#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACVR2B	93	genome.wustl.edu	37	3	38520670	38520670	+	Nonsense_Mutation	SNP	A	A	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr3:38520670A>T	ENST00000352511.4	+	6	1190	c.718A>T	c.(718-720)Aag>Tag	p.K240*		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		ACCTGGCATGAAGCACGAGAA	0.597																																						dbGAP											0													192.0	180.0	184.0					3																	38520670		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.718A>T	3.37:g.38520670A>T	ENSP00000340361:p.Lys240*		Q4VAV0	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt	p.K240*	ENST00000352511.4	37	c.718	CCDS2679.1	3	.	.	.	.	.	.	.	.	.	.	A	41	8.579413	0.98870	.	.	ENSG00000114739	ENST00000352511	.	.	.	4.61	4.61	0.57282	.	0.152960	0.56097	D	0.000037	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1819	0.65580	1.0:0.0:0.0:0.0	.	.	.	.	X	240	.	ENSP00000340361:K240X	K	+	1	0	ACVR2B	38495674	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.019000	0.57181	1.922000	0.55676	0.460000	0.39030	AAG	ACVR2B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000114739		0.597	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR2B	HGNC	protein_coding	OTTHUMT00000254059.3	33	0.00	0	A	NM_001106		38520670	38520670	+1	no_errors	ENST00000352511	ensembl	human	known	69_37n	nonsense	20	25.93	7	SNP	1.000	T
ANK3	288	genome.wustl.edu	37	10	61833948	61833948	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr10:61833948T>C	ENST00000280772.2	-	37	6882	c.6691A>G	c.(6691-6693)Aat>Gat	p.N2231D	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2231					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						AAAACCCGATTGTGGTCATCT	0.418																																						dbGAP											0													216.0	200.0	206.0					10																	61833948		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.6691A>G	10.37:g.61833948T>C	ENSP00000280772:p.Asn2231Asp		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.N2231D	ENST00000280772.2	37	c.6691	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	T	8.736	0.917768	0.17982	.	.	ENSG00000151150	ENST00000280772	T	0.63096	-0.02	6.05	6.05	0.98169	.	0.483365	0.17261	N	0.180784	T	0.45736	0.1357	N	0.08118	0	0.80722	D	1	B	0.12630	0.006	B	0.15870	0.014	T	0.34576	-0.9823	10	0.38643	T	0.18	.	16.5952	0.84794	0.0:0.0:0.0:1.0	.	2231	Q12955	ANK3_HUMAN	D	2231	ENSP00000280772:N2231D	ENSP00000280772:N2231D	N	-	1	0	ANK3	61503954	1.000000	0.71417	0.931000	0.37212	0.785000	0.44390	4.560000	0.60802	2.318000	0.78349	0.523000	0.50628	AAT	ANK3	-	NULL	ENSG00000151150		0.418	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	137	0.00	0	T	NM_020987		61833948	61833948	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	286	16.13	55	SNP	0.946	C
ANK3	288	genome.wustl.edu	37	10	61835214	61835214	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr10:61835214A>T	ENST00000280772.2	-	37	5616	c.5425T>A	c.(5425-5427)Tct>Act	p.S1809T	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1809	Ser-rich.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTAGTTGCAGATATTGACGAC	0.428																																						dbGAP											0													130.0	137.0	135.0					10																	61835214		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.5425T>A	10.37:g.61835214A>T	ENSP00000280772:p.Ser1809Thr		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.S1809T	ENST00000280772.2	37	c.5425	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	A	12.36	1.915526	0.33815	.	.	ENSG00000151150	ENST00000280772	T	0.65549	-0.16	5.54	4.36	0.52297	.	0.181637	0.26855	N	0.022145	T	0.50222	0.1603	L	0.29908	0.895	0.80722	D	1	B	0.23377	0.084	B	0.21708	0.036	T	0.46679	-0.9174	10	0.62326	D	0.03	.	11.7717	0.51962	0.6381:0.3619:0.0:0.0	.	1809	Q12955	ANK3_HUMAN	T	1809	ENSP00000280772:S1809T	ENSP00000280772:S1809T	S	-	1	0	ANK3	61505220	0.988000	0.35896	0.990000	0.47175	0.994000	0.84299	1.088000	0.30877	0.871000	0.35750	0.378000	0.23410	TCT	ANK3	-	NULL	ENSG00000151150		0.428	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	32	0.00	0	A	NM_020987		61835214	61835214	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	38	42.42	28	SNP	1.000	T
ANKRD30BL	554226	genome.wustl.edu	37	2	133015334	133015334	+	5'UTR	SNP	G	G	T	rs1710724|rs449812		TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr2:133015334G>T	ENST00000470729.1	-	0	208				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GGGGGCCTGCGGTACCAGGAA	0.706																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1217C>A	2.37:g.133015334G>T			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.706	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	12	0.00	0	G	NR_027019		133015334	133015334	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	23	23.33	7	SNP	0.025	T
ANKS4B	257629	genome.wustl.edu	37	16	21261144	21261144	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr16:21261144A>T	ENST00000311620.5	+	2	330	c.257A>T	c.(256-258)aAc>aTc	p.N86I		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	86					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		TTCCTGGTCAACTTTGGTGCC	0.517																																						dbGAP											0													98.0	96.0	97.0					16																	21261144		2038	4197	6235	-	-	-	SO:0001583	missense	0			AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.257A>T	16.37:g.21261144A>T	ENSP00000308772:p.Asn86Ile			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.N86I	ENST00000311620.5	37	c.257	CCDS42130.1	16	.	.	.	.	.	.	.	.	.	.	A	18.14	3.557550	0.65425	.	.	ENSG00000175311	ENST00000311620	T	0.65364	-0.15	5.81	3.57	0.40892	Ankyrin repeat-containing domain (4);	0.143601	0.64402	D	0.000010	T	0.72953	0.3525	M	0.72894	2.215	0.80722	D	1	D	0.52996	0.957	P	0.61397	0.888	T	0.72593	-0.4246	10	0.72032	D	0.01	-11.5875	9.5837	0.39504	0.8578:0.0:0.1422:0.0	.	86	Q8N8V4	ANS4B_HUMAN	I	86	ENSP00000308772:N86I	ENSP00000308772:N86I	N	+	2	0	ANKS4B	21168645	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	2.949000	0.49074	0.463000	0.27118	-0.326000	0.08463	AAC	ANKS4B	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000175311		0.517	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS4B	HGNC	protein_coding	OTTHUMT00000436535.1	71	0.00	0	A	NM_145865		21261144	21261144	+1	no_errors	ENST00000311620	ensembl	human	known	69_37n	missense	72	30.77	32	SNP	1.000	T
BPIFA2	140683	genome.wustl.edu	37	20	31756984	31756984	+	Silent	SNP	C	C	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr20:31756984C>T	ENST00000253362.2	+	2	179	c.33C>T	c.(31-33)tgC>tgT	p.C11C	BPIFA2_ENST00000354932.5_Silent_p.C11C			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	11						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										TTCTCCTGTGCGGCGTGCTCA	0.493																																						dbGAP											0													170.0	150.0	157.0					20																	31756984		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.33C>T	20.37:g.31756984C>T			Q9BQQ0	Silent	SNP	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom	p.C11	ENST00000253362.2	37	c.33	CCDS13214.1	20																																																																																			BPIFA2	-	NULL	ENSG00000131050		0.493	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BPIFA2	HGNC	protein_coding	OTTHUMT00000257117.1	42	0.00	0	C	NM_080574		31756984	31756984	+1	no_errors	ENST00000253362	ensembl	human	known	69_37n	silent	49	33.78	25	SNP	0.133	T
CDK11A	728642	genome.wustl.edu	37	1	1638858	1638858	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr1:1638858G>A	ENST00000378633.1	-	11	1323	c.1244C>T	c.(1243-1245)cCg>cTg	p.P415L	CDK11A_ENST00000356200.3_Missense_Mutation_p.P378L|CDK11A_ENST00000357760.2_Missense_Mutation_p.P411L|CDK11A_ENST00000358779.5_Missense_Mutation_p.P402L|CDK11A_ENST00000404249.3_Missense_Mutation_p.P412L|CDK11A_ENST00000378635.3_3'UTR|CDK11A_ENST00000495016.1_5'Flank|CDK11A_ENST00000378638.2_Missense_Mutation_p.P378L|RP1-283E3.8_ENST00000598846.1_RNA			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	415					apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						CTGCAGGGCCGGCAGGTACTT	0.697																																					Pancreas(186;965 2119 30274 40311 50569)	dbGAP											0													34.0	47.0	43.0					1																	1638858		2003	4165	6168	-	-	-	SO:0001583	missense	0			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.1244C>T	1.37:g.1638858G>A	ENSP00000367900:p.Pro415Leu		O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P412L	ENST00000378633.1	37	c.1235		1	.	.	.	.	.	.	.	.	.	.	-	16.06	3.017036	0.54576	.	.	ENSG00000008128	ENST00000356200;ENST00000404249;ENST00000357760;ENST00000358779;ENST00000378633;ENST00000378638;ENST00000378630	T;T;T;T;T;T	0.05925	3.37;3.37;3.37;3.37;3.37;3.37	2.64	2.64	0.31445	.	0.000000	0.85682	D	0.000000	T	0.14270	0.0345	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.995;0.992;0.992	T	0.03296	-1.1051	10	0.87932	D	0	.	12.7033	0.57046	0.0:0.0:1.0:0.0	.	412;402;412;402	B4E0M9;B4E0N4;Q9UQ88-2;Q9UQ88-4	.;.;.;.	L	378;412;411;402;415;378;378	ENSP00000348529:P378L;ENSP00000384442:P412L;ENSP00000350403:P411L;ENSP00000351629:P402L;ENSP00000367900:P415L;ENSP00000367905:P378L	ENSP00000348529:P378L	P	-	2	0	CDK11A	1628718	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	8.191000	0.89716	1.503000	0.48686	0.423000	0.28283	CCG	CDK11A	-	superfamily_Kinase-like_dom	ENSG00000008128		0.697	CDK11A-005	NOVEL	basic	protein_coding	CDK11A	HGNC	protein_coding	OTTHUMT00000001735.1	43	0.00	0	G	NM_024011		1638858	1638858	-1	no_errors	ENST00000404249	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	1.000	A
MROH9	80133	genome.wustl.edu	37	1	170940889	170940889	+	Splice_Site	SNP	A	A	G			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr1:170940889A>G	ENST00000367758.3	+	8	580	c.481A>G	c.(481-483)Ata>Gta	p.I161V	MROH9_ENST00000367759.4_Splice_Site_p.I161V	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	161				I -> L (in Ref. 1; BAB15690). {ECO:0000305}.													TCTCCATTAGATAAGTGTTGA	0.403																																						dbGAP											0													298.0	266.0	276.0					1																	170940889		1940	4135	6075	-	-	-	SO:0001630	splice_region_variant	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.481-1A>G	1.37:g.170940889A>G			A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.I161V	ENST00000367758.3	37	c.481	CCDS41436.1	1	.	.	.	.	.	.	.	.	.	.	A	9.568	1.120372	0.20877	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.66638	-0.22;2.58	5.25	-8.54	0.00912	.	1.972690	0.02158	N	0.058560	T	0.13970	0.0338	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.13407	0.009;0.009	T	0.07751	-1.0756	9	.	.	.	1.7354	1.144	0.01771	0.2121:0.3713:0.1847:0.2319	.	161;161	F5GWX6;Q5TGP6	.;CA129_HUMAN	V	161	ENSP00000356733:I161V;ENSP00000356732:I161V	.	I	+	1	0	C1orf129	169207513	0.007000	0.16637	0.026000	0.17262	0.058000	0.15608	-0.224000	0.09164	-1.410000	0.02035	-0.313000	0.08912	ATA	C1orf129	-	superfamily_ARM-type_fold	ENSG00000117501		0.403	MROH9-001	KNOWN	basic|CCDS	protein_coding	C1orf129	HGNC	protein_coding	OTTHUMT00000099327.1	101	0.00	0	A	NM_025063	Missense_Mutation	170940889	170940889	+1	no_errors	ENST00000367759	ensembl	human	known	69_37n	missense	169	17.16	35	SNP	0.039	G
CTSV	1515	genome.wustl.edu	37	9	99797047	99797047	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr9:99797047G>A	ENST00000259470.5	-	7	1115	c.866C>T	c.(865-867)gCa>gTa	p.A289V	CTSV_ENST00000479932.1_5'Flank|CTSV_ENST00000538255.1_Missense_Mutation_p.A289V	NM_001333.3	NP_001324.2	O60911	CATL2_HUMAN	cathepsin V	289					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic cell death (GO:0048102)|catagen (GO:0042637)|cellular response to starvation (GO:0009267)|decidualization (GO:0046697)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|multicellular organismal aging (GO:0010259)|negative regulation of keratinocyte proliferation (GO:0010839)|nerve development (GO:0021675)|protein autoprocessing (GO:0016540)|regulation of actin cytoskeleton reorganization (GO:2000249)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to gonadotropin (GO:0034698)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	aminopeptidase activity (GO:0004177)|cysteine-type carboxypeptidase activity (GO:0016807)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptide binding (GO:0042277)										ATTCGAATTTGCTCCTTCAAA	0.383																																						dbGAP											0													113.0	111.0	112.0					9																	99797047		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14734	CCDS6723.1	9q22.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000136943	ENSG00000136943		"""Cathepsins"""	2538	protein-coding gene	gene with protein product		603308	"""cathepsin L2"""	CTSL2		9563472, 10029531	Standard	NM_001201575		Approved	CTSU	uc004awt.3	O60911	OTTHUMG00000020314	ENST00000259470.5:c.866C>T	9.37:g.99797047G>A	ENSP00000259470:p.Ala289Val		O60233|Q2TB86|Q5T1U0	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.A289V	ENST00000259470.5	37	c.866	CCDS6723.1	9	.	.	.	.	.	.	.	.	.	.	G	2.748	-0.260653	0.05791	.	.	ENSG00000136943	ENST00000259470;ENST00000538255	T;T	0.21543	2.0;2.0	3.83	-3.87	0.04218	Peptidase C1A, papain C-terminal (2);	.	.	.	.	T	0.06416	0.0165	N	0.01874	-0.695	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.43507	-0.9387	8	.	.	.	.	9.1209	0.36786	0.0:0.4736:0.1738:0.3526	.	289;289	B2R717;O60911	.;CATL2_HUMAN	V	289	ENSP00000259470:A289V;ENSP00000445052:A289V	.	A	-	2	0	CTSL2	98836868	0.179000	0.23135	0.000000	0.03702	0.005000	0.04900	0.316000	0.19469	-0.764000	0.04651	-0.181000	0.13052	GCA	CTSL2	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000136943		0.383	CTSV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSL2	HGNC	protein_coding	OTTHUMT00000053301.2	103	0.00	0	G	NM_001333		99797047	99797047	-1	no_errors	ENST00000259470	ensembl	human	known	69_37n	missense	236	18.56	54	SNP	0.001	A
CYTH4	27128	genome.wustl.edu	37	22	37695271	37695271	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr22:37695271C>T	ENST00000248901.6	+	6	545	c.358C>T	c.(358-360)Ccc>Tcc	p.P120S	CYTH4_ENST00000405206.3_Missense_Mutation_p.P120S|CYTH4_ENST00000439667.1_3'UTR|CYTH4_ENST00000402997.1_Missense_Mutation_p.P120S	NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	120	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						CCCCAGGGATCCCATCAACCT	0.647																																						dbGAP											0													48.0	44.0	45.0					22																	37695271		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.358C>T	22.37:g.37695271C>T	ENSP00000248901:p.Pro120Ser		Q5R3F9|Q9UGT6	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.P120S	ENST00000248901.6	37	c.358	CCDS13946.1	22	.	.	.	.	.	.	.	.	.	.	C	11.69	1.714850	0.30413	.	.	ENSG00000100055	ENST00000248901;ENST00000422721;ENST00000402997;ENST00000405206	T;T;T	0.29397	1.57;1.57;1.57	4.62	3.6	0.41247	SEC7-like (4);	0.249383	0.39759	N	0.001268	T	0.25827	0.0629	L	0.49640	1.575	0.80722	D	1	B;B	0.33637	0.08;0.42	B;B	0.33196	0.081;0.159	T	0.04767	-1.0928	10	0.42905	T	0.14	.	8.0388	0.30508	0.0:0.7519:0.1595:0.0885	.	120;133	Q9UIA0;Q9H7Q0	CYH4_HUMAN;.	S	120;133;120;120	ENSP00000248901:P120S;ENSP00000385997:P120S;ENSP00000384280:P120S	ENSP00000248901:P120S	P	+	1	0	CYTH4	36025217	0.749000	0.28305	0.942000	0.38095	0.388000	0.30384	2.066000	0.41452	1.078000	0.41014	0.561000	0.74099	CCC	CYTH4	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000100055		0.647	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH4	HGNC	protein_coding	OTTHUMT00000318917.1	15	0.00	0	C			37695271	37695271	+1	no_errors	ENST00000248901	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	0.945	T
DDX55	57696	genome.wustl.edu	37	12	124094511	124094511	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr12:124094511C>G	ENST00000238146.4	+	7	627	c.577C>G	c.(577-579)Cca>Gca	p.P193A	DDX55_ENST00000538744.1_Missense_Mutation_p.P193A	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	193	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		GGAGTTTTTGCCAAAGCAGAG	0.517																																						dbGAP											0													78.0	75.0	76.0					12																	124094511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.577C>G	12.37:g.124094511C>G	ENSP00000238146:p.Pro193Ala		Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.P193A	ENST00000238146.4	37	c.577	CCDS9251.1	12	.	.	.	.	.	.	.	.	.	.	C	29.5	5.012431	0.93346	.	.	ENSG00000111364	ENST00000238146;ENST00000538449;ENST00000538744	T;T	0.48836	2.49;0.8	5.98	5.98	0.97165	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71358	0.3330	M	0.76574	2.34	0.80722	D	1	D;D;D	0.71674	0.996;0.997;0.998	D;D;D	0.79108	0.992;0.989;0.937	T	0.72221	-0.4356	10	0.87932	D	0	-35.8063	20.4366	0.99092	0.0:1.0:0.0:0.0	.	193;193;193	B4DVE4;Q8NHQ9;F5H5U2	.;DDX55_HUMAN;.	A	193	ENSP00000238146:P193A;ENSP00000443114:P193A	ENSP00000238146:P193A	P	+	1	0	DDX55	122660464	1.000000	0.71417	0.999000	0.59377	0.886000	0.51366	7.818000	0.86416	2.843000	0.97960	0.585000	0.79938	CCA	DDX55	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000111364		0.517	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX55	HGNC	protein_coding	OTTHUMT00000400616.2	50	0.00	0	C			124094511	124094511	+1	no_errors	ENST00000238146	ensembl	human	known	69_37n	missense	49	36.36	28	SNP	1.000	G
DHX9	1660	genome.wustl.edu	37	1	182849707	182849707	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr1:182849707G>A	ENST00000367549.3	+	22	2698	c.2588G>A	c.(2587-2589)cGt>cAt	p.R863H	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	863					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						ATTGAGCCTCGTTTTGGCAAA	0.413																																					Colon(69;210 1162 3697 13559 39565)	dbGAP											0													108.0	100.0	103.0					1																	182849707		1868	4101	5969	-	-	-	SO:0001583	missense	0			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2588G>A	1.37:g.182849707G>A	ENSP00000356520:p.Arg863His		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	pfam_Ds-RNA-bd,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Ds-RNA-bd,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Ds-RNA-bd	p.R863H	ENST00000367549.3	37	c.2588	CCDS41444.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.329134	0.95733	.	.	ENSG00000135829	ENST00000367549	T	0.36878	1.23	5.66	5.66	0.87406	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.66167	0.2762	M	0.85710	2.77	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.67941	-0.5540	10	0.48119	T	0.1	.	19.3565	0.94416	0.0:0.0:1.0:0.0	.	142;863	B3KU66;Q08211	.;DHX9_HUMAN	H	863	ENSP00000356520:R863H	ENSP00000356520:R863H	R	+	2	0	DHX9	181116330	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	9.014000	0.93635	2.645000	0.89757	0.650000	0.86243	CGT	DHX9	-	pfam_Helicase-assoc_dom,smart_Helicase-assoc_dom	ENSG00000135829		0.413	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX9	HGNC	protein_coding	OTTHUMT00000085522.2	90	0.00	0	G	NM_030588		182849707	182849707	+1	no_errors	ENST00000367549	ensembl	human	known	69_37n	missense	89	11.88	12	SNP	1.000	A
DNMT3A	1788	genome.wustl.edu	37	2	25457218	25457218	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr2:25457218C>T	ENST00000264709.3	-	23	3006	c.2669G>A	c.(2668-2670)gGc>gAc	p.G890D	DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000321117.5_Missense_Mutation_p.G890D|DNMT3A_ENST00000380746.4_Missense_Mutation_p.G701D|DNMT3A_ENST00000402667.1_Missense_Mutation_p.G667D	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	890	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.G890D(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATGACCGGCCCAGCAGTCT	0.582			"""Mis, F, N, S"""		AML																																	dbGAP		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											63.0	58.0	60.0					2																	25457218		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2669G>A	2.37:g.25457218C>T	ENSP00000264709:p.Gly890Asp		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	pfam_PWWP,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP,pfscan_PWWP	p.G890D	ENST00000264709.3	37	c.2669	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470144	0.84533	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5	5.82	5.82	0.92795	.	0.045507	0.85682	D	0.000000	D	0.99912	0.9958	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.79108	0.992;0.502	D	0.96464	0.9343	10	0.87932	D	0	-10.7599	18.6564	0.91455	0.0:1.0:0.0:0.0	.	890;701	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	D	701;890;890;667	ENSP00000370122:G701D;ENSP00000324375:G890D;ENSP00000264709:G890D;ENSP00000384237:G667D	ENSP00000264709:G890D	G	-	2	0	DNMT3A	25310722	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.814000	0.86154	2.745000	0.94114	0.561000	0.74099	GGC	DNMT3A	-	NULL	ENSG00000119772		0.582	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	HGNC	protein_coding	OTTHUMT00000211587.1	36	0.00	0	C	NM_022552		25457218	25457218	-1	no_errors	ENST00000264709	ensembl	human	known	69_37n	missense	39	38.10	24	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126320040	126320041	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr4:126320040_126320041delTA	ENST00000394329.3	+	2	5290_5291	c.5277_5278delTA	c.(5275-5280)attatgfs	p.M1760fs	FAT4_ENST00000335110.5_Frame_Shift_Del_p.M58fs	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1760	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GCTCTAAGATTATGCAGCTGAC	0.411																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5277_5278delTA	4.37:g.126320040_126320041delTA	ENSP00000377862:p.Met1760fs		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.M1760fs	ENST00000394329.3	37	c.5277_5278	CCDS3732.3	4																																																																																			FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000196159		0.411	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	29	0.00	0	TA	NM_024582		126320040	126320041	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	frame_shift_del	51	18.75	12	DEL	0.987:1.000	-
FUK	197258	genome.wustl.edu	37	16	70497609	70497609	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr16:70497609A>C	ENST00000288078.6	+	3	398	c.166A>C	c.(166-168)Agc>Cgc	p.S56R	FUK_ENST00000428974.2_Missense_Mutation_p.S56R|FUK_ENST00000571514.1_Intron|FUK_ENST00000378912.2_Missense_Mutation_p.S56R	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	56						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				GCGTGTGGGCAGCGGAGGAGC	0.642																																						dbGAP											0													33.0	42.0	39.0					16																	70497609		2079	4212	6291	-	-	-	SO:0001583	missense	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.166A>C	16.37:g.70497609A>C	ENSP00000288078:p.Ser56Arg		Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.S56R	ENST00000288078.6	37	c.166	CCDS10891.2	16	.	.	.	.	.	.	.	.	.	.	A	27.4	4.830946	0.91036	.	.	ENSG00000157353	ENST00000288078;ENST00000378912;ENST00000428974	T;T;T	0.68903	1.85;2.08;-0.36	5.05	5.05	0.67936	.	0.047667	0.85682	N	0.000000	D	0.83599	0.5289	M	0.86420	2.815	0.52099	D	0.999946	D;D;B	0.89917	1.0;1.0;0.125	D;D;B	0.91635	0.998;0.999;0.041	D	0.86910	0.2060	10	0.87932	D	0	-14.872	14.7779	0.69743	1.0:0.0:0.0:0.0	.	56;56;56	B4DEU5;Q8N0W3-2;Q8N0W3	.;.;FUK_HUMAN	R	56	ENSP00000288078:S56R;ENSP00000368192:S56R;ENSP00000408007:S56R	ENSP00000288078:S56R	S	+	1	0	FUK	69055110	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	6.127000	0.71642	2.037000	0.60232	0.533000	0.62120	AGC	FUK	-	NULL	ENSG00000157353		0.642	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	22	0.00	0	A	NM_145059		70497609	70497609	+1	no_errors	ENST00000378912	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	1.000	C
GPATCH2	55105	genome.wustl.edu	37	1	217793197	217793197	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr1:217793197T>C	ENST00000366935.3	-	2	811	c.701A>G	c.(700-702)gAa>gGa	p.E234G	GPATCH2_ENST00000366934.3_Missense_Mutation_p.E234G	NM_018040.2	NP_060510.1	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	234					negative regulation of phosphatase activity (GO:0010923)		nucleic acid binding (GO:0003676)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)	35				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		CTGGTTCGTTTCCTCACTTTC	0.323																																						dbGAP											0													107.0	106.0	107.0					1																	217793197		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001114	CCDS1518.1, CCDS73031.1	1q41	2013-01-28		2006-12-13	ENSG00000092978	ENSG00000092978		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""G patch domain containing"""	25499	protein-coding gene	gene with protein product	"""cancer/testis antigen 110"", ""protein phosphatase 1, regulatory subunit 30"""			GPATC2		19432882, 15375528	Standard	XM_005273174		Approved	FLJ10252, CT110, PPP1R30	uc001hlf.1	Q9NW75	OTTHUMG00000000527	ENST00000366935.3:c.701A>G	1.37:g.217793197T>C	ENSP00000355902:p.Glu234Gly		Q5VYK7|Q5VYK8|Q86YE7	Missense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.E234G	ENST00000366935.3	37	c.701	CCDS1518.1	1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.386107	0.82902	.	.	ENSG00000092978	ENST00000366935;ENST00000366934	T;T	0.49139	0.79;0.79	5.68	5.68	0.88126	.	0.091957	0.85682	D	0.000000	T	0.61640	0.2363	M	0.73598	2.24	0.58432	D	0.999998	D;P	0.55385	0.971;0.917	P;P	0.52646	0.705;0.606	T	0.66901	-0.5806	10	0.66056	D	0.02	-21.5658	15.9175	0.79531	0.0:0.0:0.0:1.0	.	234;234	Q9NW75-2;Q9NW75	.;GPTC2_HUMAN	G	234	ENSP00000355902:E234G;ENSP00000355901:E234G	ENSP00000355901:E234G	E	-	2	0	GPATCH2	215859820	1.000000	0.71417	0.994000	0.49952	0.897000	0.52465	5.850000	0.69473	2.155000	0.67459	0.482000	0.46254	GAA	GPATCH2	-	NULL	ENSG00000092978		0.323	GPATCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH2	HGNC	protein_coding	OTTHUMT00000001272.1	72	0.00	0	T	NM_018040		217793197	217793197	-1	no_errors	ENST00000366935	ensembl	human	known	69_37n	missense	154	52.02	167	SNP	1.000	C
GPR98	84059	genome.wustl.edu	37	5	89970042	89970042	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr5:89970042C>T	ENST00000405460.2	+	23	5197	c.5101C>T	c.(5101-5103)Cat>Tat	p.H1701Y	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1701					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGCTAGTGATCATCCATATGG	0.423																																						dbGAP											0													67.0	62.0	64.0					5																	89970042		1926	4112	6038	-	-	-	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.5101C>T	5.37:g.89970042C>T	ENSP00000384582:p.His1701Tyr		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.H1701Y	ENST00000405460.2	37	c.5101	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837079	0.91117	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.27104	1.69	4.89	4.89	0.63831	.	0.044205	0.85682	D	0.000000	T	0.40247	0.1109	L	0.41710	1.295	0.80722	D	1	D	0.59357	0.985	P	0.60415	0.874	T	0.12243	-1.0555	10	0.45353	T	0.12	.	18.4586	0.90729	0.0:1.0:0.0:0.0	.	1701	Q8WXG9	GPR98_HUMAN	Y	1701	ENSP00000384582:H1701Y	ENSP00000296619:H1701Y	H	+	1	0	GPR98	90005798	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.486000	0.81215	2.434000	0.82447	0.485000	0.47835	CAT	GPR98	-	NULL	ENSG00000164199		0.423	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	26	0.00	0	C	NM_032119		89970042	89970042	+1	no_errors	ENST00000405460	ensembl	human	known	69_37n	missense	68	35.24	37	SNP	1.000	T
IGFBP2	3485	genome.wustl.edu	37	2	217525400	217525400	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr2:217525400T>C	ENST00000233809.4	+	2	692	c.563T>C	c.(562-564)cTg>cCg	p.L188P	IGFBP2_ENST00000456764.1_Missense_Mutation_p.L44P	NM_000597.2	NP_000588	P18065	IBP2_HUMAN	insulin-like growth factor binding protein 2, 36kDa	188					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of activated T cell proliferation (GO:0042104)|regulation of cell growth (GO:0001558)|regulation of insulin-like growth factor receptor signaling pathway (GO:0043567)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)			endometrium(2)|large_intestine(1)|lung(2)	5		Renal(323;0.0458)		Epithelial(149;2.9e-06)|all cancers(144;0.000223)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00968)		ATGAAGGAGCTGGCCGTGTTC	0.637																																						dbGAP											0													32.0	37.0	35.0					2																	217525400		2043	4194	6237	-	-	-	SO:0001583	missense	0				CCDS42815.1	2q35	2014-09-16	2002-08-29		ENSG00000115457	ENSG00000115457			5471	protein-coding gene	gene with protein product		146731	"""insulin-like growth factor binding protein 2 (36kD)"""	IBP2		1697583	Standard	NM_000597		Approved		uc021vwn.1	P18065	OTTHUMG00000155341	ENST00000233809.4:c.563T>C	2.37:g.217525400T>C	ENSP00000233809:p.Leu188Pro		Q14619|Q9UCL3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_IGFBP-like,superfamily_Thyroglobulin_1,superfamily_Growth_fac_rcpt,smart_IGFBP-like,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP_1-6_chordata,prints_IGFBP-2	p.L188P	ENST00000233809.4	37	c.563	CCDS42815.1	2	.	.	.	.	.	.	.	.	.	.	T	17.91	3.504726	0.64410	.	.	ENSG00000115457	ENST00000434997;ENST00000233809;ENST00000456764	T;T	0.08370	3.18;3.1	4.43	4.43	0.53597	.	0.447951	0.20912	N	0.083454	T	0.18087	0.0434	L	0.38175	1.15	0.58432	D	0.999999	D;D	0.76494	0.999;0.978	D;P	0.66196	0.942;0.733	T	0.00926	-1.1512	10	0.72032	D	0.01	-12.7717	13.022	0.58794	0.0:0.0:0.0:1.0	.	222;188	Q59FF1;P18065	.;IBP2_HUMAN	P	22;188;44	ENSP00000233809:L188P;ENSP00000389646:L44P	ENSP00000233809:L188P	L	+	2	0	IGFBP2	217233645	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	5.227000	0.65305	1.852000	0.53769	0.459000	0.35465	CTG	IGFBP2	-	NULL	ENSG00000115457		0.637	IGFBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFBP2	HGNC	protein_coding	OTTHUMT00000339540.1	38	0.00	0	T	NM_000597		217525400	217525400	+1	no_errors	ENST00000233809	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	1.000	C
KIAA0430	9665	genome.wustl.edu	37	16	15702217	15702217	+	Silent	SNP	T	T	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr16:15702217T>A	ENST00000396368.3	-	21	4319	c.4113A>T	c.(4111-4113)acA>acT	p.T1371T	KIAA0430_ENST00000548025.1_Silent_p.T1368T|KIAA0430_ENST00000602337.1_Silent_p.T1368T|KIAA0430_ENST00000344181.3_Silent_p.T973T|KIAA0430_ENST00000551742.1_Silent_p.T1371T|KIAA0430_ENST00000540441.2_Silent_p.T1206T|CTB-193M12.1_ENST00000549756.1_RNA|KIAA0430_ENST00000547936.1_5'Flank	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1371	HTH OST-type 6. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GGAGACGAAATGTATAACCAA	0.358																																						dbGAP											0													86.0	83.0	84.0					16																	15702217		1857	4104	5961	-	-	-	SO:0001819	synonymous_variant	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4113A>T	16.37:g.15702217T>A			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.T1371	ENST00000396368.3	37	c.4113	CCDS10562.2	16																																																																																			KIAA0430	-	NULL	ENSG00000166783		0.358	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	58	0.00	0	T	NM_014647		15702217	15702217	-1	no_errors	ENST00000396368	ensembl	human	known	69_37n	silent	82	12.77	12	SNP	0.007	A
KIF13B	23303	genome.wustl.edu	37	8	28981618	28981618	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr8:28981618C>T	ENST00000524189.1	-	27	3313	c.3275G>A	c.(3274-3276)cGt>cAt	p.R1092H	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1092					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CCATTTTCTACGAAGTCTCTC	0.348																																						dbGAP											0													137.0	122.0	127.0					8																	28981618		1851	4100	5951	-	-	-	SO:0001583	missense	0			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3275G>A	8.37:g.28981618C>T	ENSP00000427900:p.Arg1092His		B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1092H	ENST00000524189.1	37	c.3275	CCDS55217.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.257950	0.95368	.	.	ENSG00000197892	ENST00000524189	D	0.84298	-1.83	5.28	5.28	0.74379	.	0.050683	0.64402	D	0.000001	D	0.92880	0.7735	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93372	0.6736	10	0.87932	D	0	.	19.1132	0.93326	0.0:1.0:0.0:0.0	.	1092	F8VPJ2	.	H	1092	ENSP00000427900:R1092H	ENSP00000427900:R1092H	R	-	2	0	KIF13B	29037537	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.009000	0.76347	2.736000	0.93811	0.655000	0.94253	CGT	KIF13B	-	NULL	ENSG00000197892		0.348	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	HGNC	protein_coding	OTTHUMT00000376878.1	116	0.00	0	C			28981618	28981618	-1	no_errors	ENST00000524189	ensembl	human	known	69_37n	missense	176	20.36	45	SNP	1.000	T
KIF14	9928	genome.wustl.edu	37	1	200584501	200584501	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr1:200584501C>A	ENST00000367350.4	-	3	1787	c.1349G>T	c.(1348-1350)gGc>gTc	p.G450V		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	450	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TTTTCCAGAGCCAGTCTGACC	0.403																																						dbGAP											0													87.0	89.0	89.0					1																	200584501		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.1349G>T	1.37:g.200584501C>A	ENSP00000356319:p.Gly450Val		Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G450V	ENST00000367350.4	37	c.1349	CCDS30963.1	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819711	0.90873	.	.	ENSG00000118193	ENST00000367350	D	0.83591	-1.74	5.94	5.94	0.96194	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	D	0.95677	0.8594	H	0.99182	4.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97010	0.9735	10	0.87932	D	0	.	20.369	0.98888	0.0:1.0:0.0:0.0	.	450	Q15058	KIF14_HUMAN	V	450	ENSP00000356319:G450V	ENSP00000356319:G450V	G	-	2	0	KIF14	198851124	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.409000	0.80053	2.819000	0.97034	0.650000	0.86243	GGC	KIF14	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000118193		0.403	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF14	HGNC	protein_coding	OTTHUMT00000086878.1	42	0.00	0	C	NM_014875		200584501	200584501	-1	no_errors	ENST00000367350	ensembl	human	known	69_37n	missense	39	33.90	20	SNP	1.000	A
L3MBTL1	26013	genome.wustl.edu	37	20	42143725	42143725	+	Silent	SNP	G	G	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr20:42143725G>A	ENST00000427442.2	+	5	672	c.513G>A	c.(511-513)gcG>gcA	p.A171A	L3MBTL1_ENST00000373135.3_Silent_p.A103A|L3MBTL1_ENST00000444063.1_Silent_p.A103A|L3MBTL1_ENST00000418998.1_Silent_p.A171A|L3MBTL1_ENST00000457824.1_3'UTR|L3MBTL1_ENST00000373134.1_Silent_p.A103A			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	103					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						AGTGCCAGGCGTGCGGGCCTC	0.627																																						dbGAP											0													66.0	64.0	65.0					20																	42143725		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.513G>A	20.37:g.42143725G>A			B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Silent	SNP	pfam_Mbt,pfam_Znf_C2HC,superfamily_SAM/pointed,smart_Mbt,pfscan_Mbt	p.A171	ENST00000427442.2	37	c.513	CCDS46602.2	20																																																																																			L3MBTL1	-	NULL	ENSG00000185513		0.627	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL1	HGNC	protein_coding	OTTHUMT00000079300.3	25	0.00	0	G	NM_032107		42143725	42143725	+1	no_errors	ENST00000418998	ensembl	human	known	69_37n	silent	25	37.50	15	SNP	0.386	A
L3MBTL1	26013	genome.wustl.edu	37	20	42161475	42161475	+	Silent	SNP	G	G	A	rs201765532	byFrequency	TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr20:42161475G>A	ENST00000427442.2	+	12	1440	c.1281G>A	c.(1279-1281)ccG>ccA	p.P427P	L3MBTL1_ENST00000373135.3_Silent_p.P359P|L3MBTL1_ENST00000444063.1_Silent_p.P359P|L3MBTL1_ENST00000418998.1_Silent_p.P427P|L3MBTL1_ENST00000373134.1_Silent_p.P359P			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	359					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						GCATGAACCCGTCCCTTGTCT	0.587													G|||	7	0.00139776	0.0	0.0	5008	,	,		17562	0.006		0.001	False		,,,				2504	0.0					dbGAP											0													142.0	128.0	133.0					20																	42161475		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1281G>A	20.37:g.42161475G>A			B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	pfam_Mbt,pfam_Znf_C2HC,smart_Mbt,pfscan_Mbt	p.R50H	ENST00000427442.2	37	c.149	CCDS46602.2	20	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	5.715	0.316446	0.10789	.	.	ENSG00000185513	ENST00000445228	.	.	.	5.18	-10.4	0.00318	.	.	.	.	.	T	0.46328	0.1387	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62234	-0.6897	4	.	.	.	.	8.0367	0.30496	0.2003:0.1384:0.5313:0.1301	.	.	.	.	H	50	.	.	R	+	2	0	L3MBTL1	41594889	0.000000	0.05858	0.054000	0.19295	0.794000	0.44872	-1.868000	0.01644	-4.050000	0.00078	-2.615000	0.00158	CGT	L3MBTL1	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000185513		0.587	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL1	HGNC	protein_coding	OTTHUMT00000079300.3	75	0.00	0	G	NM_032107		42161475	42161475	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000445228	ensembl	human	known	69_37n	missense	94	33.33	47	SNP	0.000	A
MKI67	4288	genome.wustl.edu	37	10	129903220	129903220	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr10:129903220T>C	ENST00000368654.3	-	13	7259	c.6884A>G	c.(6883-6885)aAt>aGt	p.N2295S	MKI67_ENST00000368653.3_Missense_Mutation_p.N1935S	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2295	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GCCAGGTAAATTTCCTGGCAG	0.498																																						dbGAP											0													187.0	191.0	190.0					10																	129903220		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6884A>G	10.37:g.129903220T>C	ENSP00000357643:p.Asn2295Ser		Q5VWH2	Missense_Mutation	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.N2295S	ENST00000368654.3	37	c.6884	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	T	12.51	1.960942	0.34565	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02067	4.47;4.47	3.47	-6.39	0.01951	.	4.435290	0.00998	N	0.003625	T	0.01976	0.0062	L	0.31476	0.935	0.09310	N	1	B;P;P	0.42296	0.106;0.569;0.775	B;B;B	0.43701	0.028;0.332;0.428	T	0.44590	-0.9318	10	0.10111	T	0.7	.	3.2213	0.06716	0.132:0.1793:0.4756:0.2131	.	2294;1935;2295	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	S	2295;1935;2294	ENSP00000357643:N2295S;ENSP00000357642:N1935S	ENSP00000357642:N1935S	N	-	2	0	MKI67	129793210	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.912000	0.04046	-1.542000	0.01725	-0.648000	0.03929	AAT	MKI67	-	pfam_K167R	ENSG00000148773		0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	90	0.00	0	T	NM_002417		129903220	129903220	-1	no_errors	ENST00000368654	ensembl	human	known	69_37n	missense	318	23.63	99	SNP	0.000	C
MSI1	4440	genome.wustl.edu	37	12	120794783	120794783	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr12:120794783G>A	ENST00000257552.2	-	9	662	c.574C>T	c.(574-576)Cca>Tca	p.P192S	MSI1_ENST00000546622.1_5'UTR	NM_002442.3	NP_002433.1	O43347	MSI1H_HUMAN	musashi RNA-binding protein 1	192					epithelial cell differentiation (GO:0030855)|nervous system development (GO:0007399)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(4)|central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAGCCCGTTGGCGACATCACC	0.587											OREG0022190	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													108.0	90.0	96.0					12																	120794783		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB012851	CCDS9196.1	12q24	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	7330	protein-coding gene	gene with protein product		603328	"""Musashi (Drosophila) homolog 1"", ""musashi homolog 1 (Drosophila)"""			9790759	Standard	NM_002442		Approved		uc001tye.2	O43347	OTTHUMG00000169344	ENST00000257552.2:c.574C>T	12.37:g.120794783G>A	ENSP00000257552:p.Pro192Ser	1506	Q96PU0|Q96PU1|Q96PU2|Q96PU3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P192S	ENST00000257552.2	37	c.574	CCDS9196.1	12	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206786	0.58343	.	.	ENSG00000135097	ENST00000257552	D	0.82526	-1.62	4.1	4.1	0.47936	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.64402	D	0.000004	D	0.83050	0.5170	M	0.76574	2.34	0.80722	D	1	B	0.23442	0.085	B	0.25291	0.059	T	0.81165	-0.1057	10	0.35671	T	0.21	.	17.6216	0.88083	0.0:0.0:1.0:0.0	.	192	O43347	MSI1H_HUMAN	S	192	ENSP00000257552:P192S	ENSP00000257552:P192S	P	-	1	0	MSI1	119279166	1.000000	0.71417	0.201000	0.23476	0.010000	0.07245	9.118000	0.94355	2.568000	0.86640	0.561000	0.74099	CCA	MSI1	-	NULL	ENSG00000135097		0.587	MSI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSI1	HGNC	protein_coding	OTTHUMT00000403629.1	35	0.00	0	G	NM_002442		120794783	120794783	-1	no_errors	ENST00000257552	ensembl	human	known	69_37n	missense	67	11.84	9	SNP	0.997	A
MYO3A	53904	genome.wustl.edu	37	10	26446238	26446238	+	Splice_Site	SNP	G	G	A	rs200531358		TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr10:26446238G>A	ENST00000265944.5	+	26	2959		c.e26-1		MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA						ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GTGTATTATAGTATTCCCTGA	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		16049	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													112.0	114.0	114.0					10																	26446238		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2794-1G>A	10.37:g.26446238G>A			Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Splice_Site	SNP	-	e24-1	ENST00000265944.5	37	c.2794-1	CCDS7148.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	21.0	4.087006	0.76642	.	.	ENSG00000095777	ENST00000265944	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3468	0.94367	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO3A	26486244	1.000000	0.71417	0.997000	0.53966	0.720000	0.41350	9.809000	0.99208	2.640000	0.89533	0.655000	0.94253	.	MYO3A	-	-	ENSG00000095777		0.348	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	86	0.00	0	G	NM_017433	Intron	26446238	26446238	+1	no_errors	ENST00000265944	ensembl	human	known	69_37n	splice_site	94	24.19	30	SNP	1.000	A
NLRP8	126205	genome.wustl.edu	37	19	56466488	56466488	+	Missense_Mutation	SNP	C	C	T	rs532289570		TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr19:56466488C>T	ENST00000291971.3	+	3	1135	c.1064C>T	c.(1063-1065)cCg>cTg	p.P355L	NLRP8_ENST00000590542.1_Missense_Mutation_p.P355L	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	355	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.P355L(1)		breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GTAACCCTTCCGGGGTTTAAT	0.448													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22635	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	endometrium(1)											78.0	78.0	78.0					19																	56466488		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1064C>T	19.37:g.56466488C>T	ENSP00000291971:p.Pro355Leu		Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.P355L	ENST00000291971.3	37	c.1064	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.643841	0.00792	.	.	ENSG00000179709	ENST00000291971	T	0.77489	-1.1	1.78	-3.56	0.04626	.	.	.	.	.	T	0.34308	0.0893	N	0.00637	-1.305	0.09310	N	1	B;B	0.32717	0.381;0.128	B;B	0.20955	0.031;0.032	T	0.37174	-0.9717	9	0.24483	T	0.36	.	1.4551	0.02383	0.1974:0.259:0.3904:0.1532	.	355;355	Q86W28-2;Q86W28	.;NALP8_HUMAN	L	355	ENSP00000291971:P355L	ENSP00000291971:P355L	P	+	2	0	NLRP8	61158300	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.587000	0.23909	-0.994000	0.03463	0.514000	0.50259	CCG	NLRP8	-	NULL	ENSG00000179709		0.448	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	24	0.00	0	C	NM_176811		56466488	56466488	+1	no_errors	ENST00000291971	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.001	T
NRG1	3084	genome.wustl.edu	37	8	32620793	32620793	+	Intron	SNP	G	G	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr8:32620793G>T	ENST00000405005.3	+	12	1268				NRG1_ENST00000519301.1_Intron|NRG1_ENST00000356819.4_Intron|NRG1_ENST00000539990.1_Intron|NRG1_ENST00000287842.3_Intron|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000287845.5_Intron|NRG1_ENST00000521670.1_Missense_Mutation_p.Q442H			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.Q442Q(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		AATGCATGCAGATCCAGCTAT	0.383																																						dbGAP											1	Substitution - coding silent(1)	skin(1)											212.0	193.0	199.0					8																	32620793		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1269-473G>T	8.37:g.32620793G>T			A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EGF-like,pfscan_EG-like_dom,pfscan_Ig-like,prints_Neuregulin	p.Q442H	ENST00000405005.3	37	c.1326	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	G	12.15	1.851324	0.32699	.	.	ENSG00000157168	ENST00000521670	T	0.71103	-0.54	5.2	5.2	0.72013	.	.	.	.	.	T	0.69513	0.3119	N	0.08118	0	0.80722	D	1	P;D;D	0.60575	0.943;0.98;0.988	P;D;D	0.72338	0.781;0.948;0.977	T	0.75722	-0.3218	9	0.87932	D	0	.	14.0976	0.65034	0.0:0.0:1.0:0.0	.	288;438;442	B7Z1D7;B0FYA9;Q02297-3	.;.;.	H	442	ENSP00000428828:Q442H	ENSP00000428828:Q442H	Q	+	3	2	NRG1	32740335	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.695000	0.47043	2.702000	0.92279	0.650000	0.86243	CAG	NRG1	-	NULL	ENSG00000157168		0.383	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	76	0.00	0	G			32620793	32620793	+1	no_errors	ENST00000521670	ensembl	human	known	69_37n	missense	95	18.80	22	SNP	1.000	T
PCDHA1	56147	genome.wustl.edu	37	5	140167729	140167729	+	Silent	SNP	G	G	A	rs543937372		TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr5:140167729G>A	ENST00000504120.2	+	1	1854	c.1854G>A	c.(1852-1854)gcG>gcA	p.A618A	PCDHA1_ENST00000378133.3_Silent_p.A618A|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	618	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGCGGCGCGCGCATCCCGT	0.667																																						dbGAP											0													69.0	73.0	72.0					5																	140167729		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1854G>A	5.37:g.140167729G>A			O75288|Q9NRT7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A618	ENST00000504120.2	37	c.1854	CCDS54913.1	5																																																																																			PCDHA1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204970		0.667	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	9	0.00	0	G	NM_018900		140167729	140167729	+1	no_errors	ENST00000504120	ensembl	human	known	69_37n	silent	44	36.23	25	SNP	0.009	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	32	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	37	44.78	30	SNP	1.000	G
PSIP1	11168	genome.wustl.edu	37	9	15490026	15490026	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr9:15490026C>A	ENST00000380733.4	-	4	589	c.246G>T	c.(244-246)tgG>tgT	p.W82C	PSIP1_ENST00000380738.4_Missense_Mutation_p.W82C|PSIP1_ENST00000397519.2_Missense_Mutation_p.W82C|PSIP1_ENST00000380715.1_Missense_Mutation_p.W82C|PSIP1_ENST00000380716.4_Missense_Mutation_p.W82C			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	82					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		TATCTATCTCCCATAAACCTT	0.284																																						dbGAP											0													94.0	85.0	88.0					9																	15490026		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.246G>T	9.37:g.15490026C>A	ENSP00000370109:p.Trp82Cys		D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Missense_Mutation	SNP	pfam_LEDGF,pfam_PWWP,smart_PWWP,prints_Treacle-like_TCS,pfscan_PWWP	p.W82C	ENST00000380733.4	37	c.246	CCDS6479.1	9	.	.	.	.	.	.	.	.	.	.	C	23.5	4.422450	0.83559	.	.	ENSG00000164985	ENST00000380733;ENST00000380738;ENST00000380715;ENST00000380716;ENST00000397519	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.84206	0.5421	M	0.66939	2.045	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.973	D;D;D	0.85130	0.997;0.984;0.98	D	0.84478	0.0603	10	0.87932	D	0	.	20.301	0.98609	0.0:1.0:0.0:0.0	.	82;82;82	O75475-2;Q05CM9;O75475	.;.;PSIP1_HUMAN	C	82	ENSP00000370109:W82C;ENSP00000370114:W82C;ENSP00000370091:W82C;ENSP00000370092:W82C;ENSP00000380653:W82C	ENSP00000370091:W82C	W	-	3	0	PSIP1	15480026	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.546000	0.82137	2.809000	0.96659	0.555000	0.69702	TGG	PSIP1	-	NULL	ENSG00000164985		0.284	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	HGNC	protein_coding	OTTHUMT00000055445.1	67	0.00	0	C	NM_033222		15490026	15490026	-1	no_errors	ENST00000380733	ensembl	human	known	69_37n	missense	306	14.04	50	SNP	1.000	A
SEC14L6	730005	genome.wustl.edu	37	22	30921905	30921905	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr22:30921905C>T	ENST00000402034.2	-	9	678	c.679G>A	c.(679-681)Gag>Aag	p.E227K		NM_001193336.2	NP_001180265.2	B5MCN3	S14L6_HUMAN	SEC14-like 6 (S. cerevisiae)	227	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			lung(3)	3						TTTGTCAGCTCCTGCTTCCAG	0.597																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS54518.1	22q12.2	2011-05-06			ENSG00000214491	ENSG00000214491			40047	protein-coding gene	gene with protein product							Standard	NM_001193336		Approved		uc021wnu.1	B5MCN3	OTTHUMG00000151267	ENST00000402034.2:c.679G>A	22.37:g.30921905C>T	ENSP00000385695:p.Glu227Lys			Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.E227K	ENST00000402034.2	37	c.679	CCDS54518.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	10.03|10.03	1.237552|1.237552	0.22711|0.22711	.|.	.|.	ENSG00000214491|ENSG00000214491	ENST00000402034|ENST00000437871	T|.	0.27402|.	1.67|.	3.99|3.99	3.99|3.99	0.46301|0.46301	.|.	.|.	.|.	.|.	.|.	T|T	0.70824|0.70824	0.3268|0.3268	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.71632|0.71632	-0.4534|-0.4534	7|5	0.07175|.	T|.	0.84|.	-12.5561|-12.5561	15.6663|15.6663	0.77234|0.77234	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	K|E	227|31	ENSP00000385695:E227K|.	ENSP00000385695:E227K|.	E|G	-|-	1|2	0|0	SEC14L6|SEC14L6	29251905|29251905	0.796000|0.796000	0.28864|0.28864	0.184000|0.184000	0.23157|0.23157	0.094000|0.094000	0.18550|0.18550	4.457000|4.457000	0.60088|0.60088	1.767000|1.767000	0.52121|0.52121	0.430000|0.430000	0.28490|0.28490	GAG|GGA	SEC14L6	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000214491		0.597	SEC14L6-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	SEC14L6	HGNC	protein_coding	OTTHUMT00000322022.2	61	0.00	0	C			30921905	30921905	-1	no_errors	ENST00000402034	ensembl	human	novel	69_37n	missense	58	35.56	32	SNP	0.996	T
SYT8	90019	genome.wustl.edu	37	11	1855822	1855822	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr11:1855822G>T	ENST00000381968.3	+	1	149	c.21G>T	c.(19-21)tgG>tgT	p.W7C	SYT8_ENST00000436964.2_Intron|SYT8_ENST00000535046.1_Intron|SYT8_ENST00000341958.3_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	7					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCATGGCTGGCAAACCATGG	0.647																																						dbGAP											0													33.0	29.0	30.0					11																	1855822		2192	4297	6489	-	-	-	SO:0001583	missense	0			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.21G>T	11.37:g.1855822G>T	ENSP00000371394:p.Trp7Cys		A6NFJ4|Q9NSV9	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,pfscan_C2_membr_targeting	p.W7C	ENST00000381968.3	37	c.21	CCDS7726.2	11	.	.	.	.	.	.	.	.	.	.	g	6.455	0.452053	0.12283	.	.	ENSG00000149043	ENST00000381968;ENST00000381978	T	0.10005	2.92	3.06	1.17	0.20885	.	.	.	.	.	T	0.06416	0.0165	N	0.22421	0.69	0.09310	N	1	P	0.39060	0.657	B	0.34652	0.187	T	0.31503	-0.9941	9	0.72032	D	0.01	.	5.0623	0.14564	0.2838:0.0:0.7162:0.0	.	7	Q8NBV8	SYT8_HUMAN	C	7;1	ENSP00000371394:W7C	ENSP00000371394:W7C	W	+	3	0	SYT8	1812398	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.024000	0.13555	0.337000	0.23665	0.313000	0.20887	TGG	SYT8	-	NULL	ENSG00000149043		0.647	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT8	HGNC	protein_coding	OTTHUMT00000025013.4	45	0.00	0	G			1855822	1855822	+1	no_errors	ENST00000381968	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	0.000	T
ZNF451	26036	genome.wustl.edu	37	6	57012098	57012098	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JE-01A-11D-A13L-09	TCGA-D8-A1JE-10A-01D-A188-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bb34512b-2432-4256-968c-d7fdf38f126a	35afe2e2-1bdd-49ce-ba61-8a6f98749a17	g.chr6:57012098C>A	ENST00000370706.4	+	10	1459	c.1215C>A	c.(1213-1215)agC>agA	p.S405R	ZNF451_ENST00000357489.3_Missense_Mutation_p.S405R|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.S405R|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GCCACAGCAGCGAAGGGAACA	0.388																																						dbGAP											0													79.0	79.0	79.0					6																	57012098		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.1215C>A	6.37:g.57012098C>A	ENSP00000359740:p.Ser405Arg		Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S405R	ENST00000370706.4	37	c.1215	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	C	7.643	0.681350	0.14907	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.06687	3.27;3.27;3.27	5.2	0.293	0.15742	.	0.580068	0.19828	N	0.105152	T	0.02230	0.0069	L	0.44542	1.39	0.80722	D	1	B;B;P;B	0.38597	0.355;0.242;0.639;0.448	B;B;B;B	0.34038	0.128;0.06;0.174;0.06	T	0.52668	-0.8545	10	0.23302	T	0.38	-2.0261	9.546	0.39282	0.0:0.2424:0.0:0.7576	.	405;405;405;405	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	R	405	ENSP00000359740:S405R;ENSP00000350083:S405R;ENSP00000421645:S405R	ENSP00000350083:S405R	S	+	3	2	ZNF451	57120057	1.000000	0.71417	0.617000	0.29091	0.963000	0.63663	1.799000	0.38824	-0.199000	0.10317	-0.143000	0.13931	AGC	ZNF451	-	NULL	ENSG00000112200		0.388	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2	18	0.00	0	C	NM_015555		57012098	57012098	+1	no_errors	ENST00000370706	ensembl	human	known	69_37n	missense	23	37.84	14	SNP	0.977	A
