00	0	G	NR_027019		133015252	133015252	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	0.383	A
ANKS1A	23294	genome.wustl.edu	37	6	35051198	35051198	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr6:35051198C>G	ENST00000360359.3	+	20	3050	c.2912C>G	c.(2911-2913)tCt>tGt	p.S971C	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	971	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CTGTAGAAATCTACGGAGCAC	0.527																																						dbGAP											0													179.0	150.0	160.0					6																	35051198		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2912C>G	6.37:g.35051198C>G	ENSP00000353518:p.Ser971Cys		A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTyr_interaction_dom,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTyr_interaction_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTyr_interaction_dom,pfscan_SAM,prints_Ankyrin_rpt	p.S971C	ENST00000360359.3	37	c.2912	CCDS4798.1	6	.	.	.	.	.	.	.	.	.	.	C	21.9	4.209544	0.79240	.	.	ENSG00000064999	ENST00000360359;ENST00000373990	T	0.20738	2.05	4.86	4.86	0.63082	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.43416	D	0.000564	T	0.43433	0.1247	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.99;0.999	T	0.51466	-0.8702	10	0.87932	D	0	-11.9991	18.0077	0.89214	0.0:1.0:0.0:0.0	.	297;297;971	Q49AR9;E7EM84;Q92625	.;.;ANS1A_HUMAN	C	971;297	ENSP00000353518:S971C	ENSP00000353518:S971C	S	+	2	0	ANKS1A	35159176	1.000000	0.71417	0.949000	0.38748	0.670000	0.39368	7.797000	0.85911	2.252000	0.74401	0.655000	0.94253	TCT	ANKS1A	-	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	ENSG00000064999		0.527	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS1A	HGNC	protein_coding	OTTHUMT00000040262.1	30	0.00	0	C	XM_166478		35051198	35051198	+1	no_errors	ENST00000360359	ensembl	human	known	69_37n	missense	70	23.91	22	SNP	1.000	G
ANO1	55107	genome.wustl.edu	37	11	69950207	69950207	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:69950207C>G	ENST00000355303.5	+	4	948	c.643C>G	c.(643-645)Cag>Gag	p.Q215E	ANO1_ENST00000538023.1_Missense_Mutation_p.Q215E|ANO1_ENST00000530676.1_Missense_Mutation_p.Q99E|ANO1_ENST00000398543.2_Missense_Mutation_p.Q99E|ANO1_ENST00000316296.5_Missense_Mutation_p.Q187E	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	215					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	GCACAGGCCCCAGACCATGAA	0.547																																						dbGAP											0													47.0	49.0	48.0					11																	69950207		1891	4101	5992	-	-	-	SO:0001583	missense	0			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.643C>G	11.37:g.69950207C>G	ENSP00000347454:p.Gln215Glu		A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	pfam_Anoctamin	p.Q215E	ENST00000355303.5	37	c.643	CCDS44663.1	11	.	.	.	.	.	.	.	.	.	.	C	0.518	-0.863623	0.02590	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000531604;ENST00000316296;ENST00000530676	T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;2.17;-0.32;-0.32	5.25	5.25	0.73442	.	0.218384	0.39544	N	0.001324	T	0.42471	0.1204	N	0.02357	-0.585	0.39944	D	0.974441	B;B	0.22800	0.075;0.021	B;B	0.22386	0.039;0.007	T	0.42378	-0.9455	9	.	.	.	.	17.8596	0.88777	0.0:1.0:0.0:0.0	.	187;215	Q5XXA6-3;Q5XXA6	.;ANO1_HUMAN	E	215;215;99;182;187;99	ENSP00000347454:Q215E;ENSP00000444689:Q215E;ENSP00000381551:Q99E;ENSP00000436392:Q182E;ENSP00000319477:Q187E;ENSP00000435797:Q99E	.	Q	+	1	0	ANO1	69627855	0.007000	0.16637	1.000000	0.80357	0.491000	0.33493	1.331000	0.33793	2.460000	0.83146	0.650000	0.86243	CAG	ANO1	-	NULL	ENSG00000131620		0.547	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO1	HGNC	protein_coding	OTTHUMT00000393685.1	34	0.00	0	C	NM_018043		69950207	69950207	+1	no_errors	ENST00000355303	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	1.000	G
ASH1L	55870	genome.wustl.edu	37	1	155450828	155450828	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:155450828C>G	ENST00000368346.3	-	3	2472	c.1833G>C	c.(1831-1833)ttG>ttC	p.L611F	ASH1L_ENST00000392403.3_Missense_Mutation_p.L611F			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	611					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GACCAACGTTCAAGTGGGTAC	0.338																																						dbGAP											0													77.0	81.0	80.0					1																	155450828		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.1833G>C	1.37:g.155450828C>G	ENSP00000357330:p.Leu611Phe		Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.L611F	ENST00000368346.3	37	c.1833		1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816899	0.32145	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89875	-2.58;-2.58	5.23	5.23	0.72850	.	0.135440	0.33732	N	0.004607	T	0.65281	0.2676	N	0.08118	0	0.80722	D	1	B;B	0.31859	0.232;0.343	B;B	0.30646	0.055;0.118	T	0.69472	-0.5136	10	0.52906	T	0.07	.	6.2436	0.20805	0.0:0.6989:0.1829:0.1182	.	611;611	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	F	611	ENSP00000357330:L611F;ENSP00000376204:L611F	ENSP00000357330:L611F	L	-	3	2	ASH1L	153717452	0.993000	0.37304	1.000000	0.80357	0.928000	0.56348	0.529000	0.23019	2.882000	0.98803	0.655000	0.94253	TTG	ASH1L	-	NULL	ENSG00000116539		0.338	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	51	0.00	0	C	NM_018489		155450828	155450828	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	1.000	G
ATP6V1A	523	genome.wustl.edu	37	3	113517105	113517105	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:113517105G>C	ENST00000273398.3	+	12	1414	c.1306G>C	c.(1306-1308)Gat>Cat	p.D436H	ATP6V1A_ENST00000538620.1_Missense_Mutation_p.D403H	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	436					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	CTGGGGCTTAGATAAGAAACT	0.368																																						dbGAP											0													153.0	144.0	147.0					3																	113517105		2203	4300	6503	-	-	-	SO:0001583	missense	0			L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1306G>C	3.37:g.113517105G>C	ENSP00000273398:p.Asp436His		B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1/A1-cplx_a/bsu_N,tigrfam_ATPase_V1-cplx_asu	p.D436H	ENST00000273398.3	37	c.1306	CCDS2976.1	3	.	.	.	.	.	.	.	.	.	.	G	25.9	4.684219	0.88639	.	.	ENSG00000114573	ENST00000545842;ENST00000273398;ENST00000538620	D;D	0.82984	-1.67;-1.67	5.32	5.32	0.75619	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.94558	0.8247	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96231	0.9168	10	0.87932	D	0	-17.0523	19.0065	0.92852	0.0:0.0:1.0:0.0	.	436	P38606	VATA_HUMAN	H	153;436;403	ENSP00000273398:D436H;ENSP00000439874:D403H	ENSP00000273398:D436H	D	+	1	0	ATP6V1A	114999795	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.450000	0.97607	2.503000	0.84419	0.555000	0.69702	GAT	ATP6V1A	-	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,tigrfam_ATPase_V1-cplx_asu	ENSG00000114573		0.368	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1A	HGNC	protein_coding	OTTHUMT00000354457.1	39	0.00	0	G	NM_001690		113517105	113517105	+1	no_errors	ENST00000273398	ensembl	human	known	69_37n	missense	78	12.36	11	SNP	1.000	C
BRD8	10902	genome.wustl.edu	37	5	137481544	137481544	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr5:137481544G>C	ENST00000254900.5	-	24	3673	c.3302C>G	c.(3301-3303)cCt>cGt	p.P1101R		NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	1101					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATCCTGAACAGGGTCATCCTG	0.418																																						dbGAP											0													75.0	74.0	74.0					5																	137481544		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3302C>G	5.37:g.137481544G>C	ENSP00000254900:p.Pro1101Arg		O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,superfamily_Peptidase_M20_dimer,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.P1101R	ENST00000254900.5	37	c.3302	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	G	10.20	1.284869	0.23392	.	.	ENSG00000112983	ENST00000254900;ENST00000427976	T;T	0.30981	1.85;1.51	5.12	4.25	0.50352	Bromodomain (2);	0.000000	0.42682	D	0.000663	T	0.21145	0.0509	L	0.29908	0.895	0.80722	D	1	B	0.22003	0.063	B	0.25614	0.062	T	0.04664	-1.0935	10	0.14656	T	0.56	.	10.6293	0.45527	0.0898:0.0:0.9102:0.0	.	1101	Q9H0E9	BRD8_HUMAN	R	1101;207	ENSP00000254900:P1101R;ENSP00000392646:P207R	ENSP00000254900:P1101R	P	-	2	0	BRD8	137509443	1.000000	0.71417	0.999000	0.59377	0.150000	0.21749	4.189000	0.58358	1.169000	0.42739	-0.136000	0.14681	CCT	BRD8	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000112983		0.418	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	HGNC	protein_coding	OTTHUMT00000251282.3	49	0.00	0	G	NM_006696		137481544	137481544	-1	no_errors	ENST00000254900	ensembl	human	known	69_37n	missense	12	63.64	21	SNP	1.000	C
CARD11	84433	genome.wustl.edu	37	7	2978400	2978400	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr7:2978400C>G	ENST00000396946.4	-	7	1333	c.930G>C	c.(928-930)aaG>aaC	p.K310N		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	310					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCAGGGCCTCCTTGCGGTCGT	0.642			Mis		DLBCL																																	dbGAP		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													83.0	66.0	72.0					7																	2978400		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.930G>C	7.37:g.2978400C>G	ENSP00000380150:p.Lys310Asn		A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.K310N	ENST00000396946.4	37	c.930	CCDS5336.2	7	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780427	0.49891	.	.	ENSG00000198286	ENST00000396946	T	0.35048	1.33	5.72	3.6	0.41247	.	0.051701	0.85682	D	0.000000	T	0.24431	0.0592	L	0.27053	0.805	0.40087	D	0.976206	B	0.29716	0.255	B	0.26969	0.075	T	0.14090	-1.0485	10	0.72032	D	0.01	-44.1357	10.0384	0.42142	0.0:0.7624:0.0:0.2376	.	310	Q9BXL7	CAR11_HUMAN	N	310	ENSP00000380150:K310N	ENSP00000380150:K310N	K	-	3	2	CARD11	2944926	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.874000	0.28065	1.419000	0.47118	0.591000	0.81541	AAG	CARD11	-	NULL	ENSG00000198286		0.642	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	23	0.00	0	C	NM_032415		2978400	2978400	-1	no_errors	ENST00000396946	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	G
CERS2	29956	genome.wustl.edu	37	1	150940918	150940918	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:150940918C>T	ENST00000271688.6	-	3	630	c.244G>A	c.(244-246)Gcc>Acc	p.A82T	CERS2_ENST00000368954.5_Missense_Mutation_p.A82T|CERS2_ENST00000561294.1_Missense_Mutation_p.A82T|RP11-316M1.12_ENST00000561111.1_RNA|CERS2_ENST00000345896.4_5'UTR|RP11-316M1.12_ENST00000560481.1_RNA	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	82					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TCCAAGGTGGCGTTGGGAGGT	0.557																																						dbGAP											0													83.0	77.0	79.0					1																	150940918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.244G>A	1.37:g.150940918C>T	ENSP00000271688:p.Ala82Thr		D3DV06|Q5SZE5|Q9HD96|Q9NW79	Missense_Mutation	SNP	pirsf_Longevity_assurance_LAG1_LAC1,pfam_TLC-dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_TLC-dom,pfscan_TLC-dom,pfscan_Homeodomain	p.A82T	ENST00000271688.6	37	c.244	CCDS973.1	1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745555	0.49151	.	.	ENSG00000143418	ENST00000368954;ENST00000271688;ENST00000368949;ENST00000361419;ENST00000421609;ENST00000457392	T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92	5.08	4.18	0.49190	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.053822	0.85682	D	0.000000	T	0.08626	0.0214	N	0.25890	0.77	0.43569	D	0.995897	B	0.13145	0.007	B	0.13407	0.009	T	0.07328	-1.0778	10	0.28530	T	0.3	-10.074	13.8461	0.63468	0.0:0.4626:0.5374:0.0	.	82	Q96G23	CERS2_HUMAN	T	82;82;102;82;82;82	ENSP00000357950:A82T;ENSP00000271688:A82T;ENSP00000357945:A102T;ENSP00000355020:A82T;ENSP00000393239:A82T;ENSP00000394012:A82T	ENSP00000271688:A82T	A	-	1	0	CERS2	149207542	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.063000	0.49978	1.385000	0.46445	0.655000	0.94253	GCC	CERS2	-	pirsf_Longevity_assurance_LAG1_LAC1,pfam_Homeodomain,superfamily_Homeodomain-like,pfscan_Homeodomain	ENSG00000143418		0.557	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS2	HGNC	protein_coding	OTTHUMT00000084897.2	34	0.00	0	C	NM_022075		150940918	150940918	-1	no_errors	ENST00000271688	ensembl	human	known	69_37n	missense	43	24.14	14	SNP	1.000	T
CHD4	1108	genome.wustl.edu	37	12	6710551	6710551	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr12:6710551C>G	ENST00000357008.2	-	6	866	c.703G>C	c.(703-705)Gct>Cct	p.A235P	CHD4_ENST00000544040.1_Missense_Mutation_p.A228P|CHD4_ENST00000544484.1_Missense_Mutation_p.A232P|CHD4_ENST00000309577.6_Missense_Mutation_p.A235P	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	235	Poly-Ala.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TCCACCACAGCTACCGCTGCT	0.582																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													83.0	90.0	88.0					12																	6710551		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.703G>C	12.37:g.6710551C>G	ENSP00000349508:p.Ala235Pro		Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A235P	ENST00000357008.2	37	c.703	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329363	0.60743	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	D;D;D;D;T	0.90732	-2.71;-2.71;-2.7;-2.72;0.72	5.87	5.87	0.94306	.	0.130569	0.50627	D	0.000106	D	0.84813	0.5555	N	0.12961	0.28	0.58432	D	0.999994	B;B;B	0.21225	0.011;0.053;0.004	B;B;B	0.18263	0.011;0.021;0.011	T	0.78886	-0.2027	10	0.48119	T	0.1	2.2156	20.2084	0.98285	0.0:1.0:0.0:0.0	.	235;235;228	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	P	232;228;235;235;209;235	ENSP00000440392:A232P;ENSP00000440542:A228P;ENSP00000312419:A235P;ENSP00000349508:A235P;ENSP00000437506:A235P	ENSP00000312419:A235P	A	-	1	0	CHD4	6580812	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	4.595000	0.61048	2.774000	0.95407	0.650000	0.86243	GCT	CHD4	-	NULL	ENSG00000111642		0.582	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		16	0.00	0	C	NM_001273		6710551	6710551	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	5	73.68	14	SNP	1.000	G
CHD4	1108	genome.wustl.edu	37	12	6711295	6711295	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr12:6711295G>T	ENST00000357008.2	-	4	432	c.269C>A	c.(268-270)cCa>cAa	p.P90Q	CHD4_ENST00000544040.1_Missense_Mutation_p.P83Q|CHD4_ENST00000544484.1_Missense_Mutation_p.P87Q|CHD4_ENST00000309577.6_Missense_Mutation_p.P90Q	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	90					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CACAAACTCTGGCCCCTCCCC	0.577																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													40.0	44.0	42.0					12																	6711295		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.269C>A	12.37:g.6711295G>T	ENSP00000349508:p.Pro90Gln		Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P90Q	ENST00000357008.2	37	c.269	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986421	0.35036	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942;ENST00000545584	D;D;D;D;T	0.89485	-2.52;-2.52;-2.52;-2.52;1.01	5.83	5.83	0.93111	.	0.521859	0.17796	N	0.161738	D	0.82499	0.5050	L	0.34521	1.04	0.31943	N	0.610699	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.76822	-0.2817	10	0.18276	T	0.48	-2.7184	12.8683	0.57951	0.0:0.0:0.7967:0.2033	.	90;90;83	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	Q	87;83;90;90;64;90;83	ENSP00000440392:P87Q;ENSP00000440542:P83Q;ENSP00000312419:P90Q;ENSP00000349508:P90Q;ENSP00000437506:P90Q	ENSP00000312419:P90Q	P	-	2	0	CHD4	6581556	0.991000	0.36638	0.990000	0.47175	0.997000	0.91878	1.865000	0.39479	2.759000	0.94783	0.650000	0.86243	CCA	CHD4	-	NULL	ENSG00000111642		0.577	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		25	0.00	0	G	NM_001273		6711295	6711295	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.891	T
CLDN22	53842	genome.wustl.edu	37	4	184240911	184240911	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr4:184240911G>T	ENST00000323319.5	-	1	1016	c.461C>A	c.(460-462)cCa>cAa	p.P154Q	WWC2_ENST00000403733.3_3'UTR	NM_001111319.1	NP_001104789.1	Q8N7P3	CLD22_HUMAN	claudin 22	154					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			cervix(1)|kidney(1)|lung(3)|prostate(1)|skin(1)	7		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.0172)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|Esophageal squamous(56;0.176)		all cancers(43;4.1e-26)|Epithelial(43;6.45e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|Colorectal(24;5.87e-06)|GBM - Glioblastoma multiforme(59;6.5e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		GACAAAGTCTGGGACGTTCTC	0.592																																						dbGAP											0													33.0	34.0	34.0					4																	184240911		1568	3577	5145	-	-	-	SO:0001583	missense	0			AK098064	CCDS43286.1	4q35.1	2010-08-05			ENSG00000177300	ENSG00000177300		"""Claudins"""	2044	protein-coding gene	gene with protein product							Standard	NM_001111319		Approved	CLDN21	uc010isa.1	Q8N7P3	OTTHUMG00000160627	ENST00000323319.5:c.461C>A	4.37:g.184240911G>T	ENSP00000318113:p.Pro154Gln			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	p.P154Q	ENST00000323319.5	37	c.461	CCDS43286.1	4	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875125	0.72180	.	.	ENSG00000177300	ENST00000323319	D	0.88975	-2.45	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.94951	0.8367	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.93472	0.6820	10	0.45353	T	0.12	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	154	Q8N7P3	CLD22_HUMAN	Q	154	ENSP00000318113:P154Q	ENSP00000318113:P154Q	P	-	2	0	CLDN22	184477905	1.000000	0.71417	0.251000	0.24312	0.333000	0.28666	5.261000	0.65496	2.941000	0.99782	0.655000	0.94253	CCA	CLDN22	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000177300		0.592	CLDN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN22	HGNC	protein_coding	OTTHUMT00000361493.1	24	0.00	0	G			184240911	184240911	-1	no_errors	ENST00000323319	ensembl	human	known	69_37n	missense	8	61.90	13	SNP	1.000	T
CLPX	10845	genome.wustl.edu	37	15	65471352	65471352	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:65471352G>C	ENST00000300107.3	-	3	466	c.278C>G	c.(277-279)tCt>tGt	p.S93C		NM_006660.3	NP_006651.2	O76031	CLPX_HUMAN	caseinolytic mitochondrial matrix peptidase chaperone subunit	93					ATP catabolic process (GO:0006200)|positive regulation of peptidase activity (GO:0010952)|protein folding (GO:0006457)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial endopeptidase Clp complex (GO:0009841)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|metal ion binding (GO:0046872)|peptidase activator activity (GO:0016504)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	16						AGAATTCCCAGAGCCTGATTT	0.408																																						dbGAP											0													126.0	115.0	119.0					15																	65471352		2202	4299	6501	-	-	-	SO:0001583	missense	0			AJ006267	CCDS10202.1	15q22.31	2013-09-12	2013-09-12		ENSG00000166855	ENSG00000166855		"""ATPases / AAA-type"""	2088	protein-coding gene	gene with protein product		615611	"""ClpX (caseinolytic protease X, E. coli) homolog"", ""ClpX caseinolytic protease X homolog (E. coli)"", ""ClpX caseinolytic peptidase X homolog (E. coli)"""			22841477	Standard	NM_006660		Approved		uc002aom.3	O76031	OTTHUMG00000133139	ENST00000300107.3:c.278C>G	15.37:g.65471352G>C	ENSP00000300107:p.Ser93Cys		A1L428|A8K8F1|B9EGI8|Q9H4D9	Missense_Mutation	SNP	pfam_ATPase_AAA-2,pfam_Clp_ATPase_C,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_Sigma_54_int,smart_AAA+_ATPase,tigrfam_Clp_protease_ATP-bd_su_ClpX	p.S93C	ENST00000300107.3	37	c.278	CCDS10202.1	15	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845890	0.91277	.	.	ENSG00000166855	ENST00000300107;ENST00000546194	T	0.19250	2.16	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.28333	0.0700	L	0.43923	1.385	0.80722	D	1	D;D	0.56746	0.977;0.957	P;P	0.48368	0.575;0.478	T	0.02698	-1.1122	10	0.66056	D	0.02	.	18.4277	0.90614	0.0:0.0:1.0:0.0	.	93;93	Q9H072;O76031	.;CLPX_HUMAN	C	93	ENSP00000300107:S93C	ENSP00000300107:S93C	S	-	2	0	CLPX	63258405	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.996000	0.93539	2.583000	0.87209	0.655000	0.94253	TCT	CLPX	-	NULL	ENSG00000166855		0.408	CLPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPX	HGNC	protein_coding	OTTHUMT00000256828.2	50	0.00	0	G	NM_006660		65471352	65471352	-1	no_errors	ENST00000300107	ensembl	human	known	69_37n	missense	66	19.51	16	SNP	1.000	C
CNGA2	1260	genome.wustl.edu	37	X	150911600	150911600	+	Nonsense_Mutation	SNP	A	A	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chrX:150911600A>T	ENST00000329903.4	+	6	658	c.625A>T	c.(625-627)Aag>Tag	p.K209*		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	209					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.K209*(1)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CAAAGATACCAAGAAACTGCG	0.478																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											114.0	87.0	96.0					X																	150911600		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.625A>T	X.37:g.150911600A>T	ENSP00000328478:p.Lys209*		A0AVD0	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.K209*	ENST00000329903.4	37	c.625	CCDS14701.1	X	.	.	.	.	.	.	.	.	.	.	A	25.5	4.644423	0.87859	.	.	ENSG00000183862	ENST00000329903	.	.	.	5.36	5.36	0.76844	.	0.243735	0.42294	D	0.000723	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1986	0.54311	1.0:0.0:0.0:0.0	.	.	.	.	X	209	.	ENSP00000328478:K209X	K	+	1	0	CNGA2	150662256	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	4.623000	0.61247	1.785000	0.52413	0.417000	0.27973	AAG	CNGA2	-	pfam_Ion_trans_dom	ENSG00000183862		0.478	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA2	HGNC	protein_coding	OTTHUMT00000060888.1	21	0.00	0	A	NM_005140		150911600	150911600	+1	no_errors	ENST00000329903	ensembl	human	known	69_37n	nonsense	30	18.92	7	SNP	1.000	T
COL5A1	1289	genome.wustl.edu	37	9	137687118	137687118	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr9:137687118G>C	ENST00000371817.3	+	34	3170	c.2756G>C	c.(2755-2757)gGt>gCt	p.G919A		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	919	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGTCCGAGGGGTGAAAGAGGC	0.627																																						dbGAP											0													80.0	86.0	84.0					9																	137687118		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2756G>C	9.37:g.137687118G>C	ENSP00000360882:p.Gly919Ala		Q15094|Q5SUX4	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.G919A	ENST00000371817.3	37	c.2756	CCDS6982.1	9	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270615	0.80469	.	.	ENSG00000130635	ENST00000371817	D	0.97066	-4.23	4.22	4.22	0.49857	.	0.000000	0.64402	U	0.000001	D	0.98807	0.9598	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99824	1.1049	10	0.87932	D	0	.	16.5867	0.84729	0.0:0.0:1.0:0.0	.	919	P20908	CO5A1_HUMAN	A	919	ENSP00000360882:G919A	ENSP00000360882:G919A	G	+	2	0	COL5A1	136826939	1.000000	0.71417	0.998000	0.56505	0.785000	0.44390	9.169000	0.94788	1.904000	0.55121	0.297000	0.19635	GGT	COL5A1	-	NULL	ENSG00000130635		0.627	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	35	0.00	0	G	NM_000093		137687118	137687118	+1	no_errors	ENST00000371817	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	C
COPG1	22820	genome.wustl.edu	37	3	128973842	128973842	+	Silent	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:128973842G>A	ENST00000314797.6	+	7	518	c.414G>A	c.(412-414)caG>caA	p.Q138Q		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	138					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										CCATGCTGCAGGCTATTGAGC	0.562																																						dbGAP											0													118.0	93.0	101.0					3																	128973842		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.414G>A	3.37:g.128973842G>A			A8K6M8|B3KMF6|Q54AC4	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_gsu_app,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_Coatomer/calthrin_app_sub_C,pirsf_Coatomer_gsu	p.Q138	ENST00000314797.6	37	c.414	CCDS33851.1	3																																																																																			COPG1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Coatomer_gsu	ENSG00000181789		0.562	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPG1	HGNC	protein_coding	OTTHUMT00000355456.1	26	0.00	0	G	NM_016128		128973842	128973842	+1	no_errors	ENST00000314797	ensembl	human	known	69_37n	silent	50	41.18	35	SNP	1.000	A
CPED1	79974	genome.wustl.edu	37	7	120655806	120655806	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr7:120655806C>G	ENST00000310396.5	+	3	804	c.337C>G	c.(337-339)Cag>Gag	p.Q113E	CPED1_ENST00000495036.1_3'UTR|CPED1_ENST00000450913.2_Missense_Mutation_p.Q113E|CPED1_ENST00000340646.5_Missense_Mutation_p.Q113E	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	113						endoplasmic reticulum (GO:0005783)		p.Q113*(1)									AACAGAGCTTCAGCTACACCA	0.498																																						dbGAP											1	Substitution - Nonsense(1)	endometrium(1)											85.0	70.0	76.0					7																	120655806		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.337C>G	7.37:g.120655806C>G	ENSP00000309772:p.Gln113Glu		A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.Q113E	ENST00000310396.5	37	c.337	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	C	2.456	-0.325327	0.05350	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000340646	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.84	1.51	0.23008	.	1.356310	0.04593	N	0.397150	T	0.36580	0.0972	L	0.37630	1.12	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.06405	0.001;0.002	T	0.36187	-0.9758	10	0.59425	D	0.04	.	9.487	0.38935	0.1642:0.4205:0.4153:0.0	.	113;113	A4D0V7-2;A4D0V7	.;CG058_HUMAN	E	113	ENSP00000309772:Q113E;ENSP00000398082:Q113E;ENSP00000406122:Q113E;ENSP00000345235:Q113E	ENSP00000309772:Q113E	Q	+	1	0	C7orf58	120443042	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.408000	0.21065	0.282000	0.22254	0.591000	0.81541	CAG	CPED1	-	NULL	ENSG00000106034		0.498	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	33	0.00	0	C	NM_024913		120655806	120655806	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.000	G
CPED1	79974	genome.wustl.edu	37	7	120767288	120767288	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr7:120767288C>A	ENST00000310396.5	+	10	1746	c.1279C>A	c.(1279-1281)Ctt>Att	p.L427I	CPED1_ENST00000450913.2_Missense_Mutation_p.L427I|CPED1_ENST00000423795.1_Missense_Mutation_p.L207I	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	427						endoplasmic reticulum (GO:0005783)											ATTTCAGAGACTTTATAGATC	0.308																																						dbGAP											0													86.0	91.0	89.0					7																	120767288		2201	4292	6493	-	-	-	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1279C>A	7.37:g.120767288C>A	ENSP00000309772:p.Leu427Ile		A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.L427I	ENST00000310396.5	37	c.1279	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	C	4.707	0.131500	0.08981	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000423795;ENST00000443817	T;T;T;T;T	0.45276	2.23;0.9;1.91;1.91;1.47	4.48	2.28	0.28536	.	0.499227	0.18545	N	0.138096	T	0.31071	0.0785	L	0.45137	1.4	0.31599	N	0.652986	P;B;B	0.50272	0.933;0.009;0.013	P;B;B	0.47251	0.542;0.005;0.006	T	0.26608	-1.0098	10	0.13108	T	0.6	-11.1989	2.2023	0.03927	0.2938:0.4525:0.1464:0.1073	.	207;427;427	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	I	427;427;427;207;207	ENSP00000309772:L427I;ENSP00000398082:L427I;ENSP00000406122:L427I;ENSP00000415573:L207I;ENSP00000391952:L207I	ENSP00000309772:L427I	L	+	1	0	C7orf58	120554524	0.765000	0.28485	0.913000	0.36048	0.704000	0.40688	0.595000	0.24029	1.004000	0.39156	0.467000	0.42956	CTT	CPED1	-	NULL	ENSG00000106034		0.308	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	60	0.00	0	C	NM_024913		120767288	120767288	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	missense	75	23.47	23	SNP	0.602	A
CRY2	1408	genome.wustl.edu	37	11	45891248	45891248	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:45891248G>C	ENST00000443527.2	+	7	1159	c.1137G>C	c.(1135-1137)tgG>tgC	p.W379C	CRY2_ENST00000417225.2_Missense_Mutation_p.W297C	NM_021117.3	NP_066940.2	Q49AN0	CRY2_HUMAN	cryptochrome circadian clock 2	358					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|glucose homeostasis (GO:0042593)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of sodium-dependent phosphate transport (GO:2000118)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|FAD binding (GO:0071949)|phosphatase binding (GO:0019902)|single-stranded DNA binding (GO:0003697)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(2)	15						GCTTCCCTTGGATTGATGCCA	0.642																																					Esophageal Squamous(106;91 1499 8126 12599 39610)	dbGAP											0													83.0	82.0	82.0					11																	45891248		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB014558	CCDS7915.2, CCDS44576.1	11p11.2	2014-01-17	2014-01-17		ENSG00000121671	ENSG00000121671			2385	protein-coding gene	gene with protein product		603732	"""cryptochrome 2 (photolyase-like)"""			8909283	Standard	NM_021117		Approved		uc010rgn.2	Q49AN0	OTTHUMG00000153225	ENST00000443527.2:c.1137G>C	11.37:g.45891248G>C	ENSP00000406751:p.Trp379Cys		B4DH32|B4DZD6|O75148|Q8IV71	Missense_Mutation	SNP	pfam_Photolyase_FAD-bd/Cryptochr_C,pfam_DNA_photolyase_N,superfamily_Photolyase_FAD-bd/Cryptochr_C,superfamily_DNA_photolyase_N	p.W379C	ENST00000443527.2	37	c.1137	CCDS7915.2	11	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412335	0.83340	.	.	ENSG00000121671	ENST00000417225;ENST00000443527	.	.	.	5.99	5.99	0.97316	DNA photolyase, FAD-binding/Cryptochrome, C-terminal (2);	0.060714	0.64402	D	0.000001	T	0.79149	0.4397	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.79022	-0.1973	9	0.87932	D	0	-14.5945	20.4777	0.99188	0.0:0.0:1.0:0.0	.	358;379;297	Q49AN0;B4DZD6;Q49AN0-2	CRY2_HUMAN;.;.	C	297;379	.	ENSP00000397419:W297C	W	+	3	0	CRY2	45847824	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.840000	0.97914	0.655000	0.94253	TGG	CRY2	-	pfam_Photolyase_FAD-bd/Cryptochr_C,superfamily_Photolyase_FAD-bd/Cryptochr_C	ENSG00000121671		0.642	CRY2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CRY2	HGNC	protein_coding	OTTHUMT00000330235.2	23	0.00	0	G	NM_021117		45891248	45891248	+1	no_errors	ENST00000443527	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	C
CTPS2	56474	genome.wustl.edu	37	X	16720990	16720990	+	Silent	SNP	T	T	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chrX:16720990T>G	ENST00000443824.1	-	2	779	c.36A>C	c.(34-36)tcA>tcC	p.S12S	CTPS2_ENST00000380241.3_Silent_p.S12S|CTPS2_ENST00000359276.4_Silent_p.S12S	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	12					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					TACCAATGCCTGAGATGACCC	0.438																																						dbGAP											0													149.0	125.0	133.0					X																	16720990		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.36A>C	X.37:g.16720990T>G			B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Silent	SNP	pfam_CTP_synthase_N,pfam_GATASE_1,pfam_Peptidase_C26,tigrfam_CTP_synthase	p.S12	ENST00000443824.1	37	c.36	CCDS14175.1	X																																																																																			CTPS2	-	pfam_CTP_synthase_N,tigrfam_CTP_synthase	ENSG00000047230		0.438	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	HGNC	protein_coding	OTTHUMT00000055906.1	57	0.00	0	T	NM_019857		16720990	16720990	-1	no_errors	ENST00000359276	ensembl	human	known	69_37n	silent	40	28.57	16	SNP	0.075	G
DENND4C	55667	genome.wustl.edu	37	9	19346465	19346465	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr9:19346465G>C	ENST00000380432.2	+	18	2876	c.2843G>C	c.(2842-2844)aGt>aCt	p.S948T	DENND4C_ENST00000434457.2_Missense_Mutation_p.S1233T|DENND4C_ENST00000602925.1_Missense_Mutation_p.S1184T			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	948					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						AAGAGAAGTAGTTTATATGGT	0.383																																						dbGAP											0													78.0	79.0	78.0					9																	19346465		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.2843G>C	9.37:g.19346465G>C	ENSP00000369797:p.Ser948Thr		A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.S948T	ENST00000380432.2	37	c.2843		9	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127611	0.77549	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000453857;ENST00000540671;ENST00000380432;ENST00000380427	T;T	0.35236	1.35;1.32	5.81	5.81	0.92471	.	0.000000	0.56097	D	0.000028	T	0.60728	0.2291	M	0.62723	1.935	0.48341	D	0.999638	P;D;D;D	0.71674	0.754;0.993;0.998;0.996	P;P;D;D	0.80764	0.61;0.879;0.994;0.968	T	0.60475	-0.7256	10	0.72032	D	0.01	-18.7838	20.0896	0.97814	0.0:0.0:1.0:0.0	.	278;948;130;948	B7Z660;Q5VZ89-5;Q5VZ89-3;Q5VZ89	.;.;.;DEN4C_HUMAN	T	948;421;130;278;421;130	ENSP00000305795:S421T;ENSP00000443804:S278T	ENSP00000305795:S421T	S	+	2	0	DENND4C	19336465	1.000000	0.71417	0.488000	0.27440	0.861000	0.49209	4.496000	0.60360	2.741000	0.93983	0.650000	0.86243	AGT	DENND4C	-	NULL	ENSG00000137145		0.383	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	HGNC	protein_coding		32	0.00	0	G	NM_017925		19346465	19346465	+1	no_errors	ENST00000380437	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.976	C
DGKD	8527	genome.wustl.edu	37	2	234357967	234357967	+	Silent	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr2:234357967G>A	ENST00000264057.2	+	15	1845	c.1833G>A	c.(1831-1833)ctG>ctA	p.L611L	DGKD_ENST00000409813.3_Silent_p.L567L	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	611					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	AGCTCATGCTGAGAGCCAACA	0.572											OREG0015296	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													50.0	48.0	49.0					2																	234357967		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.1833G>A	2.37:g.234357967G>A		2373	Q14158|Q6PK55|Q8NG53	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,pfam_Pleckstrin_homology,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.L611	ENST00000264057.2	37	c.1833	CCDS2504.1	2																																																																																			DGKD	-	NULL	ENSG00000077044		0.572	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	HGNC	protein_coding	OTTHUMT00000257072.2	22	0.00	0	G	NM_003648		234357967	234357967	+1	no_errors	ENST00000264057	ensembl	human	known	69_37n	silent	24	22.58	7	SNP	0.998	A
DMBT1	1755	genome.wustl.edu	37	10	124389917	124389917	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr10:124389917C>G	ENST00000338354.3	+	45	5655	c.5549C>G	c.(5548-5550)tCt>tGt	p.S1850C	DMBT1_ENST00000368909.3_Missense_Mutation_p.S1850C|DMBT1_ENST00000368955.3_Missense_Mutation_p.S1840C|DMBT1_ENST00000359586.6_Missense_Mutation_p.S570C|DMBT1_ENST00000344338.3_Missense_Mutation_p.S1840C|DMBT1_ENST00000368956.2_Missense_Mutation_p.S1222C|DMBT1_ENST00000330163.4_Missense_Mutation_p.S1222C			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1850	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATATTTACATCTTCTTACAAC	0.393																																					Ovarian(182;93 2026 18125 22222 38972)	dbGAP											0													127.0	118.0	121.0					10																	124389917		1870	4108	5978	-	-	-	SO:0001583	missense	0				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.5549C>G	10.37:g.124389917C>G	ENSP00000342210:p.Ser1850Cys		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_Srcr_rcpt,pfam_CUB,pfam_Zona_pellucida_Endoglin/CD105,superfamily_Srcr_rcpt-rel,superfamily_CUB,smart_Srcr_rcpt-rel,smart_CUB,smart_Zona_pellucida_Endoglin/CD105,pfscan_CUB,pfscan_Srcr_rcpt,pfscan_Zona_pellucida_Endoglin/CD105,prints_Srcr_rcpt	p.S1979C	ENST00000338354.3	37	c.5936		10	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820870	0.71028	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99	4.45	4.45	0.53987	CUB (5);	.	.	.	.	T	0.79452	0.4448	H	0.99249	4.485	0.31793	N	0.629392	D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;0.999;1.0;0.995	D;D;D;D;D;D;D	0.85130	0.958;0.992;0.958;0.987;0.943;0.997;0.993	D	0.87155	0.2211	9	0.51188	T	0.08	.	16.2171	0.82237	0.0:1.0:0.0:0.0	.	570;1830;1099;1979;1222;1840;1850	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	C	1850;1979;1850;1850;1850;1850;1222;1840;1222;1222;1850;1840;1222;570	ENSP00000342210:S1850C;ENSP00000343175:S1840C;ENSP00000327747:S1222C;ENSP00000357905:S1850C;ENSP00000357951:S1840C;ENSP00000357952:S1222C;ENSP00000352593:S570C	ENSP00000331522:S1222C	S	+	2	0	DMBT1	124379907	0.957000	0.32711	0.024000	0.17045	0.416000	0.31233	4.727000	0.61993	2.150000	0.67090	0.655000	0.94253	TCT	DMBT1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000187908		0.393	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	56	0.00	0	C	NM_004406		124389917	124389917	+1	no_errors	ENST00000368915	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	0.704	G
DNMT3B	1789	genome.wustl.edu	37	20	31374344	31374344	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr20:31374344G>A	ENST00000328111.2	+	5	664	c.343G>A	c.(343-345)Gag>Aag	p.E115K	DNMT3B_ENST00000353855.2_Missense_Mutation_p.E115K|DNMT3B_ENST00000375623.4_Intron|DNMT3B_ENST00000344505.4_Missense_Mutation_p.E115K|DNMT3B_ENST00000443239.3_Intron|DNMT3B_ENST00000456297.2_Intron|DNMT3B_ENST00000348286.2_Missense_Mutation_p.E115K|DNMT3B_ENST00000201963.3_Missense_Mutation_p.E127K	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	115	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTCCAGCCGGGAGAGGCACAG	0.647																																						dbGAP											0													67.0	65.0	66.0					20																	31374344		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.343G>A	20.37:g.31374344G>A	ENSP00000328547:p.Glu115Lys		A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	pfam_PWWP,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP,pfscan_PWWP	p.E115K	ENST00000328111.2	37	c.343	CCDS13205.1	20	.	.	.	.	.	.	.	.	.	.	G	16.91	3.253052	0.59212	.	.	ENSG00000088305	ENST00000328111;ENST00000537219;ENST00000353855;ENST00000348286;ENST00000344505;ENST00000201963	D;D;D;D;D	0.97430	-4.32;-4.37;-4.32;-4.2;-4.38	4.56	4.56	0.56223	.	0.626359	0.16775	N	0.200042	D	0.92420	0.7594	N	0.24115	0.695	0.80722	D	1	B;P;P;P	0.45827	0.4;0.708;0.867;0.828	B;B;B;B	0.41510	0.121;0.251;0.359;0.254	D	0.90547	0.4506	10	0.08837	T	0.75	-34.3952	12.7139	0.57103	0.0:0.0:1.0:0.0	.	127;115;115;115	Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;DNM3B_HUMAN	K	115;201;115;115;115;127	ENSP00000328547:E115K;ENSP00000313397:E115K;ENSP00000337764:E115K;ENSP00000345105:E115K;ENSP00000201963:E127K	ENSP00000201963:E127K	E	+	1	0	DNMT3B	30838005	1.000000	0.71417	0.991000	0.47740	0.713000	0.41058	4.034000	0.57289	2.382000	0.81193	0.462000	0.41574	GAG	DNMT3B	-	NULL	ENSG00000088305		0.647	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMT3B	HGNC	protein_coding	OTTHUMT00000078643.2	17	0.00	0	G	NM_006892		31374344	31374344	+1	no_errors	ENST00000328111	ensembl	human	known	69_37n	missense	6	70.00	14	SNP	0.995	A
DNTTIP2	30836	genome.wustl.edu	37	1	94343060	94343060	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:94343060T>A	ENST00000436063.2	-	2	488	c.431A>T	c.(430-432)gAa>gTa	p.E144V	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		AACATGAGATTCTGCTTCAGA	0.408																																						dbGAP											0													109.0	97.0	100.0					1																	94343060		1855	4093	5948	-	-	-	SO:0001583	missense	0			AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.431A>T	1.37:g.94343060T>A	ENSP00000411010:p.Glu144Val		Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	pfam_Fcf2	p.E144V	ENST00000436063.2	37	c.431	CCDS44174.1	1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.954016	0.73902	.	.	ENSG00000067334	ENST00000436063;ENST00000528680	T	0.48201	0.82	5.23	5.23	0.72850	.	0.096535	0.45126	D	0.000399	T	0.54870	0.1885	M	0.66939	2.045	0.37604	D	0.920678	D	0.63880	0.993	P	0.60949	0.881	T	0.62760	-0.6786	10	0.87932	D	0	.	13.9057	0.63834	0.0:0.0:0.0:1.0	.	144	Q5QJE6	TDIF2_HUMAN	V	144;151	ENSP00000411010:E144V	ENSP00000352137:E144V	E	-	2	0	DNTTIP2	94115648	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	3.468000	0.53086	2.209000	0.71365	0.524000	0.50904	GAA	DNTTIP2	-	NULL	ENSG00000067334		0.408	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNTTIP2	HGNC	protein_coding	OTTHUMT00000028317.2	59	0.00	0	T	NM_014597		94343060	94343060	-1	no_errors	ENST00000436063	ensembl	human	known	69_37n	missense	93	13.08	14	SNP	1.000	A
EFCAB3	146779	genome.wustl.edu	37	17	60484535	60484535	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:60484535G>C	ENST00000305286.3	+	8	907	c.829G>C	c.(829-831)Gag>Cag	p.E277Q	EFCAB3_ENST00000450662.2_Missense_Mutation_p.E329Q	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	277							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			GCATTTCTTTGAGGATTATTT	0.353																																						dbGAP											0													72.0	74.0	73.0					17																	60484535		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.829G>C	17.37:g.60484535G>C	ENSP00000302649:p.Glu277Gln		J3KQM8	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.E329Q	ENST00000305286.3	37	c.985	CCDS11632.1	17	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050615	0.55218	.	.	ENSG00000172421	ENST00000450662;ENST00000305286	T;T	0.71103	-0.54;-0.44	5.91	5.91	0.95273	.	0.097257	0.44902	D	0.000401	T	0.77903	0.4200	M	0.66939	2.045	0.38263	D	0.941933	D	0.58268	0.982	P	0.52672	0.706	T	0.81017	-0.1123	10	0.56958	D	0.05	.	15.7957	0.78409	0.0:0.0:1.0:0.0	.	277	Q8N7B9	EFCB3_HUMAN	Q	329;277	ENSP00000403932:E329Q;ENSP00000302649:E277Q	ENSP00000302649:E277Q	E	+	1	0	EFCAB3	57838267	1.000000	0.71417	1.000000	0.80357	0.214000	0.24535	5.133000	0.64764	2.805000	0.96524	0.460000	0.39030	GAG	EFCAB3	-	NULL	ENSG00000172421		0.353	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB3	HGNC	protein_coding	OTTHUMT00000379114.1	30	0.00	0	G	NM_173503		60484535	60484535	+1	no_errors	ENST00000450662	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	C
EFEMP1	2202	genome.wustl.edu	37	2	56145044	56145044	+	Silent	SNP	T	T	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr2:56145044T>G	ENST00000394555.2	-	4	708	c.273A>C	c.(271-273)gcA>gcC	p.A91A	EFEMP1_ENST00000355426.3_Silent_p.A91A|EFEMP1_ENST00000424836.2_Silent_p.A33A|EFEMP1_ENST00000394554.1_Silent_p.A91A	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	91					epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGGTTCCTTCTGCTGGTTGTG	0.542																																					GBM(92;934 1319 7714 28760 40110)	dbGAP											0													114.0	114.0	114.0					2																	56145044		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.273A>C	2.37:g.56145044T>G			A8K3I4|B4DW75|D6W5D2|Q541U7	Silent	SNP	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.A91	ENST00000394555.2	37	c.273	CCDS1857.1	2																																																																																			EFEMP1	-	NULL	ENSG00000115380		0.542	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	HGNC	protein_coding	OTTHUMT00000251491.2	55	0.00	0	T			56145044	56145044	-1	no_errors	ENST00000355426	ensembl	human	known	69_37n	silent	50	41.18	35	SNP	0.000	G
EP300	2033	genome.wustl.edu	37	22	41566475	41566475	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr22:41566475A>C	ENST00000263253.7	+	27	5571	c.4352A>C	c.(4351-4353)cAt>cCt	p.H1451P	RP1-85F18.6_ENST00000415054.1_RNA|RNU6-375P_ENST00000517050.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1451	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.H1451L(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TTCCATTGCCATCCTCCTGAC	0.428			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													dbGAP		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	1	Substitution - Missense(1)	urinary_tract(1)											151.0	131.0	138.0					22																	41566475		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4352A>C	22.37:g.41566475A>C	ENSP00000263253:p.His1451Pro		B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.H1451P	ENST00000263253.7	37	c.4352	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	A	20.9	4.061475	0.76187	.	.	ENSG00000100393	ENST00000263253	D	0.91521	-2.86	5.5	5.5	0.81552	.	0.000000	0.49916	D	0.000125	D	0.96898	0.8987	H	0.96460	3.825	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	D	0.98190	1.0462	10	0.87932	D	0	-9.7709	15.6131	0.76744	1.0:0.0:0.0:0.0	.	1451	Q09472	EP300_HUMAN	P	1451	ENSP00000263253:H1451P	ENSP00000263253:H1451P	H	+	2	0	EP300	39896421	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.237000	0.95368	2.084000	0.62774	0.533000	0.62120	CAT	EP300	-	pfam_Histone_H3-K56_AcTrfase_RTT109	ENSG00000100393		0.428	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	43	0.00	0	A	NM_001429		41566475	41566475	+1	no_errors	ENST00000263253	ensembl	human	known	69_37n	missense	40	45.95	34	SNP	1.000	C
FAM186B	84070	genome.wustl.edu	37	12	49994357	49994357	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr12:49994357C>G	ENST00000257894.2	-	4	1227	c.1066G>C	c.(1066-1068)Gaa>Caa	p.E356Q	PRPF40B_ENST00000508736.1_3'UTR|FAM186B_ENST00000551047.1_Intron|FAM186B_ENST00000544141.1_Missense_Mutation_p.E266Q	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	356						protein complex (GO:0043234)				breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGTTGGCTTTCCTCCATGACT	0.552																																						dbGAP											0													157.0	135.0	142.0					12																	49994357		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.1066G>C	12.37:g.49994357C>G	ENSP00000257894:p.Glu356Gln		B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	NULL	p.E356Q	ENST00000257894.2	37	c.1066	CCDS8788.1	12	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402867	0.62288	.	.	ENSG00000135436	ENST00000544141;ENST00000257894	T;T	0.14391	2.51;2.73	5.51	1.29	0.21616	.	0.302587	0.23908	N	0.043379	T	0.11239	0.0274	L	0.60455	1.87	0.09310	N	1	P;P	0.35872	0.525;0.525	B;B	0.33454	0.164;0.164	T	0.16928	-1.0386	9	.	.	.	3.0E-4	5.1101	0.14804	0.0:0.4839:0.3218:0.1943	.	266;356	B4DZ15;Q8IYM0	.;F186B_HUMAN	Q	266;356	ENSP00000438569:E266Q;ENSP00000257894:E356Q	.	E	-	1	0	FAM186B	48280624	0.000000	0.05858	0.019000	0.16419	0.228000	0.25075	-0.149000	0.10204	0.031000	0.15407	0.655000	0.94253	GAA	FAM186B	-	NULL	ENSG00000135436		0.552	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM186B	HGNC	protein_coding	OTTHUMT00000394583.2	28	0.00	0	C	NM_032130		49994357	49994357	-1	no_errors	ENST00000257894	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.154	G
NUTM2F	54754	genome.wustl.edu	37	9	97082499	97082499	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr9:97082499A>T	ENST00000253262.4	-	5	1379	c.1359T>A	c.(1357-1359)ttT>ttA	p.F453L	NUTM2F_ENST00000341207.4_Missense_Mutation_p.F438L|NUTM2F_ENST00000335456.7_Missense_Mutation_p.F438L	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	453																	CCTTGGTGACAAAGTCTTCCT	0.557																																						dbGAP											0													23.0	31.0	28.0					9																	97082499		1830	4048	5878	-	-	-	SO:0001583	missense	0				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1359T>A	9.37:g.97082499A>T	ENSP00000253262:p.Phe453Leu		B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	NULL	p.F453L	ENST00000253262.4	37	c.1359	CCDS47994.1	9	.	.	.	.	.	.	.	.	.	.	.	12.97	2.096027	0.36952	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207;ENST00000375347	T;T;T	0.57752	0.38;0.95;0.95	1.2	-1.81	0.07882	Nuclear Testis protein, C-terminal (1);	0.103901	0.43579	D	0.000556	T	0.48352	0.1495	M	0.64567	1.98	0.09310	N	1	P	0.50617	0.937	P	0.49276	0.605	T	0.46638	-0.9177	10	0.87932	D	0	.	4.0579	0.09824	0.4928:0.0:0.5072:0.0	.	453	A1L443	FA22F_HUMAN	L	438;453;438;287	ENSP00000335067:F438L;ENSP00000253262:F453L;ENSP00000343865:F438L	ENSP00000253262:F453L	F	-	3	2	FAM22F	96122320	0.548000	0.26473	0.024000	0.17045	0.159000	0.22180	-0.106000	0.10890	-0.335000	0.08451	-0.635000	0.03985	TTT	FAM22F	-	NULL	ENSG00000130950		0.557	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM22F	HGNC	protein_coding	OTTHUMT00000053173.2	32	0.00	0	A	NM_017561		97082499	97082499	-1	no_errors	ENST00000253262	ensembl	human	known	69_37n	missense	50	19.35	12	SNP	0.033	T
FANCI	55215	genome.wustl.edu	37	15	89838218	89838218	+	Silent	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:89838218G>C	ENST00000310775.7	+	24	2615	c.2529G>C	c.(2527-2529)gtG>gtC	p.V843V	FANCI_ENST00000300027.8_Intron	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	843					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					GCTATGCAGTGAATGTAGCTC	0.468								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0													156.0	141.0	146.0					15																	89838218		689	1590	2279	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.2529G>C	15.37:g.89838218G>C			A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Silent	SNP	NULL	p.V843	ENST00000310775.7	37	c.2529	CCDS45346.1	15																																																																																			FANCI	-	NULL	ENSG00000140525		0.468	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	HGNC	protein_coding	OTTHUMT00000421140.1	52	0.00	0	G	NM_018193		89838218	89838218	+1	no_errors	ENST00000310775	ensembl	human	known	69_37n	silent	35	31.37	16	SNP	0.926	C
FBN2	2201	genome.wustl.edu	37	5	127611744	127611744	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr5:127611744C>A	ENST00000508053.1	-	65	8554	c.7580G>T	c.(7579-7581)gGa>gTa	p.G2527V	FBN2_ENST00000262464.4_Missense_Mutation_p.G2527V			P35556	FBN2_HUMAN	fibrillin 2	2527	EGF-like 42; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCATGTCTTTCCATCCTCTTG	0.433																																						dbGAP											0													214.0	190.0	198.0					5																	127611744		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.7580G>T	5.37:g.127611744C>A	ENSP00000424571:p.Gly2527Val		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G2527V	ENST00000508053.1	37	c.7580	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869696	0.72065	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.88818	-2.43;-2.43	5.06	3.22	0.36961	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.100570	0.44097	D	0.000491	D	0.95981	0.8691	H	0.95780	3.72	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96912	0.9668	10	0.72032	D	0.01	.	15.4627	0.75373	0.0:0.7367:0.2633:0.0	.	2527	P35556	FBN2_HUMAN	V	2527	ENSP00000262464:G2527V;ENSP00000424571:G2527V	ENSP00000262464:G2527V	G	-	2	0	FBN2	127639643	0.998000	0.40836	0.589000	0.28718	0.972000	0.66771	3.922000	0.56462	0.777000	0.33496	0.655000	0.94253	GGA	FBN2	-	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000138829		0.433	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	68	0.00	0	C	NM_001999		127611744	127611744	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.996	A
FEM1A	55527	genome.wustl.edu	37	19	4793084	4793084	+	Missense_Mutation	SNP	C	C	G	rs377569506		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr19:4793084C>G	ENST00000269856.3	+	1	1357	c.1218C>G	c.(1216-1218)ttC>ttG	p.F406L	AC005523.2_ENST00000601192.1_RNA|AC005523.2_ENST00000596170.1_RNA|AC005523.3_ENST00000598782.1_lincRNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	406					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)	p.F406F(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		CGGGCAATTTCGAGCGCTGCA	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		18192	0.0		0.001	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											61.0	58.0	59.0					19																	4793084		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.1218C>G	19.37:g.4793084C>G	ENSP00000269856:p.Phe406Leu		B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.F406L	ENST00000269856.3	37	c.1218	CCDS12135.1	19	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328342	0.60743	.	.	ENSG00000141965	ENST00000269856	T	0.62498	0.02	4.88	-0.391	0.12446	Tetratricopeptide-like helical (1);	0.000000	0.85682	U	0.000000	T	0.63426	0.2510	M	0.82193	2.58	0.49483	D	0.999798	P	0.39809	0.689	P	0.49999	0.628	T	0.64491	-0.6395	10	0.05620	T	0.96	-22.4133	6.2208	0.20681	0.0:0.4581:0.133:0.4088	.	406	Q9BSK4	FEM1A_HUMAN	L	406	ENSP00000269856:F406L	ENSP00000269856:F406L	F	+	3	2	FEM1A	4744084	0.333000	0.24731	0.985000	0.45067	0.964000	0.63967	-0.333000	0.07894	0.121000	0.18284	-0.339000	0.08088	TTC	FEM1A	-	NULL	ENSG00000141965		0.622	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEM1A	HGNC	protein_coding	OTTHUMT00000459000.1	11	0.00	0	C			4793084	4793084	+1	no_errors	ENST00000269856	ensembl	human	known	69_37n	missense	7	58.82	10	SNP	0.998	G
FRMD7	90167	genome.wustl.edu	37	X	131212589	131212589	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chrX:131212589G>T	ENST00000298542.4	-	12	1631	c.1456C>A	c.(1456-1458)Cag>Aag	p.Q486K	FRMD7_ENST00000464296.1_Missense_Mutation_p.Q471K|FRMD7_ENST00000370879.1_Missense_Mutation_p.Q366K	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	486					regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					CCAACCTGCTGACCTGTACAA	0.488																																						dbGAP											0													143.0	128.0	133.0					X																	131212589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.1456C>A	X.37:g.131212589G>T	ENSP00000298542:p.Gln486Lys		C0LLJ3|Q5JX99	Missense_Mutation	SNP	pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.Q486K	ENST00000298542.4	37	c.1456	CCDS35397.1	X	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765891	0.69878	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.86030	-2.06;-1.72;-1.83	5.88	5.88	0.94601	.	0.082185	0.52532	D	0.000077	D	0.84534	0.5493	M	0.66939	2.045	0.33695	D	0.613839	P;P	0.52692	0.955;0.86	P;B	0.46026	0.501;0.4	D	0.84890	0.0836	10	0.08179	T	0.78	.	16.3801	0.83458	0.0:0.0:1.0:0.0	.	471;486	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	K	366;486;471	ENSP00000359916:Q366K;ENSP00000298542:Q486K;ENSP00000417996:Q471K	ENSP00000298542:Q486K	Q	-	1	0	FRMD7	131040270	0.907000	0.30839	1.000000	0.80357	0.984000	0.73092	1.267000	0.33050	2.474000	0.83562	0.600000	0.82982	CAG	FRMD7	-	NULL	ENSG00000165694		0.488	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD7	HGNC	protein_coding	OTTHUMT00000355031.1	31	0.00	0	G	NM_194277		131212589	131212589	-1	no_errors	ENST00000298542	ensembl	human	known	69_37n	missense	46	31.34	21	SNP	1.000	T
FRMPD1	22844	genome.wustl.edu	37	9	37740228	37740228	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr9:37740228T>A	ENST00000539465.1	+	15	2296	c.1703T>A	c.(1702-1704)gTg>gAg	p.V568E	FRMPD1_ENST00000541302.1_Missense_Mutation_p.V437E|FRMPD1_ENST00000377765.3_Missense_Mutation_p.V568E|FRMPD1_ENST00000536622.1_Missense_Mutation_p.V390E|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	568						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		ACACCTGAGGTGGCTAGGAGG	0.642																																						dbGAP											0													29.0	35.0	33.0					9																	37740228		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1703T>A	9.37:g.37740228T>A	ENSP00000444411:p.Val568Glu		B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.V568E	ENST00000539465.1	37	c.1703	CCDS6612.1	9	.	.	.	.	.	.	.	.	.	.	T	6.635	0.485645	0.12641	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.16597	3.33;3.33;2.33;2.33	5.76	-4.68	0.03309	.	1.308000	0.04956	N	0.461121	T	0.07458	0.0188	N	0.24115	0.695	0.09310	N	1	B;B	0.10296	0.0;0.003	B;B	0.08055	0.0;0.003	T	0.32903	-0.9889	10	0.08837	T	0.75	0.2236	0.5282	0.00624	0.2517:0.2541:0.1282:0.366	.	437;568	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	E	568;568;390;437	ENSP00000366995:V568E;ENSP00000444411:V568E;ENSP00000437762:V390E;ENSP00000444804:V437E	ENSP00000366995:V568E	V	+	2	0	FRMPD1	37730228	0.000000	0.05858	0.071000	0.20095	0.155000	0.21991	-1.124000	0.03260	-0.520000	0.06435	-0.333000	0.08304	GTG	FRMPD1	-	NULL	ENSG00000070601		0.642	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	HGNC	protein_coding	OTTHUMT00000402969.1	13	0.00	0	T	NM_014907		37740228	37740228	+1	no_errors	ENST00000377765	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	0.008	A
FRRS1L	23732	genome.wustl.edu	37	9	111903756	111903756	+	Silent	SNP	A	A	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr9:111903756A>G	ENST00000561981.2	-	4	728	c.729T>C	c.(727-729)gaT>gaC	p.D243D		NM_014334.2	NP_055149.2	Q9P0K9	FRS1L_HUMAN	ferric-chelate reductase 1-like	243	DOMON. {ECO:0000255|PROSITE- ProRule:PRU00246}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)											CTCCTTCTTCATCTCTGGCAG	0.468																																						dbGAP											0													148.0	144.0	145.0					9																	111903756		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF155065	CCDS35098.1	9q31.3	2014-07-16	2012-03-06	2012-03-06	ENSG00000260230	ENSG00000260230			1362	protein-coding gene	gene with protein product		604574	"""chromosome 9 open reading frame 4"""	C9orf4		10603000	Standard	NM_014334		Approved	CG-6	uc004bdw.1	Q9P0K9	OTTHUMG00000020468	ENST00000561981.2:c.729T>C	9.37:g.111903756A>G			Q5T4G4	Silent	SNP	pfam_DOMON_domain,smart_DOMON_domain,pfscan_DOMON_domain	p.D243	ENST00000561981.2	37	c.729	CCDS35098.1	9																																																																																			FRRS1L	-	pfam_DOMON_domain,smart_DOMON_domain,pfscan_DOMON_domain	ENSG00000136805		0.468	FRRS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRRS1L	HGNC	protein_coding	OTTHUMT00000053586.2	48	0.00	0	A	NM_014334		111903756	111903756	-1	no_errors	ENST00000374581	ensembl	human	known	69_37n	silent	24	40.00	16	SNP	0.977	G
DDX42	11325	genome.wustl.edu	37	17	61898796	61898796	+	IGR	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:61898796C>G	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Missense_Mutation_p.E602Q	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						GTGGCAGCTTCTGTCCCCGAA	0.522																																						dbGAP											0													115.0	116.0	116.0					17																	61898796		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61898796C>G			A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_rRNA_MeTfrase_Spb1_C,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_rRNA_MeTfrase_Spb1_DUF3381	p.E602Q	ENST00000578681.1	37	c.1804	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	C	7.143	0.582281	0.13749	.	.	ENSG00000108592	ENST00000427159	T	0.30714	1.52	4.3	0.97	0.19692	.	0.437838	0.22287	N	0.062046	T	0.12305	0.0299	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.14023	0.01	T	0.18999	-1.0319	10	0.28530	T	0.3	-9.255	5.4979	0.16813	0.0:0.6196:0.0:0.3803	.	602	Q8IY81	RRMJ3_HUMAN	Q	602	ENSP00000396673:E602Q	ENSP00000396673:E602Q	E	-	1	0	FTSJ3	59252528	0.002000	0.14202	0.004000	0.12327	0.107000	0.19398	-0.087000	0.11215	0.462000	0.27095	0.563000	0.77884	GAA	FTSJ3	-	NULL	ENSG00000108592		0.522	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	HGNC	protein_coding	OTTHUMT00000444368.1	29	0.00	0	C	NM_007372		61898796	61898796	-1	no_errors	ENST00000427159	ensembl	human	known	69_37n	missense	19	28.57	8	SNP	0.001	G
FUT6	2528	genome.wustl.edu	37	19	5832255	5832255	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr19:5832255G>C	ENST00000318336.4	-	3	1518	c.324C>G	c.(322-324)caC>caG	p.H108Q	FUT6_ENST00000527106.1_Missense_Mutation_p.H108Q|FUT6_ENST00000524754.1_Missense_Mutation_p.H108Q|FUT6_ENST00000286955.5_Missense_Mutation_p.H108Q|FUT6_ENST00000592563.1_Missense_Mutation_p.H108Q	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	108					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						CCTCTCGGTGGTGCACGATGA	0.637																																						dbGAP											0													83.0	72.0	76.0					19																	5832255		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.324C>G	19.37:g.5832255G>C	ENSP00000313398:p.His108Gln		A6NEX0|D6W637|Q9UND8	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.H108Q	ENST00000318336.4	37	c.324	CCDS12152.1	19	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815415	0.50527	.	.	ENSG00000156413	ENST00000524754;ENST00000527106;ENST00000318336;ENST00000286955;ENST00000341530;ENST00000529165	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.88	3.09	-3.35	0.04928	.	0.000000	0.64402	D	0.000011	T	0.50137	0.1598	M	0.91249	3.19	0.31430	N	0.673267	D;D	0.71674	0.998;0.998	D;D	0.77004	0.989;0.983	T	0.55903	-0.8067	10	0.87932	D	0	.	9.1177	0.36769	0.4104:0.0:0.5896:0.0	.	108;108	C9J8A2;P51993	.;FUT6_HUMAN	Q	108	ENSP00000431708:H108Q;ENSP00000432954:H108Q;ENSP00000313398:H108Q;ENSP00000286955:H108Q;ENSP00000436547:H108Q	ENSP00000286955:H108Q	H	-	3	2	FUT6	5783255	0.896000	0.30565	0.141000	0.22245	0.013000	0.08279	-0.082000	0.11304	-0.543000	0.06240	-0.436000	0.05848	CAC	FUT6	-	pfam_Glyco_trans_10	ENSG00000156413		0.637	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT6	HGNC	protein_coding	OTTHUMT00000394218.2	21	0.00	0	G	NM_000150		5832255	5832255	-1	no_errors	ENST00000592563	ensembl	human	known	69_37n	missense	8	71.43	20	SNP	0.983	C
GAB3	139716	genome.wustl.edu	37	X	153924265	153924265	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chrX:153924265C>G	ENST00000369575.3	-	8	1485	c.1454G>C	c.(1453-1455)aGa>aCa	p.R485T	GAB3_ENST00000424127.2_Missense_Mutation_p.R486T|GAB3_ENST00000496390.1_5'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	485					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AATACCATTTCTTTCTGGAGA	0.373																																						dbGAP											0													62.0	55.0	57.0					X																	153924265		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1454G>C	X.37:g.153924265C>G	ENSP00000358588:p.Arg485Thr		A6NHF8|E9PB44	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R486T	ENST00000369575.3	37	c.1457	CCDS14760.1	X	.	.	.	.	.	.	.	.	.	.	C	18.94	3.728832	0.69074	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.24151	1.87;1.87;1.87	5.44	5.44	0.79542	.	0.430961	0.26394	N	0.024629	T	0.38214	0.1032	M	0.84846	2.72	0.41418	D	0.987782	D;D;D	0.61697	0.99;0.99;0.99	P;P;P	0.45099	0.469;0.469;0.469	T	0.43734	-0.9373	10	0.24483	T	0.36	-23.7068	15.5927	0.76550	0.0:1.0:0.0:0.0	.	486;486;485	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	T	485;486;486	ENSP00000358588:R485T;ENSP00000358581:R486T;ENSP00000399588:R486T	ENSP00000358581:R486T	R	-	2	0	GAB3	153577459	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.683000	0.54663	2.277000	0.76020	0.513000	0.50165	AGA	GAB3	-	NULL	ENSG00000160219		0.373	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	38	0.00	0	C	NM_001081573		153924265	153924265	-1	no_errors	ENST00000424127	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	1.000	G
GBP4	115361	genome.wustl.edu	37	1	89658731	89658731	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:89658731C>G	ENST00000355754.6	-	5	623	c.526G>C	c.(526-528)Gat>Cat	p.D176H		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	176	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.D176H(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		TCAGCTTCATCAGGTCTGGGG	0.478																																						dbGAP											1	Substitution - Missense(1)	lung(1)											130.0	122.0	124.0					1																	89658731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.526G>C	1.37:g.89658731C>G	ENSP00000359490:p.Asp176His		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C	p.D176H	ENST00000355754.6	37	c.526	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	c	9.339	1.062562	0.19987	.	.	ENSG00000162654	ENST00000355754	T	0.75050	-0.9	4.92	3.06	0.35304	Guanylate-binding protein, N-terminal (1);	0.644741	0.15769	N	0.245544	T	0.51210	0.1661	L	0.49778	1.585	0.09310	N	1	B	0.24092	0.097	B	0.30105	0.111	T	0.48937	-0.8990	10	0.39692	T	0.17	.	9.5557	0.39337	0.0:0.8275:0.0:0.1725	.	176	Q96PP9	GBP4_HUMAN	H	176	ENSP00000359490:D176H	ENSP00000359490:D176H	D	-	1	0	GBP4	89431319	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.246000	0.08878	0.798000	0.33994	-0.127000	0.14921	GAT	GBP4	-	pfam_Guanylate-bd_N	ENSG00000162654		0.478	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	49	0.00	0	C	NM_052941		89658731	89658731	-1	no_errors	ENST00000355754	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	0.005	G
GDI1	2664	genome.wustl.edu	37	X	153668821	153668821	+	Silent	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chrX:153668821C>T	ENST00000447750.2	+	6	1022	c.687C>T	c.(685-687)taC>taT	p.Y229Y		NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	229					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACCCGCTCTACGGCTTGGGCG	0.577																																						dbGAP											0													113.0	103.0	106.0					X																	153668821		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.687C>T	X.37:g.153668821C>T			P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Silent	SNP	pfam_GDP_dissociation_inhibitor,prints_RabGDI,prints_GDP_dissociation_inhibitor	p.Y229	ENST00000447750.2	37	c.687	CCDS35452.1	X																																																																																			GDI1	-	pfam_GDP_dissociation_inhibitor,prints_GDP_dissociation_inhibitor	ENSG00000203879		0.577	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDI1	HGNC	protein_coding	OTTHUMT00000081649.2	50	0.00	0	C	NM_001493		153668821	153668821	+1	no_errors	ENST00000447750	ensembl	human	known	69_37n	silent	40	23.08	12	SNP	0.988	T
GOLGA6L2	283685	genome.wustl.edu	37	15	23685102	23685102	+	Silent	SNP	T	T	C	rs76302230		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:23685102T>C	ENST00000567107.1	-	8	2572	c.2520A>G	c.(2518-2520)ggA>ggG	p.G840G	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	599										breast(1)|endometrium(7)	8						ctcctcctgctcccgcatctt	0.622																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2520A>G	15.37:g.23685102T>C			A1L301	Silent	SNP	NULL	p.G840	ENST00000567107.1	37	c.2520		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.622	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	17	0.00	0	T	NM_182561		23685102	23685102	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	silent	14	39.13	9	SNP	0.000	C
GOLGB1	2804	genome.wustl.edu	37	3	121409716	121409716	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:121409716G>A	ENST00000340645.5	-	14	8605	c.8480C>T	c.(8479-8481)tCt>tTt	p.S2827F	GOLGB1_ENST00000393667.3_Missense_Mutation_p.S2832F	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2827					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTGGTTATAAGAATCTTCTAG	0.438																																						dbGAP											0													79.0	76.0	77.0					3																	121409716		2203	4300	6503	-	-	-	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8480C>T	3.37:g.121409716G>A	ENSP00000341848:p.Ser2827Phe		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.S2827F	ENST00000340645.5	37	c.8480	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	10.30	1.311571	0.23821	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.15718	2.4;2.4	5.3	5.3	0.74995	.	0.098967	0.45606	D	0.000358	T	0.12817	0.0311	L	0.27053	0.805	0.40428	D	0.979913	P;P;B	0.45474	0.859;0.859;0.425	B;B;B	0.40009	0.316;0.316;0.132	T	0.01839	-1.1263	10	0.51188	T	0.08	.	11.3879	0.49796	0.0:0.0:0.8197:0.1802	.	2832;2832;2827	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	F	2827;2832	ENSP00000341848:S2827F;ENSP00000377275:S2832F	ENSP00000341848:S2827F	S	-	2	0	GOLGB1	122892406	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.006000	0.57083	2.756000	0.94617	0.655000	0.94253	TCT	GOLGB1	-	superfamily_STAT_TF_coiled-coil	ENSG00000173230		0.438	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	47	0.00	0	G	NM_004487		121409716	121409716	-1	no_errors	ENST00000340645	ensembl	human	known	69_37n	missense	61	21.79	17	SNP	0.992	A
GRK7	131890	genome.wustl.edu	37	3	141535617	141535617	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:141535617G>C	ENST00000264952.2	+	4	1524	c.1387G>C	c.(1387-1389)Gaa>Caa	p.E463Q		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	463	AGC-kinase C-terminal.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						TCCTCGCCTGGAAGCTGGCCT	0.453																																						dbGAP											0													119.0	120.0	120.0					3																	141535617		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.1387G>C	3.37:g.141535617G>C	ENSP00000264952:p.Glu463Gln			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_GPCR_kinase,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom	p.E463Q	ENST00000264952.2	37	c.1387	CCDS3120.1	3	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777168	0.70107	.	.	ENSG00000114124	ENST00000264952	T	0.25749	1.78	5.4	4.51	0.55191	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.46658	0.1404	M	0.87971	2.92	0.58432	D	0.999999	D	0.59767	0.986	P	0.50970	0.655	T	0.58418	-0.7640	10	0.51188	T	0.08	-13.1717	16.0369	0.80638	0.0:0.1347:0.8653:0.0	.	463	Q8WTQ7	GRK7_HUMAN	Q	463	ENSP00000264952:E463Q	ENSP00000264952:E463Q	E	+	1	0	GRK7	143018307	1.000000	0.71417	0.998000	0.56505	0.423000	0.31445	6.637000	0.74304	1.258000	0.44101	0.467000	0.42956	GAA	GRK7	-	superfamily_Kinase-like_dom,smart_AGC-kinase_C	ENSG00000114124		0.453	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK7	HGNC	protein_coding	OTTHUMT00000353168.1	48	0.00	0	G	NM_139209		141535617	141535617	+1	no_errors	ENST00000264952	ensembl	human	known	69_37n	missense	60	20.00	15	SNP	1.000	C
GTF3C6	112495	genome.wustl.edu	37	6	111280417	111280417	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr6:111280417G>T	ENST00000329970.7	+	2	310	c.100G>T	c.(100-102)Gac>Tac	p.D34Y	GTF3C6_ENST00000480191.1_3'UTR	NM_138408.3	NP_612417.1	Q969F1	TF3C6_HUMAN	general transcription factor IIIC, polypeptide 6, alpha 35kDa	34					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			NS(1)|kidney(1)|large_intestine(1)|lung(1)	4		all_cancers(87;0.00328)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|Colorectal(196;0.0466)|all_epithelial(87;0.0575)		OV - Ovarian serous cystadenocarcinoma(136;0.105)|all cancers(137;0.179)|Epithelial(106;0.186)		TATTGATTCAGACTTCCTCTC	0.408																																						dbGAP											0													115.0	115.0	115.0					6																	111280417		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057977	CCDS5087.1	6q21	2010-03-23	2007-07-26	2007-07-26	ENSG00000155115	ENSG00000155115		"""General transcription factors"""	20872	protein-coding gene	gene with protein product		611784	"""chromosome 6 open reading frame 51"""	C6orf51		17409385	Standard	NM_138408		Approved	bA397G5.3, TFIIIC35	uc003pum.3	Q969F1	OTTHUMG00000015370	ENST00000329970.7:c.100G>T	6.37:g.111280417G>T	ENSP00000357863:p.Asp34Tyr		Q5VXN2	Missense_Mutation	SNP	pfam_TFIIIC_tau55-rel	p.D34Y	ENST00000329970.7	37	c.100	CCDS5087.1	6	.	.	.	.	.	.	.	.	.	.	g	20.7	4.033217	0.75504	.	.	ENSG00000155115	ENST00000329970	.	.	.	5.08	5.08	0.68730	.	0.091958	0.64402	D	0.000001	T	0.74718	0.3753	M	0.74258	2.255	0.58432	D	0.999991	D	0.89917	1.0	D	0.65684	0.937	T	0.78201	-0.2296	9	0.87932	D	0	-0.8036	18.422	0.90594	0.0:0.0:1.0:0.0	.	34	Q969F1	TF3C6_HUMAN	Y	34	.	ENSP00000357863:D34Y	D	+	1	0	GTF3C6	111387110	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	6.539000	0.73856	2.520000	0.84964	0.478000	0.44815	GAC	GTF3C6	-	NULL	ENSG00000155115		0.408	GTF3C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C6	HGNC	protein_coding	OTTHUMT00000041820.1	68	0.00	0	G	NM_138408		111280417	111280417	+1	no_errors	ENST00000329970	ensembl	human	known	69_37n	missense	50	27.54	19	SNP	1.000	T
GZF1	64412	genome.wustl.edu	37	20	23350861	23350861	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr20:23350861C>T	ENST00000338121.5	+	6	1996	c.1919C>T	c.(1918-1920)tCt>tTt	p.S640F	GZF1_ENST00000542987.1_Missense_Mutation_p.S149F|GZF1_ENST00000544236.1_Missense_Mutation_p.S164F|GZF1_ENST00000377051.2_Missense_Mutation_p.S640F			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	640					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					AAATTGCTGTCTTTTGCAGAA	0.488																																						dbGAP											0													109.0	87.0	94.0					20																	23350861		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1919C>T	20.37:g.23350861C>T	ENSP00000338290:p.Ser640Phe		A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S640F	ENST00000338121.5	37	c.1919	CCDS13151.1	20	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419492	0.62622	.	.	ENSG00000125812	ENST00000544236;ENST00000338121;ENST00000542987;ENST00000377051	T;T;T;T	0.10860	2.99;2.83;3.29;2.83	5.77	5.77	0.91146	.	0.115308	0.38548	N	0.001651	T	0.19927	0.0479	L	0.32530	0.975	0.41943	D	0.990627	D	0.61080	0.989	P	0.55087	0.768	T	0.00165	-1.1967	10	0.66056	D	0.02	.	18.9709	0.92715	0.0:1.0:0.0:0.0	.	640	Q9H116	GZF1_HUMAN	F	164;640;149;640	ENSP00000445458:S164F;ENSP00000338290:S640F;ENSP00000445118:S149F;ENSP00000366250:S640F	ENSP00000338290:S640F	S	+	2	0	GZF1	23298861	1.000000	0.71417	1.000000	0.80357	0.172000	0.22775	5.282000	0.65615	2.728000	0.93425	0.655000	0.94253	TCT	GZF1	-	NULL	ENSG00000125812		0.488	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GZF1	HGNC	protein_coding	OTTHUMT00000078333.1	28	0.00	0	C	NM_022482		23350861	23350861	+1	no_errors	ENST00000338121	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	1.000	T
HSPH1	10808	genome.wustl.edu	37	13	31713136	31713136	+	Splice_Site	DEL	C	C	-			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr13:31713136delC	ENST00000320027.5	-	15	2433		c.e15+1		HSPH1_ENST00000445273.2_Splice_Site|HSPH1_ENST00000380405.4_Splice_Site|HSPH1_ENST00000429785.2_Splice_Site|HSPH1_ENST00000380406.5_Splice_Site	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1						chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		AAACGACCTACCATTAATTCT	0.313																																						dbGAP											0													111.0	97.0	102.0					13																	31713136		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.2088+1G>-	13.37:g.31713136delC			B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Splice_Site	DEL	-	e15+1	ENST00000320027.5	37	c.2094+1	CCDS9340.1	13																																																																																			HSPH1	-	-	ENSG00000120694		0.313	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPH1	HGNC	protein_coding	OTTHUMT00000044384.1	46	0.00	0	C		Intron	31713136	31713136	-1	no_errors	ENST00000445273	ensembl	human	known	69_37n	splice_site_del	41	14.58	7	DEL	1.000	-
HUWE1	10075	genome.wustl.edu	37	X	53631744	53631744	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chrX:53631744A>C	ENST00000342160.3	-	25	3005	c.2548T>G	c.(2548-2550)Tcc>Gcc	p.S850A	HUWE1_ENST00000262854.6_Missense_Mutation_p.S850A|HUWE1_ENST00000218328.8_Missense_Mutation_p.S850A			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	850					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GAGAGGATGGAGTCCAACTGA	0.483																																						dbGAP											0													65.0	63.0	64.0					X																	53631744		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.2548T>G	X.37:g.53631744A>C	ENSP00000340648:p.Ser850Ala		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.S850A	ENST00000342160.3	37	c.2548	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	A	11.75	1.732474	0.30684	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.45668	1.2;1.2;0.89	5.88	5.88	0.94601	.	0.579574	0.18081	N	0.152285	T	0.32406	0.0828	L	0.44542	1.39	0.32142	N	0.585374	P	0.38565	0.637	B	0.30495	0.116	T	0.40308	-0.9570	10	0.19147	T	0.46	.	14.1505	0.65381	1.0:0.0:0.0:0.0	.	850	Q7Z6Z7	HUWE1_HUMAN	A	850	ENSP00000340648:S850A;ENSP00000262854:S850A;ENSP00000218328:S850A	ENSP00000218328:S850A	S	-	1	0	HUWE1	53648469	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.883000	0.48554	1.987000	0.57996	0.486000	0.48141	TCC	HUWE1	-	NULL	ENSG00000086758		0.483	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	39	0.00	0	A	XM_497119		53631744	53631744	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	1.000	C
IGF2	3481	genome.wustl.edu	37	11	2167538	2167538	+	Intron	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:2167538C>T	ENST00000300632.5	-	2	720				IGF2-AS_ENST00000381363.4_RNA|INS-IGF2_ENST00000481781.1_5'Flank|IGF2-AS_ENST00000445504.2_RNA|IGF2-AS_ENST00000381361.3_RNA	NM_001007139.4	NP_001007140.2	P01344	IGF2_HUMAN	insulin-like growth factor 2						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|exocrine pancreas development (GO:0031017)|female pregnancy (GO:0007565)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|striated muscle cell differentiation (GO:0051146)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	growth factor activity (GO:0008083)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protein serine/threonine kinase activator activity (GO:0043539)|receptor activator activity (GO:0030546)	p.A123D(1)		central_nervous_system(1)|kidney(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	6		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		ACAAACCCAGCTCCTTTCTCC	0.642																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											100.0	104.0	103.0					11																	2167538		1924	4137	6061	-	-	-	SO:0001627	intron_variant	0			M29645, AK025719	CCDS7728.1, CCDS44517.1	11p15.5	2014-09-16	2014-09-16		ENSG00000167244	ENSG00000167244			5466	protein-coding gene	gene with protein product	"""somatomedin A"""	147470	"""chromosome 11 open reading frame 43"""	C11orf43		2450353, 3167054	Standard	NM_000612		Approved	FLJ44734, IGF-II	uc009ydf.3	P01344	OTTHUMG00000009395	ENST00000300632.5:c.5+1257G>A	11.37:g.2167538C>T			B3KX48|B7WP08|C9JAF2|E3UN45|P78449|Q14299|Q1WM26|Q9UC68|Q9UC69	Missense_Mutation	SNP	NULL	p.A123V	ENST00000300632.5	37	c.368	CCDS7728.1	11	.	.	.	.	.	.	.	.	.	.	C	9.926	1.213610	0.22289	.	.	ENSG00000099869	ENST00000381363	.	.	.	2.53	1.6	0.23607	.	.	.	.	.	T	0.31949	0.0813	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.28776	-1.0033	7	0.87932	D	0	.	8.2797	0.31894	0.0:0.8622:0.0:0.1378	.	123	Q6U949	IG2AS_HUMAN	V	123	.	ENSP00000370766:A123V	A	+	2	0	IGF2AS	2124114	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	-0.060000	0.11712	0.169000	0.19679	-1.598000	0.00824	GCT	IGF2-AS	-	NULL	ENSG00000099869		0.642	IGF2-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGF2-AS	HGNC	protein_coding		22	0.00	0	C	NM_000612		2167538	2167538	+1	no_errors	ENST00000381361	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	0.002	T
IGSF10	285313	genome.wustl.edu	37	3	151163081	151163081	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:151163081G>C	ENST00000282466.3	-	4	4687	c.4688C>G	c.(4687-4689)tCt>tGt	p.S1563C		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1563					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGTTAATTTAGAATTCTGTGA	0.398																																						dbGAP											0													168.0	170.0	169.0					3																	151163081		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4688C>G	3.37:g.151163081G>C	ENSP00000282466:p.Ser1563Cys		Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S1563C	ENST00000282466.3	37	c.4688	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133437	0.37630	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.69926	-0.44	5.76	4.83	0.62350	.	0.174068	0.28279	N	0.015936	T	0.64461	0.2600	N	0.08118	0	0.09310	N	0.999995	D	0.89917	1.0	D	0.68192	0.956	T	0.60712	-0.7209	10	0.66056	D	0.02	.	13.5266	0.61599	0.0:0.1566:0.8434:0.0	.	1563	Q6WRI0	IGS10_HUMAN	C	1563;190	ENSP00000282466:S1563C	ENSP00000282466:S1563C	S	-	2	0	IGSF10	152645771	0.160000	0.22878	0.402000	0.26371	0.157000	0.22087	1.737000	0.38197	2.724000	0.93272	0.650000	0.86243	TCT	IGSF10	-	NULL	ENSG00000152580		0.398	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	56	0.00	0	G	NM_178822		151163081	151163081	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	missense	68	13.92	11	SNP	0.310	C
IL1RAPL1	11141	genome.wustl.edu	37	X	29417323	29417323	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chrX:29417323C>G	ENST00000378993.1	+	5	1274	c.601C>G	c.(601-603)Ctg>Gtg	p.L201V	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.L201V	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	201	Ig-like C2-type 2.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						AAGAGATACTCTGCTTATAAG	0.323																																						dbGAP											0													74.0	72.0	73.0					X																	29417323		2202	4294	6496	-	-	-	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.601C>G	X.37:g.29417323C>G	ENSP00000368278:p.Leu201Val		A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom,pfscan_Ig-like	p.L201V	ENST00000378993.1	37	c.601	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	C	13.34	2.209464	0.39003	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	D;D	0.92099	-2.97;-2.97	5.75	-0.652	0.11450	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.93138	0.7815	M	0.80982	2.52	0.31903	N	0.615689	P	0.49307	0.922	P	0.53224	0.721	D	0.91442	0.5174	9	.	.	.	.	10.4435	0.44479	0.0:0.4459:0.0:0.5541	.	201	Q9NZN1	IRPL1_HUMAN	V	201	ENSP00000368278:L201V;ENSP00000305200:L201V	.	L	+	1	2	IL1RAPL1	29327244	0.310000	0.24527	0.331000	0.25455	0.418000	0.31294	0.923000	0.28757	-0.693000	0.05121	-1.144000	0.01866	CTG	IL1RAPL1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000169306		0.323	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	45	0.00	0	C	NM_014271		29417323	29417323	+1	no_errors	ENST00000302196	ensembl	human	known	69_37n	missense	28	33.33	14	SNP	0.790	G
IL1RL2	8808	genome.wustl.edu	37	2	102805699	102805699	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr2:102805699C>G	ENST00000264257.2	+	3	348	c.222C>G	c.(220-222)caC>caG	p.H74Q	IL1RL2_ENST00000539491.1_Missense_Mutation_p.H74Q|IL1RL2_ENST00000481806.1_Intron|IL1RL2_ENST00000441515.2_Intron	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	74	Ig-like C2-type 1.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						CTAGAATTCACCAGGACGAGA	0.388																																						dbGAP											0													72.0	70.0	71.0					2																	102805699		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.222C>G	2.37:g.102805699C>G	ENSP00000264257:p.His74Gln		A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II,prints_IL1R_rcpt	p.H74Q	ENST00000264257.2	37	c.222	CCDS2056.1	2	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677295	0.68042	.	.	ENSG00000115598	ENST00000264257;ENST00000421464;ENST00000539491	T;T;T	0.34472	4.14;1.36;4.14	5.86	4.05	0.47172	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.335848	0.33610	N	0.004740	T	0.54224	0.1845	M	0.76328	2.33	0.37200	D	0.904313	D	0.89917	1.0	D	0.81914	0.995	T	0.59632	-0.7418	10	0.34782	T	0.22	.	8.4249	0.32723	0.0:0.827:0.0:0.173	.	74	Q9HB29	ILRL2_HUMAN	Q	74	ENSP00000264257:H74Q;ENSP00000387611:H74Q;ENSP00000442184:H74Q	ENSP00000264257:H74Q	H	+	3	2	IL1RL2	102172131	0.999000	0.42202	1.000000	0.80357	0.932000	0.56968	0.316000	0.19469	1.626000	0.50381	0.650000	0.86243	CAC	IL1RL2	-	smart_Ig_sub,pfscan_Ig-like,prints_IL1R_rcpt	ENSG00000115598		0.388	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL2	HGNC	protein_coding	OTTHUMT00000253290.1	40	0.00	0	C	NM_003854		102805699	102805699	+1	no_errors	ENST00000264257	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	1.000	G
INHBA	3624	genome.wustl.edu	37	7	41729394	41729394	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr7:41729394G>A	ENST00000242208.4	-	3	1381	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Missense_Mutation_p.R379W|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	379				RMR -> AC (in Ref. 7; CAA51163). {ECO:0000305}.	activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.R379W(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CTATGGCCCCGCATGCGGTAG	0.537										TSP Lung(11;0.080)																												dbGAP											1	Substitution - Missense(1)	large_intestine(1)											126.0	112.0	117.0					7																	41729394		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.1135C>T	7.37:g.41729394G>A	ENSP00000242208:p.Arg379Trp		Q14599	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaA,prints_Inhibin_asu	p.R379W	ENST00000242208.4	37	c.1135	CCDS5464.1	7	.	.	.	.	.	.	.	.	.	.	.	14.76	2.631060	0.46944	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	D;D	0.85339	-1.97;-1.97	5.86	2.59	0.31030	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92319	0.7563	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93414	0.6771	10	0.87932	D	0	-21.1176	15.948	0.79809	0.0:0.0:0.5124:0.4876	.	379	P08476	INHBA_HUMAN	W	379	ENSP00000242208:R379W;ENSP00000397197:R379W	ENSP00000242208:R379W	R	-	1	2	INHBA	41695919	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.507000	0.22675	0.732000	0.32470	0.591000	0.81541	CGG	INHBA	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000122641		0.537	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBA	HGNC	protein_coding	OTTHUMT00000250793.1	27	0.00	0	G			41729394	41729394	-1	no_errors	ENST00000242208	ensembl	human	known	69_37n	missense	9	74.29	26	SNP	0.995	A
KAT6A	7994	genome.wustl.edu	37	8	41790605	41790605	+	Silent	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr8:41790605G>A	ENST00000396930.3	-	18	5676	c.5133C>T	c.(5131-5133)ttC>ttT	p.F1711F	KAT6A_ENST00000406337.1_Silent_p.F1711F|KAT6A_ENST00000265713.2_Silent_p.F1711F	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1711	Interaction with PML.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GAGCTGGGGTGAAACTGTTAT	0.567																																						dbGAP											0													77.0	80.0	79.0					8																	41790605		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.5133C>T	8.37:g.41790605G>A			Q76L81	Silent	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.F1711	ENST00000396930.3	37	c.5133	CCDS6124.1	8																																																																																			KAT6A	-	NULL	ENSG00000083168		0.567	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1	25	0.00	0	G	NM_006766		41790605	41790605	-1	no_errors	ENST00000265713	ensembl	human	known	69_37n	silent	47	22.95	14	SNP	1.000	A
KBTBD3	143879	genome.wustl.edu	37	11	105929688	105929688	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:105929688C>G	ENST00000531482.2	-	1	150	c.137G>C	c.(136-138)aGa>aCa	p.R46T	KBTBD3_ENST00000526793.1_Missense_Mutation_p.R46T|KBTBD3_ENST00000531837.1_Missense_Mutation_p.R46T|KBTBD3_ENST00000534815.1_Intron			Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	42										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		ATTTTGTTCTCTAAAATTCTG	0.333																																						dbGAP											0													82.0	82.0	82.0					11																	105929688		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000531482.2:c.137G>C	11.37:g.105929688C>G	ENSP00000475836:p.Arg46Thr		Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	pfam_BACK,pfam_BTB_POZ,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R46T	ENST00000531482.2	37	c.137		11	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962793	0.92791	.	.	ENSG00000182359	ENST00000526793;ENST00000531837	T;T	0.72942	-0.7;-0.7	5.7	5.7	0.88788	BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.89646	0.6775	H	0.95679	3.705	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.984	D	0.92102	0.5689	10	0.87932	D	0	.	19.8344	0.96650	0.0:1.0:0.0:0.0	.	46;42	A8K1K0;Q8NAB2	.;KBTB3_HUMAN	T	46	ENSP00000436262:R46T;ENSP00000432163:R46T	ENSP00000436262:R46T	R	-	2	0	KBTBD3	105434898	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.426000	0.80270	2.692000	0.91855	0.655000	0.94253	AGA	KBTBD3	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,pirsf_Kelch-like_gigaxonin	ENSG00000182359		0.333	KBTBD3-006	PUTATIVE	basic|exp_conf	protein_coding	KBTBD3	HGNC	protein_coding	OTTHUMT00000388708.2	56	0.00	0	C	NM_152433		105929688	105929688	-1	no_errors	ENST00000526793	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	1.000	G
RIC1	57589	genome.wustl.edu	37	9	5763167	5763167	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr9:5763167G>C	ENST00000414202.2	+	19	2331	c.2140G>C	c.(2140-2142)Gcc>Ccc	p.A714P	KIAA1432_ENST00000251879.6_Missense_Mutation_p.A714P|KIAA1432_ENST00000449720.2_Missense_Mutation_p.A598P|KIAA1432_ENST00000381532.2_Missense_Mutation_p.A635P|KIAA1432_ENST00000418622.3_Missense_Mutation_p.A635P	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TGTTGTACTAGCCCAGTCTGT	0.468																																						dbGAP											0													104.0	83.0	90.0					9																	5763167		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000414202.2:c.2140G>C	9.37:g.5763167G>C	ENSP00000416696:p.Ala714Pro			Missense_Mutation	SNP	pfam_Ribosome_control_1,superfamily_WD40_repeat_dom	p.A635P	ENST00000414202.2	37	c.1903	CCDS34982.2	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.9|25.9	4.688616|4.688616	0.88639|0.88639	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720|ENST00000545641	.|.	.|.	.|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77718|0.77718	0.4172|0.4172	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.79784|.	0.989;0.989;0.992;0.993|.	T|T	0.75800|0.75800	-0.3190|-0.3190	9|5	0.62326|.	D|.	0.03|.	-13.8137|-13.8137	20.0079|20.0079	0.97439|0.97439	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	598;635;714;714|.	B7ZM67;B2RN24;Q4ADV7;G5E932|.	.;.;RIC1_HUMAN;.|.	P|T	714;714;635;635;598|605	.|.	ENSP00000251879:A714P|.	A|S	+|+	1|2	0|0	KIAA1432|KIAA1432	5753167|5753167	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.984000|0.984000	0.73092|0.73092	9.476000|9.476000	0.97823|0.97823	2.726000|2.726000	0.93360|0.93360	0.561000|0.561000	0.74099|0.74099	GCC|AGC	KIAA1432	-	NULL	ENSG00000107036		0.468	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1432	HGNC	protein_coding	OTTHUMT00000051636.3	62	0.00	0	G			5763167	5763167	+1	no_errors	ENST00000418622	ensembl	human	known	69_37n	missense	30	81.48	132	SNP	1.000	C
KLHDC7A	127707	genome.wustl.edu	37	1	18808277	18808277	+	Missense_Mutation	SNP	G	G	C	rs375552768		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:18808277G>C	ENST00000400664.1	+	1	854	c.802G>C	c.(802-804)Gtc>Ctc	p.V268L		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	268						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CATAGCCCGCGTCCGAATGGA	0.592																																						dbGAP											0													75.0	80.0	78.0					1																	18808277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.802G>C	1.37:g.18808277G>C	ENSP00000383505:p.Val268Leu		Q8N8W6	Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.V268L	ENST00000400664.1	37	c.802	CCDS185.2	1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.435345	0.25813	.	.	ENSG00000179023	ENST00000400664;ENST00000540290	T	0.78364	-1.17	5.02	1.79	0.24919	.	0.953767	0.08662	U	0.912351	T	0.63022	0.2476	N	0.24115	0.695	0.18873	N	0.999985	P;P	0.42735	0.788;0.788	B;B	0.35655	0.207;0.207	T	0.51395	-0.8711	10	0.72032	D	0.01	.	8.9848	0.35988	0.3342:0.0:0.6658:0.0	.	205;268	A7E2V3;Q5VTJ3	.;KLD7A_HUMAN	L	268;205	ENSP00000383505:V268L	ENSP00000383505:V268L	V	+	1	0	KLHDC7A	18680864	1.000000	0.71417	0.311000	0.25182	0.130000	0.20726	1.194000	0.32174	0.089000	0.17243	0.313000	0.20887	GTC	KLHDC7A	-	NULL	ENSG00000179023		0.592	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7A	HGNC	protein_coding	OTTHUMT00000006923.3	16	0.00	0	G	NM_152375		18808277	18808277	+1	no_errors	ENST00000400664	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	0.419	C
KRTAP10-4	386672	genome.wustl.edu	37	21	45993851	45993851	+	Silent	SNP	C	C	T	rs201895065		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr21:45993851C>T	ENST00000400374.3	+	1	246	c.216C>T	c.(214-216)tgC>tgT	p.C72C	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_5'Flank	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	72	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						CAGTGACCTGCGAGCCCAGCC	0.721																																						dbGAP											0													20.0	38.0	32.0					21																	45993851		1993	4191	6184	-	-	-	SO:0001819	synonymous_variant	0			AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.216C>T	21.37:g.45993851C>T			Q08AS0	Silent	SNP	NULL	p.C72	ENST00000400374.3	37	c.216	CCDS42957.1	21																																																																																			KRTAP10-4	-	NULL	ENSG00000215454		0.721	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-4	HGNC	protein_coding	OTTHUMT00000128045.1	9	0.00	0	C	NM_198687		45993851	45993851	+1	no_errors	ENST00000400374	ensembl	human	known	69_37n	silent	7	41.67	5	SNP	0.141	T
LOXL4	84171	genome.wustl.edu	37	10	100017441	100017441	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr10:100017441C>G	ENST00000260702.3	-	8	1376	c.1226G>C	c.(1225-1227)aGg>aCg	p.R409T	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	409	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GACATTGCACCTGACAGCAGC	0.597																																						dbGAP											0													163.0	134.0	144.0					10																	100017441		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1226G>C	10.37:g.100017441C>G	ENSP00000260702:p.Arg409Thr		Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Lysyl_oxidase,prints_Srcr_rcpt	p.R409T	ENST00000260702.3	37	c.1226	CCDS7473.1	10	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566930	0.86439	.	.	ENSG00000138131	ENST00000260702	T	0.32988	1.43	5.55	4.64	0.57946	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.090924	0.64402	D	0.000002	T	0.45538	0.1347	L	0.39147	1.195	0.53005	D	0.999961	D	0.76494	0.999	D	0.74674	0.984	T	0.35773	-0.9775	10	0.46703	T	0.11	.	14.3018	0.66357	0.0:0.9284:0.0:0.0716	.	409	Q96JB6	LOXL4_HUMAN	T	409	ENSP00000260702:R409T	ENSP00000260702:R409T	R	-	2	0	LOXL4	100007431	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	6.080000	0.71299	1.333000	0.45449	0.555000	0.69702	AGG	LOXL4	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	ENSG00000138131		0.597	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL4	HGNC	protein_coding	OTTHUMT00000049766.1	22	0.00	0	C	NM_032211		100017441	100017441	-1	no_errors	ENST00000260702	ensembl	human	known	69_37n	missense	10	66.67	20	SNP	1.000	G
MAEA	10296	genome.wustl.edu	37	4	1330721	1330721	+	Silent	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr4:1330721C>T	ENST00000303400.4	+	7	901	c.838C>T	c.(838-840)Ctg>Ttg	p.L280L	MAEA_ENST00000505177.2_Silent_p.L318L|MAEA_ENST00000505839.1_Silent_p.L232L|MAEA_ENST00000510794.1_Silent_p.L279L|MAEA_ENST00000264750.6_Silent_p.L239L|MAEA_ENST00000514708.1_Missense_Mutation_p.A213V|MAEA_ENST00000512289.1_3'UTR|MAEA_ENST00000452175.2_Silent_p.L201L	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	280					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	ACTACACCAGCTGGGAAACAA	0.602																																						dbGAP											0													117.0	98.0	104.0					4																	1330721		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.838C>T	4.37:g.1330721C>T			O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.A213V	ENST00000303400.4	37	c.638	CCDS33936.1	4	.	.	.	.	.	.	.	.	.	.	C	17.53	3.411872	0.62511	.	.	ENSG00000090316	ENST00000503653;ENST00000382947;ENST00000514708	T;T	0.52983	0.64;0.73	5.71	4.86	0.63082	.	.	.	.	.	T	0.38026	0.1025	.	.	.	0.80722	D	1	B	0.11235	0.004	B	0.10450	0.005	T	0.18304	-1.0341	8	0.46703	T	0.11	-8.9315	11.2894	0.49241	0.0:0.859:0.0:0.141	.	213	D6RIB6	.	V	254;213;213	ENSP00000421644:A254V;ENSP00000427512:A213V	ENSP00000372405:A213V	A	+	2	0	MAEA	1320721	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.138000	0.50570	2.691000	0.91804	0.563000	0.77884	GCT	MAEA	-	NULL	ENSG00000090316		0.602	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEA	HGNC	protein_coding	OTTHUMT00000359511.1	33	0.00	0	C	NM_005882		1330721	1330721	+1	no_errors	ENST00000514708	ensembl	human	known	69_37n	missense	17	30.77	8	SNP	1.000	T
MCM2	4171	genome.wustl.edu	37	3	127327260	127327260	+	Silent	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:127327260G>A	ENST00000265056.7	+	7	1381	c.1137G>A	c.(1135-1137)caG>caA	p.Q379Q		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	379					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						TCCGAATCCAGGAGAGTCCAG	0.572																																						dbGAP											0													125.0	130.0	128.0					3																	127327260		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.1137G>A	3.37:g.127327260G>A			Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_AAA-3,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,prints_MCM_2,prints_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase	p.R242K	ENST00000265056.7	37	c.725	CCDS3043.1	3	.	.	.	.	.	.	.	.	.	.	G	10.20	1.284774	0.23392	.	.	ENSG00000073111	ENST00000491422	.	.	.	5.31	3.24	0.37175	.	.	.	.	.	T	0.61800	0.2376	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59768	-0.7392	4	.	.	.	-32.233	11.2777	0.49176	0.1971:0.0:0.8029:0.0	.	.	.	.	K	242	.	.	R	+	2	0	MCM2	128809950	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.329000	0.43876	1.231000	0.43661	0.591000	0.81541	AGG	MCM2	-	superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase	ENSG00000073111		0.572	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM2	HGNC	protein_coding	OTTHUMT00000356612.1	29	0.00	0	G			127327260	127327260	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000491422	ensembl	human	novel	69_37n	missense	32	27.27	12	SNP	1.000	A
MCM3	4172	genome.wustl.edu	37	6	52138116	52138116	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr6:52138116C>G	ENST00000229854.7	-	11	1664	c.1588G>C	c.(1588-1590)Gat>Cat	p.D530H	MCM3_ENST00000476448.1_5'Flank|MCM3_ENST00000419835.2_Missense_Mutation_p.D484H|MCM3_ENST00000596288.1_Missense_Mutation_p.D575H			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	530					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					TTGGGATCATCTGTGGCCAGG	0.453																																						dbGAP											0													164.0	146.0	152.0					6																	52138116		2203	4300	6503	-	-	-	SO:0001583	missense	0			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1588G>C	6.37:g.52138116C>G	ENSP00000229854:p.Asp530His		B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_3	p.D530H	ENST00000229854.7	37	c.1588		6	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654423	0.67472	.	.	ENSG00000112118	ENST00000229854;ENST00000340349;ENST00000419835;ENST00000421471	T;T;T	0.18338	4.26;4.19;2.22	5.31	5.31	0.75309	.	0.144737	0.64402	D	0.000008	T	0.08492	0.0211	L	0.43701	1.375	0.80722	D	1	B;B	0.12013	0.005;0.003	B;B	0.17979	0.02;0.014	T	0.03728	-1.1009	10	0.45353	T	0.12	-14.451	12.4892	0.55891	0.0:0.9241:0.0:0.0759	.	484;530	B4DUQ9;P25205	.;MCM3_HUMAN	H	530;27;484;25	ENSP00000229854:D530H;ENSP00000388647:D484H;ENSP00000407651:D25H	ENSP00000229854:D530H	D	-	1	0	MCM3	52246075	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.420000	0.66441	2.759000	0.94783	0.563000	0.77884	GAT	MCM3	-	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase	ENSG00000112118		0.453	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	HGNC	protein_coding	OTTHUMT00000470784.1	49	0.00	0	C			52138116	52138116	-1	no_errors	ENST00000229854	ensembl	human	known	69_37n	missense	109	15.50	20	SNP	1.000	G
MEIS2	4212	genome.wustl.edu	37	15	37390202	37390202	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:37390202C>T	ENST00000561208.1	-	2	629	c.211G>A	c.(211-213)Gac>Aac	p.D71N	MEIS2_ENST00000424352.2_Missense_Mutation_p.D71N|MEIS2_ENST00000397620.2_5'UTR|MEIS2_ENST00000219869.9_5'UTR|MEIS2_ENST00000557796.2_Missense_Mutation_p.D58N|MEIS2_ENST00000382766.2_Missense_Mutation_p.D71N|MEIS2_ENST00000397624.3_5'UTR|MEIS2_ENST00000559085.1_Missense_Mutation_p.D58N|MEIS2_ENST00000559561.1_Missense_Mutation_p.D71N|RP11-128A17.1_ENST00000559509.1_RNA|MEIS2_ENST00000340545.5_Missense_Mutation_p.D58N|MEIS2_ENST00000338564.5_Missense_Mutation_p.D71N|MEIS2_ENST00000444725.1_Missense_Mutation_p.D71N			O14770	MEIS2_HUMAN	Meis homeobox 2	71	Required for interaction with PBX1. {ECO:0000250}.				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		TTCAAGGCGTCGTTGACAGCG	0.627																																						dbGAP											0													71.0	65.0	67.0					15																	37390202		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.211G>A	15.37:g.37390202C>T	ENSP00000453793:p.Asp71Asn		A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	pfam_Homeodomain,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.D71N	ENST00000561208.1	37	c.211	CCDS10044.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.769069	0.96914	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766;ENST00000424352;ENST00000444725;ENST00000340545;ENST00000397624	T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.58	5.51	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.57475	0.2056	M	0.69463	2.115	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.992;0.996;0.999;0.995;0.966;0.973	T	0.59188	-0.7501	10	0.49607	T	0.09	-18.9369	14.097	0.65029	0.0:0.9267:0.0:0.0733	.	58;71;71;71;71;58	Q96DI2;O14770-4;O14770;O14770-3;O14770-2;B3KP98	.;.;MEIS2_HUMAN;.;.;.	N	71;71;71;71;71;58;58	ENSP00000326296:D71N;ENSP00000341400:D71N;ENSP00000372216:D71N;ENSP00000404185:D71N;ENSP00000391887:D71N;ENSP00000339549:D58N	ENSP00000326296:D71N	D	-	1	0	MEIS2	35177494	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.387000	0.79785	1.312000	0.45043	0.655000	0.94253	GAC	MEIS2	-	NULL	ENSG00000134138		0.627	MEIS2-001	KNOWN	basic|CCDS	protein_coding	MEIS2	HGNC	protein_coding	OTTHUMT00000252003.2	18	0.00	0	C	NM_170677		37390202	37390202	-1	no_errors	ENST00000561208	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	1.000	T
KMT2A	4297	genome.wustl.edu	37	11	118344879	118344879	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:118344879C>G	ENST00000389506.5	+	3	3005	c.3005C>G	c.(3004-3006)tCc>tGc	p.S1002C	KMT2A_ENST00000354520.4_Missense_Mutation_p.S1002C|KMT2A_ENST00000534358.1_Missense_Mutation_p.S1002C			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1002					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GTTAAACATTCCACTTCCTCC	0.517																																						dbGAP											0													101.0	97.0	98.0					11																	118344879		2200	4296	6496	-	-	-	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3005C>G	11.37:g.118344879C>G	ENSP00000374157:p.Ser1002Cys		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.S1002C	ENST00000389506.5	37	c.3005	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	13.33	2.203940	0.38905	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520	D;T;D;D	0.82893	-1.66;2.12;-1.66;-1.63	5.52	5.52	0.82312	.	0.062955	0.64402	D	0.000003	D	0.84593	0.5506	N	0.19112	0.55	0.47441	D	0.999421	P;D;D	0.69078	0.641;0.981;0.997	B;P;D	0.64321	0.436;0.628;0.924	D	0.86495	0.1800	10	0.59425	D	0.04	.	18.4241	0.90604	0.0:1.0:0.0:0.0	.	1002;1002;1035	E9PQG7;Q03164;E9PR05	.;MLL1_HUMAN;.	C	1002;1035;1002;1002	ENSP00000436786:S1002C;ENSP00000432391:S1035C;ENSP00000374157:S1002C;ENSP00000346516:S1002C	ENSP00000346516:S1002C	S	+	2	0	MLL	117850089	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.205000	0.77881	2.588000	0.87417	0.591000	0.81541	TCC	MLL	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.517	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	35	0.00	0	C	NM_005933		118344879	118344879	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	missense	13	50.00	13	SNP	1.000	G
MORF4L1	10933	genome.wustl.edu	37	15	79178563	79178563	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:79178563C>G	ENST00000331268.5	+	5	557	c.353C>G	c.(352-354)gCc>gGc	p.A118G	MORF4L1_ENST00000558746.1_Missense_Mutation_p.A79G|MORF4L1_ENST00000558502.1_5'UTR|MORF4L1_ENST00000559345.1_5'UTR|MORF4L1_ENST00000561171.1_3'UTR|MORF4L1_ENST00000379535.4_Missense_Mutation_p.A104G|MORF4L1_ENST00000426013.2_Missense_Mutation_p.A79G	NM_206839.2	NP_996670.1	Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1	118					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)			breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						CTTCAAAAAGCCAATCAGTAA	0.403																																						dbGAP											0													83.0	79.0	80.0					15																	79178563		2196	4293	6489	-	-	-	SO:0001583	missense	0			AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000331268.5:c.353C>G	15.37:g.79178563C>G	ENSP00000331310:p.Ala118Gly		B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	Missense_Mutation	SNP	pfam_MRG,pfam_Tudor-knot,superfamily_Chromodomain-like,pirsf_Hist_Nua4_cplx_EAF3/MRG15_su	p.A118G	ENST00000331268.5	37	c.353	CCDS10307.1	15	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709093	0.89018	.	.	ENSG00000185787	ENST00000379535;ENST00000426013;ENST00000331268	T;T;T	0.45668	0.89;0.89;1.3	5.21	5.21	0.72293	Chromo domain-like (1);	0.000000	0.85682	D	0.000000	T	0.52468	0.1736	L	0.50333	1.59	0.80722	D	1	B;B;B;D	0.61080	0.042;0.378;0.071;0.989	B;B;B;P	0.56612	0.033;0.087;0.233;0.802	T	0.41980	-0.9478	10	0.25751	T	0.34	-0.105	17.3306	0.87262	0.0:1.0:0.0:0.0	.	79;104;79;118	A5D8W6;B3KTM8;Q9UBU8-2;Q9UBU8	.;.;.;MO4L1_HUMAN	G	104;79;118	ENSP00000368850:A104G;ENSP00000408880:A79G;ENSP00000331310:A118G	ENSP00000331310:A118G	A	+	2	0	MORF4L1	76965618	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.190000	0.77755	2.437000	0.82529	0.585000	0.79938	GCC	MORF4L1	-	superfamily_Chromodomain-like,pirsf_Hist_Nua4_cplx_EAF3/MRG15_su	ENSG00000185787		0.403	MORF4L1-001	KNOWN	basic|CCDS	protein_coding	MORF4L1	HGNC	protein_coding	OTTHUMT00000290131.4	56	0.00	0	C	NM_006791		79178563	79178563	+1	no_errors	ENST00000331268	ensembl	human	known	69_37n	missense	32	56.16	41	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9085748	9085748	+	Missense_Mutation	SNP	C	C	T	rs187896955		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr19:9085748C>T	ENST00000397910.4	-	1	6270	c.6067G>A	c.(6067-6069)Gga>Aga	p.G2023R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2023	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGCTGCTTCCAGAAGAGACT	0.468													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22887	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													120.0	115.0	117.0					19																	9085748		2000	4171	6171	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6067G>A	19.37:g.9085748C>T	ENSP00000381008:p.Gly2023Arg		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.G2023R	ENST00000397910.4	37	c.6067	CCDS54212.1	19	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	c	2.299	-0.360520	0.05103	.	.	ENSG00000181143	ENST00000397910	T	0.03607	3.87	0.235	0.235	0.15431	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	.	.	.	D	0.76494	0.999	D	0.78314	0.991	T	0.41466	-0.9507	7	0.87932	D	0	.	.	.	.	.	2023	B5ME49	.	R	2023	ENSP00000381008:G2023R	ENSP00000381008:G2023R	G	-	1	0	MUC16	8946748	0.009000	0.17119	0.142000	0.22268	0.144000	0.21451	-0.062000	0.11674	0.308000	0.22923	0.313000	0.20887	GGA	MUC16	-	NULL	ENSG00000181143		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	43	0.00	0	C	NM_024690		9085748	9085748	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	44	26.67	16	SNP	0.172	T
MYBPC1	4604	genome.wustl.edu	37	12	102056175	102056175	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr12:102056175G>C	ENST00000550270.1	+	19	1997	c.1997G>C	c.(1996-1998)tGg>tCg	p.W666S	MYBPC1_ENST00000545503.2_Missense_Mutation_p.W666S|MYBPC1_ENST00000549145.1_Missense_Mutation_p.W679S|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000536007.1_Missense_Mutation_p.W647S|MYBPC1_ENST00000551300.1_Missense_Mutation_p.W567S|MYBPC1_ENST00000441232.1_Missense_Mutation_p.W666S|MYBPC1_ENST00000360610.2_Missense_Mutation_p.W666S|MYBPC1_ENST00000361685.2_Missense_Mutation_p.W691S|MYBPC1_ENST00000547405.1_Missense_Mutation_p.W640S|MYBPC1_ENST00000361466.2_Missense_Mutation_p.W691S|MYBPC1_ENST00000553190.1_Missense_Mutation_p.W666S|MYBPC1_ENST00000392934.3_Missense_Mutation_p.W653S|MYBPC1_ENST00000541119.1_Missense_Mutation_p.W654S|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000547509.1_Missense_Mutation_p.W652S|MYBPC1_ENST00000452455.2_Missense_Mutation_p.W666S			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	666	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						AGCTCCAGGTGGATGAGGCTG	0.403																																						dbGAP											0													85.0	82.0	83.0					12																	102056175		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1997G>C	12.37:g.102056175G>C	ENSP00000449702:p.Trp666Ser		B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.W691S	ENST00000550270.1	37	c.2072	CCDS9085.1	12	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505027	0.85282	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.86	5.86	0.93980	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.48767	D	0.000169	D	0.83348	0.5235	H	0.96861	3.895	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.997;0.999;1.0;1.0;0.999	D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;0.998;0.99;0.999;0.999;1.0;0.999	D	0.87747	0.2589	10	0.87932	D	0	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	647;654;666;666;653;640;666;666;691;691	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.	S	640;666;666;666;653;652;691;679;666;691;666;647;654;691;567;666	ENSP00000448175:W640S;ENSP00000400908:W666S;ENSP00000388989:W666S;ENSP00000353822:W666S;ENSP00000376665:W653S;ENSP00000447362:W652S;ENSP00000354845:W691S;ENSP00000447660:W679S;ENSP00000447900:W666S;ENSP00000440034:W666S;ENSP00000446128:W647S;ENSP00000442847:W654S;ENSP00000354849:W691S;ENSP00000447116:W567S;ENSP00000449702:W666S	ENSP00000353822:W666S	W	+	2	0	MYBPC1	100580306	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.937000	0.99478	0.650000	0.86243	TGG	MYBPC1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196091		0.403	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1	36	0.00	0	G			102056175	102056175	+1	no_errors	ENST00000361466	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	C
MYH13	8735	genome.wustl.edu	37	17	10222306	10222306	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:10222306C>T	ENST00000418404.3	-	26	3702	c.3539G>A	c.(3538-3540)aGg>aAg	p.R1180K	MYH13_ENST00000252172.4_Missense_Mutation_p.R1180K|RP11-401O9.3_ENST00000577743.1_RNA|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1180					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTCCAGGTCCCTGCGCATTTT	0.582																																						dbGAP											0													128.0	131.0	130.0					17																	10222306		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.3539G>A	17.37:g.10222306C>T	ENSP00000404570:p.Arg1180Lys		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.R1180K	ENST00000418404.3	37	c.3539	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796730	0.90453	.	.	ENSG00000006788	ENST00000252172	T	0.76448	-1.02	4.05	3.07	0.35406	Myosin tail (1);	.	.	.	.	D	0.85124	0.5625	M	0.78456	2.415	0.29581	N	0.849138	P	0.36086	0.536	P	0.51833	0.681	T	0.82022	-0.0663	9	0.87932	D	0	.	12.0217	0.53348	0.0:0.9147:0.0:0.0853	.	1180	Q9UKX3	MYH13_HUMAN	K	1180	ENSP00000252172:R1180K	ENSP00000252172:R1180K	R	-	2	0	MYH13	10163031	0.828000	0.29307	0.998000	0.56505	0.992000	0.81027	7.582000	0.82546	1.033000	0.39918	0.591000	0.81541	AGG	MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.582	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	47	0.00	0	C	NM_003802		10222306	10222306	-1	no_errors	ENST00000252172	ensembl	human	known	69_37n	missense	16	71.43	40	SNP	1.000	T
MYO7A	4647	genome.wustl.edu	37	11	76903310	76903310	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:76903310A>G	ENST00000409709.3	+	31	4411	c.4139A>G	c.(4138-4140)tAc>tGc	p.Y1380C	MYO7A_ENST00000409619.2_Missense_Mutation_p.Y1369C|MYO7A_ENST00000458637.2_Missense_Mutation_p.Y1380C	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1380	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TTTGGGGAGTACAGGTGTGAG	0.602											OREG0021258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													114.0	127.0	123.0					11																	76903310		2191	4275	6466	-	-	-	SO:0001583	missense	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.4139A>G	11.37:g.76903310A>G	ENSP00000386331:p.Tyr1380Cys	1171	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.Y1380C	ENST00000409709.3	37	c.4139	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	A	21.2	4.113711	0.77210	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	4.83	4.83	0.62350	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.88912	0.6566	M	0.92604	3.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	D	0.91649	0.5333	10	0.87932	D	0	.	14.4085	0.67099	1.0:0.0:0.0:0.0	.	1369;1380;1380	B9A011;F8VUN5;Q13402	.;.;MYO7A_HUMAN	C	1380;1380;1369;591;1379;1349;1256;561	ENSP00000386331:Y1380C;ENSP00000392185:Y1380C;ENSP00000386635:Y1369C;ENSP00000417017:Y561C	ENSP00000345075:Y1256C	Y	+	2	0	MYO7A	76580958	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	8.953000	0.93041	1.799000	0.52666	0.472000	0.43445	TAC	MYO7A	-	superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000137474		0.602	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	28	0.00	0	A	NM_000260		76903310	76903310	+1	no_errors	ENST00000409709	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	1.000	G
NCOA1	8648	genome.wustl.edu	37	2	24991255	24991255	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr2:24991255G>A	ENST00000406961.1	+	23	4973	c.4321G>A	c.(4321-4323)Gaa>Aaa	p.E1441K	NCOA1_ENST00000405141.1_3'UTR|NCOA1_ENST00000348332.3_Missense_Mutation_p.E1441K|NCOA1_ENST00000407230.1_3'UTR|NCOA1_ENST00000395856.3_Missense_Mutation_p.E1440K|NCOA1_ENST00000288599.5_3'UTR			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1441					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTACTGACTGAATAACCACT	0.408			T	PAX3	alveolar rhadomyosarcoma																																	dbGAP		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0													45.0	51.0	49.0					2																	24991255		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.4321G>A	2.37:g.24991255G>A	ENSP00000385216:p.Glu1441Lys		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.E1441K	ENST00000406961.1	37	c.4321	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	G	18.16	3.563231	0.65538	.	.	ENSG00000084676	ENST00000406961;ENST00000348332;ENST00000395856	T;T;T	0.03607	3.87;3.87;3.87	5.79	5.79	0.91817	.	0.048935	0.85682	D	0.000000	T	0.15782	0.0380	L	0.50333	1.59	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.77557	0.99;0.978	T	0.00031	-1.2279	10	0.87932	D	0	.	19.6353	0.95728	0.0:0.0:1.0:0.0	.	1440;1441	Q15788-3;Q15788	.;NCOA1_HUMAN	K	1441;1441;1440	ENSP00000385216:E1441K;ENSP00000320940:E1441K;ENSP00000379197:E1440K	ENSP00000320940:E1441K	E	+	1	0	NCOA1	24844759	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.934000	0.92915	2.750000	0.94351	0.563000	0.77884	GAA	NCOA1	-	NULL	ENSG00000084676		0.408	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	HGNC	protein_coding	OTTHUMT00000246852.3	24	0.00	0	G	NM_147223		24991255	24991255	+1	no_errors	ENST00000348332	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	A
NDRG1	10397	genome.wustl.edu	37	8	134266813	134266813	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr8:134266813G>A	ENST00000414097.2	-	9	1430	c.563C>T	c.(562-564)cCg>cTg	p.P188L	NDRG1_ENST00000323851.7_Missense_Mutation_p.P188L|NDRG1_ENST00000522476.1_Missense_Mutation_p.P122L|NDRG1_ENST00000537882.1_Missense_Mutation_p.P107L|NDRG1_ENST00000518176.1_Intron|NDRG1_ENST00000354944.5_Missense_Mutation_p.P118L|NDRG1_ENST00000518066.1_Intron	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	188					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)		NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CACCATGTCCGGCAGAGCTTG	0.522			T	ERG	prostate																																	dbGAP		Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	0													84.0	68.0	73.0					8																	134266813		2203	4300	6503	-	-	-	SO:0001583	missense	0			X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.563C>T	8.37:g.134266813G>A	ENSP00000404854:p.Pro188Leu		B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Missense_Mutation	SNP	pfam_Ndr	p.P188L	ENST00000414097.2	37	c.563	CCDS34945.1	8	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502724	0.64298	.	.	ENSG00000104419	ENST00000323851;ENST00000354944;ENST00000414097;ENST00000537882;ENST00000535532;ENST00000522476	T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3	5.87	5.87	0.94306	.	0.046039	0.85682	D	0.000000	T	0.35248	0.0925	L	0.43757	1.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00624	-1.1639	10	0.25106	T	0.35	-16.9696	18.794	0.91987	0.0:0.0:1.0:0.0	.	188	Q92597	NDRG1_HUMAN	L	188;118;188;107;16;122	ENSP00000319977:P188L;ENSP00000347028:P118L;ENSP00000404854:P188L;ENSP00000437443:P107L;ENSP00000427894:P122L	ENSP00000319977:P188L	P	-	2	0	NDRG1	134335995	1.000000	0.71417	0.963000	0.40424	0.886000	0.51366	5.925000	0.70062	2.784000	0.95788	0.549000	0.68633	CCG	NDRG1	-	pfam_Ndr	ENSG00000104419		0.522	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDRG1	HGNC	protein_coding	OTTHUMT00000378805.1	32	0.00	0	G			134266813	134266813	-1	no_errors	ENST00000323851	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	0.981	A
NEO1	4756	genome.wustl.edu	37	15	73428353	73428353	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:73428353G>C	ENST00000339362.5	+	6	1447	c.1000G>C	c.(1000-1002)Gag>Cag	p.E334Q	NEO1_ENST00000558964.1_Missense_Mutation_p.E334Q|NEO1_ENST00000261908.6_Missense_Mutation_p.E334Q|NEO1_ENST00000560262.1_Missense_Mutation_p.E334Q			Q92859	NEO1_HUMAN	neogenin 1	334	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						AGCTCAAGCAGAGCTTACAGT	0.378																																						dbGAP											0													114.0	112.0	112.0					15																	73428353		2198	4297	6495	-	-	-	SO:0001583	missense	0			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.1000G>C	15.37:g.73428353G>C	ENSP00000341198:p.Glu334Gln		B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E334Q	ENST00000339362.5	37	c.1000	CCDS10247.1	15	.	.	.	.	.	.	.	.	.	.	G	13.35	2.211672	0.39102	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.68765	-0.35;-0.35	6.04	6.04	0.98038	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.220802	0.46442	D	0.000295	T	0.45296	0.1335	N	0.04669	-0.19	0.51767	D	0.999938	B;B;B	0.20368	0.009;0.004;0.044	B;B;B	0.24155	0.012;0.017;0.051	T	0.44544	-0.9321	10	0.08837	T	0.75	-20.4676	17.496	0.87717	0.0:0.0:1.0:0.0	.	334;334;334	B7ZKM9;B7ZKN0;Q92859	.;.;NEO1_HUMAN	Q	334;52;334	ENSP00000341198:E334Q;ENSP00000261908:E334Q	ENSP00000261908:E334Q	E	+	1	0	NEO1	71215406	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	5.850000	0.69473	2.873000	0.98535	0.561000	0.74099	GAG	NEO1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000067141		0.378	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEO1	HGNC	protein_coding	OTTHUMT00000257472.2	47	0.00	0	G	NM_002499		73428353	73428353	+1	no_errors	ENST00000261908	ensembl	human	known	69_37n	missense	27	61.43	43	SNP	1.000	C
NHP2L1	4809	genome.wustl.edu	37	22	42071108	42071108	+	Silent	SNP	C	C	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr22:42071108C>A	ENST00000401959.1	-	4	532	c.216G>T	c.(214-216)ctG>ctT	p.L72L	NHP2L1_ENST00000215956.5_Silent_p.L72L|NHP2L1_ENST00000463675.1_5'UTR|NHP2L1_ENST00000402458.1_Silent_p.L76L|NHP2L1_ENST00000355257.3_Silent_p.L72L	NM_005008.3	NP_004999.1	P55769	NH2L1_HUMAN	NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)	72					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ribosome biogenesis (GO:0042254)|RNA splicing (GO:0008380)	box C/D snoRNP complex (GO:0031428)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|lung(1)|prostate(1)	4						TGTCTTCACACAGCAGCGGCA	0.592																																						dbGAP											0													79.0	73.0	75.0					22																	42071108		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14022.1, CCDS33653.1	22q13	2009-01-06	2001-11-28		ENSG00000100138	ENSG00000100138			7819	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 15.5kDa (U4/U6.U5)"""	601304	"""non-histone chromosome protein 2 (S. cerevisiae)-like 1"", ""sperm specific antigen 1"""	SSFA1		8978773	Standard	NM_005008		Approved	SNU13, FA-1, SPAG12, SNRNP15-5, 15.5K	uc003bav.3	P55769	OTTHUMG00000151189	ENST00000401959.1:c.216G>T	22.37:g.42071108C>A				Silent	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45,pfam_RNase_P_Pop3,prints_H/ACA_rnp_Nhp2_euk,prints_Ribosomal_L7Ae/L8/Nhp2,prints_Ribosomal_L7Ae_prok	p.L72	ENST00000401959.1	37	c.216	CCDS14022.1	22																																																																																			NHP2L1	-	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45,pfam_RNase_P_Pop3,prints_Ribosomal_L7Ae/L8/Nhp2	ENSG00000100138		0.592	NHP2L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NHP2L1	HGNC	protein_coding	OTTHUMT00000321682.1	34	0.00	0	C	NM_001003796		42071108	42071108	-1	no_errors	ENST00000215956	ensembl	human	known	69_37n	silent	32	25.58	11	SNP	1.000	A
NKTR	4820	genome.wustl.edu	37	3	42678814	42678814	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:42678814A>G	ENST00000232978.8	+	13	1806	c.1618A>G	c.(1618-1620)Aag>Gag	p.K540E	RP4-613B23.1_ENST00000438017.1_RNA|RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	540	Arg/Ser-rich.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		GACTGCGTCAAAGTCCTCATC	0.433																																						dbGAP											0													94.0	101.0	99.0					3																	42678814		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.1618A>G	3.37:g.42678814A>G	ENSP00000232978:p.Lys540Glu			Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom	p.K540E	ENST00000232978.8	37	c.1618	CCDS2702.1	3	.	.	.	.	.	.	.	.	.	.	A	13.55	2.269930	0.40095	.	.	ENSG00000114857	ENST00000232978	T	0.15256	2.44	5.63	5.63	0.86233	.	0.138852	0.64402	D	0.000005	T	0.17746	0.0426	L	0.54323	1.7	0.80722	D	1	P;B	0.39480	0.675;0.376	B;B	0.32864	0.154;0.073	T	0.01925	-1.1246	10	0.41790	T	0.15	-15.7063	15.8189	0.78626	1.0:0.0:0.0:0.0	.	240;540	Q6M1B8;P30414	.;NKTR_HUMAN	E	540	ENSP00000232978:K540E	ENSP00000232978:K540E	K	+	1	0	NKTR	42653818	0.979000	0.34478	1.000000	0.80357	0.831000	0.47069	2.095000	0.41729	2.145000	0.66743	0.482000	0.46254	AAG	NKTR	-	NULL	ENSG00000114857		0.433	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	HGNC	protein_coding	OTTHUMT00000256642.2	42	0.00	0	A	NM_005385		42678814	42678814	+1	no_errors	ENST00000232978	ensembl	human	known	69_37n	missense	9	72.73	24	SNP	1.000	G
NISCH	11188	genome.wustl.edu	37	3	52521224	52521224	+	Silent	SNP	C	C	G	rs139766391		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:52521224C>G	ENST00000479054.1	+	17	1788	c.1716C>G	c.(1714-1716)gcC>gcG	p.A572A	NISCH_ENST00000345716.4_Silent_p.A572A			Q9Y2I1	NISCH_HUMAN	nischarin	572	Interaction with PAK1. {ECO:0000250}.|Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	CAGAACATGCCGAGCCGGAGG	0.652																																						dbGAP											0													85.0	73.0	77.0					3																	52521224		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.1716C>G	3.37:g.52521224C>G			C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Silent	SNP	pfam_Phox,pfam_Leu-rich_rpt,superfamily_Phox,smart_Phox,pfscan_Phox	p.A572	ENST00000479054.1	37	c.1716	CCDS33767.1	3																																																																																			NISCH	-	NULL	ENSG00000010322		0.652	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NISCH	HGNC	protein_coding	OTTHUMT00000351357.1	22	0.00	0	C	NM_007184		52521224	52521224	+1	no_errors	ENST00000345716	ensembl	human	known	69_37n	silent	6	60.00	9	SNP	0.013	G
NPEPPS	9520	genome.wustl.edu	37	17	45689957	45689957	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:45689957C>G	ENST00000322157.4	+	18	2464	c.2227C>G	c.(2227-2229)Ctg>Gtg	p.L743V	RP11-580I16.2_ENST00000582066.1_RNA|RP11-580I16.2_ENST00000582389.1_RNA|NPEPPS_ENST00000544660.1_Missense_Mutation_p.L663V|NPEPPS_ENST00000530173.1_Missense_Mutation_p.L739V	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	743					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						CTCCGCTGATCTGAGGAGTCC	0.403																																						dbGAP											0													95.0	94.0	94.0					17																	45689957		1861	4109	5970	-	-	-	SO:0001583	missense	0			Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.2227C>G	17.37:g.45689957C>G	ENSP00000320324:p.Leu743Val		B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.L743V	ENST00000322157.4	37	c.2227	CCDS45721.1	17	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537858	0.65085	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000544660	T;T;T	0.13420	2.59;2.59;2.59	5.32	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.23492	0.0568	L	0.52573	1.65	0.80722	D	1	P;B;P	0.39737	0.685;0.136;0.685	P;B;P	0.50049	0.531;0.393;0.629	T	0.01013	-1.1481	10	0.38643	T	0.18	.	14.2201	0.65820	0.0:0.9277:0.0:0.0723	.	739;426;743	E9PLK3;B7Z1H4;P55786	.;.;PSA_HUMAN	V	739;743;663	ENSP00000433287:L739V;ENSP00000320324:L743V;ENSP00000442461:L663V	ENSP00000320324:L743V	L	+	1	2	NPEPPS	43044956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.064000	0.71169	1.233000	0.43693	0.650000	0.86243	CTG	NPEPPS	-	NULL	ENSG00000141279		0.403	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPEPPS	HGNC	protein_coding	OTTHUMT00000384269.1	36	0.00	0	C	NM_006310		45689957	45689957	+1	no_errors	ENST00000322157	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	1.000	G
NUP160	23279	genome.wustl.edu	37	11	47814408	47814408	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:47814408G>A	ENST00000378460.2	-	28	3426	c.3380C>T	c.(3379-3381)gCt>gTt	p.A1127V	NUP160_ENST00000528071.1_Missense_Mutation_p.A1013V|NUP160_ENST00000530326.1_Missense_Mutation_p.A1013V	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	1127					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						ATTGAGAGCAGCCAGATAACA	0.473																																						dbGAP											0													150.0	139.0	143.0					11																	47814408		2201	4298	6499	-	-	-	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.3380C>T	11.37:g.47814408G>A	ENSP00000367721:p.Ala1127Val		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.A1127V	ENST00000378460.2	37	c.3380	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883110	0.91740	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	T;T;T	0.56941	1.0;0.49;0.43	5.44	5.44	0.79542	.	0.127219	0.52532	D	0.000074	T	0.45013	0.1321	L	0.52126	1.63	0.80722	D	1	P	0.41188	0.741	B	0.32289	0.143	T	0.41142	-0.9525	10	0.20519	T	0.43	.	18.8821	0.92360	0.0:0.0:1.0:0.0	.	1127	Q12769	NU160_HUMAN	V	1127;1013;1013	ENSP00000367721:A1127V;ENSP00000433590:A1013V;ENSP00000432367:A1013V	ENSP00000367721:A1127V	A	-	2	0	NUP160	47770984	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.434000	0.97515	2.558000	0.86282	0.650000	0.86243	GCT	NUP160	-	NULL	ENSG00000030066		0.473	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	44	0.00	0	G	NM_015231		47814408	47814408	-1	no_errors	ENST00000378460	ensembl	human	known	69_37n	missense	45	42.31	33	SNP	1.000	A
OR5M11	219487	genome.wustl.edu	37	11	56310392	56310392	+	Silent	SNP	C	C	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:56310392C>A	ENST00000528616.2	-	1	365	c.342G>T	c.(340-342)ctG>ctT	p.L114L		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						CCATTGCTGCCAGCATGTAAA	0.463																																						dbGAP											0													69.0	71.0	71.0					11																	56310392		2187	4294	6481	-	-	-	SO:0001819	synonymous_variant	0			AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.342G>T	11.37:g.56310392C>A			B2RNL5|B2RNL7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L114	ENST00000528616.2	37	c.342	CCDS53629.1	11																																																																																			OR5M11	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000255223		0.463	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M11	HGNC	protein_coding	OTTHUMT00000391608.1	33	0.00	0	C	NM_001005245		56310392	56310392	-1	no_errors	ENST00000528616	ensembl	human	known	69_37n	silent	23	39.47	15	SNP	0.812	A
PAN2	9924	genome.wustl.edu	37	12	56721845	56721845	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr12:56721845C>G	ENST00000425394.2	-	5	961	c.585G>C	c.(583-585)gaG>gaC	p.E195D	PAN2_ENST00000548043.1_Missense_Mutation_p.E195D|PAN2_ENST00000257931.5_Missense_Mutation_p.E195D|PAN2_ENST00000440411.3_Missense_Mutation_p.E195D	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	CTCCAGGCGTCTCTACTGCAT	0.522																																						dbGAP											0													88.0	87.0	88.0					12																	56721845		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.585G>C	12.37:g.56721845C>G	ENSP00000401721:p.Glu195Asp			Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19	p.E195D	ENST00000425394.2	37	c.585	CCDS44922.1	12	.	.	.	.	.	.	.	.	.	.	C	5.300	0.240700	0.10023	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043;ENST00000547572	T;T;T;T;T	0.35236	1.55;1.55;1.55;1.55;1.32	5.04	3.19	0.36642	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.132034	0.53938	D	0.000056	T	0.23727	0.0574	L	0.41236	1.265	0.27427	N	0.954123	B;B;B	0.31435	0.022;0.083;0.323	B;B;B	0.27380	0.004;0.017;0.079	T	0.16541	-1.0399	10	0.11485	T	0.65	-20.8606	9.3107	0.37903	0.0:0.7578:0.0:0.2422	.	195;195;195	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	D	195;195;195;195;56	ENSP00000401721:E195D;ENSP00000388231:E195D;ENSP00000257931:E195D;ENSP00000449861:E195D;ENSP00000449092:E56D	ENSP00000257931:E195D	E	-	3	2	PAN2	55008112	0.164000	0.22935	0.995000	0.50966	0.905000	0.53344	0.336000	0.19823	0.617000	0.30160	-0.150000	0.13652	GAG	PAN2	-	superfamily_WD40_repeat_dom	ENSG00000135473		0.522	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	HGNC	protein_coding	OTTHUMT00000409024.1	29	0.00	0	C	NM_014871		56721845	56721845	-1	no_errors	ENST00000425394	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.128	G
PCLO	27445	genome.wustl.edu	37	7	82579907	82579907	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr7:82579907C>A	ENST00000333891.9	-	6	10334	c.9997G>T	c.(9997-9999)Gag>Tag	p.E3333*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.E3333*|PCLO_ENST00000437081.1_Nonsense_Mutation_p.E53*	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATTGCCTGCTCTGTAGTGGTT	0.483																																						dbGAP											0													121.0	112.0	115.0					7																	82579907		1937	4151	6088	-	-	-	SO:0001587	stop_gained	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9997G>T	7.37:g.82579907C>A	ENSP00000334319:p.Glu3333*			Nonsense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.E3333*	ENST00000333891.9	37	c.9997	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930460	0.92389	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.2834	0.94061	0.0:1.0:0.0:0.0	.	.	.	.	X	3264;3333;3333;53	.	ENSP00000334319:E3333X	E	-	1	0	PCLO	82417843	1.000000	0.71417	0.962000	0.40283	0.969000	0.65631	5.957000	0.70323	2.634000	0.89283	0.563000	0.77884	GAG	PCLO	-	NULL	ENSG00000186472		0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	50	0.00	0	C	NM_014510		82579907	82579907	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	nonsense	35	27.08	13	SNP	0.995	A
PCLO	27445	genome.wustl.edu	37	7	82784791	82784791	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr7:82784791T>G	ENST00000333891.9	-	2	1503	c.1166A>C	c.(1165-1167)aAg>aCg	p.K389T	PCLO_ENST00000423517.2_Missense_Mutation_p.K389T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGCTAAAGCCTTTGGCCCAGG	0.592																																						dbGAP											0													69.0	69.0	69.0					7																	82784791		1974	4161	6135	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1166A>C	7.37:g.82784791T>G	ENSP00000334319:p.Lys389Thr			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.K389T	ENST00000333891.9	37	c.1166	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	0.091	-1.166964	0.01660	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.19806	2.12;2.15	3.6	3.6	0.41247	.	.	.	.	.	T	0.18425	0.0442	L	0.47190	1.495	0.39461	D	0.967564	B;B	0.30281	0.275;0.275	B;B	0.24269	0.052;0.052	T	0.10894	-1.0610	9	0.87932	D	0	.	10.8088	0.46533	0.0:0.0:0.0:1.0	.	389;389	Q9Y6V0-5;Q9Y6V0-6	.;.	T	389	ENSP00000334319:K389T;ENSP00000388393:K389T	ENSP00000334319:K389T	K	-	2	0	PCLO	82622727	0.754000	0.28360	0.006000	0.13384	0.126000	0.20510	0.458000	0.21892	1.884000	0.54569	0.533000	0.62120	AAG	PCLO	-	NULL	ENSG00000186472		0.592	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	37	0.00	0	T	NM_014510		82784791	82784791	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	44	21.43	12	SNP	0.017	G
PLD1	5337	genome.wustl.edu	37	3	171320875	171320875	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:171320875C>G	ENST00000351298.4	-	27	3344	c.3218G>C	c.(3217-3219)tGg>tCg	p.W1073S	PLD1_ENST00000342215.6_3'UTR|PLD1_ENST00000356327.5_Missense_Mutation_p.W1035S	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	1073					chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	CTCTTAAGTCCAAACCTCCAT	0.488																																					NSCLC(149;2174 3517 34058)	dbGAP											0													77.0	77.0	77.0					3																	171320875		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.3218G>C	3.37:g.171320875C>G	ENSP00000342793:p.Trp1073Ser			Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.W1073S	ENST00000351298.4	37	c.3218	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	C	26.9	4.778138	0.90195	.	.	ENSG00000075651	ENST00000356327;ENST00000351298	T;T	0.07688	3.19;3.17	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	M	0.89287	3.02	0.80722	D	1	D;D	0.76494	0.993;0.999	D;D	0.77557	0.959;0.99	T	0.27157	-1.0082	10	0.87932	D	0	-9.5845	20.6439	0.99570	0.0:1.0:0.0:0.0	.	1058;1073	Q59EA4;Q13393	.;PLD1_HUMAN	S	1035;1073	ENSP00000348681:W1035S;ENSP00000342793:W1073S	ENSP00000342793:W1073S	W	-	2	0	PLD1	172803569	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.792000	0.85828	2.890000	0.99128	0.650000	0.86243	TGG	PLD1	-	pirsf_PLipase_D_euk	ENSG00000075651		0.488	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	33	0.00	0	C	NM_002662		171320875	171320875	-1	no_errors	ENST00000351298	ensembl	human	known	69_37n	missense	66	25.00	22	SNP	1.000	G
POLR1D	51082	genome.wustl.edu	37	13	28239878	28239878	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr13:28239878A>C	ENST00000399697.3	+	3	275	c.157A>C	c.(157-159)Aac>Cac	p.N53H	POLR1D_ENST00000465887.1_3'UTR	NM_001206559.1|NM_152705.2	NP_001193488.1|NP_689918.1	Q9Y2S0	RPAC2_HUMAN	polymerase (RNA) I polypeptide D, 16kDa	0					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			endometrium(1)|large_intestine(1)|lung(4)|stomach(2)	8		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0758)|OV - Ovarian serous cystadenocarcinoma(117;0.1)|Epithelial(112;0.213)		CACAATTAAAAACACATTGCC	0.418																																						dbGAP											0													93.0	89.0	90.0					13																	28239878		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077044, BC018528	CCDS9324.1, CCDS9325.1, CCDS73555.1	13q12.2	2013-01-21			ENSG00000186184	ENSG00000186184		"""RNA polymerase subunits"""	20422	protein-coding gene	gene with protein product		613715				11042152, 12391170	Standard	NM_015972		Approved	RPAC2, RPA16, RPO1-3, RPA9, MGC9850	uc001urp.3	Q9Y2S0	OTTHUMG00000016635	ENST00000399697.3:c.157A>C	13.37:g.28239878A>C	ENSP00000382604:p.Asn53His		Q5TBX2|Q96BR3	Missense_Mutation	SNP	NULL	p.N53H	ENST00000399697.3	37	c.157	CCDS9324.1	13	.	.	.	.	.	.	.	.	.	.	A	25.5	4.645066	0.87859	.	.	ENSG00000186184	ENST00000399697	.	.	.	6.11	6.11	0.99139	.	0.211680	0.39274	U	0.001413	T	0.80665	0.4666	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.82906	-0.0225	8	0.72032	D	0.01	.	16.7021	0.85357	1.0:0.0:0.0:0.0	.	53	Q9Y2S0-2	.	H	53	.	ENSP00000382604:N53H	N	+	1	0	POLR1D	27137878	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.414000	0.73318	2.343000	0.79666	0.533000	0.62120	AAC	POLR1D	-	NULL	ENSG00000186184		0.418	POLR1D-004	NOVEL	basic|appris_candidate|CCDS	protein_coding	POLR1D	HGNC	protein_coding	OTTHUMT00000044306.1	43	0.00	0	A	NM_015972, NM_152705		28239878	28239878	+1	no_errors	ENST00000399697	ensembl	human	novel	69_37n	missense	67	19.28	16	SNP	1.000	C
POLR1D	51082	genome.wustl.edu	37	13	28239900	28239900	+	Frame_Shift_Del	DEL	A	A	-			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr13:28239900delA	ENST00000399697.3	+	3	297	c.179delA	c.(178-180)gagfs	p.E60fs	POLR1D_ENST00000465887.1_3'UTR	NM_001206559.1|NM_152705.2	NP_001193488.1|NP_689918.1	Q9Y2S0	RPAC2_HUMAN	polymerase (RNA) I polypeptide D, 16kDa	0					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			endometrium(1)|large_intestine(1)|lung(4)|stomach(2)	8		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0758)|OV - Ovarian serous cystadenocarcinoma(117;0.1)|Epithelial(112;0.213)		TCTCATAAAGAGCAAGACCAT	0.438																																						dbGAP											0													101.0	98.0	99.0					13																	28239900		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF077044, BC018528	CCDS9324.1, CCDS9325.1, CCDS73555.1	13q12.2	2013-01-21			ENSG00000186184	ENSG00000186184		"""RNA polymerase subunits"""	20422	protein-coding gene	gene with protein product		613715				11042152, 12391170	Standard	NM_015972		Approved	RPAC2, RPA16, RPO1-3, RPA9, MGC9850	uc001urp.3	Q9Y2S0	OTTHUMG00000016635	ENST00000399697.3:c.179delA	13.37:g.28239900delA	ENSP00000382604:p.Glu60fs		Q5TBX2|Q96BR3	Frame_Shift_Del	DEL	NULL	p.E60fs	ENST00000399697.3	37	c.179	CCDS9324.1	13																																																																																			POLR1D	-	NULL	ENSG00000186184		0.438	POLR1D-004	NOVEL	basic|appris_candidate|CCDS	protein_coding	POLR1D	HGNC	protein_coding	OTTHUMT00000044306.1	47	0.00	0	A	NM_015972, NM_152705		28239900	28239900	+1	no_errors	ENST00000399697	ensembl	human	novel	69_37n	frame_shift_del	68	21.59	19	DEL	1.000	-
PRG4	10216	genome.wustl.edu	37	1	186266033	186266033	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:186266033A>C	ENST00000445192.2	+	2	71	c.26A>C	c.(25-27)tAc>tCc	p.Y9S	PRG4_ENST00000367486.3_Missense_Mutation_p.Y9S|PRG4_ENST00000367485.4_Missense_Mutation_p.Y9S|PRG4_ENST00000367484.3_Missense_Mutation_p.Y9S|PRG4_ENST00000367483.4_Missense_Mutation_p.Y9S	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	9					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTTCCCATTTACCTGTTGTTG	0.368																																						dbGAP											0													210.0	160.0	177.0					1																	186266033		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.26A>C	1.37:g.186266033A>C	ENSP00000399679:p.Tyr9Ser		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Somatomedin_B_dom,smart_Hemopexin/matrixin_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.Y9S	ENST00000445192.2	37	c.26	CCDS1369.1	1	.	.	.	.	.	.	.	.	.	.	A	5.419	0.262550	0.10294	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000533951;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T;T	0.41400	3.54;3.68;1.0;3.64;3.56;3.67	5.8	2.17	0.27698	.	0.974748	0.08342	U	0.960721	T	0.33118	0.0852	L	0.54323	1.7	0.09310	N	1	P;P;P;P	0.47910	0.902;0.763;0.651;0.763	B;B;B;B	0.39027	0.288;0.288;0.15;0.288	T	0.16600	-1.0397	10	0.27082	T	0.32	3.0252	4.2424	0.10654	0.7005:0.0:0.1438:0.1557	.	9;9;9;9	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	S	9	ENSP00000356456:Y9S;ENSP00000356454:Y9S;ENSP00000431330:Y9S;ENSP00000356453:Y9S;ENSP00000356455:Y9S;ENSP00000399679:Y9S	ENSP00000356452:Y9S	Y	+	2	0	PRG4	184532656	0.000000	0.05858	0.048000	0.18961	0.301000	0.27625	0.254000	0.18314	0.120000	0.18254	0.477000	0.44152	TAC	PRG4	-	NULL	ENSG00000116690		0.368	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	55	0.00	0	A	NM_005807		186266033	186266033	+1	no_errors	ENST00000445192	ensembl	human	known	69_37n	missense	94	21.01	25	SNP	0.049	C
PRR14L	253143	genome.wustl.edu	37	22	32109100	32109100	+	Silent	SNP	T	T	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr22:32109100T>G	ENST00000327423.6	-	4	4914	c.4725A>C	c.(4723-4725)cgA>cgC	p.R1575R	PRR14L_ENST00000397493.2_Silent_p.R1575R|PRR14L_ENST00000434485.1_Silent_p.R1575R	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1575										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						CAGGTTCTAATCGTGTAGGTG	0.448											OREG0003533	type=REGULATORY REGION|Gene=BC040859|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													37.0	36.0	36.0					22																	32109100		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.4725A>C	22.37:g.32109100T>G		829	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Silent	SNP	NULL	p.R1575	ENST00000327423.6	37	c.4725	CCDS13900.2	22																																																																																			PRR14L	-	NULL	ENSG00000183530		0.448	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	HGNC	protein_coding	OTTHUMT00000074993.2	35	0.00	0	T	NM_173566		32109100	32109100	-1	no_errors	ENST00000397493	ensembl	human	known	69_37n	silent	43	12.24	6	SNP	0.000	G
RAD21L1	642636	genome.wustl.edu	37	20	1234974	1234974	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr20:1234974G>A	ENST00000409241.1	+	14	1637	c.1544G>A	c.(1543-1545)cGa>cAa	p.R515Q	RAD21L1_ENST00000402452.1_Intron|RAD21L1_ENST00000381882.2_Intron	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	515					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						AATAGTGACCGAAAACAAGCA	0.393																																						dbGAP											0													68.0	58.0	61.0					20																	1234974		692	1591	2283	-	-	-	SO:0001583	missense	0			AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.1544G>A	20.37:g.1234974G>A	ENSP00000386414:p.Arg515Gln		B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.R515Q	ENST00000409241.1	37	c.1544	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141106	0.37825	.	.	ENSG00000244588	ENST00000409241	D	0.86865	-2.18	4.92	2.79	0.32731	Rad21/Rec8-like protein, C-terminal (1);Rad21/Rec8-like protein, C-terminal, eukaryotic (1);	.	.	.	.	D	0.85212	0.5645	L	0.48362	1.52	0.80722	D	1	D	0.54047	0.964	P	0.49387	0.609	D	0.84939	0.0864	9	0.66056	D	0.02	.	9.4844	0.38919	0.0913:0.1521:0.7566:0.0	.	515	Q9H4I0	RD21L_HUMAN	Q	515	ENSP00000386414:R515Q	ENSP00000386414:R515Q	R	+	2	0	RAD21L1	1182974	1.000000	0.71417	0.998000	0.56505	0.776000	0.43924	3.336000	0.52113	1.256000	0.44068	0.655000	0.94253	CGA	RAD21L1	-	pfam_Rad21/Rec8_C_eu	ENSG00000244588		0.393	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	HGNC	protein_coding	OTTHUMT00000334022.1	38	0.00	0	G			1234974	1234974	+1	no_errors	ENST00000409241	ensembl	human	known	69_37n	missense	15	68.75	33	SNP	0.993	A
RMI1	80010	genome.wustl.edu	37	9	86616601	86616601	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr9:86616601G>A	ENST00000325875.3	+	3	1032	c.700G>A	c.(700-702)Gat>Aat	p.D234N		NM_024945.2	NP_079221.2	Q9H9A7	RMI1_HUMAN	RecQ mediated genome instability 1	234					DNA replication (GO:0006260)|glucose homeostasis (GO:0042593)|multicellular organism growth (GO:0035264)|reduction of food intake in response to dietary excess (GO:0002023)|response to glucose (GO:0009749)	nucleus (GO:0005634)				biliary_tract(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						CAGAGTTACAGATGTTCTAGA	0.383																																						dbGAP											0													105.0	105.0	105.0					9																	86616601		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK022950	CCDS6669.1	9q22.1	2013-06-10	2013-06-10	2006-06-12	ENSG00000178966	ENSG00000178966			25764	protein-coding gene	gene with protein product	"""BLM-Associated Polypeptide, 75 kDa"""	610404	"""chromosome 9 open reading frame 76"", ""RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae)"""	C9orf76		15775963, 20826341	Standard	NM_024945		Approved	FLJ12888, BLAP75	uc004anq.4	Q9H9A7	OTTHUMG00000020113	ENST00000325875.3:c.700G>A	9.37:g.86616601G>A	ENSP00000317039:p.Asp234Asn		Q05BX1|Q05CW3|Q5SQG8|Q5SQG9|Q6P1Q4|Q6PI89|Q7Z6L6	Missense_Mutation	SNP	pfam_DUF1767	p.D234N	ENST00000325875.3	37	c.700	CCDS6669.1	9	.	.	.	.	.	.	.	.	.	.	G	15.32	2.797962	0.50208	.	.	ENSG00000178966	ENST00000445877;ENST00000325875	T;T	0.50548	0.74;1.33	5.62	4.72	0.59763	.	0.719686	0.12940	N	0.426638	T	0.47801	0.1465	M	0.62723	1.935	0.09310	N	0.999999	P	0.43094	0.799	B	0.40901	0.343	T	0.35425	-0.9789	10	0.22706	T	0.39	-14.2798	14.5886	0.68347	0.0701:0.0:0.9299:0.0	.	234	Q9H9A7	RMI1_HUMAN	N	234	ENSP00000402433:D234N;ENSP00000317039:D234N	ENSP00000317039:D234N	D	+	1	0	RMI1	85806421	0.997000	0.39634	0.871000	0.34182	0.961000	0.63080	3.425000	0.52771	1.505000	0.48720	0.655000	0.94253	GAT	RMI1	-	NULL	ENSG00000178966		0.383	RMI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RMI1	HGNC	protein_coding	OTTHUMT00000052870.1	36	0.00	0	G	NM_024945		86616601	86616601	+1	no_errors	ENST00000325875	ensembl	human	known	69_37n	missense	38	22.45	11	SNP	0.275	A
RNF17	56163	genome.wustl.edu	37	13	25428135	25428135	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr13:25428135A>G	ENST00000255324.5	+	25	3515	c.3463A>G	c.(3463-3465)Aaa>Gaa	p.K1155E	RNF17_ENST00000381921.1_Missense_Mutation_p.K1155E|RNF17_ENST00000339524.3_Missense_Mutation_p.K207E	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1155					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CAGTGAACAGAAAGTGTCTGA	0.403																																						dbGAP											0													85.0	87.0	86.0					13																	25428135		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3463A>G	13.37:g.25428135A>G	ENSP00000255324:p.Lys1155Glu		Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.K1155E	ENST00000255324.5	37	c.3463	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	A	4.279	0.050962	0.08243	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120;ENST00000339524	T;T;T;T	0.22945	3.52;3.52;2.74;1.93	4.95	2.5	0.30297	.	0.423845	0.22416	N	0.060356	T	0.18551	0.0445	L	0.54323	1.7	0.09310	N	1	P;P;B;P	0.48694	0.914;0.732;0.002;0.732	B;B;B;B	0.40901	0.283;0.343;0.006;0.185	T	0.13388	-1.0511	10	0.08599	T	0.76	-3.2494	6.7223	0.23336	0.7294:0.0:0.2706:0.0	.	1151;207;1155;1155	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	E	1155;1155;1014;479;207	ENSP00000255324:K1155E;ENSP00000371346:K1155E;ENSP00000388892:K479E;ENSP00000344776:K207E	ENSP00000255324:K1155E	K	+	1	0	RNF17	24326135	0.002000	0.14202	0.050000	0.19076	0.016000	0.09150	1.679000	0.37597	0.458000	0.26988	0.477000	0.44152	AAA	RNF17	-	NULL	ENSG00000132972		0.403	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	33	0.00	0	A	NM_031994		25428135	25428135	+1	no_errors	ENST00000255324	ensembl	human	known	69_37n	missense	29	36.96	17	SNP	0.075	G
ROBO1	6091	genome.wustl.edu	37	3	78656060	78656060	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr3:78656060C>G	ENST00000464233.1	-	29	4680	c.4567G>C	c.(4567-4569)Gac>Cac	p.D1523H	ROBO1_ENST00000436010.2_Missense_Mutation_p.D1484H|ROBO1_ENST00000495273.1_Missense_Mutation_p.D1478H|ROBO1_ENST00000467549.1_Missense_Mutation_p.D1423H|ROBO1_ENST00000466906.1_5'UTR	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1523					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CCTTTTCTGTCTGATGATCTG	0.468																																						dbGAP											0													384.0	365.0	371.0					3																	78656060		2022	4200	6222	-	-	-	SO:0001583	missense	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4567G>C	3.37:g.78656060C>G	ENSP00000420321:p.Asp1523His		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D1523H	ENST00000464233.1	37	c.4567	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807834	0.50421	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.61274	0.16;0.14;0.14;0.12	5.23	4.35	0.52113	.	0.217647	0.47455	D	0.000224	T	0.45836	0.1362	N	0.19112	0.55	0.37200	D	0.904324	P;B;B;B;B	0.35656	0.514;0.291;0.412;0.231;0.415	B;B;B;B;B	0.41332	0.354;0.087;0.188;0.17;0.247	T	0.49698	-0.8912	9	.	.	.	.	12.9596	0.58451	0.0:0.9218:0.0:0.0782	.	1487;1523;1478;1423;1484	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	H	1484;1478;1523;1478;1423;1527	ENSP00000406043:D1484H;ENSP00000420321:D1523H;ENSP00000420637:D1478H;ENSP00000417992:D1423H	.	D	-	1	0	ROBO1	78738750	1.000000	0.71417	0.996000	0.52242	0.935000	0.57460	5.732000	0.68563	1.336000	0.45506	0.491000	0.48974	GAC	ROBO1	-	NULL	ENSG00000169855		0.468	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	74	0.00	0	C	NM_002941		78656060	78656060	-1	no_errors	ENST00000464233	ensembl	human	known	69_37n	missense	68	23.60	21	SNP	1.000	G
RPL18A	6142	genome.wustl.edu	37	19	17972952	17972952	+	Missense_Mutation	SNP	G	G	A	rs565769311		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr19:17972952G>A	ENST00000222247.5	+	3	329	c.248G>A	c.(247-249)cGc>cAc	p.R83H	RPL18A_ENST00000600147.1_Missense_Mutation_p.R83H|SNORA68_ENST00000384437.1_RNA|RPL18A_ENST00000599870.1_Missense_Mutation_p.R54H|RPL18A_ENST00000599898.1_Missense_Mutation_p.R44H	NM_000980.3	NP_000971.1	Q02543	RL18A_HUMAN	ribosomal protein L18a	83				R -> S (in Ref. 2; CAA56788). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(1)	5						ATCTGGCTGCGCTATGACTCC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17756	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													50.0	53.0	52.0					19																	17972952		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB007175	CCDS12367.1	19p13.11	2011-04-06			ENSG00000105640	ENSG00000105640		"""L ribosomal proteins"""	10311	protein-coding gene	gene with protein product	"""60S ribosomal protein L18a"", ""ribosomal protein L18a-like protein"""	604178				9582194	Standard	NM_000980		Approved	L18A	uc002nhp.3	Q02543		ENST00000222247.5:c.248G>A	19.37:g.17972952G>A	ENSP00000222247:p.Arg83His			Missense_Mutation	SNP	pfam_Ribosomal_L18a/LX	p.R83H	ENST00000222247.5	37	c.248	CCDS12367.1	19	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005845	0.35415	.	.	ENSG00000105640	ENST00000420197;ENST00000222247	.	.	.	4.19	3.15	0.36227	Ribosomal protein L18a/LX (1);	0.055705	0.64402	D	0.000001	T	0.65481	0.2695	M	0.94101	3.495	0.80722	D	1	P	0.39782	0.688	B	0.31390	0.129	T	0.71649	-0.4529	9	0.66056	D	0.02	.	9.9959	0.41898	0.1021:0.0:0.8979:0.0	.	83	Q02543	RL18A_HUMAN	H	83	.	ENSP00000222247:R83H	R	+	2	0	RPL18A	17833952	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	9.577000	0.98196	0.902000	0.36520	-0.251000	0.11542	CGC	RPL18A	-	pfam_Ribosomal_L18a/LX	ENSG00000105640		0.627	RPL18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL18A	HGNC	protein_coding	OTTHUMT00000466679.1	23	0.00	0	G	NM_000980		17972952	17972952	+1	no_errors	ENST00000222247	ensembl	human	known	69_37n	missense	21	50.00	21	SNP	1.000	A
RPL3	6122	genome.wustl.edu	37	22	39711522	39711522	+	Silent	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr22:39711522C>G	ENST00000216146.4	-	5	713	c.540G>C	c.(538-540)ctG>ctC	p.L180L	RPL3_ENST00000401609.1_Silent_p.L128L|SNORD83B_ENST00000386745.1_RNA|SNORD83A_ENST00000386747.1_RNA|RPL3_ENST00000465618.1_5'UTR	NM_000967.3|NM_001033853.1	NP_000958.1|NP_001029025.1	P39023	RL3_HUMAN	ribosomal protein L3	180					cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(4)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Melanoma(58;0.04)				Homoharringtonine(DB04865)	GGATCTCCATCAGGTGGGCCT	0.612																																						dbGAP											0													51.0	48.0	49.0					22																	39711522		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007166	CCDS13988.1	22q13	2011-04-06			ENSG00000100316	ENSG00000100316		"""L ribosomal proteins"""	10332	protein-coding gene	gene with protein product		604163				2891103, 9582194	Standard	NM_000967		Approved	L3	uc003axi.3	P39023	OTTHUMG00000151079	ENST00000216146.4:c.540G>C	22.37:g.39711522C>G			B2RDV9|Q15548|Q5I0G0	Missense_Mutation	SNP	pfam_Ribosomal_L3,superfamily_Transl_elong_init/rib_B-barrel	p.D212H	ENST00000216146.4	37	c.634	CCDS13988.1	22	.	.	.	.	.	.	.	.	.	.	C	10.72	1.429514	0.25726	.	.	ENSG00000100316	ENST00000427905	.	.	.	5.47	0.575	0.17374	.	.	.	.	.	T	0.72724	0.3496	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74968	-0.3483	4	.	.	.	.	19.5838	0.95484	0.0:0.2764:0.7236:0.0	.	.	.	.	H	212	.	.	D	-	1	0	RPL3	38041468	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.426000	0.34870	0.249000	0.21456	0.462000	0.41574	GAT	RPL3	-	pfam_Ribosomal_L3,superfamily_Transl_elong_init/rib_B-barrel	ENSG00000100316		0.612	RPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL3	HGNC	protein_coding	OTTHUMT00000321196.1	26	0.00	0	C	NM_000967		39711522	39711522	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427905	ensembl	human	putative	69_37n	missense	28	31.71	13	SNP	1.000	G
RREB1	6239	genome.wustl.edu	37	6	7248826	7248826	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr6:7248826G>C	ENST00000349384.6	+	12	5003	c.4689G>C	c.(4687-4689)caG>caC	p.Q1563H	RREB1_ENST00000379933.3_Missense_Mutation_p.Q1563H|RREB1_ENST00000334984.6_Missense_Mutation_p.Q1352H|RREB1_ENST00000379938.2_Missense_Mutation_p.Q1618H	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1563					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GGATCCACCAGAAAGCCAGGC	0.577																																						dbGAP											0													110.0	92.0	98.0					6																	7248826		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.4689G>C	6.37:g.7248826G>C	ENSP00000305560:p.Gln1563His		A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q1618H	ENST00000349384.6	37	c.4854	CCDS34336.1	6	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477281	0.63849	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.12672	3.42;3.42;3.42;2.66	5.7	4.79	0.61399	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000020	T	0.23289	0.0563	M	0.69823	2.125	0.28277	N	0.924163	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.80764	0.987;0.98;0.994	T	0.07927	-1.0747	10	0.87932	D	0	-45.8471	13.2364	0.59971	0.0801:0.0:0.9199:0.0	.	1352;1563;1618	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	H	1563;1618;1563;1352	ENSP00000369265:Q1563H;ENSP00000369270:Q1618H;ENSP00000305560:Q1563H;ENSP00000335574:Q1352H	ENSP00000335574:Q1352H	Q	+	3	2	RREB1	7193825	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.915000	0.75770	1.324000	0.45282	0.655000	0.94253	CAG	RREB1	-	pfscan_Znf_C2H2	ENSG00000124782		0.577	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	HGNC	protein_coding	OTTHUMT00000352985.1	24	0.00	0	G			7248826	7248826	+1	no_errors	ENST00000379938	ensembl	human	known	69_37n	missense	83	16.16	16	SNP	1.000	C
RTN1	6252	genome.wustl.edu	37	14	60212735	60212737	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr14:60212735_60212737delCTC	ENST00000267484.5	-	2	1039_1041	c.704_706delGAG	c.(703-708)ggagtc>gtc	p.G235del		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	235					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GGTTCACGGACTCCTTCAGGTTT	0.438																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.704_706delGAG	14.37:g.60212735_60212737delCTC	ENSP00000267484:p.Gly235del		Q16800|Q16801|Q5BKZ4|Q9BQ59	In_Frame_Del	DEL	pfam_Reticulon,pfscan_Reticulon	p.G235in_frame_del	ENST00000267484.5	37	c.706_704	CCDS9740.1	14																																																																																			RTN1	-	NULL	ENSG00000139970		0.438	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2	62	0.00	0	CTC			60212735	60212737	-1	no_errors	ENST00000267484	ensembl	human	known	69_37n	in_frame_del	43	32.31	21	DEL	0.000:0.000:0.000	-
SCMH1	22955	genome.wustl.edu	37	1	41499688	41499688	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:41499688T>C	ENST00000326197.7	-	13	1980	c.1681A>G	c.(1681-1683)Atg>Gtg	p.M561V	SCMH1_ENST00000472037.1_5'UTR|SCMH1_ENST00000397174.2_Intron|SCMH1_ENST00000402904.2_Missense_Mutation_p.M561V|SCMH1_ENST00000372597.1_Intron|SCMH1_ENST00000456518.2_Intron|SCMH1_ENST00000361191.5_Intron|SCMH1_ENST00000337495.5_Intron|SCMH1_ENST00000372595.1_Missense_Mutation_p.M500V|SCMH1_ENST00000361705.3_Intron|SCMH1_ENST00000397171.2_Intron|SCMH1_ENST00000372596.1_Intron					sex comb on midleg homolog 1 (Drosophila)											breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				aatgattccatatcccttctt	0.418																																						dbGAP											0													135.0	123.0	127.0					1																	41499688		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.1681A>G	1.37:g.41499688T>C	ENSP00000318094:p.Met561Val			Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.M561V	ENST00000326197.7	37	c.1681	CCDS30688.1	1	.	.	.	.	.	.	.	.	.	.	T	9.518	1.107597	0.20714	.	.	ENSG00000010803	ENST00000402904;ENST00000372595;ENST00000326197	T;T;T	0.16073	2.37;2.37;2.37	2.37	0.739	0.18324	.	3.708760	0.00846	N	0.001796	T	0.07908	0.0198	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32134	-0.9918	10	0.25106	T	0.35	.	3.6873	0.08332	0.0:0.3458:0.0:0.6542	.	561	Q96GD3	SCMH1_HUMAN	V	561;500;561	ENSP00000386079:M561V;ENSP00000361676:M500V;ENSP00000318094:M561V	ENSP00000318094:M561V	M	-	1	0	SCMH1	41272275	0.714000	0.27936	0.993000	0.49108	0.930000	0.56654	-0.142000	0.10311	0.176000	0.19873	0.379000	0.24179	ATG	SCMH1	-	NULL	ENSG00000010803		0.418	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SCMH1	HGNC	protein_coding	OTTHUMT00000015656.1	49	0.00	0	T			41499688	41499688	-1	no_errors	ENST00000326197	ensembl	human	known	69_37n	missense	109	18.05	24	SNP	0.996	C
SERPINB1	1992	genome.wustl.edu	37	6	2840702	2840702	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr6:2840702G>C	ENST00000380739.5	-	2	321	c.119C>G	c.(118-120)gCc>gGc	p.A40G	SERPINB1_ENST00000476896.1_5'UTR|SERPINB1_ENST00000537185.1_5'UTR	NM_030666.3	NP_109591.1	P30740	ILEU_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 1	40					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|ovary(2)	13	Ovarian(93;0.0412)			OV - Ovarian serous cystadenocarcinoma(45;0.0717)		AAAAACCATGGCCATAGCAGA	0.512																																						dbGAP											0													84.0	80.0	82.0					6																	2840702		2203	4300	6503	-	-	-	SO:0001583	missense	0			M93056	CCDS4477.1	6p25.2	2014-02-18	2005-08-18		ENSG00000021355	ENSG00000021355		"""Serine (or cysteine) peptidase inhibitors"""	3311	protein-coding gene	gene with protein product		130135	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1"""	ELANH2		1376927, 24172014	Standard	NM_030666		Approved	EI, PI2, anti-elastase	uc003mub.4	P30740	OTTHUMG00000014124	ENST00000380739.5:c.119C>G	6.37:g.2840702G>C	ENSP00000370115:p.Ala40Gly		A8K5L2|B4DNT0|Q53FB9|Q5W0E1|Q9UDF8	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.A40G	ENST00000380739.5	37	c.119	CCDS4477.1	6	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072988	0.55646	.	.	ENSG00000021355	ENST00000380739;ENST00000542771	D	0.85339	-1.97	5.06	3.2	0.36748	Serpin domain (3);	0.153499	0.64402	D	0.000017	T	0.76807	0.4039	L	0.60012	1.86	0.80722	D	1	B	0.19073	0.033	B	0.28232	0.087	T	0.74937	-0.3494	10	0.87932	D	0	.	14.641	0.68726	0.0:0.2643:0.7357:0.0	.	40	P30740	ILEU_HUMAN	G	40;2	ENSP00000370115:A40G	ENSP00000370115:A40G	A	-	2	0	SERPINB1	2785701	1.000000	0.71417	0.997000	0.53966	0.877000	0.50540	5.952000	0.70282	0.597000	0.29811	0.561000	0.74099	GCC	SERPINB1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000021355		0.512	SERPINB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB1	HGNC	protein_coding	OTTHUMT00000039637.1	26	0.00	0	G			2840702	2840702	-1	no_errors	ENST00000380739	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	1.000	C
SH3GL3	6457	genome.wustl.edu	37	15	84241415	84241415	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:84241415C>T	ENST00000427482.2	+	5	736	c.430C>T	c.(430-432)Cag>Tag	p.Q144*	SH3GL3_ENST00000535412.1_Nonsense_Mutation_p.Q144*|SH3GL3_ENST00000434347.1_Nonsense_Mutation_p.Q152*|SH3GL3_ENST00000324537.5_Nonsense_Mutation_p.Q152*	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	144	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						TGATCCACTTCAGTTACTACA	0.333																																						dbGAP											0													85.0	77.0	80.0					15																	84241415		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.430C>T	15.37:g.84241415C>T	ENSP00000391372:p.Gln144*		O43553|O43554	Nonsense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_SH3_domain	p.Q152*	ENST00000427482.2	37	c.454	CCDS10325.2	15	.	.	.	.	.	.	.	.	.	.	C	42	9.223020	0.99105	.	.	ENSG00000140600	ENST00000427482;ENST00000535412;ENST00000324537;ENST00000434347	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-21.7067	18.6219	0.91323	0.0:1.0:0.0:0.0	.	.	.	.	X	144;144;152;152	.	ENSP00000320092:Q152X	Q	+	1	0	SH3GL3	82032419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.400000	0.79949	2.715000	0.92844	0.585000	0.79938	CAG	SH3GL3	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000140600		0.333	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL3	HGNC	protein_coding	OTTHUMT00000347797.1	35	0.00	0	C	NM_003027		84241415	84241415	+1	no_errors	ENST00000324537	ensembl	human	known	69_37n	nonsense	37	17.78	8	SNP	1.000	T
SLC1A7	6512	genome.wustl.edu	37	1	53556433	53556433	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:53556433G>C	ENST00000371494.4	-	8	1204	c.1077C>G	c.(1075-1077)aaC>aaG	p.N359K	SLC1A7_ENST00000488036.1_5'UTR	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	359					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		GGTCGATGTGGTTGTTCTCCA	0.642																																					NSCLC(128;80 1811 21245 38490 51715)	dbGAP											0													108.0	79.0	89.0					1																	53556433		2203	4300	6503	-	-	-	SO:0001583	missense	0			U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.1077C>G	1.37:g.53556433G>C	ENSP00000360549:p.Asn359Lys		Q5VVZ0|Q969Z8|Q9BW45	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.N359K	ENST00000371494.4	37	c.1077	CCDS574.1	1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307979	0.60305	.	.	ENSG00000162383	ENST00000371494	T	0.59224	0.28	5.34	3.47	0.39725	.	0.000000	0.85682	D	0.000000	T	0.74527	0.3728	M	0.89534	3.04	0.80722	D	1	D	0.55385	0.971	P	0.60345	0.873	T	0.75619	-0.3255	10	0.56958	D	0.05	-7.41	9.021	0.36200	0.2257:0.0:0.7743:0.0	.	359	O00341	EAA5_HUMAN	K	359	ENSP00000360549:N359K	ENSP00000360549:N359K	N	-	3	2	SLC1A7	53329021	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	2.537000	0.45702	0.640000	0.30582	0.313000	0.20887	AAC	SLC1A7	-	pfam_Na-dicarboxylate_symporter	ENSG00000162383		0.642	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A7	HGNC	protein_coding	OTTHUMT00000024746.1	19	0.00	0	G	NM_006671		53556433	53556433	-1	no_errors	ENST00000371494	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	C
SLC24A5	283652	genome.wustl.edu	37	15	48413271	48413271	+	Silent	SNP	G	G	A	rs200329662		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:48413271G>A	ENST00000341459.3	+	1	103	c.30G>A	c.(28-30)gcG>gcA	p.A10A	SLC24A5_ENST00000449382.2_Silent_p.A10A|SLC24A5_ENST00000482911.2_Silent_p.A10A	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	10					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		AAACATGGGCGAGAAGGGCTC	0.572																																						dbGAP											0													77.0	63.0	68.0					15																	48413271		2198	4297	6495	-	-	-	SO:0001819	synonymous_variant	0			AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.30G>A	15.37:g.48413271G>A			A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Silent	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.A10	ENST00000341459.3	37	c.30	CCDS10128.1	15																																																																																			SLC24A5	-	NULL	ENSG00000188467		0.572	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A5	HGNC	protein_coding	OTTHUMT00000254340.2	32	0.00	0	G	NM_205850		48413271	48413271	+1	no_errors	ENST00000341459	ensembl	human	known	69_37n	silent	16	27.27	6	SNP	0.018	A
SLC25A1	6576	genome.wustl.edu	37	22	19164129	19164129	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr22:19164129C>T	ENST00000215882.5	-	7	865	c.709G>A	c.(709-711)Gga>Aga	p.G237R	CLTCL1_ENST00000442042.2_5'Flank|SLC25A1_ENST00000451283.1_Missense_Mutation_p.G134R|SLC25A1_ENST00000461267.1_5'Flank	NM_005984.3	NP_005975.1	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1	237					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|citrate transport (GO:0015746)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	citrate transmembrane transporter activity (GO:0015137)			cervix(1)|lung(1)	2	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		GGAGTGTTTCCAAAGACACTG	0.607																																						dbGAP											0													46.0	51.0	50.0					22																	19164129		2203	4299	6502	-	-	-	SO:0001583	missense	0			U25147	CCDS13758.1, CCDS74817.1	22q11	2013-05-22			ENSG00000100075	ENSG00000100075		"""Solute carriers"""	10979	protein-coding gene	gene with protein product		190315	"""solute carrier family 20 (mitochondrial citrate transporter), member 3"""	SLC20A3		8666394, 9254007	Standard	NM_001256534		Approved	CTP	uc002zoz.4	P53007	OTTHUMG00000150123	ENST00000215882.5:c.709G>A	22.37:g.19164129C>T	ENSP00000215882:p.Gly237Arg		A8K8E8|Q9BSK6	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.G237R	ENST00000215882.5	37	c.709	CCDS13758.1	22	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815842	0.90790	.	.	ENSG00000100075	ENST00000215882;ENST00000451283	T;T	0.78816	-1.21;-1.21	5.48	5.48	0.80851	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.86222	0.5881	L	0.55213	1.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.85519	0.1202	10	0.46703	T	0.11	-11.1893	19.3447	0.94358	0.0:1.0:0.0:0.0	.	244;237	D9HTE9;P53007	.;TXTP_HUMAN	R	237;134	ENSP00000215882:G237R;ENSP00000401480:G134R	ENSP00000215882:G237R	G	-	1	0	SLC25A1	17544129	1.000000	0.71417	0.929000	0.37066	0.362000	0.29581	7.763000	0.85283	2.557000	0.86248	0.462000	0.41574	GGA	SLC25A1	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000100075		0.607	SLC25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A1	HGNC	protein_coding	OTTHUMT00000316441.1	22	0.00	0	C	NM_005984		19164129	19164129	-1	no_errors	ENST00000215882	ensembl	human	known	69_37n	missense	9	62.50	15	SNP	1.000	T
SLC25A1	6576	genome.wustl.edu	37	22	19164682	19164682	+	Silent	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr22:19164682G>C	ENST00000215882.5	-	5	633	c.477C>G	c.(475-477)ccC>ccG	p.P159P	CLTCL1_ENST00000442042.2_5'Flank|SLC25A1_ENST00000451283.1_Silent_p.P56P|SLC25A1_ENST00000461267.1_5'UTR	NM_005984.3	NP_005975.1	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1	159					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|citrate transport (GO:0015746)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	citrate transmembrane transporter activity (GO:0015137)			cervix(1)|lung(1)	2	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		CTCTGTACTTGGGGTTTGGGG	0.602																																						dbGAP											0													77.0	69.0	71.0					22																	19164682		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U25147	CCDS13758.1, CCDS74817.1	22q11	2013-05-22			ENSG00000100075	ENSG00000100075		"""Solute carriers"""	10979	protein-coding gene	gene with protein product		190315	"""solute carrier family 20 (mitochondrial citrate transporter), member 3"""	SLC20A3		8666394, 9254007	Standard	NM_001256534		Approved	CTP	uc002zoz.4	P53007	OTTHUMG00000150123	ENST00000215882.5:c.477C>G	22.37:g.19164682G>C			A8K8E8|Q9BSK6	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.P159	ENST00000215882.5	37	c.477	CCDS13758.1	22																																																																																			SLC25A1	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000100075		0.602	SLC25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A1	HGNC	protein_coding	OTTHUMT00000316441.1	24	0.00	0	G	NM_005984		19164682	19164682	-1	no_errors	ENST00000215882	ensembl	human	known	69_37n	silent	49	22.22	14	SNP	0.982	C
SLC43A3	29015	genome.wustl.edu	37	11	57177571	57177571	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:57177571G>A	ENST00000395123.2	-	12	1388	c.1084C>T	c.(1084-1086)Ctc>Ttc	p.L362F	SLC43A3_ENST00000533524.1_Missense_Mutation_p.L375F|RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.L6F|SLC43A3_ENST00000529554.1_Missense_Mutation_p.L362F|SLC43A3_ENST00000352187.1_Missense_Mutation_p.L362F|SLC43A3_ENST00000395124.1_Missense_Mutation_p.L362F	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	362					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						GTCGAGCAGAGGGCCACCGCC	0.602																																						dbGAP											0													62.0	45.0	51.0					11																	57177571		2200	4296	6496	-	-	-	SO:0001583	missense	0			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.1084C>T	11.37:g.57177571G>A	ENSP00000378555:p.Leu362Phe		B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L362F	ENST00000395123.2	37	c.1084	CCDS7956.1	11	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941936	0.73557	.	.	ENSG00000254979;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802;ENSG00000134802	ENST00000529411;ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524	T;T;T;T;T;T	0.58060	1.06;0.36;0.36;0.36;0.36;0.36	5.65	4.74	0.60224	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.66228	0.2768	M	0.70842	2.15	0.45762	D	0.99865	P;P	0.52692	0.955;0.955	P;P	0.62184	0.876;0.899	T	0.68655	-0.5351	10	0.72032	D	0.01	-34.8119	8.9354	0.35697	0.1684:0.0:0.8316:0.0	.	375;362	E7EQD2;Q8NBI5	.;S43A3_HUMAN	F	6;362;362;362;362;375	ENSP00000431536:L6F;ENSP00000378555:L362F;ENSP00000378556:L362F;ENSP00000337561:L362F;ENSP00000436254:L362F;ENSP00000434515:L375F	ENSP00000431536:L6F	L	-	1	0	RP11-872D17.8;SLC43A3	56934147	1.000000	0.71417	0.836000	0.33094	0.005000	0.04900	3.142000	0.50601	1.383000	0.46405	0.655000	0.94253	CTC	SLC43A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000134802		0.602	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC43A3	HGNC	protein_coding	OTTHUMT00000393057.1	29	0.00	0	G	NM_017611		57177571	57177571	-1	no_errors	ENST00000352187	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	1.000	A
SLFN14	342618	genome.wustl.edu	37	17	33884544	33884544	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:33884544C>G	ENST00000415846.3	-	1	573	c.538G>C	c.(538-540)Gag>Cag	p.E180Q	RP11-1094M14.12_ENST00000588445.1_RNA	NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	180							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ATATCTTCCTCTTCCTGAATG	0.408																																						dbGAP											0													88.0	66.0	73.0					17																	33884544		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.538G>C	17.37:g.33884544C>G	ENSP00000391101:p.Glu180Gln		B2RTW9	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.E180Q	ENST00000415846.3	37	c.538	CCDS45650.1	17	.	.	.	.	.	.	.	.	.	.	C	16.00	2.999193	0.54147	.	.	ENSG00000236320	ENST00000415846	T	0.02216	4.39	4.24	4.24	0.50183	.	.	.	.	.	T	0.12944	0.0314	M	0.82716	2.605	0.23896	N	0.996533	D	0.76494	0.999	D	0.80764	0.994	T	0.02126	-1.1209	9	0.56958	D	0.05	-14.3295	12.332	0.55046	0.0:1.0:0.0:0.0	.	180	P0C7P3	SLN14_HUMAN	Q	180	ENSP00000391101:E180Q	ENSP00000391101:E180Q	E	-	1	0	SLFN14	30908657	.	.	1.000000	0.80357	0.731000	0.41821	.	.	2.352000	0.79861	0.655000	0.94253	GAG	SLFN14	-	NULL	ENSG00000236320		0.408	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN14	HGNC	protein_coding	OTTHUMT00000448928.1	48	0.00	0	C	NM_001129820		33884544	33884544	-1	no_errors	ENST00000415846	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	G
SMAP1	60682	genome.wustl.edu	37	6	71508424	71508424	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr6:71508424C>A	ENST00000370455.3	+	6	808	c.560C>A	c.(559-561)cCa>cAa	p.P187Q	SMAP1_ENST00000316999.5_Missense_Mutation_p.P160Q|SMAP1_ENST00000370452.3_Missense_Mutation_p.P160Q	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	187					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						CCGGCAAAACCACTTACAGCT	0.274																																						dbGAP											0													40.0	46.0	44.0					6																	71508424		2199	4290	6489	-	-	-	SO:0001583	missense	0			AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.560C>A	6.37:g.71508424C>A	ENSP00000359484:p.Pro187Gln		Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Missense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,prints_ArfGAP,pfscan_ArfGAP	p.P187Q	ENST00000370455.3	37	c.560	CCDS43478.1	6	.	.	.	.	.	.	.	.	.	.	C	13.58	2.280051	0.40294	.	.	ENSG00000112305	ENST00000370452;ENST00000316999;ENST00000370455;ENST00000370442	T;T;T	0.30981	2.03;2.04;1.51	5.32	5.32	0.75619	.	0.956118	0.08637	N	0.916075	T	0.17662	0.0424	L	0.42744	1.35	0.80722	D	1	B;B;B;B	0.15473	0.004;0.013;0.001;0.004	B;B;B;B	0.15870	0.002;0.014;0.008;0.003	T	0.01512	-1.1336	10	0.44086	T	0.13	-24.9711	13.7642	0.62983	0.1542:0.8458:0.0:0.0	.	187;160;160;187	A8K333;Q8IYB5-3;Q8IYB5-2;Q8IYB5	.;.;.;SMAP1_HUMAN	Q	160;160;187;99	ENSP00000359481:P160Q;ENSP00000313382:P160Q;ENSP00000359484:P187Q	ENSP00000313382:P160Q	P	+	2	0	SMAP1	71565145	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.779000	0.38624	2.636000	0.89361	0.655000	0.94253	CCA	SMAP1	-	NULL	ENSG00000112305		0.274	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAP1	HGNC	protein_coding	OTTHUMT00000041149.1	73	0.00	0	C	NM_001044305		71508424	71508424	+1	no_errors	ENST00000370455	ensembl	human	known	69_37n	missense	57	21.92	16	SNP	1.000	A
SMG5	23381	genome.wustl.edu	37	1	156236117	156236117	+	Missense_Mutation	SNP	G	G	T	rs144789236		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:156236117G>T	ENST00000361813.5	-	12	1454	c.1310C>A	c.(1309-1311)cCt>cAt	p.P437H	SMG5_ENST00000489907.2_5'UTR|SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	437					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					TACAGGAGGAGGCTCAGGATC	0.592																																						dbGAP											0													52.0	53.0	53.0					1																	156236117		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.1310C>A	1.37:g.156236117G>T	ENSP00000355261:p.Pro437His		D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	pfam_EST1,smart_PINc_nuc-bd	p.P437H	ENST00000361813.5	37	c.1310	CCDS1137.1	1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760227	0.31137	.	.	ENSG00000198952	ENST00000361813	T	0.30714	1.52	4.99	3.13	0.36017	.	1.075700	0.07062	N	0.833868	T	0.10594	0.0259	N	0.19112	0.55	0.58432	D	0.99999	D	0.54047	0.964	P	0.47206	0.541	T	0.40156	-0.9578	10	0.17369	T	0.5	-5.9565	6.6177	0.22786	0.3493:0.0:0.6507:0.0	.	437	Q9UPR3	SMG5_HUMAN	H	437	ENSP00000355261:P437H	ENSP00000355261:P437H	P	-	2	0	SMG5	154502741	0.038000	0.19896	0.638000	0.29380	0.262000	0.26303	0.120000	0.15647	0.698000	0.31739	-0.140000	0.14226	CCT	SMG5	-	NULL	ENSG00000198952		0.592	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1	24	0.00	0	G	NM_015327		156236117	156236117	-1	no_errors	ENST00000361813	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	0.612	T
SPG20	23111	genome.wustl.edu	37	13	36909960	36909960	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr13:36909960T>G	ENST00000451493.1	-	2	225	c.8A>C	c.(7-9)cAa>cCa	p.Q3P	SPG20_ENST00000494062.2_Missense_Mutation_p.Q3P|SPG20_ENST00000495510.1_5'UTR|SPG20_ENST00000355182.4_Missense_Mutation_p.Q3P|SPG20_ENST00000438666.2_Missense_Mutation_p.Q3P	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	3					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		TTGTGGCTCTTGCTCCATTTC	0.323																																						dbGAP											0													72.0	75.0	74.0					13																	36909960		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.8A>C	13.37:g.36909960T>G	ENSP00000414147:p.Gln3Pro		O60349|Q86Y67|Q9H1T2|Q9H1T3	Missense_Mutation	SNP	pfam_Senescence/spartin,pfam_MIT,smart_MIT	p.Q3P	ENST00000451493.1	37	c.8	CCDS9356.1	13	.	.	.	.	.	.	.	.	.	.	T	14.56	2.571465	0.45798	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	D;D;D	0.89617	-2.54;-2.54;-2.54	5.54	3.15	0.36227	.	0.316099	0.35970	N	0.002872	D	0.84651	0.5519	L	0.47716	1.5	0.29266	N	0.870995	B;P;B	0.43169	0.002;0.8;0.001	B;B;B	0.41860	0.003;0.368;0.002	T	0.79524	-0.1768	10	0.62326	D	0.03	-6.2039	8.9748	0.35928	0.0:0.1518:0.0:0.8482	.	3;3;3	A8K6Q9;B3KMI3;Q8N0X7	.;.;SPG20_HUMAN	P	3	ENSP00000406061:Q3P;ENSP00000347314:Q3P;ENSP00000414147:Q3P	ENSP00000347314:Q3P	Q	-	2	0	SPG20	35807960	1.000000	0.71417	0.995000	0.50966	0.955000	0.61496	1.673000	0.37534	0.421000	0.25980	0.491000	0.48974	CAA	SPG20	-	NULL	ENSG00000133104		0.323	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	43	0.00	0	T			36909960	36909960	-1	no_errors	ENST00000355182	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	1.000	G
SPOCK1	6695	genome.wustl.edu	37	5	136403503	136403503	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr5:136403503G>C	ENST00000394945.1	-	6	659	c.490C>G	c.(490-492)Cat>Gat	p.H164D	SPOCK1_ENST00000282223.7_Missense_Mutation_p.H164D	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	164	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAACAAGCATGGAACTCCAAT	0.537																																						dbGAP											0													126.0	116.0	120.0					5																	136403503		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.490C>G	5.37:g.136403503G>C	ENSP00000378401:p.His164Asp		B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Thyroglobulin_1,smart_Prot_inh_Kazal,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.H164D	ENST00000394945.1	37	c.490	CCDS4191.1	5	.	.	.	.	.	.	.	.	.	.	G	16.84	3.234272	0.58886	.	.	ENSG00000152377	ENST00000394945;ENST00000282223;ENST00000510689	T;T;T	0.04156	3.69;3.69;3.69	5.29	5.29	0.74685	Proteinase inhibitor I1, Kazal (1);EF-hand-like domain (1);Protease inhibitor, Kazal-type (1);	0.186089	0.48286	D	0.000192	T	0.07548	0.0190	N	0.25245	0.725	0.35866	D	0.827844	P	0.38280	0.625	P	0.46110	0.504	T	0.31779	-0.9931	10	0.66056	D	0.02	.	15.6524	0.77108	0.0:0.0:1.0:0.0	.	164	Q08629	TICN1_HUMAN	D	164;164;19	ENSP00000378401:H164D;ENSP00000282223:H164D;ENSP00000421677:H19D	ENSP00000282223:H164D	H	-	1	0	SPOCK1	136431402	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.882000	0.69714	2.472000	0.83506	0.561000	0.74099	CAT	SPOCK1	-	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal	ENSG00000152377		0.537	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOCK1	HGNC	protein_coding	OTTHUMT00000251222.1	32	0.00	0	G	NM_004598		136403503	136403503	-1	no_errors	ENST00000282223	ensembl	human	known	69_37n	missense	16	44.83	13	SNP	1.000	C
SPR	6697	genome.wustl.edu	37	2	73115498	73115498	+	Silent	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr2:73115498G>A	ENST00000234454.5	+	2	433	c.360G>A	c.(358-360)gtG>gtA	p.V120V	SPR_ENST00000498749.1_Intron	NM_003124.4	NP_003115.1	P35270	SPRE_HUMAN	sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)	120					cell morphogenesis involved in neuron differentiation (GO:0048667)|death (GO:0016265)|dopamine metabolic process (GO:0042417)|L-phenylalanine metabolic process (GO:0006558)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|norepinephrine metabolic process (GO:0042415)|oxidation-reduction process (GO:0055114)|pteridine metabolic process (GO:0019889)|regulation of multicellular organism growth (GO:0040014)|regulation of nitric-oxide synthase activity (GO:0050999)|serotonin metabolic process (GO:0042428)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldo-keto reductase (NADP) activity (GO:0004033)|NADP binding (GO:0050661)|sepiapterin reductase activity (GO:0004757)			lung(4)|ovary(2)	6						CCACTCAAGTGAACAACTACT	0.547											OREG0014704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													170.0	153.0	159.0					2																	73115498		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1920.1	2p14-p12	2013-06-03			ENSG00000116096	ENSG00000116096	1.1.1.153	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	11257	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 38C, member 1"""	182125				1883349, 19027726	Standard	NM_003124		Approved	SDR38C1	uc002sik.2	P35270	OTTHUMG00000129777	ENST00000234454.5:c.360G>A	2.37:g.73115498G>A		1142	A8K741|D6W5H2|Q53GI9|Q9UBB1	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,tigrfam_Sepiapterin_red	p.V120	ENST00000234454.5	37	c.360	CCDS1920.1	2																																																																																			SPR	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,tigrfam_Sepiapterin_red	ENSG00000116096		0.547	SPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPR	HGNC	protein_coding	OTTHUMT00000251993.2	34	0.00	0	G			73115498	73115498	+1	no_errors	ENST00000234454	ensembl	human	known	69_37n	silent	39	15.22	7	SNP	1.000	A
SPRR1A	6698	genome.wustl.edu	37	1	152957724	152957724	+	Silent	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr1:152957724G>A	ENST00000368762.1	+	1	18	c.18G>A	c.(16-18)caG>caA	p.Q6Q	SPRR1A_ENST00000307122.2_Silent_p.Q6Q			P35321	SPR1A_HUMAN	small proline-rich protein 1A	6	2 X 12 AA approximate repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(2)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)	7	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTCAGCAGCAGAAGCAGCCTT	0.478																																						dbGAP											0													111.0	113.0	112.0					1																	152957724		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L05187	CCDS1032.1	1q21-q22	2008-02-05			ENSG00000169474	ENSG00000169474			11259	protein-coding gene	gene with protein product		182265				8325635	Standard	NM_005987		Approved		uc001faw.3	P35321	OTTHUMG00000014404	ENST00000368762.1:c.18G>A	1.37:g.152957724G>A			B1AN47|D3DV31|Q2M303|Q9UDG4	Silent	SNP	pfam_Cornifin	p.Q6	ENST00000368762.1	37	c.18	CCDS1032.1	1																																																																																			SPRR1A	-	NULL	ENSG00000169474		0.478	SPRR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRR1A	HGNC	protein_coding	OTTHUMT00000040062.1	40	0.00	0	G	NM_005987		152957724	152957724	+1	no_errors	ENST00000307122	ensembl	human	known	69_37n	silent	62	15.07	11	SNP	1.000	A
STOML3	161003	genome.wustl.edu	37	13	39542611	39542611	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr13:39542611C>G	ENST00000379631.4	-	6	921	c.577G>C	c.(577-579)Gat>Cat	p.D193H	STOML3_ENST00000423210.1_Missense_Mutation_p.D184H	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	193					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		ATCCGAACATCTTTGATTTCC	0.517																																						dbGAP											0													109.0	107.0	108.0					13																	39542611		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.577G>C	13.37:g.39542611C>G	ENSP00000368952:p.Asp193His		B4E285|Q5JS35	Missense_Mutation	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.D193H	ENST00000379631.4	37	c.577	CCDS9367.1	13	.	.	.	.	.	.	.	.	.	.	C	32	5.135450	0.94517	.	.	ENSG00000133115	ENST00000379631;ENST00000423210	D;D	0.94793	-3.52;-3.52	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.96932	0.8998	M	0.78456	2.415	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71656	0.974;0.974	D	0.95646	0.8702	10	0.28530	T	0.3	-26.1101	18.3464	0.90324	0.0:1.0:0.0:0.0	.	184;193	B4E285;Q8TAV4	.;STML3_HUMAN	H	193;184	ENSP00000368952:D193H;ENSP00000401989:D184H	ENSP00000368952:D193H	D	-	1	0	STOML3	38440611	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.514000	0.81750	2.680000	0.91292	0.655000	0.94253	GAT	STOML3	-	pfam_Band_7,smart_Band_7,prints_Stomatin	ENSG00000133115		0.517	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STOML3	HGNC	protein_coding	OTTHUMT00000044604.2	22	0.00	0	C			39542611	39542611	-1	no_errors	ENST00000379631	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	G
SUPT6H	6830	genome.wustl.edu	37	17	27022374	27022374	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:27022374G>C	ENST00000314616.6	+	29	4062	c.3779G>C	c.(3778-3780)gGa>gCa	p.G1260A	SUPT6H_ENST00000347486.4_Missense_Mutation_p.G1260A	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1260	Interaction with KDM6A. {ECO:0000250}.|S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					atctaGGTGGGAATGACTGTT	0.493																																						dbGAP											0													92.0	68.0	76.0					17																	27022374		2203	4300	6503	-	-	-	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3779G>C	17.37:g.27022374G>C	ENSP00000319104:p.Gly1260Ala		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.G1260A	ENST00000314616.6	37	c.3779	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.165350	0.94768	.	.	ENSG00000109111	ENST00000314616	T	0.61980	0.06	5.59	5.59	0.84812	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.80576	0.4649	M	0.92459	3.31	0.80722	D	1	D	0.54397	0.966	P	0.52646	0.705	D	0.85458	0.1165	10	0.72032	D	0.01	-17.1611	19.5967	0.95544	0.0:0.0:1.0:0.0	.	1260	Q7KZ85	SPT6H_HUMAN	A	1260	ENSP00000319104:G1260A	ENSP00000319104:G1260A	G	+	2	0	SUPT6H	24046501	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.355000	0.97087	2.627000	0.88993	0.655000	0.94253	GGA	SUPT6H	-	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pirsf_TF_Spt6,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000109111		0.493	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	35	0.00	0	G	NM_003170		27022374	27022374	+1	no_errors	ENST00000314616	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	1.000	C
TIMM23	100287932	genome.wustl.edu	37	10	51592391	51592391	+	3'UTR	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr10:51592391C>G	ENST00000260867.4	-	0	866				TIMM23_ENST00000374065.3_3'UTR|TIMM23_ENST00000374064.3_3'UTR|TIMM23_ENST00000485812.1_5'UTR	NM_006327.3	NP_006318.1	O14925	TIM23_HUMAN	translocase of inner mitochondrial membrane 23 homolog (yeast)						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			endometrium(1)|large_intestine(1)|pancreas(1)	3						AAATCAAAATCTCCAATTTTT	0.408																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF030162	CCDS73091.1	10q11.21-q11.23	2010-03-17			ENSG00000138297				17312	protein-coding gene	gene with protein product		605034				10339406	Standard	NM_006327		Approved	TIM23	uc010qha.2	O14925	OTTHUMG00000018213	ENST00000260867.4:c.*113G>C	10.37:g.51592391C>G			Q53FF8|Q5T1E6|Q6P5S5	RNA	SNP	-	NULL	ENST00000260867.4	37	NULL	CCDS7238.1	10																																																																																			TIMM23	-	-	ENSG00000138297		0.408	TIMM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM23	HGNC	protein_coding	OTTHUMT00000048040.1	11	0.00	0	C	NM_006327.2		51592391	51592391	-1	no_errors	ENST00000485812	ensembl	human	known	69_37n	rna	10	60.00	15	SNP	0.000	G
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.H193R|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H193R	ENST00000269305.4	37	c.578	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	39	0.00	0	T	NM_000546		7578271	7578271	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	16	63.64	28	SNP	0.998	C
TRIM23	373	genome.wustl.edu	37	5	64907435	64907435	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr5:64907435G>C	ENST00000231524.9	-	4	1011	c.640C>G	c.(640-642)Cac>Gac	p.H214D	TRIM23_ENST00000274327.7_Missense_Mutation_p.H214D|TRIM23_ENST00000508808.1_5'Flank|TRIM23_ENST00000381018.3_Missense_Mutation_p.H214D	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	214					GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		CATACCTTGTGACCCTGGTGT	0.413																																						dbGAP											0													132.0	129.0	130.0					5																	64907435		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.640C>G	5.37:g.64907435G>C	ENSP00000231524:p.His214Asp		Q9BZY4|Q9BZY5	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_Znf_C2H2,tigrfam_Small_GTP-bd_dom	p.H214D	ENST00000231524.9	37	c.640	CCDS3987.1	5	.	.	.	.	.	.	.	.	.	.	G	22.7	4.330688	0.81690	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	T;T;T	0.75154	-0.91;-0.91;-0.91	4.77	4.77	0.60923	Zinc finger, B-box (1);	0.000000	0.85682	D	0.000000	D	0.84880	0.5570	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.91635	0.991;0.999;0.996	D	0.86773	0.1974	10	0.87932	D	0	.	18.1363	0.89620	0.0:0.0:1.0:0.0	.	214;214;214	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	D	214	ENSP00000231524:H214D;ENSP00000370406:H214D;ENSP00000274327:H214D	ENSP00000231524:H214D	H	-	1	0	TRIM23	64943191	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.388000	0.97237	2.347000	0.79759	0.491000	0.48974	CAC	TRIM23	-	smart_Znf_B-box	ENSG00000113595		0.413	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM23	HGNC	protein_coding	OTTHUMT00000215058.2	50	0.00	0	G	NM_001656		64907435	64907435	-1	no_errors	ENST00000231524	ensembl	human	known	69_37n	missense	61	21.79	17	SNP	1.000	C
TSPAN14	81619	genome.wustl.edu	37	10	82264498	82264498	+	Silent	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr10:82264498C>G	ENST00000429989.3	+	3	319	c.96C>G	c.(94-96)gtC>gtG	p.V32V	TSPAN14_ENST00000341863.6_Silent_p.V32V|TSPAN14_ENST00000481124.1_Intron|TSPAN14_ENST00000372164.3_Intron|TSPAN14_ENST00000372158.1_Silent_p.V32V|TSPAN14_ENST00000372156.1_Silent_p.V32V	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14	32					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			CTGGAGTTGTCTTCCTTGGAG	0.522																																						dbGAP											0													215.0	179.0	191.0					10																	82264498		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.96C>G	10.37:g.82264498C>G			A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V32	ENST00000429989.3	37	c.96	CCDS7369.1	10																																																																																			TSPAN14	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000108219		0.522	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN14	HGNC	protein_coding	OTTHUMT00000049081.2	50	0.00	0	C	NM_030927		82264498	82264498	+1	no_errors	ENST00000372156	ensembl	human	known	69_37n	silent	66	20.48	17	SNP	1.000	G
TTC23	64927	genome.wustl.edu	37	15	99759224	99759224	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr15:99759224C>G	ENST00000394132.2	-	7	1151	c.334G>C	c.(334-336)Gaa>Caa	p.E112Q	TTC23_ENST00000262074.4_Missense_Mutation_p.E112Q|TTC23_ENST00000394130.1_Missense_Mutation_p.E112Q|TTC23_ENST00000394136.1_Missense_Mutation_p.E112Q|TTC23_ENST00000558613.1_Missense_Mutation_p.E112Q|TTC23_ENST00000558663.1_Missense_Mutation_p.E112Q|TTC23_ENST00000394135.3_Missense_Mutation_p.E112Q|TTC23_ENST00000394129.2_Missense_Mutation_p.E112Q			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	112										endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			CTGGCTTTTTCTGCATGTTGT	0.428																																						dbGAP											0													234.0	223.0	227.0					15																	99759224		2197	4297	6494	-	-	-	SO:0001583	missense	0				CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.334G>C	15.37:g.99759224C>G	ENSP00000377690:p.Glu112Gln		A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Missense_Mutation	SNP	smart_TPR_repeat	p.E112Q	ENST00000394132.2	37	c.334	CCDS10379.2	15	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044934	0.75846	.	.	ENSG00000103852	ENST00000394132;ENST00000394136;ENST00000262074;ENST00000394135;ENST00000394130;ENST00000394129	T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05	5.02	5.02	0.67125	Tetratricopeptide-like helical (1);	0.427722	0.23086	N	0.052100	T	0.60560	0.2278	M	0.72479	2.2	0.32248	N	0.571833	D;P	0.76494	0.999;0.798	D;B	0.69479	0.964;0.329	T	0.65228	-0.6219	10	0.33141	T	0.24	-21.4173	13.7281	0.62769	0.0:1.0:0.0:0.0	.	112;112	Q5W5X9-2;Q5W5X9	.;TTC23_HUMAN	Q	112	ENSP00000377690:E112Q;ENSP00000377693:E112Q;ENSP00000262074:E112Q;ENSP00000377692:E112Q;ENSP00000377688:E112Q;ENSP00000457901:E112Q	ENSP00000262074:E112Q	E	-	1	0	TTC23	97576747	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.335000	0.59298	2.618000	0.88619	0.655000	0.94253	GAA	TTC23	-	smart_TPR_repeat	ENSG00000103852		0.428	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23	HGNC	protein_coding	OTTHUMT00000303953.2	73	0.00	0	C	NM_022905		99759224	99759224	-1	no_errors	ENST00000262074	ensembl	human	known	69_37n	missense	112	20.00	28	SNP	1.000	G
TXNDC2	84203	genome.wustl.edu	37	18	9887863	9887863	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr18:9887863C>A	ENST00000306084.6	+	2	1586	c.1387C>A	c.(1387-1389)Ctg>Atg	p.L463M	TXNDC2_ENST00000357775.5_Missense_Mutation_p.L396M|TXNDC2_ENST00000536353.2_3'UTR	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	463	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						TGAGGCATCACTGAAGGAGGC	0.567																																						dbGAP											0													60.0	52.0	54.0					18																	9887863		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.1387C>A	18.37:g.9887863C>A	ENSP00000304908:p.Leu463Met		A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	pfam_Thioredoxin_domain,pfam_Glutenin,superfamily_Thioredoxin-like_fold	p.L463M	ENST00000306084.6	37	c.1387	CCDS42414.1	18	.	.	.	.	.	.	.	.	.	.	C	12.42	1.933274	0.34096	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T	0.15718	2.4;2.4	4.05	4.05	0.47172	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.086249	0.46758	D	0.000272	T	0.38268	0.1034	M	0.72576	2.205	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	T	0.06734	-1.0810	9	.	.	.	-25.9521	12.032	0.53403	0.0:1.0:0.0:0.0	.	463	Q86VQ3	TXND2_HUMAN	M	261;396;463;448	ENSP00000350419:L396M;ENSP00000304908:L463M	.	L	+	1	2	TXNDC2	9877863	0.593000	0.26840	0.073000	0.20177	0.192000	0.23643	1.052000	0.30429	2.540000	0.85666	0.650000	0.86243	CTG	TXNDC2	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000168454		0.567	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TXNDC2	HGNC	protein_coding	OTTHUMT00000254487.1	24	0.00	0	C			9887863	9887863	+1	no_errors	ENST00000306084	ensembl	human	known	69_37n	missense	22	37.14	13	SNP	0.094	A
UBR5	51366	genome.wustl.edu	37	8	103297407	103297407	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr8:103297407C>T	ENST00000520539.1	-	40	6250	c.5644G>A	c.(5644-5646)Gag>Aag	p.E1882K	UBR5_ENST00000519528.1_5'Flank|UBR5_ENST00000220959.4_Missense_Mutation_p.E1882K|UBR5_ENST00000521922.1_Missense_Mutation_p.E1876K	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1882					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GTCATCCTCTCTCTTCTCGCT	0.438																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											0													116.0	117.0	117.0					8																	103297407		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.5644G>A	8.37:g.103297407C>T	ENSP00000429084:p.Glu1882Lys		B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.E1882K	ENST00000520539.1	37	c.5644	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656469	0.67586	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.45668	0.89;0.89;0.89	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.54351	0.1853	L	0.36672	1.1	0.80722	D	1	P;P	0.52842	0.956;0.956	D;D	0.65010	0.931;0.931	T	0.36335	-0.9752	10	0.22706	T	0.39	.	19.903	0.96995	0.0:1.0:0.0:0.0	.	1876;1882	E7EMW7;O95071	.;UBR5_HUMAN	K	1882;1882;1876	ENSP00000429084:E1882K;ENSP00000220959:E1882K;ENSP00000427819:E1876K	ENSP00000220959:E1882K	E	-	1	0	UBR5	103366583	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.814000	0.86154	2.697000	0.92050	0.563000	0.77884	GAG	UBR5	-	NULL	ENSG00000104517		0.438	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	53	0.00	0	C	NM_015902		103297407	103297407	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	missense	110	19.71	27	SNP	1.000	T
WT1	7490	genome.wustl.edu	37	11	32410657	32410657	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:32410657G>A	ENST00000379079.2	-	10	1129	c.856C>T	c.(856-858)Cgc>Tgc	p.R286C	WT1_ENST00000332351.3_Missense_Mutation_p.R501C|WT1_ENST00000448076.3_Missense_Mutation_p.R498C|WT1_ENST00000530998.1_Missense_Mutation_p.R272C	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	433					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R433fs*19(4)|p.L431fs*21(1)|p.R433fs*18(1)|p.R433fs*21(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TTGTGATGGCGGACTAATTCA	0.527			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																													dbGAP	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	7	Insertion - Frameshift(5)|Deletion - Frameshift(1)|Complex - frameshift(1)	kidney(7)											225.0	197.0	206.0					11																	32410657		2202	4299	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.856C>T	11.37:g.32410657G>A	ENSP00000368370:p.Arg286Cys		A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	pfam_Wilms_tumour_N,pfam_Znf_C2H2,smart_Znf_C2H2-like,prints_Wilms_tumour,pfscan_Znf_C2H2	p.R501C	ENST00000379079.2	37	c.1501	CCDS55751.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.6|26.6	4.748622|4.748622	0.89753|0.89753	.|.	.|.	ENSG00000184937|ENSG00000184937	ENST00000527882|ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076	.|T;T;T;T;T	.|0.56275	.|3.17;0.47;0.47;3.17;3.17	5.76|5.76	5.76|5.76	0.90799|0.90799	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.64402	.|U	.|0.000004	T|T	0.74688|0.74688	0.3749|0.3749	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.999;0.999;1.0;0.998;0.999	T|T	0.76313|0.76313	-0.3005|-0.3005	5|10	.|0.87932	.|D	.|0	.|.	19.9628|19.9628	0.97258|0.97258	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|489;433;506;272;286	.|P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.|.;WT1_HUMAN;.;.;.	L|C	161|286;501;272;481;498	.|ENSP00000368370:R286C;ENSP00000331327:R501C;ENSP00000435307:R272C;ENSP00000415516:R481C;ENSP00000413452:R498C	.|ENSP00000331327:R501C	P|R	-|-	2|1	0|0	WT1|WT1	32367233|32367233	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.864000|9.864000	0.99589|0.99589	2.711000|2.711000	0.92665|0.92665	0.561000|0.561000	0.74099|0.74099	CCG|CGC	WT1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000184937		0.527	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WT1	HGNC	protein_coding	OTTHUMT00000095434.1	61	0.00	0	G	NM_000378		32410657	32410657	-1	no_errors	ENST00000332351	ensembl	human	known	69_37n	missense	101	15.13	18	SNP	1.000	A
UCP3	7352	genome.wustl.edu	37	11	73718048	73718048	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr11:73718048C>T	ENST00000314032.4	-	2	592	c.40G>A	c.(40-42)Gct>Act	p.A14T	UCP3_ENST00000426995.2_Missense_Mutation_p.A14T|UCP3_ENST00000348534.4_Missense_Mutation_p.A14T	NM_003356.3	NP_003347.1	P55916	UCP3_HUMAN	uncoupling protein 3 (mitochondrial, proton carrier)	14					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to hormone stimulus (GO:0032870)|fatty acid metabolic process (GO:0006631)|lipid metabolic process (GO:0006629)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|response to activity (GO:0014823)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12	Breast(11;2.08e-05)					AACTTCACAGCCATGGTGGGA	0.597																																						dbGAP											0													96.0	73.0	80.0					11																	73718048		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF001787	CCDS8229.1, CCDS44677.1	11q13.4	2013-05-22				ENSG00000175564		"""Solute carriers"""	12519	protein-coding gene	gene with protein product		602044				9480760, 9196039	Standard	NM_003356		Approved	SLC25A9	uc001our.3	P55916		ENST00000314032.4:c.40G>A	11.37:g.73718048C>T	ENSP00000323740:p.Ala14Thr		O60475|Q96HL3	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling,prints_Mit_carrier	p.A14T	ENST00000314032.4	37	c.40	CCDS8229.1	11	.	.	.	.	.	.	.	.	.	.	C	6.840	0.524156	0.13066	.	.	ENSG00000175564	ENST00000314032;ENST00000348534;ENST00000426995;ENST00000544614	T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25	5.34	-1.1	0.09872	Mitochondrial carrier domain (2);	0.258066	0.44902	D	0.000409	T	0.62962	0.2471	L	0.53617	1.68	0.09310	N	1	B	0.02656	0.0	B	0.15052	0.012	T	0.40979	-0.9534	10	0.21540	T	0.41	-13.2371	2.6557	0.05012	0.1135:0.389:0.1114:0.3861	.	14	P55916	UCP3_HUMAN	T	14	ENSP00000323740:A14T;ENSP00000343615:A14T;ENSP00000392143:A14T;ENSP00000445279:A14T	ENSP00000323740:A14T	A	-	1	0	UCP3	73395696	0.000000	0.05858	0.040000	0.18447	0.307000	0.27823	0.034000	0.13776	-0.005000	0.14395	-0.137000	0.14449	GCT	UCP3	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000175564		0.597	UCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP3	HGNC	protein_coding	OTTHUMT00000398200.1	26	0.00	0	C	NM_003356		73718048	73718048	-1	no_errors	ENST00000314032	ensembl	human	known	69_37n	missense	15	50.00	15	SNP	0.005	T
ZMIZ2	83637	genome.wustl.edu	37	7	44795851	44795851	+	Start_Codon_SNP	SNP	G	G	A			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr7:44795851G>A	ENST00000309315.4	+	2	126	c.3G>A	c.(1-3)atG>atA	p.M1I	ZMIZ2_ENST00000441627.1_Start_Codon_SNP_p.M1I|ZMIZ2_ENST00000265346.7_Start_Codon_SNP_p.M1I|ZMIZ2_ENST00000413916.1_Start_Codon_SNP_p.M1I|ZMIZ2_ENST00000433667.1_Start_Codon_SNP_p.M1I	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	1					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CATTGCCAATGAACTCCATGA	0.612																																					NSCLC(20;604 852 1948 16908 50522)	dbGAP											0													62.0	68.0	66.0					7																	44795851		1943	4128	6071	-	-	-	SO:0001582	initiator_codon_variant	0			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.3G>A	7.37:g.44795851G>A	ENSP00000311778:p.Met1Ile		A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.M1I	ENST00000309315.4	37	c.3	CCDS43576.1	7	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787293	0.70337	.	.	ENSG00000122515	ENST00000413916;ENST00000457123;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.33865	1.42;1.42;1.42;1.43;1.39	4.48	4.48	0.54585	.	0.000000	0.56097	D	0.000036	T	0.50309	0.1608	.	.	.	0.35332	D	0.785723	B;P;D	0.54047	0.169;0.485;0.964	B;B;P	0.52881	0.071;0.313;0.712	T	0.66492	-0.5910	9	0.72032	D	0.01	-12.0426	16.0918	0.81094	0.0:0.0:1.0:0.0	.	1;1;1	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	I	1	ENSP00000409648:M1I;ENSP00000311778:M1I;ENSP00000414723:M1I;ENSP00000396601:M1I;ENSP00000265346:M1I	ENSP00000265346:M1I	M	+	3	0	ZMIZ2	44762376	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.103000	0.89550	2.332000	0.79248	0.467000	0.42956	ATG	ZMIZ2	-	NULL	ENSG00000122515		0.612	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ2	HGNC	protein_coding	OTTHUMT00000341790.1	30	0.00	0	G	NM_031449	Missense_Mutation	44795851	44795851	+1	no_errors	ENST00000309315	ensembl	human	known	69_37n	missense	12	70.00	28	SNP	1.000	A
ZNF121	7675	genome.wustl.edu	37	19	9677204	9677204	+	Silent	SNP	A	A	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr19:9677204A>G	ENST00000586602.1	-	6	1001	c.585T>C	c.(583-585)acT>acC	p.T195T	ZNF121_ENST00000320451.6_Silent_p.T195T			P58317	ZN121_HUMAN	zinc finger protein 121	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						GTTTCTCTCCAGTATGAATTC	0.443																																						dbGAP											0													64.0	62.0	63.0					19																	9677204		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.585T>C	19.37:g.9677204A>G				Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T195	ENST00000586602.1	37	c.585		19																																																																																			ZNF121	-	pfscan_Znf_C2H2	ENSG00000197961		0.443	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	ZNF121	HGNC	protein_coding	OTTHUMT00000449910.1	23	0.00	0	A	NM_001008727		9677204	9677204	-1	no_errors	ENST00000320451	ensembl	human	known	69_37n	silent	26	27.78	10	SNP	1.000	G
ZNF250	58500	genome.wustl.edu	37	8	146106959	146106959	+	Missense_Mutation	SNP	G	G	A	rs561303501		TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr8:146106959G>A	ENST00000292579.7	-	6	1740	c.1624C>T	c.(1624-1626)Cgt>Tgt	p.R542C	ZNF250_ENST00000417550.2_Missense_Mutation_p.R537C|ZNF250_ENST00000543949.1_Intron|ZNF250_ENST00000342660.6_Intron	NM_001109689.3|NM_021061.4	NP_001103159.1|NP_066405.1	P15622	ZN250_HUMAN	zinc finger protein 250	542				R -> G (in Ref. 6). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(2)|lung(8)|skin(1)	15	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		TTGAAGGCACGCCCACACTCC	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18974	0.0		0.0	False		,,,				2504	0.0				NSCLC(16;520 556 24096 40084 43446)	dbGAP											0													80.0	62.0	68.0					8																	146106959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095705	CCDS34972.1, CCDS55282.1	8q24.3	2013-01-08	2004-11-08			ENSG00000196150		"""Zinc fingers, C2H2-type"", ""-"""	13044	protein-coding gene	gene with protein product			"""zinc finger protein 647"""	ZNF647		12477932	Standard	NM_021061		Approved	MGC9718, ZFP647	uc003zer.4	P15622		ENST00000292579.7:c.1624C>T	8.37:g.146106959G>A	ENSP00000292579:p.Arg542Cys		D3DWP1|Q59HE9|Q8N942|Q96AH9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R542C	ENST00000292579.7	37	c.1624	CCDS34972.1	8	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403455	0.62288	.	.	ENSG00000196150	ENST00000292579;ENST00000417550;ENST00000394912	T;T	0.19806	2.12;2.12	4.14	4.14	0.48551	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.182059	0.26991	N	0.021480	T	0.39306	0.1073	M	0.69185	2.1	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.65773	0.938;0.916	T	0.15549	-1.0433	10	0.87932	D	0	-26.6869	9.7128	0.40256	0.0:0.0:0.6877:0.3123	.	537;542	D3DWP1;P15622	.;ZN250_HUMAN	C	542;537;425	ENSP00000292579:R542C;ENSP00000393442:R537C	ENSP00000292579:R542C	R	-	1	0	ZNF250	146077763	0.974000	0.33945	0.891000	0.34965	0.929000	0.56500	2.398000	0.44486	2.612000	0.88384	0.484000	0.47621	CGT	ZNF250	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196150		0.552	ZNF250-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF250	HGNC	protein_coding	OTTHUMT00000382968.1	30	0.00	0	G	NM_021061		146106959	146106959	-1	no_errors	ENST00000292579	ensembl	human	known	69_37n	missense	55	37.08	33	SNP	0.843	A
ZNF43	7594	genome.wustl.edu	37	19	21992075	21992075	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr19:21992075T>C	ENST00000354959.4	-	4	933	c.764A>G	c.(763-765)tAc>tGc	p.Y255C	ZNF43_ENST00000595461.1_Missense_Mutation_p.Y249C|ZNF43_ENST00000598381.1_Missense_Mutation_p.Y249C|ZNF43_ENST00000594012.1_Missense_Mutation_p.Y249C	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		GTAGAGTTTGTATCTAGTATA	0.348																																						dbGAP											0													44.0	48.0	47.0					19																	21992075		2187	4286	6473	-	-	-	SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.764A>G	19.37:g.21992075T>C	ENSP00000347045:p.Tyr255Cys		A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y255C	ENST00000354959.4	37	c.764	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	T	9.382	1.073219	0.20147	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.04970	3.52	1.68	0.304	0.15796	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04861	0.0131	L	0.38175	1.15	0.24665	N	0.993445	B	0.31611	0.331	B	0.21151	0.033	T	0.35599	-0.9782	9	0.87932	D	0	.	6.6266	0.22833	0.0:0.0:0.238:0.762	.	255	P17038	ZNF43_HUMAN	C	254;255	ENSP00000347045:Y255C	ENSP00000347045:Y255C	Y	-	2	0	ZNF43	21783915	0.014000	0.17966	0.001000	0.08648	0.002000	0.02628	-0.455000	0.06762	0.760000	0.33108	0.332000	0.21555	TAC	ZNF43	-	pfscan_Znf_C2H2	ENSG00000198521		0.348	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000250380.2	48	0.00	0	T	NM_003423		21992075	21992075	-1	no_errors	ENST00000354959	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	0.973	C
ZNF519	162655	genome.wustl.edu	37	18	14105980	14105980	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr18:14105980C>G	ENST00000590202.1	-	3	711	c.559G>C	c.(559-561)Gaa>Caa	p.E187Q	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589203.1_Intron|ZNF519_ENST00000589498.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	187					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						AATACTTTTTCACATTCATTA	0.274																																						dbGAP											0													34.0	36.0	35.0					18																	14105980		2179	4261	6440	-	-	-	SO:0001583	missense	0			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.559G>C	18.37:g.14105980C>G	ENSP00000464872:p.Glu187Gln			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E187Q	ENST00000590202.1	37	c.559	CCDS32797.1	18	.	.	.	.	.	.	.	.	.	.	C	8.894	0.954774	0.18431	.	.	ENSG00000175322	ENST00000309305	.	.	.	0.646	0.646	0.17789	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29355	0.0731	L	0.32530	0.975	0.20196	N	0.999926	B	0.23540	0.087	B	0.17979	0.02	T	0.29640	-1.0005	8	0.87932	D	0	.	7.2226	0.25997	0.0:0.9999:0.0:1.0E-4	.	187	Q8TB69	ZN519_HUMAN	Q	187	.	ENSP00000307908:E187Q	E	-	1	0	ZNF519	14095980	0.219000	0.23619	0.014000	0.15608	0.216000	0.24613	1.343000	0.33930	0.661000	0.30985	0.089000	0.15464	GAA	ZNF519	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175322		0.274	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1	44	0.00	0	C	NM_145287		14105980	14105980	-1	no_errors	ENST00000590202	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	0.845	G
ZNF587	84914	genome.wustl.edu	37	19	58371075	58371075	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr19:58371075G>C	ENST00000339656.5	+	3	1477	c.1295G>C	c.(1294-1296)gGg>gCg	p.G432A	ZNF814_ENST00000597652.1_5'Flank|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF587_ENST00000419854.1_Missense_Mutation_p.G389A|ZNF587_ENST00000423137.1_Missense_Mutation_p.G431A|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		CTTCACACTGGGGAAAGACCT	0.453																																					Pancreas(59;641 1233 1885 20055 50741)	dbGAP											0													72.0	79.0	77.0					19																	58371075		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.1295G>C	19.37:g.58371075G>C	ENSP00000345479:p.Gly432Ala		A0AV72|G3V0H5|Q6ZMK8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G432A	ENST00000339656.5	37	c.1295	CCDS12964.1	19	.	.	.	.	.	.	.	.	.	.	.	17.81	3.479713	0.63849	.	.	ENSG00000198466	ENST00000376209;ENST00000423137;ENST00000339656;ENST00000540851;ENST00000419854	T;T;T	0.01505	4.82;4.82;4.82	1.76	1.76	0.24704	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06872	0.0175	M	0.62016	1.91	0.25431	N	0.988187	D;D	0.89917	1.0;0.995	D;D	0.67548	0.952;0.926	T	0.16070	-1.0415	8	0.72032	D	0.01	.	10.4579	0.44561	0.0:0.0:1.0:0.0	.	431;432	G3V0H5;Q96SQ5	.;ZN587_HUMAN	A	389;431;432;432;389	ENSP00000393865:G431A;ENSP00000345479:G432A;ENSP00000406999:G389A	ENSP00000345479:G432A	G	+	2	0	ZNF587	63062887	0.815000	0.29118	0.025000	0.17156	0.779000	0.44077	1.278000	0.33179	0.940000	0.37473	0.195000	0.17529	GGG	ZNF587	-	pfscan_Znf_C2H2	ENSG00000198466		0.453	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF587	HGNC	protein_coding	OTTHUMT00000337594.2	49	0.00	0	G	NM_032828		58371075	58371075	+1	no_errors	ENST00000339656	ensembl	human	known	69_37n	missense	39	31.58	18	SNP	1.000	C
ZNF679	168417	genome.wustl.edu	37	7	63726567	63726567	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A27B-01A-11D-A167-09	TCGA-C8-A27B-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	11e43e41-54b8-4232-b078-5062288d3868	922226ba-6244-4953-ad42-f4daa474c288	g.chr7:63726567T>C	ENST00000421025.1	+	5	825	c.556T>C	c.(556-558)Tgt>Cgt	p.C186R	ZNF679_ENST00000255746.4_Missense_Mutation_p.C186R	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						ACATTTCAAATGTAAAAAATA	0.318																																						dbGAP											0													68.0	59.0	62.0					7																	63726567		692	1591	2283	-	-	-	SO:0001583	missense	0			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.556T>C	7.37:g.63726567T>C	ENSP00000416809:p.Cys186Arg			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C186R	ENST00000421025.1	37	c.556	CCDS47592.1	7	.	.	.	.	.	.	.	.	.	.	T	13.36	2.215093	0.39102	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.59772	0.24;0.24	1.12	1.12	0.20585	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.69584	0.3127	M	0.89658	3.05	0.46749	D	0.999183	D	0.61697	0.99	P	0.54889	0.763	T	0.70306	-0.4908	9	0.87932	D	0	.	6.0216	0.19632	0.0:0.0:0.0:1.0	.	186	Q8IYX0	ZN679_HUMAN	R	186	ENSP00000416809:C186R;ENSP00000255746:C186R	ENSP00000255746:C186R	C	+	1	0	ZNF679	63364002	0.992000	0.36948	0.019000	0.16419	0.082000	0.17680	2.785000	0.47782	0.451000	0.26802	0.163000	0.16589	TGT	ZNF679	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197123		0.318	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	HGNC	protein_coding	OTTHUMT00000344317.2	46	0.00	0	T	NM_153363		63726567	63726567	+1	no_errors	ENST00000255746	ensembl	human	known	69_37n	missense	53	50.47	54	SNP	0.556	C
