#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB5	340273	genome.wustl.edu	37	7	20778650	20778650	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr7:20778650C>T	ENST00000404938.2	+	24	3564	c.2912C>T	c.(2911-2913)aCg>aTg	p.T971M	ABCB5_ENST00000258738.6_Missense_Mutation_p.T526M	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	971	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)	p.T526M(1)|p.T971M(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATCGGAGAAACGCTCGTTTTG	0.418																																						dbGAP											2	Substitution - Missense(2)	prostate(2)											66.0	63.0	64.0					7																	20778650		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2912C>T	7.37:g.20778650C>T	ENSP00000384881:p.Thr971Met		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.T526M	ENST00000404938.2	37	c.1577	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425294	0.62733	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	T;T	0.79940	-1.32;-1.32	4.99	4.99	0.66335	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.324780	0.25978	N	0.027094	D	0.86012	0.5831	M	0.67953	2.075	0.48901	D	0.999725	D;D	0.63880	0.993;0.986	P;P	0.56514	0.8;0.765	D	0.86677	0.1914	10	0.56958	D	0.05	.	16.1633	0.81734	0.0:1.0:0.0:0.0	.	971;526	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	M	971;526	ENSP00000384881:T971M;ENSP00000258738:T526M	ENSP00000258738:T526M	T	+	2	0	ABCB5	20745175	0.996000	0.38824	1.000000	0.80357	0.276000	0.26787	5.624000	0.67764	2.774000	0.95407	0.484000	0.47621	ACG	ABCB5	-	superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000004846		0.418	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	74	0.00	0	C	NM_178559		20778650	20778650	+1	no_errors	ENST00000258738	ensembl	human	known	69_37n	missense	89	34.56	47	SNP	0.993	T
ACTL7B	10880	genome.wustl.edu	37	9	111617531	111617531	+	Missense_Mutation	SNP	C	C	G	rs575244865		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr9:111617531C>G	ENST00000374667.3	-	1	1708	c.680G>C	c.(679-681)gGt>gCt	p.G227A		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	227						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						GGTGAGGTCACCCCCAGCGTA	0.647																																						dbGAP											0													59.0	46.0	51.0					9																	111617531		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.680G>C	9.37:g.111617531C>G	ENSP00000363799:p.Gly227Ala		B2R9Q2|Q5JSV1	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.G227A	ENST00000374667.3	37	c.680	CCDS6771.1	9	.	.	.	.	.	.	.	.	.	.	C	10.44	1.351513	0.24512	.	.	ENSG00000148156	ENST00000374667	T	0.07688	3.17	4.63	4.63	0.57726	.	1.758260	0.03248	N	0.181460	T	0.09774	0.0240	N	0.16708	0.43	0.34639	D	0.720393	B	0.20052	0.041	B	0.21360	0.034	T	0.15037	-1.0451	10	0.87932	D	0	.	15.04	0.71781	0.0:1.0:0.0:0.0	.	227	Q9Y614	ACL7B_HUMAN	A	227	ENSP00000363799:G227A	ENSP00000363799:G227A	G	-	2	0	ACTL7B	110657352	0.000000	0.05858	0.790000	0.31976	0.122000	0.20287	0.546000	0.23284	2.401000	0.81631	0.655000	0.94253	GGT	ACTL7B	-	pfam_Actin-like,smart_Actin-like	ENSG00000148156		0.647	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7B	HGNC	protein_coding	OTTHUMT00000053571.1	15	0.00	0	C	NM_006686		111617531	111617531	-1	no_errors	ENST00000374667	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	0.991	G
AP1AR	55435	genome.wustl.edu	37	4	113189561	113189561	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr4:113189561G>A	ENST00000274000.5	+	10	1260	c.905G>A	c.(904-906)cGa>cAa	p.R302Q	AP1AR_ENST00000309703.6_Missense_Mutation_p.R269Q	NM_018569.4	NP_061039.3	Q63HQ0	AP1AR_HUMAN	adaptor-related protein complex 1 associated regulatory protein	302					cellular protein localization (GO:0034613)|negative regulation of cell motility (GO:2000146)|negative regulation of receptor recycling (GO:0001920)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|transport vesicle (GO:0030133)	AP-1 adaptor complex binding (GO:0035650)|kinesin binding (GO:0019894)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	9						CAACAGACTCGATAGGGTAAA	0.358																																						dbGAP											0													66.0	63.0	64.0					4																	113189561		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136628	CCDS3696.1, CCDS47125.1	4q25	2009-09-28	2009-09-25	2009-09-25	ENSG00000138660	ENSG00000138660			28808	protein-coding gene	gene with protein product	"""gamma1-adaptin brefeldin A resistance"""	610851	"""chromosome 4 open reading frame 16"""	C4orf16		15775984	Standard	NM_018569		Approved	PRO0971, 2C18, gamma-BAR	uc003iaj.4	Q63HQ0	OTTHUMG00000132849	ENST00000274000.5:c.905G>A	4.37:g.113189561G>A	ENSP00000274000:p.Arg302Gln		B2RCV7|Q96GG6|Q9H0V0|Q9P1L4	Missense_Mutation	SNP	NULL	p.R302Q	ENST00000274000.5	37	c.905	CCDS3696.1	4	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027896	0.75390	.	.	ENSG00000138660	ENST00000274000;ENST00000309703	T;T	0.59906	0.27;0.23	5.47	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.66327	0.2778	L	0.34521	1.04	0.41790	D	0.989868	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.70579	-0.4833	10	0.87932	D	0	-13.4973	14.5637	0.68159	0.0:0.1461:0.8539:0.0	.	269;302	Q63HQ0-2;Q63HQ0	.;AP1AR_HUMAN	Q	302;269	ENSP00000274000:R302Q;ENSP00000309023:R269Q	ENSP00000274000:R302Q	R	+	2	0	AP1AR	113409010	1.000000	0.71417	0.771000	0.31576	0.987000	0.75469	5.956000	0.70315	1.277000	0.44412	0.650000	0.86243	CGA	AP1AR	-	NULL	ENSG00000138660		0.358	AP1AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1AR	HGNC	protein_coding	OTTHUMT00000256323.2	37	0.00	0	G	NM_018569		113189561	113189561	+1	no_errors	ENST00000274000	ensembl	human	known	69_37n	missense	61	24.69	20	SNP	1.000	A
ARNTL	406	genome.wustl.edu	37	11	13381930	13381930	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr11:13381930A>T	ENST00000403290.1	+	9	773	c.418A>T	c.(418-420)Act>Tct	p.T140S	ARNTL_ENST00000389707.4_Missense_Mutation_p.T140S|ARNTL_ENST00000396441.3_Missense_Mutation_p.T140S|ARNTL_ENST00000361003.4_Missense_Mutation_p.T140S|ARNTL_ENST00000401424.1_Missense_Mutation_p.T97S|ARNTL_ENST00000389708.3_Missense_Mutation_p.T140S|ARNTL_ENST00000403510.3_Missense_Mutation_p.T97S|ARNTL_ENST00000403482.3_Missense_Mutation_p.T138S|ARNTL_ENST00000497429.1_3'UTR			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	140					circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		CTACAAACCAACTTTTCTATC	0.333																																						dbGAP											0													188.0	169.0	176.0					11																	13381930		2200	4294	6494	-	-	-	SO:0001583	missense	0			D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.418A>T	11.37:g.13381930A>T	ENSP00000384517:p.Thr140Ser		A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Missense_Mutation	SNP	pfam_PAS_fold,pfam_PAS_fold_3,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.T140S	ENST00000403290.1	37	c.418		11	.	.	.	.	.	.	.	.	.	.	A	8.382	0.837766	0.16891	.	.	ENSG00000133794	ENST00000396441;ENST00000389707;ENST00000401424;ENST00000530357;ENST00000403290;ENST00000361003;ENST00000389708;ENST00000403510;ENST00000339640;ENST00000403482	T;T;T;T;T;T;T;T;T	0.39592	3.33;3.33;3.32;1.07;3.33;2.88;3.29;3.33;3.29	5.87	4.74	0.60224	Helix-loop-helix DNA-binding (1);	0.111326	0.64402	D	0.000009	T	0.13072	0.0317	N	0.01779	-0.725	0.39437	D	0.96718	B;B;B;B;B;B	0.20261	0.043;0.001;0.0;0.0;0.0;0.001	B;B;B;B;B;B	0.17722	0.019;0.002;0.001;0.001;0.001;0.001	T	0.28073	-1.0055	10	0.02654	T	1	.	5.9657	0.19325	0.8284:0.0:0.1716:0.0	.	140;138;97;140;140;97	O00327-4;O00327-7;O00327-1;O00327;O00327-8;A2I2N6	.;.;.;BMAL1_HUMAN;.;.	S	140;140;97;97;140;140;140;97;96;138	ENSP00000379718:T140S;ENSP00000374357:T140S;ENSP00000385915:T97S;ENSP00000436313:T97S;ENSP00000384517:T140S;ENSP00000354278:T140S;ENSP00000374358:T140S;ENSP00000385581:T97S;ENSP00000385897:T138S	ENSP00000340289:T96S	T	+	1	0	ARNTL	13338506	0.996000	0.38824	0.997000	0.53966	0.996000	0.88848	2.652000	0.46682	2.371000	0.80710	0.533000	0.62120	ACT	ARNTL	-	superfamily_HLH_DNA-bd,prints_Nuc_translocat	ENSG00000133794		0.333	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	ARNTL	HGNC	protein_coding	OTTHUMT00000319173.1	119	0.00	0	A	NM_001178		13381930	13381930	+1	no_errors	ENST00000403290	ensembl	human	known	69_37n	missense	187	16.81	38	SNP	0.999	T
ASB5	140458	genome.wustl.edu	37	4	177142658	177142658	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr4:177142658C>A	ENST00000296525.3	-	4	591	c.478G>T	c.(478-480)Gcc>Tcc	p.A160S	ASB5_ENST00000511879.1_5'Flank|ASB5_ENST00000512254.1_Missense_Mutation_p.A107S	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	160					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		TGGGCTTTGGCACCATACTCC	0.498																																						dbGAP											0													127.0	118.0	121.0					4																	177142658		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.478G>T	4.37:g.177142658C>A	ENSP00000296525:p.Ala160Ser		Q8N7B5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.A160S	ENST00000296525.3	37	c.478	CCDS3827.1	4	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128253	0.77549	.	.	ENSG00000164122	ENST00000296525;ENST00000512254	T;T	0.61742	0.08;0.08	5.91	5.91	0.95273	Ankyrin repeat-containing domain (4);	0.047864	0.85682	D	0.000000	T	0.79423	0.4443	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	0.99;1.0	D;D	0.79784	0.957;0.993	T	0.81165	-0.1057	10	0.87932	D	0	-19.3809	19.2865	0.94077	0.0:1.0:0.0:0.0	.	160;107	Q8WWX0;Q8N7B5	ASB5_HUMAN;.	S	160;107	ENSP00000296525:A160S;ENSP00000422877:A107S	ENSP00000296525:A160S	A	-	1	0	ASB5	177379652	1.000000	0.71417	0.975000	0.42487	0.140000	0.21249	7.014000	0.76380	2.802000	0.96397	0.655000	0.94253	GCC	ASB5	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000164122		0.498	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB5	HGNC	protein_coding	OTTHUMT00000362344.1	38	0.00	0	C			177142658	177142658	-1	no_errors	ENST00000296525	ensembl	human	known	69_37n	missense	70	30.00	30	SNP	1.000	A
BCL11B	64919	genome.wustl.edu	37	14	99697761	99697761	+	Silent	SNP	G	G	A	rs546785434		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr14:99697761G>A	ENST00000357195.3	-	3	570	c.561C>T	c.(559-561)agC>agT	p.S187S	BCL11B_ENST00000443726.2_Intron|BCL11B_ENST00000345514.2_Intron	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	187					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CCGGGCGCGCGCTGCAGCACG	0.677			T	TLX3	T-ALL								G|||	1	0.000199681	0.0008	0.0	5008	,	,		10334	0.0		0.0	False		,,,				2504	0.0					dbGAP		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	0													21.0	23.0	22.0					14																	99697761		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.561C>T	14.37:g.99697761G>A			Q9H162	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S187	ENST00000357195.3	37	c.561	CCDS9950.1	14																																																																																			BCL11B	-	NULL	ENSG00000127152		0.677	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL11B	HGNC	protein_coding	OTTHUMT00000072332.2	20	0.00	0	G	NM_138576		99697761	99697761	-1	no_errors	ENST00000357195	ensembl	human	known	69_37n	silent	20	44.44	16	SNP	0.968	A
BMP2	650	genome.wustl.edu	37	20	6759436	6759436	+	Missense_Mutation	SNP	G	G	C	rs147542801	byFrequency	TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr20:6759436G>C	ENST00000378827.4	+	3	2110	c.891G>C	c.(889-891)aaG>aaC	p.K297N		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	297					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						CCAGCTGTAAGAGACACCCTT	0.502																																						dbGAP											0													140.0	117.0	124.0					20																	6759436		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.891G>C	20.37:g.6759436G>C	ENSP00000368104:p.Lys297Asn			Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.K297N	ENST00000378827.4	37	c.891	CCDS13099.1	20	.	.	.	.	.	.	.	.	.	.	G	14.93	2.683875	0.47991	.	.	ENSG00000125845	ENST00000378827	T	0.63255	-0.03	5.5	3.51	0.40186	Transforming growth factor-beta, C-terminal (3);	0.083581	0.85682	D	0.000000	T	0.59280	0.2182	L	0.57536	1.79	0.48087	D	0.999581	P	0.51537	0.946	P	0.45998	0.5	T	0.63559	-0.6610	10	0.87932	D	0	.	8.3286	0.32173	0.2649:0.0:0.7351:0.0	.	297	P12643	BMP2_HUMAN	N	297	ENSP00000368104:K297N	ENSP00000368104:K297N	K	+	3	2	BMP2	6707436	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.029000	0.41098	1.426000	0.47256	0.650000	0.86243	AAG	BMP2	-	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	ENSG00000125845		0.502	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP2	HGNC	protein_coding	OTTHUMT00000077918.3	60	0.00	0	G			6759436	6759436	+1	no_errors	ENST00000378827	ensembl	human	known	69_37n	missense	108	18.18	24	SNP	1.000	C
BRE	9577	genome.wustl.edu	37	2	28117484	28117484	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:28117484G>A	ENST00000342045.2	+	3	202	c.61G>A	c.(61-63)Gtg>Atg	p.V21M	BRE_ENST00000603461.1_Intron|BRE_ENST00000344773.2_Missense_Mutation_p.V21M|BRE_ENST00000379624.1_Missense_Mutation_p.V21M|BRE_ENST00000379632.2_Missense_Mutation_p.V21M|BRE_ENST00000361704.2_Missense_Mutation_p.V21M	NM_199194.2	NP_954664.1			brain and reproductive organ-expressed (TNFRSF1A modulator)											NS(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(2)	23	Acute lymphoblastic leukemia(172;0.155)					CATATCTAGCGTGGTCCGGAA	0.423																																						dbGAP											0													236.0	217.0	223.0					2																	28117484		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015767	CCDS1763.1, CCDS1764.1, CCDS1765.1	2p23	2008-02-05			ENSG00000158019	ENSG00000158019			1106	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 4"""	610497				9737713, 7826398	Standard	NM_004899		Approved	BRCC45, BRCC4	uc002rls.3	Q9NXR7	OTTHUMG00000097831	ENST00000342045.2:c.61G>A	2.37:g.28117484G>A	ENSP00000339371:p.Val21Met			Missense_Mutation	SNP	pfam_Brain/reproduct-express_prot	p.V21M	ENST00000342045.2	37	c.61	CCDS1763.1	2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307617	0.81247	.	.	ENSG00000158019	ENST00000436924;ENST00000344773;ENST00000379624;ENST00000342045;ENST00000379632;ENST00000361704;ENST00000379629	.	.	.	5.91	5.03	0.67393	.	0.062851	0.64402	D	0.000007	T	0.61236	0.2331	L	0.52573	1.65	0.48040	D	0.999572	B;P;P;B	0.49961	0.422;0.903;0.93;0.028	B;P;P;B	0.49853	0.033;0.624;0.49;0.006	T	0.65393	-0.6179	9	0.72032	D	0.01	-11.0802	13.9931	0.64378	0.0733:0.0:0.9267:0.0	.	21;21;21;21	Q9NXR7-1;Q9NXR7;Q9NXR7-4;Q9NXR7-3	.;BRE_HUMAN;.;.	M	21	.	ENSP00000339371:V21M	V	+	1	0	BRE	27970988	1.000000	0.71417	0.986000	0.45419	0.969000	0.65631	6.669000	0.74462	1.505000	0.48720	0.655000	0.94253	GTG	BRE	-	pfam_Brain/reproduct-express_prot	ENSG00000158019		0.423	BRE-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BRE	HGNC	protein_coding	OTTHUMT00000215114.1	103	0.00	0	G			28117484	28117484	+1	no_errors	ENST00000344773	ensembl	human	known	69_37n	missense	149	12.35	21	SNP	0.998	A
BTLA	151888	genome.wustl.edu	37	3	112185099	112185099	+	Silent	SNP	A	A	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr3:112185099A>C	ENST00000334529.5	-	5	928	c.726T>G	c.(724-726)gtT>gtG	p.V242V	BTLA_ENST00000474965.1_5'UTR|BTLA_ENST00000383680.4_Silent_p.V194V	NM_181780.3	NP_861445	Q7Z6A9	BTLA_HUMAN	B and T lymphocyte associated	242					immune response-regulating cell surface receptor signaling pathway (GO:0002768)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of B cell proliferation (GO:0030889)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|cervix(2)|large_intestine(1)|lung(5)|prostate(1)	11		Acute lymphoblastic leukemia(4;1.34e-07)|all_hematologic(4;0.000361)				GATTAGAATAAACTTCAGACC	0.418																																						dbGAP											0													99.0	95.0	97.0					3																	112185099		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY293286	CCDS33819.1, CCDS43130.1	3q13.2	2013-01-11			ENSG00000186265	ENSG00000186265		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21087	protein-coding gene	gene with protein product		607925				12796776	Standard	NM_001085357		Approved	BTLA1, CD272	uc003dza.4	Q7Z6A9	OTTHUMG00000159255	ENST00000334529.5:c.726T>G	3.37:g.112185099A>C			Q3B831|Q3HS85|Q6ZNH9	Silent	SNP	smart_Ig_sub,pfscan_Ig-like	p.V242	ENST00000334529.5	37	c.726	CCDS33819.1	3																																																																																			BTLA	-	NULL	ENSG00000186265		0.418	BTLA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTLA	HGNC	protein_coding	OTTHUMT00000354101.1	35	0.00	0	A	NM_181780		112185099	112185099	-1	no_errors	ENST00000334529	ensembl	human	known	69_37n	silent	66	12.00	9	SNP	0.439	C
C17orf97	400566	genome.wustl.edu	37	17	262973	262973	+	Silent	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr17:262973G>A	ENST00000360127.6	+	2	355	c.339G>A	c.(337-339)ccG>ccA	p.P113P	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	113										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						AGAGCCAGCCGCTTTCTTCCT	0.512																																						dbGAP											0													121.0	110.0	114.0					17																	262973		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.339G>A	17.37:g.262973G>A			A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	NULL	p.P113	ENST00000360127.6	37	c.339	CCDS32519.2	17																																																																																			C17orf97	-	NULL	ENSG00000187624		0.512	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf97	HGNC	protein_coding	OTTHUMT00000255648.4	78	0.00	0	G	NM_001013672		262973	262973	+1	no_errors	ENST00000360127	ensembl	human	known	69_37n	silent	102	22.39	30	SNP	0.000	A
C1orf141	400757	genome.wustl.edu	37	1	67581050	67581050	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:67581050C>A	ENST00000371007.2	-	5	440	c.331G>T	c.(331-333)Gaa>Taa	p.E111*	C1orf141_ENST00000371006.1_Nonsense_Mutation_p.E111*|C1orf141_ENST00000544837.1_Nonsense_Mutation_p.E111*	NM_001276351.1	NP_001263280.1	Q5JVX7	CA141_HUMAN	chromosome 1 open reading frame 141	111										NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18						GACTCACTTTCTTTATTTTTT	0.284																																						dbGAP											0													47.0	48.0	47.0					1																	67581050		2189	4274	6463	-	-	-	SO:0001587	stop_gained	0			BC090886	CCDS30745.1, CCDS72804.1	1p31.2	2012-07-23			ENSG00000203963	ENSG00000203963			32044	protein-coding gene	gene with protein product							Standard	NM_001276351		Approved		uc001ddm.2	Q5JVX7	OTTHUMG00000009406	ENST00000371007.2:c.331G>T	1.37:g.67581050C>A	ENSP00000360046:p.Glu111*		Q0P5P5|Q5JVX5	Nonsense_Mutation	SNP	NULL	p.E111*	ENST00000371007.2	37	c.331	CCDS30745.1	1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.623943	0.28889	.	.	ENSG00000203963	ENST00000371007;ENST00000371006;ENST00000544837;ENST00000371005;ENST00000448166	.	.	.	3.94	2.03	0.26663	.	0.229124	0.22466	N	0.059694	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.5574	5.3854	0.16215	0.0:0.682:0.2066:0.1114	.	.	.	.	X	111	.	ENSP00000360044:E111X	E	-	1	0	C1orf141	67353638	1.000000	0.71417	0.724000	0.30704	0.042000	0.13812	1.537000	0.36083	0.614000	0.30107	-0.136000	0.14681	GAA	C1orf141	-	NULL	ENSG00000203963		0.284	C1orf141-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf141	HGNC	protein_coding	OTTHUMT00000026096.2	68	0.00	0	C	NM_001013674		67581050	67581050	-1	no_errors	ENST00000371006	ensembl	human	known	69_37n	nonsense	91	13.33	14	SNP	0.825	A
TOPAZ1	375337	genome.wustl.edu	37	3	44285298	44285298	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr3:44285298C>T	ENST00000309765.4	+	2	1468	c.1300C>T	c.(1300-1302)Ccg>Tcg	p.P434S		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	434						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										TGCTTCAGAGCCGTTAGGTTA	0.358																																						dbGAP											0													54.0	49.0	51.0					3																	44285298		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.1300C>T	3.37:g.44285298C>T	ENSP00000310303:p.Pro434Ser			Missense_Mutation	SNP	NULL	p.P434S	ENST00000309765.4	37	c.1300	CCDS46809.1	3	.	.	.	.	.	.	.	.	.	.	C	0.713	-0.786575	0.02907	.	.	ENSG00000173769	ENST00000309765	T	0.09911	2.93	5.55	-2.26	0.06867	.	0.708561	0.13736	N	0.366333	T	0.03915	0.0110	N	0.17082	0.46	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.41910	-0.9482	10	0.12766	T	0.61	1.7806	0.1413	0.00084	0.2562:0.1842:0.2527:0.307	.	434	Q8N9V7	CC077_HUMAN	S	434	ENSP00000310303:P434S	ENSP00000310303:P434S	P	+	1	0	C3orf77	44260302	0.000000	0.05858	0.028000	0.17463	0.244000	0.25665	-0.369000	0.07533	-0.412000	0.07519	0.650000	0.86243	CCG	C3orf77	-	NULL	ENSG00000173769		0.358	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf77	HGNC	protein_coding	OTTHUMT00000343247.1	23	0.00	0	C	NM_001145030		44285298	44285298	+1	no_errors	ENST00000309765	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.007	T
C5orf42	65250	genome.wustl.edu	37	5	37169272	37169272	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr5:37169272T>G	ENST00000508244.1	-	33	6947	c.6854A>C	c.(6853-6855)aAt>aCt	p.N2285T	C5orf42_ENST00000274258.7_Missense_Mutation_p.N1165T|C5orf42_ENST00000425232.2_Missense_Mutation_p.N2285T			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2285						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTGGCTTACATTCAAATGGGA	0.448																																						dbGAP											0													110.0	110.0	110.0					5																	37169272		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6854A>C	5.37:g.37169272T>G	ENSP00000421690:p.Asn2285Thr		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.N2285T	ENST00000508244.1	37	c.6854	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	T	9.347	1.064437	0.20067	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.26957	1.73;1.73;1.7;1.7	5.53	2.99	0.34606	.	0.341047	0.21888	N	0.067621	T	0.35248	0.0925	L	0.54323	1.7	0.09310	N	1	D;D	0.63880	0.977;0.993	P;P	0.57057	0.787;0.812	T	0.11891	-1.0569	10	0.62326	D	0.03	.	7.3951	0.26931	0.0:0.074:0.1431:0.7828	.	2285;1165	E9PH94;Q9H799	.;CE042_HUMAN	T	2285;2285;1165;1333;1165	ENSP00000421690:N2285T;ENSP00000389014:N2285T;ENSP00000274258:N1165T;ENSP00000424223:N1333T	ENSP00000274258:N1165T	N	-	2	0	C5orf42	37205029	0.001000	0.12720	0.021000	0.16686	0.247000	0.25773	0.523000	0.22925	0.322000	0.23283	0.533000	0.62120	AAT	C5orf42	-	NULL	ENSG00000197603		0.448	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	96	0.00	0	T	NM_023073		37169272	37169272	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	missense	128	15.23	23	SNP	0.095	G
CAMKV	79012	genome.wustl.edu	37	3	49898960	49898960	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr3:49898960G>A	ENST00000477224.1	-	5	831	c.353C>T	c.(352-354)tCg>tTg	p.S118L	RN7SL217P_ENST00000584520.1_RNA|CAMKV_ENST00000466940.1_Intron|CAMKV_ENST00000467248.1_Missense_Mutation_p.S43L|CAMKV_ENST00000488336.1_Missense_Mutation_p.S118L|CAMKV_ENST00000296471.7_Missense_Mutation_p.S118L|CAMKV_ENST00000498324.1_5'UTR|CAMKV_ENST00000463537.1_Missense_Mutation_p.S118L			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	118	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GTCTCGCTCCGAGTAGTAGCC	0.612																																						dbGAP											0													108.0	87.0	94.0					3																	49898960		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.353C>T	3.37:g.49898960G>A	ENSP00000419195:p.Ser118Leu		A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S118L	ENST00000477224.1	37	c.353	CCDS33762.1	3	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477368	0.84640	.	.	ENSG00000164076	ENST00000296471;ENST00000488336;ENST00000463537;ENST00000477224;ENST00000467248;ENST00000480398	T;T;T;T;T;T	0.55052	2.5;2.5;0.84;2.5;0.54;0.54	5.25	5.25	0.73442	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.34853	N	0.003633	T	0.68760	0.3036	M	0.64260	1.97	0.80722	D	1	D;D;D;D	0.69078	0.991;0.993;0.993;0.997	P;P;P;P	0.61477	0.889;0.749;0.706;0.889	T	0.72265	-0.4344	10	0.87932	D	0	.	18.4692	0.90766	0.0:0.0:1.0:0.0	.	81;118;118;118	B4DMF2;Q8NCB2-2;Q8NCB2-3;Q8NCB2	.;.;.;CAMKV_HUMAN	L	118;118;118;118;43;31	ENSP00000296471:S118L;ENSP00000418809:S118L;ENSP00000417614:S118L;ENSP00000419195:S118L;ENSP00000420053:S43L;ENSP00000420000:S31L	ENSP00000296471:S118L	S	-	2	0	CAMKV	49873964	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.457000	0.83068	0.563000	0.77884	TCG	CAMKV	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000164076		0.612	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKV	HGNC	protein_coding	OTTHUMT00000350584.4	42	0.00	0	G	NM_024046		49898960	49898960	-1	no_errors	ENST00000477224	ensembl	human	known	69_37n	missense	28	39.13	18	SNP	1.000	A
CCDC62	84660	genome.wustl.edu	37	12	123262167	123262167	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr12:123262167C>T	ENST00000253079.6	+	2	510	c.166C>T	c.(166-168)Ctt>Ttt	p.L56F	CCDC62_ENST00000537566.1_5'UTR|CCDC62_ENST00000392441.4_Missense_Mutation_p.L56F	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	56					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		GCAACAGCTTCTTTCATGGGA	0.438																																						dbGAP											0													106.0	98.0	101.0					12																	123262167		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.166C>T	12.37:g.123262167C>T	ENSP00000253079:p.Leu56Phe		A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	superfamily_Prefoldin	p.L56F	ENST00000253079.6	37	c.166	CCDS9238.1	12	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131944	0.77662	.	.	ENSG00000130783	ENST00000253079;ENST00000392441	T;T	0.35421	1.31;1.31	5.87	4.94	0.65067	.	0.294694	0.28431	N	0.015361	T	0.55577	0.1929	M	0.63843	1.955	0.80722	D	1	P;D	0.76494	0.936;0.999	P;D	0.72075	0.64;0.976	T	0.43845	-0.9366	10	0.31617	T	0.26	-11.455	15.7641	0.78110	0.1363:0.8637:0.0:0.0	.	56;56	Q6P9F0-2;Q6P9F0	.;CCD62_HUMAN	F	56	ENSP00000253079:L56F;ENSP00000376236:L56F	ENSP00000253079:L56F	L	+	1	0	CCDC62	121828120	0.630000	0.27155	0.939000	0.37840	0.854000	0.48673	2.580000	0.46068	2.941000	0.99782	0.655000	0.94253	CTT	CCDC62	-	NULL	ENSG00000130783		0.438	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC62	HGNC	protein_coding	OTTHUMT00000400930.1	50	0.00	0	C	NM_032573		123262167	123262167	+1	no_errors	ENST00000253079	ensembl	human	known	69_37n	missense	78	15.05	14	SNP	0.971	T
CCR7	1236	genome.wustl.edu	37	17	38721654	38721654	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr17:38721654A>T	ENST00000246657.2	-	1	70	c.8T>A	c.(7-9)cTg>cAg	p.L3Q		NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	3					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				TCACTCACCCAGGTCCATGAC	0.592																																						dbGAP											0													144.0	113.0	124.0					17																	38721654		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.8T>A	17.37:g.38721654A>T	ENSP00000246657:p.Leu3Gln			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Chemokine_CCR7,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_Chemokine_CCR11,pfscan_GPCR_Rhodpsn_supfam	p.L3Q	ENST00000246657.2	37	c.8	CCDS11369.1	17	.	.	.	.	.	.	.	.	.	.	A	12.25	1.882786	0.33255	.	.	ENSG00000126353	ENST00000246657	T	0.61510	0.1	4.59	3.48	0.39840	.	6.654570	0.00481	N	0.000125	T	0.47340	0.1440	N	0.22421	0.69	0.80722	D	1	B	0.19583	0.037	B	0.15484	0.013	T	0.31888	-0.9927	10	0.51188	T	0.08	.	7.3185	0.26513	0.898:0.0:0.102:0.0	.	3	P32248	CCR7_HUMAN	Q	3	ENSP00000246657:L3Q	ENSP00000246657:L3Q	L	-	2	0	CCR7	35975180	1.000000	0.71417	0.994000	0.49952	0.653000	0.38743	0.763000	0.26517	0.847000	0.35167	0.450000	0.29827	CTG	CCR7	-	prints_Chemokine_CCR7	ENSG00000126353		0.592	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR7	HGNC	protein_coding	OTTHUMT00000257222.1	45	0.00	0	A			38721654	38721654	-1	no_errors	ENST00000246657	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	0.995	T
CDK16	5127	genome.wustl.edu	37	X	47088130	47088130	+	Splice_Site	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chrX:47088130G>T	ENST00000357227.4	+	16	1878	c.1454G>T	c.(1453-1455)gGc>gTc	p.G485V	CDK16_ENST00000457458.2_Splice_Site_p.G491V|CDK16_ENST00000518022.1_Splice_Site_p.G485V|CDK16_ENST00000276052.6_Splice_Site_p.G559V	NM_006201.4	NP_006192.1	Q00536	CDK16_HUMAN	cyclin-dependent kinase 16	485					exocytosis (GO:0006887)|growth hormone secretion (GO:0030252)|neuron projection development (GO:0031175)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|spermatogenesis (GO:0007283)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)	11						TCCCCCACAGGCAGGCCAGCT	0.637																																						dbGAP											0													108.0	72.0	84.0					X																	47088130		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS14276.1, CCDS48101.1, CCDS55408.1	Xp11	2011-11-08	2009-12-16	2009-12-16	ENSG00000102225	ENSG00000102225		"""Cyclin-dependent kinases"""	8749	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase"""	311550	"""PCTAIRE protein kinase 1"""	PCTK1		1437147, 19884882	Standard	NM_033018		Approved	PCTAIRE, PCTAIRE1, PCTGAIRE, FLJ16665	uc011mll.2	Q00536	OTTHUMG00000021438	ENST00000357227.4:c.1454-1G>T	X.37:g.47088130G>T			A8K280|B7Z7C8|J3KN74|J3KQP7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G559V	ENST00000357227.4	37	c.1676	CCDS14276.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.26|15.26	2.781963|2.781963	0.49891|0.49891	.|.	.|.	ENSG00000102225|ENSG00000102225	ENST00000520141|ENST00000457458;ENST00000357227;ENST00000540877;ENST00000540311;ENST00000518022;ENST00000276052;ENST00000523344	.|T;T;T;T;T	.|0.75260	.|-0.46;-0.46;-0.46;-0.51;-0.92	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.117336	.|0.56097	.|D	.|0.000027	T|T	0.65217|0.65217	0.2670|0.2670	N|N	0.25332|0.25332	0.735|0.735	0.80722|0.80722	D|D	1|1	.|P;B;B	.|0.35456	.|0.502;0.142;0.076	.|B;B;B	.|0.34722	.|0.188;0.021;0.071	T|T	0.68700|0.68700	-0.5339|-0.5339	5|10	.|0.66056	.|D	.|0.02	.|.	16.0201|16.0201	0.80478|0.80478	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|559;590;485	.|B7Z7C8;B7Z8T0;Q00536	.|.;.;CDK16_HUMAN	S|V	80|491;485;590;437;485;559;249	.|ENSP00000405798:G491V;ENSP00000349762:G485V;ENSP00000429751:G485V;ENSP00000276052:G559V;ENSP00000428349:G249V	.|ENSP00000276052:G559V	A|G	+|+	1|2	0|0	CDK16|CDK16	46973074|46973074	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	2.639000|2.639000	0.46570|0.46570	2.498000|2.498000	0.84270|0.84270	0.513000|0.513000	0.50165|0.50165	GCA|GGC	CDK16	-	NULL	ENSG00000102225		0.637	CDK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK16	HGNC	protein_coding	OTTHUMT00000056406.2	49	0.00	0	G	NM_006201	Missense_Mutation	47088130	47088130	+1	no_errors	ENST00000276052	ensembl	human	known	69_37n	missense	66	15.19	12	SNP	1.000	T
CHML	1122	genome.wustl.edu	37	1	241798027	241798027	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:241798027C>A	ENST00000366553.1	-	1	1205	c.1042G>T	c.(1042-1044)Gaa>Taa	p.E348*	OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	348					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			CAAGATGATTCTGATGTCATT	0.388																																						dbGAP											0													131.0	132.0	132.0					1																	241798027		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1042G>T	1.37:g.241798027C>A	ENSP00000355511:p.Glu348*		B2RAB9|Q17RE0|Q9H1Y4	Nonsense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.E348*	ENST00000366553.1	37	c.1042	CCDS31073.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.371795	0.97511	.	.	ENSG00000203668	ENST00000366553	.	.	.	4.96	3.07	0.35406	.	0.498586	0.22367	U	0.061000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-8.6879	13.5032	0.61469	0.0:0.6804:0.3196:0.0	.	.	.	.	X	348	.	ENSP00000355511:E348X	E	-	1	0	CHML	239864650	1.000000	0.71417	0.955000	0.39395	0.983000	0.72400	3.059000	0.49947	0.788000	0.33755	-0.165000	0.13383	GAA	CHML	-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk	ENSG00000203668		0.388	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1	80	0.00	0	C	NM_001821		241798027	241798027	-1	no_errors	ENST00000366553	ensembl	human	known	69_37n	nonsense	96	11.93	13	SNP	1.000	A
CMYA5	202333	genome.wustl.edu	37	5	79030169	79030169	+	Missense_Mutation	SNP	T	T	G	rs374238063		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr5:79030169T>G	ENST00000446378.2	+	2	5612	c.5581T>G	c.(5581-5583)Ttg>Gtg	p.L1861V		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1861					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GAGAGAGAATTTGCCTTTGGA	0.343																																						dbGAP											0													85.0	83.0	84.0					5																	79030169		1822	4086	5908	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.5581T>G	5.37:g.79030169T>G	ENSP00000394770:p.Leu1861Val		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.L1861V	ENST00000446378.2	37	c.5581	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	T	11.74	1.728269	0.30593	.	.	ENSG00000164309	ENST00000446378	T	0.58940	0.3	5.42	-0.115	0.13560	.	0.232106	0.22115	N	0.064421	T	0.42720	0.1215	L	0.43923	1.385	0.09310	N	0.999999	B	0.17038	0.02	B	0.17433	0.018	T	0.34104	-0.9842	10	0.66056	D	0.02	.	4.8142	0.13358	0.0:0.1666:0.3035:0.5299	.	1861	Q8N3K9	CMYA5_HUMAN	V	1861	ENSP00000394770:L1861V	ENSP00000394770:L1861V	L	+	1	2	CMYA5	79065925	0.992000	0.36948	0.674000	0.29902	0.108000	0.19459	0.295000	0.19065	-0.235000	0.09767	-0.321000	0.08615	TTG	CMYA5	-	NULL	ENSG00000164309		0.343	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	43	0.00	0	T	NM_153610		79030169	79030169	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	29	38.30	18	SNP	0.456	G
CNKSR2	22866	genome.wustl.edu	37	X	21450849	21450849	+	Silent	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chrX:21450849C>T	ENST00000379510.3	+	3	384	c.348C>T	c.(346-348)acC>acT	p.T116T	CNKSR2_ENST00000279451.4_Silent_p.T116T|CNKSR2_ENST00000425654.2_Silent_p.T116T|CNKSR2_ENST00000543067.1_Silent_p.T116T	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	116	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ATGGGAGGACCAGCCGAAAAT	0.448																																						dbGAP											0													133.0	130.0	131.0					X																	21450849		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.348C>T	X.37:g.21450849C>T			B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Silent	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.T116	ENST00000379510.3	37	c.348	CCDS14198.1	X																																																																																			CNKSR2	-	pfam_CRIC_domain_Chordata	ENSG00000149970		0.448	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	66	0.00	0	C	NM_014927		21450849	21450849	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	silent	61	35.11	33	SNP	0.987	T
COL12A1	1303	genome.wustl.edu	37	6	75866154	75866154	+	Silent	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr6:75866154G>A	ENST00000322507.8	-	15	3378	c.3069C>T	c.(3067-3069)gtC>gtT	p.V1023V	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Silent_p.V1023V|COL12A1_ENST00000416123.2_Silent_p.V1023V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1023	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GGTAGTTGACGACTTTCCCTG	0.468																																						dbGAP											0													278.0	259.0	265.0					6																	75866154		1941	4144	6085	-	-	-	SO:0001819	synonymous_variant	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3069C>T	6.37:g.75866154G>A			O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.V1023	ENST00000322507.8	37	c.3069	CCDS43482.1	6																																																																																			COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.468	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	178	0.00	0	G	NM_004370		75866154	75866154	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	silent	219	36.60	127	SNP	0.000	A
CPS1	1373	genome.wustl.edu	37	2	211503908	211503908	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:211503908C>A	ENST00000233072.5	+	23	3060	c.2864C>A	c.(2863-2865)aCa>aAa	p.T955K	CPS1_ENST00000430249.2_Missense_Mutation_p.T961K|CPS1_ENST00000497121.1_3'UTR|CPS1_ENST00000451903.2_Missense_Mutation_p.T504K	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	955					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CCATCAGTAACAAACTATCTC	0.318																																						dbGAP											0													69.0	63.0	65.0					2																	211503908		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2864C>A	2.37:g.211503908C>A	ENSP00000233072:p.Thr955Lys		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE_1,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,smart_MGS-like_dom,prints_CbamoylP_synth_lsu_CPSase_dom,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.T961K	ENST00000233072.5	37	c.2882	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	28.0	4.879853	0.91740	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.98531	-4.98;-4.98;-4.98	5.26	5.26	0.73747	Pre-ATP-grasp fold (1);Carbamoyl-phosphate synthetase, large subunit, oligomerisation (2);	0.000000	0.85682	D	0.000000	D	0.99507	0.9824	H	0.99182	4.46	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97850	1.0274	10	0.87932	D	0	-8.6172	19.2249	0.93815	0.0:1.0:0.0:0.0	.	965;955	Q59HF8;P31327	.;CPSM_HUMAN	K	961;963;955;504	ENSP00000402608:T961K;ENSP00000233072:T955K;ENSP00000406136:T504K	ENSP00000233072:T955K	T	+	2	0	CPS1	211212153	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.914000	0.75764	2.618000	0.88619	0.650000	0.86243	ACA	CPS1	-	pfam_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_lsu_oligo,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.318	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	51	0.00	0	C			211503908	211503908	+1	no_errors	ENST00000430249	ensembl	human	known	69_37n	missense	74	35.65	41	SNP	1.000	A
CTAGE1	64693	genome.wustl.edu	37	18	19995860	19995860	+	5'Flank	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr18:19995860G>T	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.L639I			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					AAATTACCAAGATTATCTTTG	0.413																																						dbGAP											0													112.0	125.0	120.0					18																	19995860		2198	4299	6497	-	-	-	SO:0001631	upstream_gene_variant	0			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995860G>T	Exception_encountered		B0YIZ3	Missense_Mutation	SNP	NULL	p.L639I	ENST00000525417.1	37	c.1915		18	.	.	.	.	.	.	.	.	.	.	G	7.250	0.602950	0.13939	.	.	ENSG00000212710	ENST00000391403	T	0.09538	2.97	0.614	0.614	0.17603	.	.	.	.	.	T	0.14184	0.0343	M	0.68317	2.08	0.09310	N	0.999997	B	0.25390	0.125	B	0.34931	0.192	T	0.32587	-0.9901	7	.	.	.	.	.	.	.	.	639	Q96RT6	CTGE2_HUMAN	I	639	ENSP00000375220:L639I	.	L	-	1	0	CTAGE1	18249858	0.998000	0.40836	0.181000	0.23098	0.185000	0.23345	0.112000	0.15479	0.581000	0.29539	0.298000	0.19748	CTT	CTAGE1	-	NULL	ENSG00000212710		0.413	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	CTAGE1	HGNC	protein_coding	OTTHUMT00000386767.1	36	0.00	0	G	NM_022663, NM_172241		19995860	19995860	-1	no_errors	ENST00000391403	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	0.383	T
DICER1	23405	genome.wustl.edu	37	14	95582133	95582133	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr14:95582133G>A	ENST00000526495.1	-	13	2069	c.1778C>T	c.(1777-1779)tCg>tTg	p.S593L	DICER1_ENST00000527414.1_Missense_Mutation_p.S593L|DICER1_ENST00000541352.1_Missense_Mutation_p.S593L|DICER1_ENST00000343455.3_Missense_Mutation_p.S593L|DICER1_ENST00000393063.1_Missense_Mutation_p.S593L			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	593	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AGTATCAACCGACTTGGAACA	0.438			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																													dbGAP	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0													158.0	122.0	134.0					14																	95582133		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1778C>T	14.37:g.95582133G>A	ENSP00000437256:p.Ser593Leu		A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ,pfam_Dicer_dsRNA_binding_fold,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_PAZ,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_PAZ,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.S593L	ENST00000526495.1	37	c.1778	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902763	0.52227	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.72	4.95	4.95	0.65309	Helicase, C-terminal (1);	0.068020	0.64402	D	0.000008	T	0.29126	0.0724	N	0.02539	-0.55	0.80722	D	1	B	0.27351	0.176	B	0.21151	0.033	T	0.13415	-1.0510	10	0.26408	T	0.33	-7.373	18.5497	0.91058	0.0:0.0:1.0:0.0	.	593	Q9UPY3	DICER_HUMAN	L	593	ENSP00000343745:S593L;ENSP00000437256:S593L;ENSP00000376783:S593L;ENSP00000435681:S593L;ENSP00000444719:S593L	ENSP00000343745:S593L	S	-	2	0	DICER1	94651886	1.000000	0.71417	0.642000	0.29436	0.439000	0.31926	9.573000	0.98181	2.453000	0.82957	0.655000	0.94253	TCG	DICER1	-	pfscan_Helicase_C	ENSG00000100697		0.438	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1	45	0.00	0	G			95582133	95582133	-1	no_errors	ENST00000343455	ensembl	human	known	69_37n	missense	90	24.37	29	SNP	0.997	A
DLL1	28514	genome.wustl.edu	37	6	170592574	170592574	+	Missense_Mutation	SNP	C	C	T	rs370005717		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr6:170592574C>T	ENST00000366756.3	-	9	2126	c.1793G>A	c.(1792-1794)cGt>cAt	p.R598H		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	598					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		GTCCTTCTCACGCTGGCAGTT	0.637																																						dbGAP											0													189.0	167.0	175.0					6																	170592574		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.1793G>A	6.37:g.170592574C>T	ENSP00000355718:p.Arg598His		B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,smart_DSL,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_DSL,pfscan_EG-like_dom	p.R598H	ENST00000366756.3	37	c.1793	CCDS5313.1	6	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967652	0.92855	.	.	ENSG00000198719	ENST00000366756	D	0.86865	-2.18	5.38	5.38	0.77491	.	0.097389	0.64402	D	0.000002	D	0.92779	0.7704	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90559	0.4514	10	0.33141	T	0.24	.	19.4992	0.95086	0.0:1.0:0.0:0.0	.	598	O00548	DLL1_HUMAN	H	598	ENSP00000355718:R598H	ENSP00000355718:R598H	R	-	2	0	DLL1	170434499	0.998000	0.40836	0.979000	0.43373	0.996000	0.88848	7.233000	0.78125	2.689000	0.91719	0.655000	0.94253	CGT	DLL1	-	NULL	ENSG00000198719		0.637	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLL1	HGNC	protein_coding	OTTHUMT00000043254.1	69	0.00	0	C			170592574	170592574	-1	no_errors	ENST00000366756	ensembl	human	known	69_37n	missense	83	42.76	62	SNP	1.000	T
DOCK2	1794	genome.wustl.edu	37	5	169494675	169494675	+	Silent	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr5:169494675C>T	ENST00000256935.8	+	45	4709	c.4629C>T	c.(4627-4629)ttC>ttT	p.F1543F	DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Silent_p.F604F|DOCK2_ENST00000520908.1_Silent_p.F1035F	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1543	DHR-2.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.F1543F(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGGAGGCTTCGCCAAGTATG	0.552																																						dbGAP											1	Substitution - coding silent(1)	kidney(1)											139.0	132.0	134.0					5																	169494675		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4629C>T	5.37:g.169494675C>T			Q2M3I0|Q96AK7	Silent	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RR-like,smart_SH3_domain,pfscan_SH3_domain	p.F1543	ENST00000256935.8	37	c.4629	CCDS4371.1	5																																																																																			DOCK2	-	pfam_DOCK,superfamily_Cyt_c_dom	ENSG00000134516		0.552	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	78	0.00	0	C	NM_004946		169494675	169494675	+1	no_errors	ENST00000256935	ensembl	human	known	69_37n	silent	120	20.53	31	SNP	0.595	T
DRD2	1813	genome.wustl.edu	37	11	113283314	113283314	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr11:113283314C>G	ENST00000362072.3	-	7	1446	c.1102G>C	c.(1102-1104)Gag>Cag	p.E368Q	DRD2_ENST00000542968.1_Missense_Mutation_p.E368Q|DRD2_ENST00000355319.2_Missense_Mutation_p.E370Q|DRD2_ENST00000535984.1_5'Flank|DRD2_ENST00000544518.1_Missense_Mutation_p.E367Q|RP11-159N11.3_ENST00000546284.1_RNA|DRD2_ENST00000346454.3_Missense_Mutation_p.E339Q|DRD2_ENST00000538967.1_Missense_Mutation_p.E370Q	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	368	Interaction with PPP1R9B. {ECO:0000250}.				activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GCTTTCTTCTCCTTCTGCTGG	0.577																																						dbGAP											0													149.0	126.0	134.0					11																	113283314		2201	4296	6497	-	-	-	SO:0001583	missense	0			M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.1102G>C	11.37:g.113283314C>G	ENSP00000354859:p.Glu368Gln		Q9NZR3|Q9UPA9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Dopa_D2_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Dopamine_rcpt	p.E370Q	ENST00000362072.3	37	c.1108	CCDS8361.1	11	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949596	0.92660	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967	T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94	6.07	5.16	0.70880	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89908	0.6851	H	0.94808	3.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.995;1.0	D	0.92771	0.6232	10	0.87932	D	0	.	15.583	0.76459	0.0:0.9341:0.0:0.0659	.	367;339;368	F8VUV1;P14416-2;P14416	.;.;DRD2_HUMAN	Q	370;339;368;367;368;370	ENSP00000347474:E370Q;ENSP00000278597:E339Q;ENSP00000354859:E368Q;ENSP00000441068:E367Q;ENSP00000442172:E368Q;ENSP00000438215:E370Q	ENSP00000278597:E339Q	E	-	1	0	DRD2	112788524	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	1.577000	0.49804	0.655000	0.94253	GAG	DRD2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000149295		0.577	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRD2	HGNC	protein_coding	OTTHUMT00000395834.1	67	0.00	0	C	NM_000795		113283314	113283314	-1	no_errors	ENST00000355319	ensembl	human	known	69_37n	missense	126	20.75	33	SNP	1.000	G
EDN3	1908	genome.wustl.edu	37	20	57899430	57899430	+	Silent	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr20:57899430C>T	ENST00000337938.2	+	5	1019	c.633C>T	c.(631-633)caC>caT	p.H211H	EDN3_ENST00000395654.3_Silent_p.H197H|EDN3_ENST00000371025.3_3'UTR|EDN3_ENST00000311585.7_3'UTR|EDN3_ENST00000371028.2_Silent_p.H211H	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	211					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					TAGACCTCCACCATCCAAAGC	0.532																																						dbGAP											0													109.0	112.0	111.0					20																	57899430		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.633C>T	20.37:g.57899430C>T			E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Silent	SNP	pfam_Endothln-like_toxin,smart_Endothln-like_toxin,prints_Bibrotoxin/Sarafotoxin-D	p.H211	ENST00000337938.2	37	c.633	CCDS13477.1	20																																																																																			EDN3	-	NULL	ENSG00000124205		0.532	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDN3	HGNC	protein_coding	OTTHUMT00000079919.2	34	0.00	0	C	NM_000114		57899430	57899430	+1	no_errors	ENST00000337938	ensembl	human	known	69_37n	silent	44	25.42	15	SNP	0.000	T
ENAM	10117	genome.wustl.edu	37	4	71500234	71500234	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr4:71500234G>T	ENST00000396073.3	+	6	701	c.420G>T	c.(418-420)aaG>aaT	p.K140N		NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	140					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			GGCCTTTGAAGCAGCCATCAC	0.488																																						dbGAP											0													98.0	102.0	101.0					4																	71500234		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.420G>T	4.37:g.71500234G>T	ENSP00000379383:p.Lys140Asn		Q17RI5|Q9H3D1	Missense_Mutation	SNP	NULL	p.K140N	ENST00000396073.3	37	c.420	CCDS3544.2	4	.	.	.	.	.	.	.	.	.	.	G	9.401	1.077892	0.20227	.	.	ENSG00000132464	ENST00000396073	T	0.58358	0.34	5.6	1.73	0.24493	.	0.414013	0.20548	N	0.090172	T	0.34978	0.0916	L	0.38531	1.155	0.24382	N	0.994782	B	0.19073	0.033	B	0.19946	0.027	T	0.17198	-1.0377	10	0.25106	T	0.35	-0.5579	3.6447	0.08180	0.0821:0.1451:0.4737:0.2991	.	140	Q9NRM1	ENAM_HUMAN	N	140	ENSP00000379383:K140N	ENSP00000379383:K140N	K	+	3	2	ENAM	71719098	0.997000	0.39634	0.248000	0.24265	0.550000	0.35303	0.394000	0.20834	0.002000	0.14630	0.460000	0.39030	AAG	ENAM	-	NULL	ENSG00000132464		0.488	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	HGNC	protein_coding	OTTHUMT00000252166.3	69	0.00	0	G	NM_031889		71500234	71500234	+1	no_errors	ENST00000396073	ensembl	human	known	69_37n	missense	111	31.48	51	SNP	0.841	T
EPPK1	83481	genome.wustl.edu	37	8	144940706	144940706	+	Missense_Mutation	SNP	C	C	T	rs112377501	byFrequency	TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr8:144940706C>T	ENST00000525985.1	-	2	6787	c.6716G>A	c.(6715-6717)cGc>cAc	p.R2239H				P58107	EPIPL_HUMAN	epiplakin 1	2239						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.R2239H(2)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTTCTCCTGGCGGCCGGGCTG	0.701																																						dbGAP											2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)											61.0	61.0	61.0					8																	144940706		2173	4243	6416	-	-	-	SO:0001583	missense	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6716G>A	8.37:g.144940706C>T	ENSP00000436337:p.Arg2239His		Q76E58|Q9NSU9	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.R2239H	ENST00000525985.1	37	c.6716		8	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221029	0.58560	.	.	ENSG00000227184	ENST00000525985	T	0.73047	-0.71	4.67	3.7	0.42460	.	.	.	.	.	T	0.50854	0.1640	L	0.38175	1.15	0.25587	N	0.986731	P	0.43938	0.822	B	0.30179	0.112	T	0.49093	-0.8975	9	0.45353	T	0.12	.	5.4805	0.16721	0.0:0.7826:0.0:0.2174	.	2239	E9PPU0	.	H	2239	ENSP00000436337:R2239H	ENSP00000436337:R2239H	R	-	2	0	EPPK1	145012694	.	.	0.959000	0.39883	0.982000	0.71751	.	.	2.420000	0.82092	0.591000	0.81541	CGC	EPPK1	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000227184		0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	23	0.00	0	C	NM_031308		144940706	144940706	-1	no_errors	ENST00000525985	ensembl	human	known	69_37n	missense	50	18.03	11	SNP	0.950	T
FCRL4	83417	genome.wustl.edu	37	1	157557342	157557342	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:157557342G>A	ENST00000271532.1	-	5	706	c.571C>T	c.(571-573)Cca>Tca	p.P191S	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	191					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TCTGGATGTGGAAATAGTTCT	0.488																																						dbGAP											0													88.0	90.0	90.0					1																	157557342		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.571C>T	1.37:g.157557342G>A	ENSP00000271532:p.Pro191Ser		Q96PJ3|Q96RE0	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P191S	ENST00000271532.1	37	c.571	CCDS1166.1	1	.	.	.	.	.	.	.	.	.	.	G	7.020	0.558436	0.13436	.	.	ENSG00000163518	ENST00000271532	T	0.14516	2.5	4.71	0.664	0.17890	.	0.173822	0.27764	N	0.017960	T	0.01835	0.0058	N	0.15975	0.35	0.80722	D	1	B	0.24533	0.105	B	0.29440	0.102	T	0.37753	-0.9692	10	0.11794	T	0.64	.	4.1172	0.10088	0.2515:0.0:0.5847:0.1638	.	191	Q96PJ5	FCRL4_HUMAN	S	191	ENSP00000271532:P191S	ENSP00000271532:P191S	P	-	1	0	FCRL4	155823966	0.666000	0.27475	0.890000	0.34922	0.820000	0.46376	-0.249000	0.08842	0.031000	0.15407	0.467000	0.42956	CCA	FCRL4	-	NULL	ENSG00000163518		0.488	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL4	HGNC	protein_coding	OTTHUMT00000086180.1	54	0.00	0	G	NM_031282		157557342	157557342	-1	no_errors	ENST00000271532	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	0.978	A
FCRL3	115352	genome.wustl.edu	37	1	157650537	157650537	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:157650537T>C	ENST00000368184.3	-	13	2272	c.1981A>G	c.(1981-1983)Att>Gtt	p.I661V	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Missense_Mutation_p.I661V	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	661						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					TGGGAATAAATCGGGTTGCTA	0.418																																						dbGAP											0													145.0	142.0	143.0					1																	157650537		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1981A>G	1.37:g.157650537T>C	ENSP00000357167:p.Ile661Val		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I661V	ENST00000368184.3	37	c.1981	CCDS1167.1	1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.989398	0.00439	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.39787	1.06;1.06	3.54	-2.88	0.05682	.	3.062970	0.01796	N	0.032638	T	0.02571	0.0078	N	0.01188	-0.97	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.002	B;B;B	0.09377	0.002;0.004;0.004	T	0.11966	-1.0566	10	0.02654	T	1	.	0.6865	0.00884	0.1788:0.2723:0.1567:0.3922	.	661;566;661	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	V	661	ENSP00000357169:I661V;ENSP00000357167:I661V	ENSP00000292392:I661V	I	-	1	0	FCRL3	155917161	0.000000	0.05858	0.008000	0.14137	0.005000	0.04900	-3.155000	0.00580	-0.604000	0.05760	-0.908000	0.02827	ATT	FCRL3	-	NULL	ENSG00000160856		0.418	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	115	0.00	0	T	NM_052939		157650537	157650537	-1	no_errors	ENST00000368186	ensembl	human	known	69_37n	missense	149	18.13	33	SNP	0.010	C
F13B	2165	genome.wustl.edu	37	1	197032127	197032127	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:197032127A>C	ENST00000367412.1	-	2	168	c.125T>G	c.(124-126)tTt>tGt	p.F42C		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	42	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						AAAGCTTTTAAAAGTATAGTA	0.353																																						dbGAP											0													108.0	122.0	117.0					1																	197032127		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.125T>G	1.37:g.197032127A>C	ENSP00000356382:p.Phe42Cys		A8K3E5|Q5VYL5	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.F42C	ENST00000367412.1	37	c.125	CCDS1388.1	1	.	.	.	.	.	.	.	.	.	.	A	16.05	3.012410	0.54468	.	.	ENSG00000143278	ENST00000367412	T	0.28454	1.61	5.58	5.58	0.84498	Complement control module (2);Sushi/SCR/CCP (1);	0.000000	0.33792	N	0.004553	T	0.59959	0.2232	M	0.83953	2.67	0.53688	D	0.999978	D	0.89917	1.0	D	0.91635	0.999	T	0.66101	-0.6007	10	0.72032	D	0.01	.	15.7383	0.77863	1.0:0.0:0.0:0.0	.	42	P05160	F13B_HUMAN	C	42	ENSP00000356382:F42C	ENSP00000356382:F42C	F	-	2	0	F13B	195298750	1.000000	0.71417	0.875000	0.34327	0.328000	0.28507	6.082000	0.71318	2.120000	0.65058	0.533000	0.62120	TTT	F13B	-	superfamily_Complement_control_module,smart_Sushi_SCR_CCP	ENSG00000143278		0.353	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13B	HGNC	protein_coding	OTTHUMT00000088821.2	52	0.00	0	A	NM_001994		197032127	197032127	-1	no_errors	ENST00000367412	ensembl	human	known	69_37n	missense	62	19.48	15	SNP	1.000	C
FKBP3	2287	genome.wustl.edu	37	14	45599056	45599056	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr14:45599056T>G	ENST00000216330.3	-	4	669	c.259A>C	c.(259-261)Aat>Cat	p.N87H	FKBP3_ENST00000396062.3_Missense_Mutation_p.N87H			Q00688	FKBP3_HUMAN	FK506 binding protein 3, 25kDa	87					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			NS(1)|biliary_tract(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	12						AGCTTCACATTTTTTACTTGC	0.348																																						dbGAP											0													130.0	124.0	126.0					14																	45599056		2203	4300	6503	-	-	-	SO:0001583	missense	0			M96256	CCDS9683.1	14q21.2	2008-08-11	2002-08-29		ENSG00000100442	ENSG00000100442			3719	protein-coding gene	gene with protein product		186947	"""FK506-binding protein 3 (25kD)"""			1374240, 1532945	Standard	NM_002013		Approved	FKBP-25, PPIase	uc010tqf.2	Q00688	OTTHUMG00000140267	ENST00000216330.3:c.259A>C	14.37:g.45599056T>G	ENSP00000216330:p.Asn87His		B2R4Q9|Q14317	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom	p.N87H	ENST00000216330.3	37	c.259	CCDS9683.1	14	.	.	.	.	.	.	.	.	.	.	T	14.52	2.559782	0.45590	.	.	ENSG00000100442	ENST00000216330;ENST00000396062	T;T	0.57273	0.41;0.41	5.77	5.77	0.91146	.	0.965042	0.08659	N	0.912731	T	0.43077	0.1231	L	0.38175	1.15	0.26342	N	0.977349	B	0.33448	0.412	B	0.27262	0.078	T	0.34825	-0.9813	10	0.49607	T	0.09	.	9.557	0.39346	0.0:0.0794:0.0:0.9206	.	87	Q00688	FKBP3_HUMAN	H	87	ENSP00000216330:N87H;ENSP00000379374:N87H	ENSP00000216330:N87H	N	-	1	0	FKBP3	44668806	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.780000	0.38634	2.203000	0.70933	0.482000	0.46254	AAT	FKBP3	-	NULL	ENSG00000100442		0.348	FKBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP3	HGNC	protein_coding	OTTHUMT00000276796.1	183	0.00	0	T	NM_002013		45599056	45599056	-1	no_errors	ENST00000216330	ensembl	human	known	69_37n	missense	232	16.85	47	SNP	0.999	G
FMO2	2327	genome.wustl.edu	37	1	171162534	171162534	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:171162534G>T	ENST00000209929.7	+	3	351	c.193G>T	c.(193-195)Gaa>Taa	p.E65*	FMO2_ENST00000441535.1_Nonsense_Mutation_p.E65*|FMO2_ENST00000529935.1_3'UTR			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	65					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CACCAGCAAAGAAATGTCCTG	0.348																																						dbGAP											0													110.0	110.0	110.0					1																	171162534		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.193G>T	1.37:g.171162534G>T	ENSP00000209929:p.Glu65*		Q53XR0	Nonsense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_2,prints_Flavin_mOase_1,prints_Flavin_mOase_5	p.E65*	ENST00000209929.7	37	c.193	CCDS1293.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.705121	0.96812	.	.	ENSG00000094963	ENST00000209929;ENST00000441535	.	.	.	5.44	4.53	0.55603	.	0.045751	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.1196	13.6004	0.62015	0.0752:0.0:0.9248:0.0	.	.	.	.	X	65	.	ENSP00000209929:E65X	E	+	1	0	FMO2	169429158	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.405000	0.97313	1.293000	0.44690	0.655000	0.94253	GAA	FMO2	-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase	ENSG00000094963		0.348	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO2	HGNC	protein_coding	OTTHUMT00000086216.2	61	0.00	0	G	NM_001460		171162534	171162534	+1	no_errors	ENST00000209929	ensembl	human	known	69_37n	nonsense	73	12.05	10	SNP	1.000	T
GNG5P2	347687	genome.wustl.edu	37	X	109590108	109590108	+	Silent	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chrX:109590108C>T	ENST00000372054.1	-	1	93	c.30G>A	c.(28-30)acG>acA	p.T10T	AMMECR1_ENST00000372057.1_Intron					guanine nucleotide binding protein (G protein), gamma 5 pseudogene 2																		CCACTTTCTTCGTAGCGGCGA	0.612																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					Xq22.3	2008-11-05			ENSG00000133136	ENSG00000133136			24826	pseudogene	pseudogene						10819326	Standard	NG_002699		Approved				OTTHUMG00000022193	ENST00000372054.1:c.30G>A	X.37:g.109590108C>T				Silent	SNP	pfam_G-protein_gamma-like_dom,superfamily_G-protein_gamma-like_dom,smart_G-protein_gamma-like_dom,prints_Gprotein-gamma,pfscan_G-protein_gamma-like_dom	p.T10	ENST00000372054.1	37	c.30		X																																																																																			GNG5P2	-	pfam_G-protein_gamma-like_dom,superfamily_G-protein_gamma-like_dom,smart_G-protein_gamma-like_dom,prints_Gprotein-gamma,pfscan_G-protein_gamma-like_dom	ENSG00000133136		0.612	GNG5P2-001	KNOWN	basic|appris_principal	protein_coding	GNG5P2	HGNC	protein_coding	OTTHUMT00000057903.1	29	0.00	0	C	NG_002699		109590108	109590108	-1	no_errors	ENST00000372054	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	1.000	T
IBSP	3381	genome.wustl.edu	37	4	88723554	88723554	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr4:88723554C>T	ENST00000226284.5	+	2	108	c.41C>T	c.(40-42)gCc>gTc	p.A14V		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	14					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)		p.A14V(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		TTGGGAATGGCCTGTGCTTTC	0.284																																						dbGAP											1	Substitution - Missense(1)	lung(1)											63.0	62.0	62.0					4																	88723554		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.41C>T	4.37:g.88723554C>T	ENSP00000226284:p.Ala14Val			Missense_Mutation	SNP	pfam_BSP_II	p.A14V	ENST00000226284.5	37	c.41	CCDS3624.1	4	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979961	0.74360	.	.	ENSG00000029559	ENST00000226284	T	0.27402	1.67	5.48	4.61	0.57282	.	0.000000	0.64402	D	0.000004	T	0.26557	0.0649	L	0.36672	1.1	0.37972	D	0.933319	B	0.21225	0.053	B	0.25987	0.065	T	0.14559	-1.0468	10	0.87932	D	0	.	10.7803	0.46374	0.0:0.9062:0.0:0.0938	.	14	P21815	SIAL_HUMAN	V	14	ENSP00000226284:A14V	ENSP00000226284:A14V	A	+	2	0	IBSP	88942578	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	3.069000	0.50026	1.268000	0.44264	0.586000	0.80456	GCC	IBSP	-	NULL	ENSG00000029559		0.284	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBSP	HGNC	protein_coding	OTTHUMT00000253050.2	65	0.00	0	C			88723554	88723554	+1	no_errors	ENST00000226284	ensembl	human	known	69_37n	missense	76	20.00	19	SNP	1.000	T
IGLV2-33	28811	genome.wustl.edu	37	22	22930906	22930906	+	RNA	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr22:22930906G>T	ENST00000390302.2	+	0	159									immunoglobulin lambda variable 2-33 (non-functional)																		GGGGCTCCTGGACAGTCGGTC	0.557																																						dbGAP											0													180.0	181.0	181.0					22																	22930906		2051	4203	6254	-	-	-			0			Z73643		22q11.2	2012-02-08	2008-09-15		ENSG00000211656	ENSG00000211656		"""Immunoglobulins / IGL locus"""	5892	other	immunoglobulin gene			"""immunoglobulin lambda variable 2-33"""				Standard	NG_000002		Approved				OTTHUMG00000151178		22.37:g.22930906G>T				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_V-set_subgr,pfscan_Ig-like	p.G34V	ENST00000390302.2	37	c.101		22																																																																																			IGLV2-33	-	pfam_Ig_V-set,pfam_Immunoglobulin,pfscan_Ig-like	ENSG00000211656		0.557	IGLV2-33-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV2-33	HGNC	IG_V_gene	OTTHUMT00000321664.2	62	0.00	0	G	NG_000002		22930906	22930906	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390302	ensembl	human	known	69_37n	missense	60	38.14	37	SNP	0.724	T
IGLV3-25	28793	genome.wustl.edu	37	22	23029718	23029718	+	RNA	SNP	A	A	T	rs199561156	byFrequency	TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr22:23029718A>T	ENST00000390305.2	+	0	363									immunoglobulin lambda variable 3-25																		TATTACTGTCAATCAGCAGAC	0.527																																						dbGAP											0													84.0	83.0	83.0					22																	23029718		2047	4207	6254	-	-	-			0			X97474		22q11.2	2012-02-08			ENSG00000211659	ENSG00000211659		"""Immunoglobulins / IGL locus"""	5908	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151221		22.37:g.23029718A>T				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.Q107L	ENST00000390305.2	37	c.320		22																																																																																			IGLV3-25	-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211659		0.527	IGLV3-25-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV3-25	HGNC	IG_V_gene	OTTHUMT00000321825.1	40	0.00	0	A	NG_000002		23029718	23029718	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390305	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.008	T
INPP4A	3631	genome.wustl.edu	37	2	99175925	99175925	+	Splice_Site	SNP	G	G	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:99175925G>C	ENST00000523221.1	+	16	1837		c.e16-1		INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409540.3_Splice_Site|INPP4A_ENST00000074304.5_Splice_Site|INPP4A_ENST00000409851.3_Splice_Site|INPP4A_ENST00000409016.4_Splice_Site|INPP4A_ENST00000545415.1_Splice_Site			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa						inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						TTTCTGTGCAGATTGCAGTCC	0.507																																						dbGAP											0													117.0	113.0	114.0					2																	99175925		2018	4193	6211	-	-	-	SO:0001630	splice_region_variant	0			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1838-1G>C	2.37:g.99175925G>C			O15326|Q13187|Q53TD8|Q8TC02	Splice_Site	SNP	-	e16-1	ENST00000523221.1	37	c.1838-1	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457285	0.84317	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3732	0.90420	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	INPP4A	98542357	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.534000	0.82004	2.894000	0.99253	0.655000	0.94253	.	INPP4A	-	-	ENSG00000040933		0.507	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	HGNC	protein_coding	OTTHUMT00000376095.1	136	0.00	0	G	NM_001566	Intron	99175925	99175925	+1	no_errors	ENST00000074304	ensembl	human	known	69_37n	splice_site	196	28.99	80	SNP	1.000	C
KLHL13	90293	genome.wustl.edu	37	X	117053569	117053569	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chrX:117053569T>C	ENST00000262820.3	-	4	1394	c.485A>G	c.(484-486)gAc>gGc	p.D162G	KLHL13_ENST00000371878.1_Missense_Mutation_p.D111G|KLHL13_ENST00000371882.1_Missense_Mutation_p.D111G|KLHL13_ENST00000541812.1_Missense_Mutation_p.D146G|KLHL13_ENST00000371876.1_Missense_Mutation_p.D111G|KLHL13_ENST00000545703.1_Missense_Mutation_p.D120G|KLHL13_ENST00000540167.1_Missense_Mutation_p.D146G|KLHL13_ENST00000469946.1_Missense_Mutation_p.D111G|KLHL13_ENST00000539496.1_Missense_Mutation_p.D165G	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	162					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)				NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						TTGAAGGTTGTCCATATTAAG	0.368																																						dbGAP											0													73.0	77.0	76.0					X																	117053569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.485A>G	X.37:g.117053569T>C	ENSP00000262820:p.Asp162Gly		B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D165G	ENST00000262820.3	37	c.494	CCDS14571.1	X	.	.	.	.	.	.	.	.	.	.	T	9.235	1.036745	0.19669	.	.	ENSG00000003096	ENST00000371882;ENST00000371876;ENST00000371878;ENST00000447671;ENST00000541812;ENST00000540167;ENST00000539496;ENST00000262820;ENST00000545703;ENST00000469946	T;T;T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	5.07	5.07	0.68467	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.049472	0.85682	D	0.000000	T	0.50650	0.1628	N	0.16098	0.37	0.49483	D	0.999792	B;B;B;B	0.09022	0.002;0.001;0.001;0.001	B;B;B;B	0.15052	0.005;0.003;0.008;0.012	T	0.47923	-0.9079	10	0.46703	T	0.11	.	13.9563	0.64150	0.0:0.0:0.0:1.0	.	146;165;156;162	Q9P2N7-3;Q9P2N7-5;Q9P2N7-4;Q9P2N7	.;.;.;KLH13_HUMAN	G	111;111;111;111;146;146;165;162;120;111	ENSP00000360949:D111G;ENSP00000360943:D111G;ENSP00000360945:D111G;ENSP00000412640:D111G;ENSP00000444450:D146G;ENSP00000441029:D146G;ENSP00000443191:D165G;ENSP00000262820:D162G;ENSP00000440707:D120G;ENSP00000419803:D111G	ENSP00000262820:D162G	D	-	2	0	KLHL13	116937597	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	7.868000	0.87116	1.870000	0.54199	0.412000	0.27726	GAC	KLHL13	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000003096		0.368	KLHL13-201	KNOWN	basic|CCDS	protein_coding	KLHL13	HGNC	protein_coding		50	0.00	0	T	NM_033495		117053569	117053569	-1	no_errors	ENST00000539496	ensembl	human	known	69_37n	missense	44	36.23	25	SNP	1.000	C
KLK11	11012	genome.wustl.edu	37	19	51526351	51526351	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr19:51526351G>T	ENST00000594768.1	-	5	878	c.693C>A	c.(691-693)tgC>tgA	p.C231*	KLK11_ENST00000391804.3_Nonsense_Mutation_p.C224*|KLK11_ENST00000594458.1_5'Flank|KLK10_ENST00000391805.1_5'Flank|KLK11_ENST00000600362.1_Nonsense_Mutation_p.C58*|KLK11_ENST00000453757.3_Nonsense_Mutation_p.C199*|KLK11_ENST00000319720.7_Nonsense_Mutation_p.C199*	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	231	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		CACTGACCTGGCAGGAGTCCT	0.567																																						dbGAP											0													107.0	68.0	81.0					19																	51526351		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.693C>A	19.37:g.51526351G>T	ENSP00000473047:p.Cys231*		O75837|Q0WXX5|Q8IXD7|Q9NS65	Nonsense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.C231*	ENST00000594768.1	37	c.693	CCDS12818.1	19	.	.	.	.	.	.	.	.	.	.	g	33	5.210243	0.95069	.	.	ENSG00000167757	ENST00000391804;ENST00000319720;ENST00000453757;ENST00000319756	.	.	.	4.01	2.96	0.34315	.	0.000000	0.39759	U	0.001272	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.6038	0.33760	0.1185:0.0:0.8815:0.0	.	.	.	.	X	224;199;199;231	.	ENSP00000324269:C199X	C	-	3	2	KLK11	56218163	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	2.867000	0.48428	0.867000	0.35654	0.449000	0.29647	TGC	KLK11	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000167757		0.567	KLK11-002	KNOWN	basic|CCDS	protein_coding	KLK11	HGNC	protein_coding	OTTHUMT00000464314.2	63	0.00	0	G	NM_006853		51526351	51526351	-1	no_errors	ENST00000319756	ensembl	human	known	69_37n	nonsense	68	29.90	29	SNP	1.000	T
LOX	4015	genome.wustl.edu	37	5	121411136	121411136	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr5:121411136G>A	ENST00000231004.4	-	3	1140	c.841C>T	c.(841-843)Cga>Tga	p.R281*	LOX_ENST00000513319.1_5'UTR|SRFBP1_ENST00000504881.1_3'UTR	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	281	Lysyl-oxidase like.				blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		TATCTTGGTCGGCTGGGTAAG	0.443																																						dbGAP											0													130.0	124.0	126.0					5																	121411136		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.841C>T	5.37:g.121411136G>A	ENSP00000231004:p.Arg281*		B2R5Q3|Q5FWF0	Nonsense_Mutation	SNP	pfam_Lysyl_oxidase,prints_Lysyl_oxidase	p.R281*	ENST00000231004.4	37	c.841	CCDS4129.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.596672	0.98381	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	.	.	.	5.51	3.56	0.40772	.	0.055265	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1441	0.59450	0.0:0.0:0.5459:0.4541	.	.	.	.	X	281;241	.	ENSP00000231004:R281X	R	-	1	2	LOX	121439035	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	1.037000	0.30241	1.256000	0.44068	0.655000	0.94253	CGA	LOX	-	pfam_Lysyl_oxidase,prints_Lysyl_oxidase	ENSG00000113083		0.443	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOX	HGNC	protein_coding	OTTHUMT00000250887.2	119	0.00	0	G			121411136	121411136	-1	no_errors	ENST00000231004	ensembl	human	known	69_37n	nonsense	135	30.26	59	SNP	1.000	A
LRFN5	145581	genome.wustl.edu	37	14	42356316	42356316	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr14:42356316C>A	ENST00000298119.4	+	3	1677	c.488C>A	c.(487-489)cCt>cAt	p.P163H	LRFN5_ENST00000554171.1_Missense_Mutation_p.P163H|LRFN5_ENST00000554120.1_Missense_Mutation_p.P163H	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	163						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GAAACCATTCCTTGGGATGCT	0.418										HNSCC(30;0.082)																												dbGAP											0													85.0	72.0	77.0					14																	42356316		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.488C>A	14.37:g.42356316C>A	ENSP00000298119:p.Pro163His		B3KU78|Q86XL2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P163H	ENST00000298119.4	37	c.488	CCDS9678.1	14	.	.	.	.	.	.	.	.	.	.	C	18.00	3.526321	0.64860	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.60548	0.18;0.18;0.18	5.56	5.56	0.83823	.	0.000000	0.56097	D	0.000036	T	0.75817	0.3901	M	0.71920	2.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78074	-0.2346	10	0.87932	D	0	.	17.0193	0.86429	0.0:1.0:0.0:0.0	.	163;163	G3V364;Q96NI6	.;LRFN5_HUMAN	H	163	ENSP00000298119:P163H;ENSP00000451897:P163H;ENSP00000451067:P163H	ENSP00000298119:P163H	P	+	2	0	LRFN5	41426066	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.595000	0.87683	0.650000	0.86243	CCT	LRFN5	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000165379		0.418	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	HGNC	protein_coding	OTTHUMT00000276786.1	54	0.00	0	C	NM_152447		42356316	42356316	+1	no_errors	ENST00000298119	ensembl	human	known	69_37n	missense	60	21.05	16	SNP	1.000	A
LSM11	134353	genome.wustl.edu	37	5	157182067	157182067	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr5:157182067C>G	ENST00000286307.5	+	4	934	c.878C>G	c.(877-879)tCc>tGc	p.S293C		NM_173491.2	NP_775762.1	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	293					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	U7 snRNA binding (GO:0071209)			breast(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	7	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGGAGGAGTCCAGGTCAGAG	0.607																																						dbGAP											0													66.0	64.0	65.0					5																	157182067		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095592	CCDS4342.1	5q33.3	2008-02-05	2004-04-28		ENSG00000155858	ENSG00000155858			30860	protein-coding gene	gene with protein product			"""LSM11 homolog, U7 small nuclear RNA associated (S. cerevisiae)"""			12975319	Standard	NM_173491		Approved	FLJ38273	uc003lxe.1	P83369	OTTHUMG00000130255	ENST00000286307.5:c.878C>G	5.37:g.157182067C>G	ENSP00000286307:p.Ser293Cys		A0AVQ1|Q7Z7P0|Q8N975	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.S293C	ENST00000286307.5	37	c.878	CCDS4342.1	5	.	.	.	.	.	.	.	.	.	.	C	17.18	3.322729	0.60634	.	.	ENSG00000155858	ENST00000286307	.	.	.	5.52	5.52	0.82312	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.231038	0.35151	N	0.003401	T	0.51041	0.1651	N	0.08118	0	0.53688	D	0.999979	D	0.71674	0.998	P	0.59703	0.862	T	0.60586	-0.7234	9	0.59425	D	0.04	-14.3563	17.2387	0.87007	0.0:1.0:0.0:0.0	.	293	P83369	LSM11_HUMAN	C	293	.	ENSP00000286307:S293C	S	+	2	0	LSM11	157114645	0.992000	0.36948	1.000000	0.80357	0.992000	0.81027	1.118000	0.31246	2.597000	0.87782	0.655000	0.94253	TCC	LSM11	-	superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000155858		0.607	LSM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM11	HGNC	protein_coding	OTTHUMT00000252580.2	41	0.00	0	C	NM_173491		157182067	157182067	+1	no_errors	ENST00000286307	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	1.000	G
MADD	8567	genome.wustl.edu	37	11	47345258	47345258	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr11:47345258G>A	ENST00000311027.5	+	31	4579	c.4414G>A	c.(4414-4416)Gga>Aga	p.G1472R	MADD_ENST00000405573.2_Missense_Mutation_p.G282R|MADD_ENST00000349238.3_Missense_Mutation_p.G1433R|MADD_ENST00000407859.3_Missense_Mutation_p.G1390R|MADD_ENST00000402799.1_Missense_Mutation_p.G1370R|MADD_ENST00000402192.2_Missense_Mutation_p.G1412R|MADD_ENST00000406482.1_Missense_Mutation_p.G1370R|MADD_ENST00000342922.4_Missense_Mutation_p.G1413R|MADD_ENST00000395336.3_Missense_Mutation_p.G1472R|MADD_ENST00000395344.3_Missense_Mutation_p.G1366R	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TAGTAACATCGGAACAGTGTA	0.522																																						dbGAP											0													228.0	167.0	188.0					11																	47345258		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4414G>A	11.37:g.47345258G>A	ENSP00000310933:p.Gly1472Arg			Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.G1472R	ENST00000311027.5	37	c.4414	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.327520	0.95733	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.58358	2.75;2.61;2.64;2.73;2.79;2.61;2.62;2.81;2.75;0.34	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.73110	0.3545	M	0.67700	2.07	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.74466	-0.3656	10	0.87932	D	0	-20.9168	19.903	0.96995	0.0:0.0:1.0:0.0	.	282;1366;1366;1472;1370;1370;1370;1433;1390;1472;1413	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	R	1413;1370;1370;1370;1433;1472;1390;1366;1472;1412;282	ENSP00000343902:G1413R;ENSP00000385585:G1370R;ENSP00000384435:G1370R;ENSP00000304505:G1433R;ENSP00000310933:G1472R;ENSP00000384204:G1390R;ENSP00000378753:G1366R;ENSP00000378745:G1472R;ENSP00000384287:G1412R;ENSP00000384483:G282R	ENSP00000310933:G1472R	G	+	1	0	MADD	47301834	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.940000	0.92958	2.705000	0.92388	0.549000	0.68633	GGA	MADD	-	NULL	ENSG00000110514		0.522	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	66	0.00	0	G			47345258	47345258	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	missense	109	14.17	18	SNP	1.000	A
MAP1S	55201	genome.wustl.edu	37	19	17836889	17836889	+	Silent	SNP	C	C	T	rs181494116	byFrequency	TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr19:17836889C>T	ENST00000324096.4	+	5	847	c.696C>T	c.(694-696)tcC>tcT	p.S232S	MAP1S_ENST00000597681.1_Intron|MAP1S_ENST00000544059.2_Silent_p.S206S|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	232	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CCCCGACCTCCGGGGGCTTCC	0.662													C|||	2	0.000399361	0.0015	0.0	5008	,	,		14501	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													20.0	23.0	22.0					19																	17836889		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.696C>T	19.37:g.17836889C>T			B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	NULL	p.S232	ENST00000324096.4	37	c.696	CCDS32954.1	19																																																																																			MAP1S	-	NULL	ENSG00000130479		0.662	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1S	HGNC	protein_coding	OTTHUMT00000466027.1	27	0.00	0	C	NM_018174		17836889	17836889	+1	no_errors	ENST00000324096	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	0.002	T
MARK1	4139	genome.wustl.edu	37	1	220824018	220824018	+	Silent	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:220824018G>A	ENST00000366917.4	+	14	1793	c.1527G>A	c.(1525-1527)agG>agA	p.R509R	MARK1_ENST00000402574.1_Silent_p.R374R|MARK1_ENST00000366918.4_Silent_p.R487R					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TCTGTGAAAGGACCACAGATC	0.368																																						dbGAP											0													175.0	158.0	163.0					1																	220824018		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1527G>A	1.37:g.220824018G>A				Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R509	ENST00000366917.4	37	c.1527	CCDS31029.2	1																																																																																			MARK1	-	NULL	ENSG00000116141		0.368	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	60	0.00	0	G			220824018	220824018	+1	no_errors	ENST00000366917	ensembl	human	known	69_37n	silent	80	13.83	13	SNP	1.000	A
MATN2	4147	genome.wustl.edu	37	8	99028810	99028810	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr8:99028810C>T	ENST00000520016.1	+	10	1740	c.1616C>T	c.(1615-1617)tCg>tTg	p.S539L	MATN2_ENST00000524308.1_Missense_Mutation_p.S498L|MATN2_ENST00000254898.5_Missense_Mutation_p.S539L|MATN2_ENST00000522025.2_Missense_Mutation_p.S255L|MATN2_ENST00000521689.1_Missense_Mutation_p.S539L			O00339	MATN2_HUMAN	matrilin 2	539	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TGTGAACATTCGTGTGTAAGC	0.418																																						dbGAP											0													106.0	100.0	102.0					8																	99028810		1893	4124	6017	-	-	-	SO:0001583	missense	0			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1616C>T	8.37:g.99028810C>T	ENSP00000430487:p.Ser539Leu		A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_VWF_A	p.S539L	ENST00000520016.1	37	c.1616	CCDS55264.1	8	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.822482	0.00589	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016	D;D;D;D;D	0.97378	-2.17;-2.17;-4.36;-4.36;-2.17	5.68	1.95	0.26073	Epidermal growth factor-like (1);	0.520289	0.17794	N	0.161793	D	0.85423	0.5693	N	0.00746	-1.225	0.09310	N	1	B;B;B;B	0.09022	0.001;0.001;0.002;0.001	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.76697	-0.2864	10	0.10111	T	0.7	-0.062	8.3992	0.32574	0.0:0.622:0.0:0.378	.	498;539;539;539	C9JH87;E9PF03;O00339-2;O00339	.;.;.;MATN2_HUMAN	L	539;539;498;498;255;539	ENSP00000429977:S539L;ENSP00000254898:S539L;ENSP00000430221:S498L;ENSP00000429010:S255L;ENSP00000430487:S539L	ENSP00000254898:S539L	S	+	2	0	MATN2	99097986	0.237000	0.23815	0.026000	0.17262	0.011000	0.07611	0.974000	0.29436	0.079000	0.16929	0.563000	0.77884	TCG	MATN2	-	smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000132561		0.418	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	HGNC	protein_coding	OTTHUMT00000380332.1	73	0.00	0	C			99028810	99028810	+1	no_errors	ENST00000254898	ensembl	human	known	69_37n	missense	189	11.27	24	SNP	0.001	T
MGA	23269	genome.wustl.edu	37	15	42041686	42041686	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr15:42041686C>T	ENST00000570161.1	+	16	5881	c.5881C>T	c.(5881-5883)Cag>Tag	p.Q1961*	MGA_ENST00000545763.1_Nonsense_Mutation_p.Q1752*|MGA_ENST00000389936.4_Nonsense_Mutation_p.Q1922*|MGA_ENST00000219905.7_Nonsense_Mutation_p.Q1961*|MGA_ENST00000566586.1_Nonsense_Mutation_p.Q1752*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTCCATTCTTCAGCATGTTGC	0.443																																						dbGAP											0													40.0	39.0	39.0					15																	42041686		1883	4118	6001	-	-	-	SO:0001587	stop_gained	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5881C>T	15.37:g.42041686C>T	ENSP00000457035:p.Gln1961*		Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.Q1961*	ENST00000570161.1	37	c.5881	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.370340	0.95900	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	5.72	5.72	0.89469	.	0.123358	0.36482	N	0.002579	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	8.9672	0.35883	0.1489:0.7776:0.0:0.0734	.	.	.	.	X	1961;1922;1752	.	ENSP00000219905:Q1961X	Q	+	1	0	MGA	39828978	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	1.446000	0.35090	2.704000	0.92352	0.563000	0.77884	CAG	MGA	-	NULL	ENSG00000174197		0.443	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	15	0.00	0	C	NM_001164273.1		42041686	42041686	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	nonsense	9	35.71	5	SNP	1.000	T
WWP2	11060	genome.wustl.edu	37	16	69967002	69967002	+	Intron	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr16:69967002C>T	ENST00000359154.2	+	17	1783				WWP2_ENST00000448661.1_Intron|WWP2_ENST00000356003.2_Intron|WWP2_ENST00000544162.1_Intron|MIR140_ENST00000385282.1_RNA|WWP2_ENST00000568684.1_Intron|WWP2_ENST00000542271.1_Intron	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2						cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCTCTGTGTCCTGCCAGTGGT	0.582																																						dbGAP											0													78.0	72.0	74.0					16																	69967002		1565	3577	5142	-	-	-	SO:0001627	intron_variant	0			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1683-871C>T	16.37:g.69967002C>T			A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	RNA	SNP	-	NULL	ENST00000359154.2	37	NULL	CCDS10885.1	16																																																																																			MIR140	-	-	ENSG00000208017		0.582	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR140	HGNC	protein_coding	OTTHUMT00000268954.1	143	0.00	0	C	NM_007014		69967002	69967002	+1	no_errors	ENST00000385282	ensembl	human	known	69_37n	rna	131	44.49	105	SNP	1.000	T
N4BP2	55728	genome.wustl.edu	37	4	40121887	40121887	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr4:40121887C>A	ENST00000261435.6	+	9	2572	c.2156C>A	c.(2155-2157)tCt>tAt	p.S719Y		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	719					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						ACAGATAGTTCTATGGAGAGA	0.378																																						dbGAP											0													107.0	116.0	113.0					4																	40121887		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2156C>A	4.37:g.40121887C>A	ENSP00000261435:p.Ser719Tyr		A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.S719Y	ENST00000261435.6	37	c.2156	CCDS3457.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.023|0.023	-1.404042|-1.404042	0.01165|0.01165	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000513269|ENST00000261435;ENST00000381804	.|T	.|0.19250	.|2.16	5.64|5.64	2.77|2.77	0.32553|0.32553	.|.	.|1.045700	.|0.07449	.|N	.|0.898696	T|T	0.11196|0.11196	0.0273|0.0273	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|P;B	.|0.36959	.|0.575;0.44	.|B;B	.|0.34242	.|0.178;0.086	T|T	0.12915|0.12915	-1.0529|-1.0529	5|10	.|0.02654	.|T	.|1	0.5509|0.5509	5.9738|5.9738	0.19367|0.19367	0.1359:0.5832:0.0:0.2809|0.1359:0.5832:0.0:0.2809	.|.	.|719;719	.|Q86UW6-2;Q86UW6	.|.;N4BP2_HUMAN	L|Y	365|719;639	.|ENSP00000261435:S719Y	.|ENSP00000261435:S719Y	F|S	+|+	3|2	2|0	N4BP2|N4BP2	39798282|39798282	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.005000|0.005000	0.04900|0.04900	-0.270000|-0.270000	0.08584|0.08584	0.243000|0.243000	0.21327|0.21327	-0.300000|-0.300000	0.09419|0.09419	TTC|TCT	N4BP2	-	NULL	ENSG00000078177		0.378	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	HGNC	protein_coding	OTTHUMT00000250458.2	32	0.00	0	C	NM_018177		40121887	40121887	+1	no_errors	ENST00000261435	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.000	A
MYOZ2	51778	genome.wustl.edu	37	4	120072076	120072076	+	Silent	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr4:120072076C>A	ENST00000307128.5	+	3	339	c.126C>A	c.(124-126)atC>atA	p.I42I		NM_016599.4	NP_057683.1			myozenin 2											endometrium(1)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						CCAGAGACATCATGTTGGAAG	0.383																																						dbGAP											0													138.0	131.0	133.0					4																	120072076		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF249873	CCDS3711.1	4q26-q27	2014-09-17	2002-01-07	2002-01-11	ENSG00000172399	ENSG00000172399			1330	protein-coding gene	gene with protein product		605602	"""chromosome 4 open reading frame 5"""	C4orf5		8619474, 9110174	Standard	NM_016599		Approved	CS-1	uc003icp.4	Q9NPC6	OTTHUMG00000132968	ENST00000307128.5:c.126C>A	4.37:g.120072076C>A				Silent	SNP	pfam_Calsarcin-bd	p.I42	ENST00000307128.5	37	c.126	CCDS3711.1	4																																																																																			MYOZ2	-	pfam_Calsarcin-bd	ENSG00000172399		0.383	MYOZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOZ2	HGNC	protein_coding	OTTHUMT00000256526.2	86	0.00	0	C			120072076	120072076	+1	no_errors	ENST00000307128	ensembl	human	known	69_37n	silent	140	14.11	23	SNP	1.000	A
MND1	84057	genome.wustl.edu	37	4	154315444	154315444	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr4:154315444C>G	ENST00000504860.1	+	4	305	c.262C>G	c.(262-264)Cta>Gta	p.L88V	MND1_ENST00000240488.3_Missense_Mutation_p.L103V					meiotic nuclear divisions 1 homolog (S. cerevisiae)											large_intestine(2)|lung(1)	3	all_hematologic(180;0.093)					GCATGCAAGCCTACAGAAAAG	0.328																																						dbGAP											0													108.0	106.0	106.0					4																	154315444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY028916	CCDS3782.1, CCDS75202.1	4q31.3	2008-02-05			ENSG00000121211	ENSG00000121211			24839	protein-coding gene	gene with protein product		611422				11940665	Standard	NM_032117		Approved	GAJ	uc003ink.2	Q9BWT6	OTTHUMG00000161523	ENST00000504860.1:c.262C>G	4.37:g.154315444C>G	ENSP00000422933:p.Leu88Val			Missense_Mutation	SNP	pfam_Mnd1,pfam_Pencillinase_R,pirsf_Mnd1	p.L103V	ENST00000504860.1	37	c.307		4	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507086	0.27036	.	.	ENSG00000121211	ENST00000240488;ENST00000508731;ENST00000504860	.	.	.	5.72	3.97	0.46021	.	0.061993	0.64402	D	0.000005	T	0.44973	0.1319	L	0.33753	1.03	0.42276	D	0.992072	B	0.26577	0.153	B	0.28849	0.095	T	0.36986	-0.9725	9	0.51188	T	0.08	-10.7139	8.0338	0.30480	0.0:0.8116:0.0:0.1884	.	103	Q9BWT6	MND1_HUMAN	V	103;88;88	.	ENSP00000240488:L103V	L	+	1	2	MND1	154534894	0.067000	0.21026	0.524000	0.27887	0.951000	0.60555	0.210000	0.17455	0.752000	0.32923	0.655000	0.94253	CTA	MND1	-	pfam_Mnd1,pfam_Pencillinase_R,pirsf_Mnd1	ENSG00000121211		0.328	MND1-002	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	MND1	HGNC	protein_coding	OTTHUMT00000365195.1	79	0.00	0	C	NM_032117		154315444	154315444	+1	no_errors	ENST00000240488	ensembl	human	known	69_37n	missense	141	29.15	58	SNP	0.686	G
NAV3	89795	genome.wustl.edu	37	12	78443778	78443778	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr12:78443778G>T	ENST00000397909.2	+	10	2202	c.2029G>T	c.(2029-2031)Gac>Tac	p.D677Y	NAV3_ENST00000266692.7_Missense_Mutation_p.D677Y|NAV3_ENST00000228327.6_Missense_Mutation_p.D677Y|RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000536525.2_Missense_Mutation_p.D677Y			Q8IVL0	NAV3_HUMAN	neuron navigator 3	677				D -> G (in Ref. 1; CAD32554). {ECO:0000305}.		membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CCTAGGTGAAGACCCTGAAAC	0.348										HNSCC(70;0.22)																												dbGAP											0													72.0	71.0	71.0					12																	78443778		1843	4087	5930	-	-	-	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2029G>T	12.37:g.78443778G>T	ENSP00000381007:p.Asp677Tyr		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.D677Y	ENST00000397909.2	37	c.2029		12	.	.	.	.	.	.	.	.	.	.	G	28.6	4.931813	0.92389	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.76709	-1.04;2.48;2.48;2.48;2.48	5.74	5.74	0.90152	.	0.000000	0.41823	U	0.000815	D	0.88651	0.6494	M	0.74647	2.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.999	D	0.89039	0.3447	10	0.87932	D	0	-19.0253	19.9196	0.97082	0.0:0.0:1.0:0.0	.	677;677;677	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	Y	677	ENSP00000446628:D677Y;ENSP00000446132:D677Y;ENSP00000381007:D677Y;ENSP00000228327:D677Y;ENSP00000266692:D677Y	ENSP00000228327:D677Y	D	+	1	0	NAV3	76967909	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.708000	0.92522	0.650000	0.86243	GAC	NAV3	-	NULL	ENSG00000067798		0.348	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	53	0.00	0	G	NM_001024383		78443778	78443778	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	1.000	T
NCOA6	23054	genome.wustl.edu	37	20	33364231	33364231	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr20:33364231G>A	ENST00000374796.2	-	5	2826	c.256C>T	c.(256-258)Cag>Tag	p.Q86*	NCOA6_ENST00000359003.2_Nonsense_Mutation_p.Q86*			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	86	CREBBP-binding region.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TCCACCTTCTGTACTTTTAGC	0.453																																						dbGAP											0													87.0	83.0	85.0					20																	33364231		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.256C>T	20.37:g.33364231G>A	ENSP00000363929:p.Gln86*		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Nonsense_Mutation	SNP	NULL	p.Q86*	ENST00000374796.2	37	c.256	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	G	54	23.062935	0.99952	.	.	ENSG00000198646	ENST00000374796;ENST00000359003;ENST00000397675	.	.	.	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-3.2077	15.8811	0.79205	0.0:0.0:0.864:0.136	.	.	.	.	X	86	.	ENSP00000351894:Q86X	Q	-	1	0	NCOA6	32827892	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.172000	0.58243	2.882000	0.98803	0.655000	0.94253	CAG	NCOA6	-	NULL	ENSG00000198646		0.453	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	72	0.00	0	G	NM_014071		33364231	33364231	-1	no_errors	ENST00000359003	ensembl	human	known	69_37n	nonsense	92	32.85	45	SNP	1.000	A
NEDD9	4739	genome.wustl.edu	37	6	11191022	11191022	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr6:11191022G>C	ENST00000379446.5	-	5	1246	c.1080C>G	c.(1078-1080)gaC>gaG	p.D360E	NEDD9_ENST00000504387.1_Missense_Mutation_p.D360E|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	360					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			CATCCACCAAGTCCCGAGAGC	0.537																																						dbGAP											0													88.0	79.0	82.0					6																	11191022		2203	4300	6503	-	-	-	SO:0001583	missense	0			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.1080C>G	6.37:g.11191022G>C	ENSP00000368759:p.Asp360Glu		A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.D360E	ENST00000379446.5	37	c.1080	CCDS4520.1	6	.	.	.	.	.	.	.	.	.	.	G	11.67	1.707153	0.30232	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.39592	1.07;1.18	5.92	-1.77	0.07982	.	0.085470	0.85682	D	0.000000	T	0.21761	0.0524	L	0.57536	1.79	0.80722	D	1	B;P;P	0.51057	0.383;0.76;0.941	B;B;P	0.49799	0.219;0.348;0.622	T	0.49854	-0.8895	10	0.02654	T	1	-35.7305	12.5054	0.55977	0.6103:0.0:0.3897:0.0	.	360;360;360	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	E	360	ENSP00000368759:D360E;ENSP00000422871:D360E	ENSP00000368759:D360E	D	-	3	2	NEDD9	11299008	0.983000	0.35010	0.981000	0.43875	0.531000	0.34715	0.257000	0.18369	-0.239000	0.09710	0.655000	0.94253	GAC	NEDD9	-	NULL	ENSG00000111859		0.537	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD9	HGNC	protein_coding	OTTHUMT00000039853.2	24	0.00	0	G	NM_006403		11191022	11191022	-1	no_errors	ENST00000379446	ensembl	human	known	69_37n	missense	11	52.17	12	SNP	0.978	C
NEK3	4752	genome.wustl.edu	37	13	52707287	52707287	+	Silent	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr13:52707287G>A	ENST00000400357.2	-	14	2754	c.1461C>T	c.(1459-1461)tgC>tgT	p.C487C	NEK3_ENST00000378101.2_Silent_p.C504C|NEK3_ENST00000339406.3_Silent_p.C504C|NEK3_ENST00000452082.2_Silent_p.C508C			P51956	NEK3_HUMAN	NIMA-related kinase 3	504					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.C504C(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		ATTATCTGTCGCACAGGCCTT	0.488																																						dbGAP											1	Substitution - coding silent(1)	central_nervous_system(1)											46.0	47.0	46.0					13																	52707287		2078	4231	6309	-	-	-	SO:0001819	synonymous_variant	0			AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.1461C>T	13.37:g.52707287G>A			A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C508	ENST00000400357.2	37	c.1524	CCDS53871.1	13																																																																																			NEK3	-	NULL	ENSG00000136098		0.488	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	NEK3	HGNC	protein_coding	OTTHUMT00000045047.3	34	0.00	0	G			52707287	52707287	-1	no_errors	ENST00000452082	ensembl	human	known	69_37n	silent	45	20.69	12	SNP	0.000	A
NFATC4	4776	genome.wustl.edu	37	14	24845639	24845639	+	Nonsense_Mutation	SNP	C	C	A	rs141569636		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr14:24845639C>A	ENST00000250373.4	+	9	2337	c.2196C>A	c.(2194-2196)tgC>tgA	p.C732*	NFATC4_ENST00000556759.1_Nonsense_Mutation_p.C267*|NFATC4_ENST00000555167.1_Nonsense_Mutation_p.C267*|NFATC4_ENST00000424781.2_Nonsense_Mutation_p.C745*|NFATC4_ENST00000556169.1_Nonsense_Mutation_p.C720*|NFATC4_ENST00000553879.1_Nonsense_Mutation_p.C662*|NFATC4_ENST00000555393.1_Nonsense_Mutation_p.C20*|NFATC4_ENST00000539237.2_Nonsense_Mutation_p.C764*|NFATC4_ENST00000554473.1_Nonsense_Mutation_p.C267*|NFATC4_ENST00000556279.1_Nonsense_Mutation_p.C764*|NFATC4_ENST00000413692.2_Nonsense_Mutation_p.C795*|NFATC4_ENST00000553469.1_Nonsense_Mutation_p.C764*|NFATC4_ENST00000555453.1_Nonsense_Mutation_p.C720*|NFATC4_ENST00000557451.1_Nonsense_Mutation_p.C662*|NFATC4_ENST00000422617.3_Nonsense_Mutation_p.C720*|NFATC4_ENST00000553708.1_Nonsense_Mutation_p.C732*|NFATC4_ENST00000554966.1_Nonsense_Mutation_p.C745*|NFATC4_ENST00000554591.1_Nonsense_Mutation_p.C795*|NFATC4_ENST00000557767.1_Nonsense_Mutation_p.C20*|NFATC4_ENST00000554050.1_Nonsense_Mutation_p.C732*|NFATC4_ENST00000555590.1_Nonsense_Mutation_p.C745*|NFATC4_ENST00000554661.1_Nonsense_Mutation_p.C662*|NFATC4_ENST00000554344.1_Nonsense_Mutation_p.C662*|NFATC4_ENST00000555802.1_Nonsense_Mutation_p.C20*	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	732	Pro-rich.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		ACCCTGCTTGCGAAACTCCTT	0.617																																						dbGAP											0													59.0	64.0	62.0					14																	24845639		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.2196C>A	14.37:g.24845639C>A	ENSP00000250373:p.Cys732*		B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Nonsense_Mutation	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.C795*	ENST00000250373.4	37	c.2385	CCDS9629.1	14	.	.	.	.	.	.	.	.	.	.	C	39	7.342448	0.98224	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453;ENST00000554473;ENST00000556759;ENST00000555167;ENST00000557767;ENST00000555393;ENST00000555802	.	.	.	5.13	-5.88	0.02290	.	0.122706	0.37715	N	0.001974	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	0.0043	13.5579	0.61770	0.0:0.1423:0.0:0.8577	.	.	.	.	X	795;795;745;745;745;764;764;764;732;732;732;662;662;662;720;662;720;720;267;267;267;20;20;20	.	ENSP00000250373:C732X	C	+	3	2	NFATC4	23915479	0.002000	0.14202	0.951000	0.38953	0.904000	0.53231	-2.543000	0.00934	-0.977000	0.03537	-0.254000	0.11334	TGC	NFATC4	-	NULL	ENSG00000100968		0.617	NFATC4-001	KNOWN	basic|CCDS	protein_coding	NFATC4	HGNC	protein_coding	OTTHUMT00000073206.6	29	0.00	0	C	NM_004554		24845639	24845639	+1	no_errors	ENST00000413692	ensembl	human	known	69_37n	nonsense	39	20.41	10	SNP	0.491	A
NPC1	4864	genome.wustl.edu	37	18	21140315	21140315	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr18:21140315G>A	ENST00000269228.5	-	6	1315	c.761C>T	c.(760-762)cCa>cTa	p.P254L	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_5'Flank	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	254	Poly-Pro.				adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGGAGGAGGTGGGGGCTGGGG	0.532																																						dbGAP											0													65.0	58.0	60.0					18																	21140315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.761C>T	18.37:g.21140315G>A	ENSP00000269228:p.Pro254Leu		B4DET3|Q9P130	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD,tigrfam_NP_C_type	p.P254L	ENST00000269228.5	37	c.761	CCDS11878.1	18	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699707	0.48307	.	.	ENSG00000141458	ENST00000269228;ENST00000540608	D	0.93859	-3.3	5.87	4.99	0.66335	.	0.050779	0.85682	D	0.000000	D	0.91192	0.7225	L	0.53729	1.69	0.80722	D	1	B;B	0.18166	0.013;0.026	B;B	0.18263	0.021;0.021	D	0.88444	0.3044	10	0.72032	D	0.01	-18.1511	14.4214	0.67185	0.0702:0.0:0.9298:0.0	.	265;254	Q59GR1;O15118	.;NPC1_HUMAN	L	254;99	ENSP00000269228:P254L	ENSP00000269228:P254L	P	-	2	0	NPC1	19394313	1.000000	0.71417	0.966000	0.40874	0.308000	0.27856	8.022000	0.88759	2.785000	0.95823	0.655000	0.94253	CCA	NPC1	-	tigrfam_NP_C_type	ENSG00000141458		0.532	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPC1	HGNC	protein_coding	OTTHUMT00000254823.2	35	0.00	0	G	NM_000271		21140315	21140315	-1	no_errors	ENST00000269228	ensembl	human	known	69_37n	missense	30	43.40	23	SNP	1.000	A
NUP43	348995	genome.wustl.edu	37	6	150067641	150067641	+	5'UTR	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr6:150067641G>A	ENST00000340413.2	-	0	67				PCMT1_ENST00000367378.1_5'Flank|NUP43_ENST00000460354.2_5'UTR|PCMT1_ENST00000464889.1_5'Flank|NUP43_ENST00000463048.3_Intron|NUP43_ENST00000367403.3_Silent_p.A58A|PCMT1_ENST00000367384.2_5'Flank|NUP43_ENST00000367404.4_5'UTR	NM_198887.1	NP_942590.1	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa						carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				breast(1)|large_intestine(2)|lung(8)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)		TGCCGAAAGCGGCCGCAGCAG	0.572											OREG0017720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													70.0	79.0	76.0					6																	150067641		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF514997	CCDS5218.1	6q25.1	2013-01-10			ENSG00000120253	ENSG00000120253		"""WD repeat domain containing"""	21182	protein-coding gene	gene with protein product		608141				12196509	Standard	XM_005266961		Approved	bA350J20.1, FLJ13287	uc003qmz.3	Q8NFH3	OTTHUMG00000015795	ENST00000340413.2:c.-10C>T	6.37:g.150067641G>A		1729	B4E2F0|Q9H8S0	Silent	SNP	superfamily_WD40_repeat_dom	p.A58	ENST00000340413.2	37	c.174	CCDS5218.1	6																																																																																			NUP43	-	NULL	ENSG00000120253		0.572	NUP43-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP43	HGNC	protein_coding	OTTHUMT00000396947.1	47	0.00	0	G	NM_198887		150067641	150067641	-1	no_errors	ENST00000367403	ensembl	human	known	69_37n	silent	26	46.94	23	SNP	0.000	A
OR2A12	346525	genome.wustl.edu	37	7	143792630	143792630	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr7:143792630G>A	ENST00000408949.2	+	1	490	c.430G>A	c.(430-432)Gcc>Acc	p.A144T		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					CACTGTCCTGGCCTCAACTTG	0.448																																						dbGAP											0													226.0	209.0	215.0					7																	143792630		2046	4205	6251	-	-	-	SO:0001583	missense	0				CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.430G>A	7.37:g.143792630G>A	ENSP00000386174:p.Ala144Thr		Q6IF43	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A144T	ENST00000408949.2	37	c.430	CCDS43670.1	7	.	.	.	.	.	.	.	.	.	.	G	5.724	0.317998	0.10845	.	.	ENSG00000221858	ENST00000408949	T	0.37752	1.18	4.23	1.32	0.21799	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.37892	0.1020	L	0.59967	1.855	0.09310	N	1	B	0.18013	0.025	B	0.37989	0.262	T	0.50039	-0.8874	9	0.56958	D	0.05	-2.1287	4.0016	0.09582	0.0935:0.1597:0.582:0.1648	.	144	Q8NGT7	O2A12_HUMAN	T	144	ENSP00000386174:A144T	ENSP00000386174:A144T	A	+	1	0	OR2A12	143423563	0.038000	0.19896	0.006000	0.13384	0.003000	0.03518	0.973000	0.29422	0.069000	0.16605	-0.430000	0.05897	GCC	OR2A12	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000221858		0.448	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A12	HGNC	protein_coding	OTTHUMT00000349969.1	115	0.00	0	G			143792630	143792630	+1	no_errors	ENST00000408949	ensembl	human	known	69_37n	missense	179	13.11	27	SNP	0.001	A
OR51A2	401667	genome.wustl.edu	37	11	4976079	4976079	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr11:4976079T>G	ENST00000380371.1	-	1	864	c.865A>C	c.(865-867)Aaa>Caa	p.K289Q	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	289			K -> N (in dbSNP:rs2570573).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACAATTGGTTTCATCAGCGGA	0.413																																						dbGAP											0													84.0	67.0	73.0					11																	4976079		2041	3736	5777	-	-	-	SO:0001583	missense	0			AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.865A>C	11.37:g.4976079T>G	ENSP00000369729:p.Lys289Gln			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K289Q	ENST00000380371.1	37	c.865	CCDS31368.1	11	.	.	.	.	.	.	.	.	.	.	-	9.790	1.177676	0.21787	.	.	ENSG00000205496	ENST00000380371	T	0.71934	-0.61	3.45	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.51312	0.1667	N	0.08118	0	0.23645	N	0.997216	B	0.09022	0.002	B	0.09377	0.004	T	0.50013	-0.8877	9	0.87932	D	0	.	11.2239	0.48871	0.0:0.0:0.0:1.0	.	289	Q8NGJ7	O51A2_HUMAN	Q	289	ENSP00000369729:K289Q	ENSP00000369729:K289Q	K	-	1	0	OR51A2	4932655	1.000000	0.71417	0.985000	0.45067	0.021000	0.10359	3.255000	0.51484	1.575000	0.49775	0.412000	0.27726	AAA	OR51A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000205496		0.413	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A2	HGNC	protein_coding	OTTHUMT00000142809.1	29	0.00	0	T	NM_001004748		4976079	4976079	-1	no_errors	ENST00000380371	ensembl	human	known	69_37n	missense	67	18.29	15	SNP	1.000	G
OR5W2	390148	genome.wustl.edu	37	11	55682047	55682047	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr11:55682047T>A	ENST00000344514.1	-	1	11	c.12A>T	c.(10-12)gaA>gaT	p.E4D		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AGGAGCAATTTTCCCAGTCCA	0.338																																					Melanoma(48;171 1190 15239 43886 49348)	dbGAP											0													35.0	37.0	37.0					11																	55682047		2200	4288	6488	-	-	-	SO:0001583	missense	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.12A>T	11.37:g.55682047T>A	ENSP00000342448:p.Glu4Asp			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.E4D	ENST00000344514.1	37	c.12	CCDS31513.1	11	.	.	.	.	.	.	.	.	.	.	T	10.87	1.474033	0.26423	.	.	ENSG00000187612	ENST00000344514	T	0.19806	2.12	4.29	-4.36	0.03645	.	1.395630	0.05083	N	0.483868	T	0.13415	0.0325	L	0.31294	0.92	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.30416	-0.9979	10	0.25751	T	0.34	.	6.9305	0.24439	0.0:0.4919:0.1523:0.3558	.	4	Q8NH69	OR5W2_HUMAN	D	4	ENSP00000342448:E4D	ENSP00000342448:E4D	E	-	3	2	OR5W2	55438623	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-2.706000	0.00821	-1.020000	0.03354	-0.398000	0.06409	GAA	OR5W2	-	NULL	ENSG00000187612		0.338	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	HGNC	protein_coding	OTTHUMT00000391523.1	10	0.00	0	T	NM_001001960		55682047	55682047	-1	no_errors	ENST00000344514	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.009	A
P2RX7	5027	genome.wustl.edu	37	12	121603182	121603182	+	Missense_Mutation	SNP	G	G	A	rs28360451		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr12:121603182G>A	ENST00000546057.1	+	6	699	c.556G>A	c.(556-558)Gaa>Aaa	p.E186K	P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000377162.2_Missense_Mutation_p.E186K|P2RX7_ENST00000535250.1_Missense_Mutation_p.E96K|P2RX7_ENST00000541446.1_5'UTR|P2RX7_ENST00000328963.5_Missense_Mutation_p.E16K	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	186					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAACAGTGCCGAAAACTTCAC	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		18709	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													116.0	96.0	103.0					12																	121603182		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.556G>A	12.37:g.121603182G>A	ENSP00000442349:p.Glu186Lys		A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X7_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.E186K	ENST00000546057.1	37	c.556	CCDS9213.1	12	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206691	0.79127	.	.	ENSG00000089041	ENST00000546057;ENST00000377162;ENST00000328963;ENST00000535250	T;T;T;T	0.05025	3.51;3.51;3.51;3.51	6.11	6.11	0.99139	.	0.259595	0.33691	N	0.004645	T	0.25791	0.0628	M	0.75884	2.315	0.80722	D	1	D;D;D	0.89917	0.987;1.0;0.999	P;P;D	0.66602	0.508;0.89;0.945	T	0.00016	-1.2388	10	0.62326	D	0.03	.	18.228	0.89924	0.0:0.0:1.0:0.0	rs28360451	16;96;186	F8W951;F5H7E8;Q99572	.;.;P2RX7_HUMAN	K	186;186;16;96	ENSP00000442349:E186K;ENSP00000366367:E186K;ENSP00000330696:E16K;ENSP00000442572:E96K	ENSP00000330696:E16K	E	+	1	0	P2RX7	120087565	1.000000	0.71417	0.959000	0.39883	0.756000	0.42949	8.198000	0.89729	2.906000	0.99361	0.655000	0.94253	GAA	P2RX7	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor	ENSG00000089041		0.552	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX7	HGNC	protein_coding	OTTHUMT00000402532.1	53	0.00	0	G	NM_002562		121603182	121603182	+1	no_errors	ENST00000546057	ensembl	human	known	69_37n	missense	92	17.12	19	SNP	0.998	A
PAG1	55824	genome.wustl.edu	37	8	81892669	81892669	+	Splice_Site	DEL	C	C	-			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr8:81892669delC	ENST00000220597.4	-	8	1647		c.e8+1			NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1						epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			ACAAAACTTACCTCTTCTTCT	0.388																																						dbGAP											0													79.0	75.0	76.0					8																	81892669		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.936+1G>-	8.37:g.81892669delC			A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Splice_Site	DEL	-	e5+1	ENST00000220597.4	37	c.936+1	CCDS6227.1	8																																																																																			PAG1	-	-	ENSG00000076641		0.388	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAG1	HGNC	protein_coding	OTTHUMT00000379352.3	54	0.00	0	C	NM_018440	Intron	81892669	81892669	-1	no_errors	ENST00000220597	ensembl	human	known	69_37n	splice_site_del	69	34.58	37	DEL	1.000	-
PAX7	5081	genome.wustl.edu	37	1	19018346	19018346	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:19018346C>A	ENST00000375375.3	+	5	1283	c.685C>A	c.(685-687)Ctg>Atg	p.L229M	PAX7_ENST00000420770.2_Missense_Mutation_p.L229M|PAX7_ENST00000400661.3_Missense_Mutation_p.L227M	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	229					anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		GGCCGAGCAGCTGGAGGAGCT	0.632			T	FOXO1A	alveolar rhabdomyosarcoma																																	dbGAP		Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	0													46.0	39.0	41.0					1																	19018346		2202	4300	6502	-	-	-	SO:0001583	missense	0			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.685C>A	1.37:g.19018346C>A	ENSP00000364524:p.Leu229Met		E9PFV9|Q0VA99|Q2PJS5	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeodomain,pfam_Pax7,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeodomain,prints_Paired_dom,pfscan_Homeodomain,pfscan_Paired_dom	p.L229M	ENST00000375375.3	37	c.685	CCDS186.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982787	0.74474	.	.	ENSG00000009709	ENST00000375375;ENST00000420770;ENST00000400661	D;D;D	0.97328	-4.34;-4.34;-4.34	4.85	4.85	0.62838	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.162943	0.42053	D	0.000778	D	0.98915	0.9632	H	0.96398	3.815	0.80722	D	1	P;D;D	0.64830	0.904;0.985;0.994	P;P;D	0.69142	0.682;0.739;0.962	D	0.99612	1.0981	10	0.87932	D	0	.	16.519	0.84308	0.0:1.0:0.0:0.0	.	229;227;229	E9PFV9;P23759-2;P23759	.;.;PAX7_HUMAN	M	229;229;227	ENSP00000364524:L229M;ENSP00000403389:L229M;ENSP00000383502:L227M	ENSP00000364524:L229M	L	+	1	2	PAX7	18890933	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.938000	0.63519	2.243000	0.73865	0.561000	0.74099	CTG	PAX7	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000009709		0.632	PAX7-001	KNOWN	basic|CCDS	protein_coding	PAX7	HGNC	protein_coding	OTTHUMT00000006928.1	13	0.00	0	C	NM_002584		19018346	19018346	+1	no_errors	ENST00000375375	ensembl	human	known	69_37n	missense	12	57.14	16	SNP	1.000	A
PCDHGB3	56102	genome.wustl.edu	37	5	140807615	140807615	+	Intron	SNP	G	G	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr5:140807615G>C	ENST00000576222.1	+	1	2546				PCDHGB8P_ENST00000502926.1_RNA|PCDHGA8_ENST00000398604.2_Intron|PCDHGA12_ENST00000252085.3_5'Flank|PCDHGB6_ENST00000520790.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGACCAAGGTGGTGGCGG	0.662																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+55239G>C	5.37:g.140807615G>C			A7E229|Q9Y5C7	RNA	SNP	-	NULL	ENST00000576222.1	37	NULL	CCDS58980.1	5																																																																																			PCDHGB8P	-	-	ENSG00000248449		0.662	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB8P	HGNC	protein_coding	OTTHUMT00000437094.1	8	0.00	0	G	NM_018924		140807615	140807615	+1	no_errors	ENST00000502926	ensembl	human	known	69_37n	rna	17	26.09	6	SNP	0.997	C
PGBD2	267002	genome.wustl.edu	37	1	249212333	249212333	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:249212333G>A	ENST00000329291.5	+	3	1697	c.1550G>A	c.(1549-1551)cGg>cAg	p.R517Q	PGBD2_ENST00000355360.4_Missense_Mutation_p.R266Q|PGBD2_ENST00000539153.1_Missense_Mutation_p.R514Q	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	517										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CTTGCCTTCCGGAGATACATT	0.512																																						dbGAP											0													115.0	97.0	103.0					1																	249212333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1550G>A	1.37:g.249212333G>A	ENSP00000331643:p.Arg517Gln		B3KVR8|Q6MZF8	Missense_Mutation	SNP	NULL	p.R517Q	ENST00000329291.5	37	c.1550	CCDS31128.1	1	.	.	.	.	.	.	.	.	.	.	.	11.99	1.804418	0.31869	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	T;T;T	0.17054	2.3;2.41;2.41	3.05	2.13	0.27403	.	0.471018	0.16966	N	0.192284	T	0.15262	0.0368	L	0.46157	1.445	0.21841	N	0.99952	D;P	0.53885	0.963;0.921	P;B	0.44860	0.462;0.153	T	0.10268	-1.0637	10	0.36615	T	0.2	.	6.2753	0.20977	0.1402:0.0:0.8598:0.0	.	514;517	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	Q	266;517;514	ENSP00000355424:R266Q;ENSP00000331643:R517Q;ENSP00000439950:R514Q	ENSP00000331643:R517Q	R	+	2	0	PGBD2	247178956	1.000000	0.71417	0.931000	0.37212	0.402000	0.30811	3.764000	0.55264	0.839000	0.34971	0.467000	0.42956	CGG	PGBD2	-	NULL	ENSG00000185220		0.512	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGBD2	HGNC	protein_coding	OTTHUMT00000097318.1	44	0.00	0	G			249212333	249212333	+1	no_errors	ENST00000329291	ensembl	human	known	69_37n	missense	32	43.86	25	SNP	0.988	A
PIAS2	9063	genome.wustl.edu	37	18	44416348	44416349	+	Frame_Shift_Ins	INS	-	-	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr18:44416348_44416349insT	ENST00000585916.1	-	9	1172_1173	c.1173_1174insA	c.(1171-1176)aaagctfs	p.A392fs	PIAS2_ENST00000324794.7_Frame_Shift_Ins_p.A392fs|PIAS2_ENST00000545673.1_Frame_Shift_Ins_p.A102fs	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	392					androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						TCATAGGCAGCTTTTTTGTCAC	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.1174dupA	18.37:g.44416354_44416354dupT	ENSP00000465676:p.Ala392fs		O75927|Q96BT5|Q96KE3	Frame_Shift_Ins	INS	pfam_Znf_MIZ,smart_SAP_DNA-bd,pfscan_Znf_MIZ,pfscan_SAP_DNA-bd	p.A391fs	ENST00000585916.1	37	c.1174_1173	CCDS32824.1	18																																																																																			PIAS2	-	pfscan_Znf_MIZ	ENSG00000078043		0.401	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS2	HGNC	protein_coding	OTTHUMT00000445656.2	82	0.00	0	-	NM_004671		44416348	44416349	-1	no_errors	ENST00000585916	ensembl	human	known	69_37n	frame_shift_ins	51	34.62	27	INS	1.000:0.998	T
PIK3CA	5290	genome.wustl.edu	37	3	178928086	178928087	+	Frame_Shift_Ins	INS	-	-	G	rs397517200		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr3:178928086_178928087insG	ENST00000263967.3	+	8	1521_1522	c.1364_1365insG	c.(1363-1368)ttgctgfs	p.L456fs		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	456	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H450fs*9(1)|p.G451_L456>V(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTAGAAGATTTGCTGAACCCTA	0.342		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	2	Complex - frameshift(1)|Complex - deletion inframe(1)	breast(1)|endometrium(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1365dupG	3.37:g.178928087_178928087dupG	ENSP00000263967:p.Leu456fs		Q14CW1|Q99762	Frame_Shift_Ins	INS	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.L456fs	ENST00000263967.3	37	c.1364_1365	CCDS43171.1	3																																																																																			PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000121879		0.342	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	109	0.00	0	-			178928086	178928087	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	frame_shift_ins	68	10.53	8	INS	1.000:1.000	G
PIP5K1B	8395	genome.wustl.edu	37	9	71532631	71532631	+	Silent	SNP	T	T	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr9:71532631T>C	ENST00000265382.3	+	9	1244	c.939T>C	c.(937-939)ggT>ggC	p.G313G	PIP5K1B_ENST00000541509.1_Silent_p.G313G	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	313	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		CTATCCAGGGTCCAGGGAAAT	0.527																																						dbGAP											0													107.0	106.0	106.0					9																	71532631		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.939T>C	9.37:g.71532631T>C			A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.G353	ENST00000265382.3	37	c.1059	CCDS6624.1	9																																																																																			PIP5K1B	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000107242		0.527	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP5K1B	HGNC	protein_coding	OTTHUMT00000052561.2	34	0.00	0	T	NM_003558		71532631	71532631	+1	no_errors	ENST00000478500	ensembl	human	known	69_37n	silent	65	12.16	9	SNP	0.518	C
PLEKHA6	22874	genome.wustl.edu	37	1	204192633	204192633	+	Missense_Mutation	SNP	G	G	A	rs200124951		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:204192633G>A	ENST00000272203.3	-	22	3428	c.3112C>T	c.(3112-3114)Cgg>Tgg	p.R1038W	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.R1058W	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	1038										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TCGGCGCCCCGTGGGGATTCA	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		11464	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													20.0	20.0	20.0					1																	204192633		2051	3997	6048	-	-	-	SO:0001583	missense	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.3112C>T	1.37:g.204192633G>A	ENSP00000272203:p.Arg1038Trp		A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R1038W	ENST00000272203.3	37	c.3112	CCDS1444.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	25.5	4.644269	0.87859	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.11277	2.79;3.25	4.72	4.72	0.59763	.	0.316202	0.26058	N	0.026593	T	0.20861	0.0502	N	0.22421	0.69	0.40241	D	0.977967	D	0.89917	1.0	D	0.76575	0.988	T	0.04811	-1.0925	10	0.87932	D	0	-19.0174	15.8456	0.78887	0.0:0.0:1.0:0.0	.	1038	Q9Y2H5	PKHA6_HUMAN	W	1038;1058	ENSP00000272203:R1038W;ENSP00000402046:R1058W	ENSP00000272203:R1038W	R	-	1	2	PLEKHA6	202459256	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.125000	0.71627	2.335000	0.79485	0.555000	0.69702	CGG	PLEKHA6	-	NULL	ENSG00000143850		0.592	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	38	0.00	0	G	NM_014935		204192633	204192633	-1	no_errors	ENST00000272203	ensembl	human	known	69_37n	missense	28	36.96	17	SNP	1.000	A
PLEKHH1	57475	genome.wustl.edu	37	14	68042162	68042162	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr14:68042162C>G	ENST00000329153.5	+	15	2274	c.2142C>G	c.(2140-2142)ttC>ttG	p.F714L		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	714	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GGAAAATCTTCTACTACTATC	0.493																																						dbGAP											0													70.0	68.0	69.0					14																	68042162		1988	4160	6148	-	-	-	SO:0001583	missense	0			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2142C>G	14.37:g.68042162C>G	ENSP00000330278:p.Phe714Leu		A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.F714L	ENST00000329153.5	37	c.2142	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	C	12.11	1.839932	0.32513	.	.	ENSG00000054690	ENST00000329153	T	0.14144	2.53	5.9	5.01	0.66863	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.05823	0.0152	N	0.10945	0.07	0.80722	D	1	B;B	0.23591	0.088;0.031	B;B	0.25140	0.058;0.029	T	0.19031	-1.0318	10	0.02654	T	1	.	7.0756	0.25203	0.2705:0.6213:0.0:0.1081	.	229;714	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	L	714	ENSP00000330278:F714L	ENSP00000330278:F714L	F	+	3	2	PLEKHH1	67111915	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	1.032000	0.30178	1.486000	0.48398	0.563000	0.77884	TTC	PLEKHH1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000054690		0.493	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	HGNC	protein_coding	OTTHUMT00000412730.3	52	0.00	0	C	XM_031054		68042162	68042162	+1	no_errors	ENST00000329153	ensembl	human	known	69_37n	missense	45	43.75	35	SNP	1.000	G
PLEKHH2	130271	genome.wustl.edu	37	2	43937469	43937469	+	Splice_Site	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:43937469G>A	ENST00000282406.4	+	13	2324	c.2214G>A	c.(2212-2214)ccG>ccA	p.P738P		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	738	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACAAATCTCCGGTGAGTGGAA	0.358																																						dbGAP											0													95.0	105.0	102.0					2																	43937469		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.2214+1G>A	2.37:g.43937469G>A			Q5JPJ6|Q6P4Q1|Q8N3Q3	Silent	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.P738	ENST00000282406.4	37	c.2214	CCDS1812.1	2																																																																																			PLEKHH2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000152527		0.358	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1	123	0.81	1	G	NM_172069	Silent	43937469	43937469	+1	no_errors	ENST00000282406	ensembl	human	known	69_37n	silent	147	29.33	61	SNP	0.842	A
POLE	5426	genome.wustl.edu	37	12	133250250	133250250	+	Missense_Mutation	SNP	G	G	C	rs483352909		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr12:133250250G>C	ENST00000320574.5	-	13	1313	c.1270C>G	c.(1270-1272)Ctc>Gtc	p.L424V	POLE_ENST00000535270.1_Missense_Mutation_p.L397V	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	424			L -> V (in CRCS12; associated with disease susceptibility). {ECO:0000269|PubMed:23263490}.		base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.L424V(2)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GCCGCCTTGAGATTATGACTG	0.592								DNA polymerases (catalytic subunits)																														dbGAP											2	Substitution - Missense(2)	endometrium(2)											158.0	147.0	151.0					12																	133250250		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.1270C>G	12.37:g.133250250G>C	ENSP00000322570:p.Leu424Val		Q13533|Q86VH9	Missense_Mutation	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.L435V	ENST00000320574.5	37	c.1303	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819233	0.50633	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577;ENST00000535934	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	5.62	5.62	0.85841	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	D	0.85323	0.5670	M	0.92317	3.295	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88279	0.2935	10	0.87932	D	0	.	13.8911	0.63740	0.0728:0.0:0.9272:0.0	.	397;424	F5H1D6;Q07864	.;DPOE1_HUMAN	V	424;435;397;204;359;42	ENSP00000322570:L424V;ENSP00000406383:L435V;ENSP00000445753:L397V;ENSP00000442519:L204V;ENSP00000443213:L42V	ENSP00000322570:L424V	L	-	1	0	POLE	131760323	1.000000	0.71417	1.000000	0.80357	0.054000	0.15201	6.687000	0.74552	2.660000	0.90430	0.305000	0.20034	CTC	POLE	-	pfam_DNA-dir_DNA_pol_B_exonuc,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	ENSG00000177084		0.592	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	31	0.00	0	G	NM_006231		133250250	133250250	-1	no_errors	ENST00000455752	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	1.000	C
POLR1A	25885	genome.wustl.edu	37	2	86276027	86276027	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:86276027A>C	ENST00000263857.6	-	18	2992	c.2614T>G	c.(2614-2616)Tac>Gac	p.Y872D	POLR1A_ENST00000409681.1_Missense_Mutation_p.Y872D			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	872					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						TCATTGCTGTAATGGTTCACT	0.408																																						dbGAP											0													135.0	130.0	132.0					2																	86276027		1934	4138	6072	-	-	-	SO:0001583	missense	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.2614T>G	2.37:g.86276027A>C	ENSP00000263857:p.Tyr872Asp		B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.Y872D	ENST00000263857.6	37	c.2614	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	A	16.92	3.256595	0.59321	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.67698	-0.28;-0.28	5.57	5.57	0.84162	RNA polymerase Rpb1, domain 4 (1);	0.141207	0.49305	D	0.000146	T	0.74550	0.3731	M	0.75777	2.31	0.51233	D	0.999919	B	0.32893	0.389	B	0.43123	0.409	T	0.76041	-0.3104	10	0.56958	D	0.05	-19.393	16.0355	0.80625	1.0:0.0:0.0:0.0	.	872	O95602	RPA1_HUMAN	D	872	ENSP00000263857:Y872D;ENSP00000386300:Y872D	ENSP00000263857:Y872D	Y	-	1	0	POLR1A	86129538	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.245000	0.65405	2.244000	0.73946	0.533000	0.62120	TAC	POLR1A	-	pfam_RNA_pol_Rpb1_4	ENSG00000068654		0.408	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	90	0.00	0	A	NM_015425		86276027	86276027	-1	no_errors	ENST00000263857	ensembl	human	known	69_37n	missense	121	17.12	25	SNP	1.000	C
POM121L2	94026	genome.wustl.edu	37	6	27278901	27278901	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr6:27278901G>A	ENST00000444565.1	-	1	1048	c.1049C>T	c.(1048-1050)aCt>aTt	p.T350I	POM121L2_ENST00000377451.2_Missense_Mutation_p.T350I	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	350										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						CTTCCCCAAAGTCAAGTTCTC	0.502																																						dbGAP											0													208.0	172.0	183.0					6																	27278901		692	1591	2283	-	-	-	SO:0001583	missense	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1049C>T	6.37:g.27278901G>A	ENSP00000392726:p.Thr350Ile		C9J1I7	Missense_Mutation	SNP	NULL	p.T350I	ENST00000444565.1	37	c.1049	CCDS59497.1	6	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142072	0.37825	.	.	ENSG00000158553	ENST00000429945;ENST00000377451;ENST00000444565	T;T;T	0.12774	2.65;2.65;2.65	3.61	2.71	0.32032	.	1.338660	0.05499	N	0.558044	T	0.04497	0.0123	N	0.19112	0.55	0.09310	N	1	B	0.32160	0.358	B	0.38616	0.277	T	0.45731	-0.9241	10	0.41790	T	0.15	.	8.3163	0.32102	0.0:0.0:0.7651:0.2349	.	350	C9J1I7	.	I	64;350;350	ENSP00000415181:T64I;ENSP00000366671:T350I;ENSP00000392726:T350I	ENSP00000366671:T350I	T	-	2	0	POM121L2	27386880	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.593000	0.23999	1.051000	0.40369	0.561000	0.74099	ACT	POM121L2	-	NULL	ENSG00000158553		0.502	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	80	0.00	0	G	NM_033482		27278901	27278901	-1	no_errors	ENST00000444565	ensembl	human	known	69_37n	missense	117	13.33	18	SNP	0.002	A
PRAMEF12	390999	genome.wustl.edu	37	1	12835814	12835814	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:12835814C>T	ENST00000357726.4	+	2	443	c.416C>T	c.(415-417)cCg>cTg	p.P139L		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	139					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.P139L(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGTCCAAGGCCGGGTGGGCAG	0.552																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											99.0	112.0	108.0					1																	12835814		2191	4298	6489	-	-	-	SO:0001583	missense	0				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.416C>T	1.37:g.12835814C>T	ENSP00000350358:p.Pro139Leu			Missense_Mutation	SNP	NULL	p.P139L	ENST00000357726.4	37	c.416	CCDS41254.1	1	.	.	.	.	.	.	.	.	.	.	.	2.451	-0.326316	0.05350	.	.	ENSG00000116726	ENST00000357726	T	0.14391	2.51	2.8	-5.6	0.02497	.	6.869170	0.00397	N	0.000045	T	0.07458	0.0188	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32188	-0.9916	10	0.10902	T	0.67	.	7.2616	0.26207	0.0:0.3784:0.1184:0.5032	.	139	O95522	PRA12_HUMAN	L	139	ENSP00000350358:P139L	ENSP00000350358:P139L	P	+	2	0	PRAMEF12	12758401	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.082000	0.01365	-2.405000	0.00575	-1.786000	0.00637	CCG	PRAMEF12	-	NULL	ENSG00000116726		0.552	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF12	HGNC	protein_coding	OTTHUMT00000005457.1	62	0.00	0	C	XM_372760		12835814	12835814	+1	no_errors	ENST00000357726	ensembl	human	known	69_37n	missense	59	34.44	31	SNP	0.000	T
PRAMEF11	440560	genome.wustl.edu	37	1	12885009	12885009	+	Missense_Mutation	SNP	A	A	C	rs267597973		TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:12885009A>C	ENST00000535591.1	-	4	1297	c.1102T>G	c.(1102-1104)Tta>Gta	p.L368V	RP5-845O24.8_ENST00000438401.1_lincRNA	NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	368					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						TCCAGGCATAAGTTTTTGAGT	0.507																																						dbGAP											0													63.0	52.0	56.0					1																	12885009		692	1590	2282	-	-	-	SO:0001583	missense	0			AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.1102T>G	1.37:g.12885009A>C	ENSP00000439551:p.Leu368Val			Missense_Mutation	SNP	NULL	p.L368V	ENST00000535591.1	37	c.1102	CCDS53268.1	1	.	.	.	.	.	.	.	.	.	.	.	4.271	0.049472	0.08243	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.03951	3.75;3.75	1.76	-2.27	0.06846	.	0.095706	0.40064	N	0.001185	T	0.07188	0.0182	M	0.86651	2.83	0.09310	N	1	B	0.34226	0.443	B	0.35278	0.199	T	0.18493	-1.0335	10	0.87932	D	0	.	2.1133	0.03708	0.3356:0.0:0.1798:0.4846	.	368	O60813	PRA11_HUMAN	V	368;409;368	ENSP00000439551:L368V;ENSP00000391839:L368V	ENSP00000328783:L409V	L	-	1	2	PRAMEF11	12807596	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.608000	0.05641	-0.667000	0.05303	-2.891000	0.00095	TTA	PRAMEF11	-	NULL	ENSG00000204513		0.507	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	HGNC	protein_coding		114	0.00	0	A	XM_496341		12885009	12885009	-1	no_errors	ENST00000535591	ensembl	human	known	69_37n	missense	243	11.64	32	SNP	0.000	C
PRPF40A	55660	genome.wustl.edu	37	2	153525674	153525674	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:153525674G>A	ENST00000410080.1	-	16	2282	c.1741C>T	c.(1741-1743)Cga>Tga	p.R581*		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	608	FF 3.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						CTATTTTTTCGCTGTCGTCTC	0.333																																						dbGAP											0													91.0	84.0	86.0					2																	153525674		1804	4059	5863	-	-	-	SO:0001587	stop_gained	0			AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.1741C>T	2.37:g.153525674G>A	ENSP00000386458:p.Arg581*		O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Nonsense_Mutation	SNP	pfam_FF_domain,pfam_WW_Rsp5_WWP,superfamily_FF_domain,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_FF_domain,pfscan_WW_Rsp5_WWP,prints_Antifreeze_1	p.R581*	ENST00000410080.1	37	c.1741	CCDS46430.1	2	.	.	.	.	.	.	.	.	.	.	G	44	10.673143	0.99447	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961	.	.	.	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.5645	13.199	0.59756	0.0:0.0:0.8406:0.1593	.	.	.	.	X	581;590;477;528	.	ENSP00000348770:R590X	R	-	1	2	PRPF40A	153233920	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.791000	0.85805	2.381000	0.81170	0.655000	0.94253	CGA	PRPF40A	-	superfamily_FF_domain,smart_FF_domain	ENSG00000196504		0.333	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF40A	HGNC	protein_coding	OTTHUMT00000333559.2	145	0.00	0	G	XM_371575		153525674	153525674	-1	no_errors	ENST00000410080	ensembl	human	known	69_37n	nonsense	212	11.98	29	SNP	1.000	A
RARA	5914	genome.wustl.edu	37	17	38508726	38508726	+	Silent	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr17:38508726C>T	ENST00000254066.5	+	6	1229	c.774C>T	c.(772-774)atC>atT	p.I258I	RARA_ENST00000425707.3_Silent_p.I161I|RARA_ENST00000394081.3_Silent_p.I253I|RARA_ENST00000394089.2_Silent_p.I258I|RARA_ENST00000394086.3_Silent_p.I274I|RARA_ENST00000420042.1_3'UTR	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	258	Ligand-binding.				apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CCGACCAGATCACCCTCCTCA	0.607			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																	dbGAP		Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	0													90.0	69.0	76.0					17																	38508726		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.774C>T	17.37:g.38508726C>T			B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.I258	ENST00000254066.5	37	c.774	CCDS11366.1	17																																																																																			RARA	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000131759		0.607	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARA	HGNC	protein_coding	OTTHUMT00000257136.2	38	0.00	0	C			38508726	38508726	+1	no_errors	ENST00000254066	ensembl	human	known	69_37n	silent	37	24.49	12	SNP	1.000	T
RGS7	6000	genome.wustl.edu	37	1	240969623	240969623	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:240969623G>T	ENST00000407727.1	-	14	1085	c.1086C>A	c.(1084-1086)ttC>ttA	p.F362L	RGS7_ENST00000331110.7_Missense_Mutation_p.F336L|RGS7_ENST00000366565.1_Missense_Mutation_p.F362L|RGS7_ENST00000446183.2_Missense_Mutation_p.F278L|RGS7_ENST00000366562.4_Missense_Mutation_p.F362L|RGS7_ENST00000401882.1_Missense_Mutation_p.F309L|RGS7_ENST00000348120.2_Missense_Mutation_p.F309L|RGS7_ENST00000366563.1_Missense_Mutation_p.F362L|RGS7_ENST00000366564.1_Missense_Mutation_p.F362L			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	362	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CTGCCAGCCAGAATCTATGCA	0.473																																						dbGAP											0													89.0	86.0	87.0					1																	240969623		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1086C>A	1.37:g.240969623G>T	ENSP00000384428:p.Phe362Leu		Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.F362L	ENST00000407727.1	37	c.1086		1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665529	0.88251	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21;0.21	5.95	4.07	0.47477	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.82167	0.4978	H	0.95850	3.73	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;0.996;1.0;0.998;0.999;0.999	D	0.87185	0.2230	10	0.87932	D	0	.	12.4191	0.55510	0.1378:0.0:0.8622:0.0	.	278;336;309;362;362;362;362	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	L	336;362;362;362;193;309;278;362;362;309	ENSP00000331485:F336L;ENSP00000355523:F362L;ENSP00000355522:F362L;ENSP00000355521:F362L;ENSP00000404399:F193L;ENSP00000341242:F309L;ENSP00000390138:F278L;ENSP00000355520:F362L;ENSP00000384428:F362L;ENSP00000385508:F309L	ENSP00000331485:F336L	F	-	3	2	RGS7	239036246	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.755000	0.68750	1.527000	0.49086	0.650000	0.86243	TTC	RGS7	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	ENSG00000182901		0.473	RGS7-204	KNOWN	basic	protein_coding	RGS7	HGNC	protein_coding		55	0.00	0	G	NM_002924		240969623	240969623	-1	no_errors	ENST00000407727	ensembl	human	known	69_37n	missense	55	21.43	15	SNP	1.000	T
ROS1	6098	genome.wustl.edu	37	6	117658501	117658501	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr6:117658501C>T	ENST00000368508.3	-	31	5280	c.5082G>A	c.(5080-5082)tgG>tgA	p.W1694*	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Nonsense_Mutation_p.W1688*	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1694	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CATTGTATTTCCACTAGAAAA	0.289			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																	dbGAP		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													61.0	61.0	61.0					6																	117658501		2202	4298	6500	-	-	-	SO:0001587	stop_gained	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.5082G>A	6.37:g.117658501C>T	ENSP00000357494:p.Trp1694*		Q15368|Q5TDB5	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.W1694*	ENST00000368508.3	37	c.5082	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	C	48	14.217661	0.99785	.	.	ENSG00000047936	ENST00000368508;ENST00000368507;ENST00000403284	.	.	.	5.03	5.03	0.67393	.	0.107671	0.42821	D	0.000641	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	14.2094	0.65755	0.0:1.0:0.0:0.0	.	.	.	.	X	1694;1688;1	.	ENSP00000357493:W1688X	W	-	3	0	ROS1	117765194	1.000000	0.71417	0.999000	0.59377	0.939000	0.58152	4.260000	0.58835	2.498000	0.84270	0.655000	0.94253	TGG	ROS1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000047936		0.289	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	48	0.00	0	C			117658501	117658501	-1	no_errors	ENST00000368508	ensembl	human	known	69_37n	nonsense	75	27.18	28	SNP	0.999	T
SBNO1	55206	genome.wustl.edu	37	12	123815832	123815832	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr12:123815832T>G	ENST00000602398.1	-	8	1127	c.1000A>C	c.(1000-1002)Atc>Ctc	p.I334L	SBNO1_ENST00000602750.1_Missense_Mutation_p.I333L|SBNO1_ENST00000420886.2_Missense_Mutation_p.I334L|SBNO1_ENST00000267176.4_Missense_Mutation_p.I333L			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	334					regulation of transcription, DNA-templated (GO:0006355)			p.I333L(1)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TCATAGATGATTCCTGCTATC	0.438																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											159.0	141.0	147.0					12																	123815832		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.1000A>C	12.37:g.123815832T>G	ENSP00000473665:p.Ile334Leu		Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	pfam_Helicase/UvrB_dom,superfamily_Prismane-like	p.I334L	ENST00000602398.1	37	c.1000	CCDS53844.1	12	.	.	.	.	.	.	.	.	.	.	T	16.98	3.270237	0.59540	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	D;D	0.92348	-3.02;-3.02	5.83	4.68	0.58851	Helicase/UvrB domain (1);	0.053100	0.64402	D	0.000001	D	0.90518	0.7029	M	0.67700	2.07	0.58432	D	0.999999	B;B;B	0.23128	0.08;0.032;0.047	B;B;B	0.26864	0.074;0.044;0.023	D	0.86892	0.2049	10	0.46703	T	0.11	-16.3253	11.8661	0.52495	0.0:0.0681:0.0:0.9319	.	334;333;332	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	L	334;333;333	ENSP00000387361:I334L;ENSP00000267176:I333L	ENSP00000267176:I333L	I	-	1	0	SBNO1	122381785	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.423000	0.52756	1.032000	0.39892	0.459000	0.35465	ATC	SBNO1	-	pfam_Helicase/UvrB_dom	ENSG00000139697		0.438	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	94	0.00	0	T	NM_018183		123815832	123815832	-1	no_errors	ENST00000420886	ensembl	human	known	69_37n	missense	153	11.56	20	SNP	1.000	G
SCN3A	6328	genome.wustl.edu	37	2	165969454	165969454	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:165969454A>G	ENST00000360093.3	-	21	4275	c.3784T>C	c.(3784-3786)Tat>Cat	p.Y1262H	SCN3A_ENST00000283254.7_Missense_Mutation_p.Y1262H|SCN3A_ENST00000409101.3_Missense_Mutation_p.Y1213H	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1262					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGAAATCCATAAGCAACCCAT	0.313																																						dbGAP											0													177.0	196.0	190.0					2																	165969454		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.3784T>C	2.37:g.165969454A>G	ENSP00000353206:p.Tyr1262His		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.Y1262H	ENST00000360093.3	37	c.3784		2	.	.	.	.	.	.	.	.	.	.	A	26.3	4.722964	0.89298	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	5.88	5.88	0.94601	Ion transport (1);	0.000000	0.50627	D	0.000108	D	0.98585	0.9527	M	0.87328	2.875	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;1.0	D;D;D;D;D	0.97110	1.0;0.998;0.996;0.996;1.0	D	0.99716	1.1008	10	0.87932	D	0	.	16.2898	0.82742	1.0:0.0:0.0:0.0	.	1262;1213;1213;1213;1262	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	H	1262;1262;1213;1213	ENSP00000353206:Y1262H;ENSP00000283254:Y1262H;ENSP00000386726:Y1213H;ENSP00000403348:Y1213H	ENSP00000283254:Y1262H	Y	-	1	0	SCN3A	165677700	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.287000	0.95975	2.250000	0.74265	0.482000	0.46254	TAT	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.313	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		91	0.00	0	A	NM_006922		165969454	165969454	-1	no_errors	ENST00000283254	ensembl	human	known	69_37n	missense	149	18.58	34	SNP	1.000	G
SDR16C5	195814	genome.wustl.edu	37	8	57228667	57228667	+	Silent	SNP	T	T	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr8:57228667T>G	ENST00000303749.3	-	2	877	c.240A>C	c.(238-240)acA>acC	p.T80T	SDR16C5_ENST00000522671.1_Silent_p.T80T|SDR16C5_ENST00000396721.2_Silent_p.T80T	NM_138969.2	NP_620419.2	Q8N3Y7	RDHE2_HUMAN	short chain dehydrogenase/reductase family 16C, member 5	80					detection of light stimulus involved in visual perception (GO:0050908)|keratinocyte proliferation (GO:0043616)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	retinol dehydrogenase activity (GO:0004745)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)	16						CCATCTTACATGTTTCCTCAT	0.522																																						dbGAP											0													112.0	111.0	111.0					8																	57228667		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6167.1	8q12.1	2011-09-20			ENSG00000170786	ENSG00000170786	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	30311	protein-coding gene	gene with protein product		608989				12372410	Standard	NM_138969		Approved	RDHE2, RDH-E2	uc003xsy.1	Q8N3Y7	OTTHUMG00000164311	ENST00000303749.3:c.240A>C	8.37:g.57228667T>G			B4DGK2|Q330K3|Q8TDV9|Q96LX1	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.T80	ENST00000303749.3	37	c.240	CCDS6167.1	8																																																																																			SDR16C5	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR	ENSG00000170786		0.522	SDR16C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDR16C5	HGNC	protein_coding	OTTHUMT00000378235.1	40	0.00	0	T	NM_138969		57228667	57228667	-1	no_errors	ENST00000303749	ensembl	human	known	69_37n	silent	60	21.79	17	SNP	0.000	G
SH3PXD2B	285590	genome.wustl.edu	37	5	171766090	171766090	+	Silent	SNP	G	G	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr5:171766090G>C	ENST00000311601.5	-	13	2189	c.2019C>G	c.(2017-2019)gcC>gcG	p.A673A	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	673					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTGGGACTTGGCAGGCCTGA	0.612																																						dbGAP											0													86.0	81.0	83.0					5																	171766090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.2019C>G	5.37:g.171766090G>C			B6F0V2|Q9P2Q1	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.A673	ENST00000311601.5	37	c.2019	CCDS34291.1	5																																																																																			SH3PXD2B	-	NULL	ENSG00000174705		0.612	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	HGNC	protein_coding	OTTHUMT00000372449.1	50	0.00	0	G	NM_017963		171766090	171766090	-1	no_errors	ENST00000311601	ensembl	human	known	69_37n	silent	70	25.53	24	SNP	0.994	C
SHROOM4	57477	genome.wustl.edu	37	X	50350572	50350572	+	Silent	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chrX:50350572G>A	ENST00000289292.7	-	6	3853	c.3570C>T	c.(3568-3570)caC>caT	p.H1190H	SHROOM4_ENST00000376020.2_Silent_p.H1190H|SHROOM4_ENST00000460112.3_Silent_p.H1074H			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1190					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					AGCCCTCCAGGTGGCCAAAGC	0.537																																						dbGAP											0													75.0	65.0	68.0					X																	50350572		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3570C>T	X.37:g.50350572G>A			A7E2X9|D6RFW0|Q96LA0	Silent	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H1190	ENST00000289292.7	37	c.3570	CCDS35277.1	X																																																																																			SHROOM4	-	NULL	ENSG00000158352		0.537	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	59	0.00	0	G	NM_020717		50350572	50350572	-1	no_errors	ENST00000289292	ensembl	human	known	69_37n	silent	87	16.19	17	SNP	0.002	A
SIPA1L1	26037	genome.wustl.edu	37	14	72085583	72085583	+	Silent	SNP	A	A	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr14:72085583A>C	ENST00000555818.1	+	3	1956	c.1608A>C	c.(1606-1608)cgA>cgC	p.R536R	SIPA1L1_ENST00000358550.2_Silent_p.R536R|SIPA1L1_ENST00000381232.3_Silent_p.R536R|SIPA1L1_ENST00000537413.1_Silent_p.R11R	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	536					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ACAACTACCGAATAATTTTTA	0.393																																						dbGAP											0													75.0	76.0	76.0					14																	72085583		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1608A>C	14.37:g.72085583A>C			J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.R536	ENST00000555818.1	37	c.1608	CCDS9807.1	14																																																																																			SIPA1L1	-	NULL	ENSG00000197555		0.393	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	59	0.00	0	A	NM_015556		72085583	72085583	+1	no_errors	ENST00000555818	ensembl	human	known	69_37n	silent	64	11.11	8	SNP	0.907	C
SLC27A5	10998	genome.wustl.edu	37	19	59009984	59009984	+	Silent	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr19:59009984G>T	ENST00000263093.2	-	10	2080	c.1971C>A	c.(1969-1971)atC>atA	p.I657I	SLC27A5_ENST00000599700.1_5'UTR|SLC27A5_ENST00000594786.1_Silent_p.I62I|SLC27A5_ENST00000601355.1_Silent_p.I573I	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	657					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		GGTCAACCACGATCCCCACAT	0.587																																						dbGAP											0													171.0	141.0	151.0					19																	59009984		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.1971C>A	19.37:g.59009984G>T			B3KVP6|B4DPQ1	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.I657	ENST00000263093.2	37	c.1971	CCDS12983.1	19																																																																																			SLC27A5	-	NULL	ENSG00000083807		0.587	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A5	HGNC	protein_coding	OTTHUMT00000467060.1	64	0.00	0	G	NM_012254		59009984	59009984	-1	no_errors	ENST00000263093	ensembl	human	known	69_37n	silent	73	26.26	26	SNP	0.004	T
SLITRK2	84631	genome.wustl.edu	37	X	144905707	144905707	+	Silent	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chrX:144905707C>T	ENST00000370490.1	+	1	6019	c.1764C>T	c.(1762-1764)acC>acT	p.T588T	SLITRK2_ENST00000413937.2_Silent_p.T588T|SLITRK2_ENST00000428560.2_Silent_p.T588T|SLITRK2_ENST00000447897.2_Silent_p.T588T|SLITRK2_ENST00000434188.2_Silent_p.T588T			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	588					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CAGATGGAACCGTCTTGTCAA	0.473													C|||	1	0.000264901	0.0008	0.0	3775	,	,		13930	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													83.0	66.0	72.0					X																	144905707		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1764C>T	X.37:g.144905707C>T			A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T588	ENST00000370490.1	37	c.1764	CCDS14680.1	X																																																																																			SLITRK2	-	NULL	ENSG00000185985		0.473	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	20	0.00	0	C	NM_032539		144905707	144905707	+1	no_errors	ENST00000370490	ensembl	human	known	69_37n	silent	34	20.93	9	SNP	0.050	T
SUZ12	23512	genome.wustl.edu	37	17	30321730	30321730	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr17:30321730C>G	ENST00000322652.5	+	13	1814	c.1585C>G	c.(1585-1587)Ctt>Gtt	p.L529V	SUZ12_ENST00000580398.1_Missense_Mutation_p.L506V	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	529					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				CACACATATTCTTGTGTGCAG	0.418			T	JAZF1	endometrial stromal tumours																																	dbGAP		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0													80.0	72.0	75.0					17																	30321730		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.1585C>G	17.37:g.30321730C>G	ENSP00000316578:p.Leu529Val		Q96BD9	Missense_Mutation	SNP	pfam_Polycomb_protein_VEFS-Box	p.L529V	ENST00000322652.5	37	c.1585	CCDS11270.1	17	.	.	.	.	.	.	.	.	.	.	c	14.57	2.573555	0.45902	.	.	ENSG00000178691	ENST00000322652	T	0.51325	0.71	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.66848	0.2831	M	0.68593	2.085	0.80722	D	1	B;D	0.63880	0.18;0.993	B;D	0.70016	0.03;0.967	T	0.66228	-0.5976	10	0.38643	T	0.18	-10.2796	18.1798	0.89773	0.0:1.0:0.0:0.0	.	529;529	A8K1U9;Q15022	.;SUZ12_HUMAN	V	529	ENSP00000316578:L529V	ENSP00000316578:L529V	L	+	1	0	SUZ12	27345843	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.814000	0.86154	2.268000	0.75426	0.551000	0.68910	CTT	SUZ12	-	NULL	ENSG00000178691		0.418	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	HGNC	protein_coding	OTTHUMT00000256260.2	39	0.00	0	C	NM_015355		30321730	30321730	+1	no_errors	ENST00000322652	ensembl	human	known	69_37n	missense	39	45.07	32	SNP	1.000	G
SYTL1	84958	genome.wustl.edu	37	1	27680340	27680340	+	Silent	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:27680340G>A	ENST00000543823.1	+	14	2148	c.1686G>A	c.(1684-1686)acG>acA	p.T562T	SYTL1_ENST00000490170.1_3'UTR|SYTL1_ENST00000318074.5_Silent_p.T550T			Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1	562					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|melanosome (GO:0042470)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)			NS(1)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	12		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CCCCCAGGACGTAGCCCCACC	0.577																																						dbGAP											0													49.0	44.0	46.0					1																	27680340		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027902	CCDS298.1, CCDS53286.1	1p35.3	2008-02-05			ENSG00000142765	ENSG00000142765			15584	protein-coding gene	gene with protein product		608042				12137562	Standard	NM_032872		Approved	SLP1, JFC1, FLJ14996, exophilin-7	uc001bnw.2	Q8IYJ3	OTTHUMG00000005770	ENST00000543823.1:c.1686G>A	1.37:g.27680340G>A			Q5SSC9|Q96BB6|Q96GU6|Q96S89|Q96SI0	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain	p.T562	ENST00000543823.1	37	c.1686	CCDS53286.1	1																																																																																			SYTL1	-	NULL	ENSG00000142765		0.577	SYTL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL1	HGNC	protein_coding		44	0.00	0	G	NM_032872		27680340	27680340	+1	no_errors	ENST00000543823	ensembl	human	known	69_37n	silent	24	34.21	13	SNP	0.094	A
TEX15	56154	genome.wustl.edu	37	8	30705357	30705357	+	Nonsense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr8:30705357C>A	ENST00000256246.2	-	1	1251	c.1177G>T	c.(1177-1179)Gaa>Taa	p.E393*	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	393					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATGAACATTTCTTTGGCCTGG	0.338																																						dbGAP											0													107.0	108.0	108.0					8																	30705357		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1177G>T	8.37:g.30705357C>A	ENSP00000256246:p.Glu393*			Nonsense_Mutation	SNP	NULL	p.E393*	ENST00000256246.2	37	c.1177	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038824	0.55003	.	.	ENSG00000133863	ENST00000256246	.	.	.	5.36	1.5	0.22942	.	0.308092	0.28109	N	0.016579	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.3089	0.15819	0.0:0.5881:0.1584:0.2535	.	.	.	.	X	393	.	ENSP00000256246:E393X	E	-	1	0	TEX15	30824899	0.001000	0.12720	0.029000	0.17559	0.135000	0.20990	0.268000	0.18571	0.337000	0.23665	0.650000	0.86243	GAA	TEX15	-	NULL	ENSG00000133863		0.338	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	146	0.68	1	C			30705357	30705357	-1	no_errors	ENST00000256246	ensembl	human	known	69_37n	nonsense	185	13.49	29	SNP	0.177	A
TFAP2D	83741	genome.wustl.edu	37	6	50740543	50740543	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr6:50740543C>T	ENST00000008391.3	+	8	1553	c.1325C>T	c.(1324-1326)gCc>gTc	p.A442V		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					TCAGAGGCTGCCGTGAAAGAG	0.448																																						dbGAP											0													45.0	42.0	43.0					6																	50740543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1325C>T	6.37:g.50740543C>T	ENSP00000008391:p.Ala442Val			Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C	p.A442V	ENST00000008391.3	37	c.1325	CCDS4933.1	6	.	.	.	.	.	.	.	.	.	.	C	14.25	2.480665	0.44044	.	.	ENSG00000008197	ENST00000008391	D	0.97209	-4.29	5.54	5.54	0.83059	.	0.118903	0.56097	D	0.000023	D	0.87661	0.6233	N	0.08118	0	0.39007	D	0.959475	B	0.09022	0.002	B	0.09377	0.004	D	0.83775	0.0222	10	0.34782	T	0.22	-4.8968	12.7719	0.57426	0.0:0.9252:0.0:0.0748	.	442	Q7Z6R9	AP2D_HUMAN	V	442	ENSP00000008391:A442V	ENSP00000008391:A442V	A	+	2	0	TFAP2D	50848502	0.994000	0.37717	0.992000	0.48379	0.976000	0.68499	2.889000	0.48601	2.607000	0.88179	0.467000	0.42956	GCC	TFAP2D	-	NULL	ENSG00000008197		0.448	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2D	HGNC	protein_coding	OTTHUMT00000040881.1	31	0.00	0	C	NM_172238		50740543	50740543	+1	no_errors	ENST00000008391	ensembl	human	known	69_37n	missense	50	11.86	7	SNP	0.997	T
TMEM131	23505	genome.wustl.edu	37	2	98412831	98412831	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:98412831C>A	ENST00000186436.5	-	28	3278	c.3050G>T	c.(3049-3051)aGa>aTa	p.R1017I		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1017						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						CTTAAATGTTCTTTTCAATGT	0.323																																						dbGAP											0													91.0	79.0	83.0					2																	98412831		1812	4066	5878	-	-	-	SO:0001583	missense	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.3050G>T	2.37:g.98412831C>A	ENSP00000186436:p.Arg1017Ile			Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.R1017I	ENST00000186436.5	37	c.3050	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.130105	0.94473	.	.	ENSG00000075568	ENST00000186436	T	0.39997	1.05	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.70055	0.3180	M	0.82716	2.605	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.72204	-0.4361	10	0.72032	D	0.01	-27.2298	20.3539	0.98825	0.0:1.0:0.0:0.0	.	1017	Q92545	TM131_HUMAN	I	1017	ENSP00000186436:R1017I	ENSP00000186436:R1017I	R	-	2	0	TMEM131	97779263	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.826000	0.97356	0.655000	0.94253	AGA	TMEM131	-	NULL	ENSG00000075568		0.323	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	76	0.00	0	C	XM_371542		98412831	98412831	-1	no_errors	ENST00000186436	ensembl	human	known	69_37n	missense	193	14.22	32	SNP	1.000	A
TMEM132D	121256	genome.wustl.edu	37	12	130184703	130184703	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr12:130184703G>A	ENST00000422113.2	-	2	946	c.620C>T	c.(619-621)aCg>aTg	p.T207M	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	207					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GGCAACCACCGTGGGGGGGCT	0.711																																						dbGAP											0													20.0	24.0	23.0					12																	130184703		2201	4292	6493	-	-	-	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.620C>T	12.37:g.130184703G>A	ENSP00000408581:p.Thr207Met		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.T207M	ENST00000422113.2	37	c.620	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	G	5.710	0.315491	0.10789	.	.	ENSG00000151952	ENST00000422113	T	0.13089	2.62	5.35	4.46	0.54185	.	0.173060	0.39341	N	0.001386	T	0.17831	0.0428	M	0.76328	2.33	0.09310	N	1	P	0.34462	0.454	B	0.30029	0.11	T	0.08330	-1.0727	9	.	.	.	-14.4918	14.3019	0.66359	0.072:0.0:0.928:0.0	.	207	Q14C87	T132D_HUMAN	M	207	ENSP00000408581:T207M	.	T	-	2	0	TMEM132D	128750656	0.135000	0.22499	0.015000	0.15790	0.003000	0.03518	0.888000	0.28268	1.236000	0.43740	0.650000	0.86243	ACG	TMEM132D	-	NULL	ENSG00000151952		0.711	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	21	0.00	0	G	NM_133448		130184703	130184703	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	0.072	A
TP53	7157	genome.wustl.edu	37	17	7577073	7577073	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr17:7577073G>A	ENST00000269305.4	-	8	1054	c.865C>T	c.(865-867)Ctc>Ttc	p.L289F	TP53_ENST00000420246.2_Missense_Mutation_p.L289F|TP53_ENST00000445888.2_Missense_Mutation_p.L289F|TP53_ENST00000359597.4_Missense_Mutation_p.L289F|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.L289F|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	289	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in a sporadic cancer; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N288fs*13(17)|p.0?(8)|p.L289F(2)|p.?(2)|p.R283fs*16(2)|p.R283fs*56(1)|p.L265_K305del41(1)|p.N288fs*15(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.L289fs*56(1)|p.L289V(1)|p.E285fs*13(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTTGCGGAGATTCTCTTCC	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	40	Deletion - Frameshift(23)|Whole gene deletion(8)|Deletion - In frame(4)|Substitution - Missense(3)|Unknown(2)	upper_aerodigestive_tract(20)|bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|central_nervous_system(2)|urinary_tract(2)|stomach(1)|lung(1)|liver(1)											100.0	86.0	91.0					17																	7577073		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.865C>T	17.37:g.7577073G>A	ENSP00000269305:p.Leu289Phe		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.L289F	ENST00000269305.4	37	c.865	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.636006	0.00806	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99737	-5.7;-5.42;-5.7;-5.7;-5.42;-6.59	5.12	0.349	0.16032	p53/RUNT-type transcription factor, DNA-binding domain (1);	0.586122	0.19111	N	0.122434	D	0.94857	0.8338	N	0.01235	-0.94	0.26978	N	0.965433	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.001	D	0.93806	0.7105	10	0.02654	T	1	-10.7124	3.6185	0.08086	0.582:0.0:0.2626:0.1554	.	289;289;289;289	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	F	289;289;289;289;289;278;157	ENSP00000352610:L289F;ENSP00000269305:L289F;ENSP00000398846:L289F;ENSP00000391127:L289F;ENSP00000391478:L289F;ENSP00000425104:L157F	ENSP00000269305:L289F	L	-	1	0	TP53	7517798	0.166000	0.22962	0.736000	0.30914	0.082000	0.17680	-0.028000	0.12350	-0.151000	0.11176	-0.415000	0.06103	CTC	TP53	-	NULL	ENSG00000141510		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	72	0.00	0	G	NM_000546		7577073	7577073	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	97	17.80	21	SNP	0.983	A
TRIO	7204	genome.wustl.edu	37	5	14363873	14363873	+	Silent	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr5:14363873G>A	ENST00000344204.4	+	14	2448	c.2424G>A	c.(2422-2424)gaG>gaA	p.E808E	TRIO_ENST00000509967.2_Silent_p.E759E|TRIO_ENST00000537187.1_Silent_p.E808E	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	808					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GGAATGATGAGCTTTCTCAGC	0.433																																						dbGAP											0													133.0	124.0	127.0					5																	14363873		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2424G>A	5.37:g.14363873G>A			D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.E808	ENST00000344204.4	37	c.2424	CCDS3883.1	5																																																																																			TRIO	-	NULL	ENSG00000038382		0.433	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	47	0.00	0	G	NM_007118		14363873	14363873	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	silent	73	25.51	25	SNP	1.000	A
TRPA1	8989	genome.wustl.edu	37	8	72967727	72967727	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr8:72967727C>A	ENST00000262209.4	-	12	1680	c.1473G>T	c.(1471-1473)aaG>aaT	p.K491N	RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	491					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.K491N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CATGTCCATTCTTTGCTGCCA	0.388																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											64.0	64.0	64.0					8																	72967727		2203	4299	6502	-	-	-	SO:0001583	missense	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1473G>T	8.37:g.72967727C>A	ENSP00000262209:p.Lys491Asn		A6NIN6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.K491N	ENST00000262209.4	37	c.1473	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	C	17.97	3.519230	0.64634	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.65549	-0.16;-0.16	5.4	-2.45	0.06481	Ankyrin repeat-containing domain (4);	0.183825	0.64402	D	0.000020	T	0.62466	0.2430	L	0.35487	1.065	0.36142	D	0.846886	D	0.67145	0.996	P	0.61275	0.886	T	0.66771	-0.5839	10	0.52906	T	0.07	-27.3158	13.7681	0.63008	0.0:0.62:0.0:0.38	.	491	O75762	TRPA1_HUMAN	N	343;491	ENSP00000428151:K343N;ENSP00000262209:K491N	ENSP00000262209:K491N	K	-	3	2	TRPA1	73130281	0.845000	0.29573	0.988000	0.46212	0.939000	0.58152	-0.165000	0.09968	-0.460000	0.07003	-0.312000	0.09012	AAG	TRPA1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104321		0.388	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	56	0.00	0	C	NM_007332		72967727	72967727	-1	no_errors	ENST00000262209	ensembl	human	known	69_37n	missense	111	16.54	22	SNP	0.917	A
TSHZ1	10194	genome.wustl.edu	37	18	73000318	73000318	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr18:73000318A>G	ENST00000580243.1	+	2	3304	c.2956A>G	c.(2956-2958)Ata>Gta	p.I986V	TSHZ1_ENST00000322038.5_Missense_Mutation_p.I941V			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	986					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		TTCTACATACATAAGTCATTT	0.463																																						dbGAP											0													110.0	96.0	101.0					18																	73000318		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2956A>G	18.37:g.73000318A>G	ENSP00000464391:p.Ile986Val		O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.I986V	ENST00000580243.1	37	c.2956		18	.	.	.	.	.	.	.	.	.	.	A	2.585	-0.296502	0.05532	.	.	ENSG00000179981	ENST00000322038	T	0.40756	1.02	5.1	2.61	0.31194	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.051363	0.85682	N	0.000000	T	0.21509	0.0518	N	0.10664	0.02	0.34196	D	0.672584	B	0.06786	0.001	B	0.14023	0.01	T	0.21008	-1.0258	10	0.42905	T	0.14	-31.5877	9.7637	0.40548	0.856:0.0:0.144:0.0	.	986	Q6ZSZ6	TSH1_HUMAN	V	941	ENSP00000323584:I941V	ENSP00000323584:I941V	I	+	1	0	TSHZ1	71129306	1.000000	0.71417	0.996000	0.52242	0.690000	0.40134	5.939000	0.70179	2.051000	0.60960	0.533000	0.62120	ATA	TSHZ1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179981		0.463	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	HGNC	protein_coding	OTTHUMT00000444913.1	76	0.00	0	A	NM_005786		73000318	73000318	+1	no_errors	ENST00000580243	ensembl	human	known	69_37n	missense	44	47.62	40	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179574368	179574368	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:179574368C>T	ENST00000591111.1	-	97	27951	c.27727G>A	c.(27727-27729)Gac>Aac	p.D9243N	TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.D8316N|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D9560N|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13366	Ig-like 75.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAACCAGCGTCGTTCATGCCT	0.438																																						dbGAP											0													172.0	176.0	175.0					2																	179574368		2052	4193	6245	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.27727G>A	2.37:g.179574368C>T	ENSP00000465570:p.Asp9243Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D8316N	ENST00000591111.1	37	c.24946		2	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523876	0.44866	.	.	ENSG00000155657	ENST00000342992	T	0.80994	-1.44	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.92459	0.7606	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93178	0.6572	9	0.87932	D	0	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	9243	Q8WZ42	TITIN_HUMAN	N	8316	ENSP00000343764:D8316N	ENSP00000343764:D8316N	D	-	1	0	TTN	179282613	1.000000	0.71417	0.273000	0.24645	0.016000	0.09150	7.818000	0.86416	2.793000	0.96121	0.655000	0.94253	GAC	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	110	0.00	0	C	NM_133378		179574368	179574368	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	203	15.06	36	SNP	1.000	T
TXNL1	9352	genome.wustl.edu	37	18	54281805	54281805	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr18:54281805T>G	ENST00000217515.6	-	6	789	c.585A>C	c.(583-585)aaA>aaC	p.K195N	TXNL1_ENST00000540155.1_Missense_Mutation_p.K72N|TXNL1_ENST00000590954.1_Missense_Mutation_p.K195N	NM_004786.2	NP_004777.1	O43396	TXNL1_HUMAN	thioredoxin-like 1	195	PITH. {ECO:0000255|PROSITE- ProRule:PRU00864}.				cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide oxidoreductase activity (GO:0015035)	p.K195N(1)		endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		TGATAAAAATTTTTACATATT	0.348																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											74.0	72.0	72.0					18																	54281805		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF003938	CCDS11961.1	18q21.31	2011-01-17	2004-05-06	2004-05-07	ENSG00000091164	ENSG00000091164			12436	protein-coding gene	gene with protein product	"""thioredoxin-like, 32kD"""	603049	"""thioredoxin-like, 32kDa"""	TXNL		9473519, 9668102	Standard	NM_004786		Approved	Txl, TRP32	uc002lgg.3	O43396	OTTHUMG00000132722	ENST00000217515.6:c.585A>C	18.37:g.54281805T>G	ENSP00000217515:p.Lys195Asn			Missense_Mutation	SNP	pfam_PITH_dom,pfam_Thioredoxin_domain,superfamily_Galactose-bd-like,superfamily_Thioredoxin-like_fold	p.K195N	ENST00000217515.6	37	c.585	CCDS11961.1	18	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084459	0.76642	.	.	ENSG00000091164	ENST00000217515;ENST00000540155	T	0.27104	1.69	5.51	4.36	0.52297	Proteasome-interacting thioredoxin-like domain, C-terminal (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.60996	0.2312	H	0.95079	3.62	0.80722	D	1	D;P	0.89917	1.0;0.941	D;P	0.91635	0.999;0.85	T	0.69833	-0.5038	10	0.87932	D	0	.	10.8695	0.46875	0.0:0.0744:0.0:0.9256	.	195;195	B2R960;O43396	.;TXNL1_HUMAN	N	195;72	ENSP00000217515:K195N	ENSP00000217515:K195N	K	-	3	2	TXNL1	52432803	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.925000	0.48884	0.926000	0.37118	0.528000	0.53228	AAA	TXNL1	-	pfam_PITH_dom,superfamily_Galactose-bd-like	ENSG00000091164		0.348	TXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNL1	HGNC	protein_coding	OTTHUMT00000256064.2	84	0.00	0	T			54281805	54281805	-1	no_errors	ENST00000217515	ensembl	human	known	69_37n	missense	112	11.11	14	SNP	1.000	G
UBE2T	29089	genome.wustl.edu	37	1	202304779	202304779	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr1:202304779C>T	ENST00000367274.4	-	2	253	c.104G>A	c.(103-105)cGa>cAa	p.R35Q		NM_014176.3	NP_054895.1	Q9NPD8	UBE2T_HUMAN	ubiquitin-conjugating enzyme E2T (putative)	35					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|skin(1)	5						CCTACGAGCTCGCAGGTCATC	0.428																																						dbGAP											0													137.0	119.0	125.0					1																	202304779		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161499	CCDS1425.1	1q32.1	2008-02-05			ENSG00000077152	ENSG00000077152		"""Ubiquitin-conjugating enzymes E2"""	25009	protein-coding gene	gene with protein product		610538				11042152	Standard	NM_014176		Approved	HSPC150	uc001gxx.4	Q9NPD8	OTTHUMG00000041392	ENST00000367274.4:c.104G>A	1.37:g.202304779C>T	ENSP00000356243:p.Arg35Gln		Q2TU36	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.R35Q	ENST00000367274.4	37	c.104	CCDS1425.1	1	.	.	.	.	.	.	.	.	.	.	c	14.08	2.427342	0.43122	.	.	ENSG00000077152	ENST00000367274	T	0.36699	1.24	5.97	2.81	0.32909	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.331335	0.33180	N	0.005193	T	0.13927	0.0337	N	0.04787	-0.16	0.26878	N	0.967609	B	0.21381	0.055	B	0.20955	0.032	T	0.34800	-0.9814	10	0.02654	T	1	-2.0883	8.6715	0.34154	0.0:0.6551:0.0:0.3449	.	35	Q9NPD8	UBE2T_HUMAN	Q	35	ENSP00000356243:R35Q	ENSP00000356243:R35Q	R	-	2	0	UBE2T	200571402	0.883000	0.30277	0.997000	0.53966	0.992000	0.81027	0.357000	0.20199	0.293000	0.22520	-0.185000	0.12909	CGA	UBE2T	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000077152		0.428	UBE2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2T	HGNC	protein_coding	OTTHUMT00000099163.1	68	0.00	0	C	NM_014176		202304779	202304779	-1	no_errors	ENST00000367274	ensembl	human	known	69_37n	missense	93	16.22	18	SNP	1.000	T
WDR1	9948	genome.wustl.edu	37	4	10079036	10079036	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr4:10079036C>G	ENST00000499869.2	-	14	1799	c.1606G>C	c.(1606-1608)Gtc>Ctc	p.V536L	WDR1_ENST00000382451.2_Missense_Mutation_p.V396L|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000382452.2_Missense_Mutation_p.V536L|WDR1_ENST00000502702.1_Missense_Mutation_p.V396L|MIR3138_ENST00000585238.1_RNA			O75083	WDR1_HUMAN	WD repeat domain 1	536					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		GCCAGGCAGACGATTTTTGCA	0.507																																						dbGAP											0													144.0	151.0	148.0					4																	10079036		2111	4237	6348	-	-	-	SO:0001583	missense	0			AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1606G>C	4.37:g.10079036C>G	ENSP00000427687:p.Val536Leu		A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V536L	ENST00000499869.2	37	c.1606	CCDS54740.1	4	.	.	.	.	.	.	.	.	.	.	C	14.72	2.618210	0.46736	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000502702;ENST00000439733	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	5.85	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.058862	0.64402	D	0.000002	T	0.30510	0.0767	N	0.02247	-0.625	0.80722	D	1	B;B	0.18610	0.029;0.017	B;B	0.17979	0.016;0.02	T	0.15435	-1.0437	10	0.11485	T	0.65	-35.4402	13.8372	0.63417	0.0:0.9273:0.0:0.0727	.	396;536	O75083-3;O75083	.;WDR1_HUMAN	L	536;536;396;396;371	ENSP00000427687:V536L;ENSP00000371890:V536L;ENSP00000371889:V396L;ENSP00000426725:V396L	ENSP00000371889:V396L	V	-	1	0	WDR1	9688134	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.639000	0.61361	1.482000	0.48325	0.655000	0.94253	GTC	WDR1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000071127		0.507	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR1	HGNC	protein_coding	OTTHUMT00000359877.1	62	0.00	0	C			10079036	10079036	-1	no_errors	ENST00000382452	ensembl	human	known	69_37n	missense	67	40.18	45	SNP	1.000	G
WDR66	144406	genome.wustl.edu	37	12	122441598	122441598	+	Silent	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr12:122441598C>T	ENST00000288912.4	+	22	4232	c.3378C>T	c.(3376-3378)atC>atT	p.I1126I		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	1126							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CAGACGAAATCACTGCAGAAA	0.383																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													125.0	115.0	118.0					12																	122441598		1861	4105	5966	-	-	-	SO:0001819	synonymous_variant	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.3378C>T	12.37:g.122441598C>T			C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.I1126	ENST00000288912.4	37	c.3378	CCDS41853.1	12																																																																																			WDR66	-	NULL	ENSG00000158023		0.383	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	110	0.00	0	C	NM_144668		122441598	122441598	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	silent	281	12.19	39	SNP	1.000	T
DAW1	164781	genome.wustl.edu	37	2	228786260	228786260	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr2:228786260G>A	ENST00000309931.2	+	12	1279	c.1196G>A	c.(1195-1197)gGc>gAc	p.G399D	DAW1_ENST00000545118.1_Missense_Mutation_p.G384D|DAW1_ENST00000373666.2_3'UTR	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	399						cilium (GO:0005929)											AACTATAAAGGCAACATAGTC	0.428																																						dbGAP											0													92.0	87.0	89.0					2																	228786260		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.1196G>A	2.37:g.228786260G>A	ENSP00000311899:p.Gly399Asp		Q6ZRY1|Q8N776	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G399D	ENST00000309931.2	37	c.1196	CCDS2470.1	2	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366125	0.82463	.	.	ENSG00000123977	ENST00000309931;ENST00000545118	T;T	0.38560	1.13;1.13	5.27	5.27	0.74061	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.254572	0.38217	N	0.001780	T	0.66257	0.2771	M	0.75777	2.31	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.69632	-0.5093	10	0.66056	D	0.02	.	17.8868	0.88858	0.0:0.0:1.0:0.0	.	399	Q8N136	WDR69_HUMAN	D	399;384	ENSP00000311899:G399D;ENSP00000437887:G384D	ENSP00000311899:G399D	G	+	2	0	WDR69	228494504	1.000000	0.71417	0.169000	0.22859	0.996000	0.88848	8.900000	0.92551	2.444000	0.82710	0.650000	0.86243	GGC	WDR69	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000123977		0.428	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR69	HGNC	protein_coding	OTTHUMT00000331745.1	38	0.00	0	G	NM_178821		228786260	228786260	+1	no_errors	ENST00000309931	ensembl	human	known	69_37n	missense	56	12.50	8	SNP	1.000	A
ZC3H14	79882	genome.wustl.edu	37	14	89038412	89038412	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr14:89038412G>C	ENST00000251038.5	+	5	499	c.274G>C	c.(274-276)Gat>Cat	p.D92H	ZC3H14_ENST00000336693.4_Missense_Mutation_p.D58H|ZC3H14_ENST00000557607.1_5'UTR|ZC3H14_ENST00000555755.1_Missense_Mutation_p.D92H|ZC3H14_ENST00000359301.3_Missense_Mutation_p.D58H|ZC3H14_ENST00000393514.5_Missense_Mutation_p.D92H|ZC3H14_ENST00000302216.8_Missense_Mutation_p.D92H|ZC3H14_ENST00000556945.1_Missense_Mutation_p.D92H	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	92						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						CAACATCTTTGATAGTAACGT	0.383																																						dbGAP											0													83.0	81.0	81.0					14																	89038412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.274G>C	14.37:g.89038412G>C	ENSP00000251038:p.Asp92His		A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	smart_Znf_CCCH	p.D92H	ENST00000251038.5	37	c.274	CCDS32133.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.523526|4.523526	0.85600|0.85600	.|.	.|.	ENSG00000100722|ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000554602;ENST00000380684;ENST00000556945;ENST00000556158;ENST00000555799;ENST00000555755;ENST00000393514;ENST00000336693;ENST00000557693;ENST00000555120|ENST00000556000	.|.	.|.	.|.	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	0.220269|.	0.46442|.	D|.	0.000299|.	T|T	0.68035|0.68035	0.2957|0.2957	L|L	0.40543|0.40543	1.245|1.245	0.43750|0.43750	D|D	0.996254|0.996254	P;P;P;P|.	0.49559|.	0.925;0.875;0.911;0.875|.	P;P;B;P|.	0.53593|.	0.73;0.548;0.443;0.548|.	T|T	0.61510|0.61510	-0.7048|-0.7048	9|5	0.45353|.	T|.	0.12|.	-5.4733|-5.4733	20.2187|20.2187	0.98312|0.98312	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	92;92;92;92|.	G3V5R4;Q6PJT7-2;Q6PJT7-3;Q6PJT7|.	.;.;.;ZC3HE_HUMAN|.	H|F	92;92;92;58;92;58;92;92;79;58;92;92;58;58;58|7	.|.	ENSP00000251038:D92H|.	D|L	+|+	1|3	0|2	ZC3H14|ZC3H14	88108165|88108165	1.000000|1.000000	0.71417|0.71417	0.827000|0.827000	0.32855|0.32855	0.979000|0.979000	0.70002|0.70002	6.830000|6.830000	0.75319|0.75319	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	GAT|TTG	ZC3H14	-	NULL	ENSG00000100722		0.383	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	ZC3H14	HGNC	protein_coding	OTTHUMT00000410387.1	70	0.00	0	G	NM_024824		89038412	89038412	+1	no_errors	ENST00000251038	ensembl	human	known	69_37n	missense	61	21.79	17	SNP	1.000	C
ZNF99	7652	genome.wustl.edu	37	19	22941531	22941531	+	Nonsense_Mutation	SNP	G	G	A	rs565513507	byFrequency	TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr19:22941531G>A	ENST00000596209.1	-	4	1270	c.1180C>T	c.(1180-1182)Cag>Tag	p.Q394*	ZNF99_ENST00000397104.3_Nonsense_Mutation_p.Q303*	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	394					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TAGGGTTTCTGTCCAGTATGA	0.363																																						dbGAP											0													70.0	75.0	74.0					19																	22941531		2036	4222	6258	-	-	-	SO:0001587	stop_gained	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1180C>T	19.37:g.22941531G>A	ENSP00000472969:p.Gln394*		M0R335	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q303*	ENST00000596209.1	37	c.907	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	N	12.26	1.886023	0.33348	.	.	ENSG00000213973	ENST00000397104	.	.	.	1.28	-2.55	0.06288	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	4.3394	0.11103	0.0:0.4594:0.1671:0.3736	.	.	.	.	X	303	.	ENSP00000380293:Q303X	Q	-	1	0	ZNF99	22733371	0.004000	0.15560	0.000000	0.03702	0.014000	0.08584	0.164000	0.16542	-2.646000	0.00426	-2.782000	0.00117	CAG	ZNF99	-	pfscan_Znf_C2H2	ENSG00000213973		0.363	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	104	0.00	0	G	XM_065124		22941531	22941531	-1	no_errors	ENST00000397104	ensembl	human	known	69_37n	nonsense	120	17.12	25	SNP	0.860	A
ZNF546	339327	genome.wustl.edu	37	19	40519819	40519819	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr19:40519819G>T	ENST00000347077.4	+	7	858	c.642G>T	c.(640-642)gaG>gaT	p.E214D	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.E188D	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					ATGCTAGAGAGAAATCATATG	0.358																																						dbGAP											0													74.0	76.0	75.0					19																	40519819		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.642G>T	19.37:g.40519819G>T	ENSP00000339823:p.Glu214Asp		A8K913	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E214D	ENST00000347077.4	37	c.642	CCDS12548.1	19	.	.	.	.	.	.	.	.	.	.	g	14.34	2.504829	0.44558	.	.	ENSG00000187187	ENST00000347077	T	0.19806	2.12	2.64	1.56	0.23342	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17450	0.0419	L	0.38733	1.17	0.24140	N	0.99573	B;B	0.24618	0.107;0.099	B;B	0.28465	0.09;0.028	T	0.25606	-1.0127	9	0.52906	T	0.07	.	8.7471	0.34594	0.0:0.0:0.7724:0.2275	.	188;214	B3KVL3;Q86UE3	.;ZN546_HUMAN	D	214	ENSP00000339823:E214D	ENSP00000339823:E214D	E	+	3	2	ZNF546	45211659	1.000000	0.71417	0.361000	0.25849	0.693000	0.40251	2.334000	0.43920	0.634000	0.30469	0.591000	0.81541	GAG	ZNF546	-	NULL	ENSG00000187187		0.358	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF546	HGNC	protein_coding	OTTHUMT00000462495.2	39	0.00	0	G	NM_178544		40519819	40519819	+1	no_errors	ENST00000347077	ensembl	human	known	69_37n	missense	49	28.99	20	SNP	1.000	T
ZNF534	147658	genome.wustl.edu	37	19	52941953	52941953	+	Nonsense_Mutation	SNP	G	G	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr19:52941953G>T	ENST00000332323.6	+	4	1340	c.1279G>T	c.(1279-1281)Gaa>Taa	p.E427*	ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Nonsense_Mutation_p.E414*	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	427					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E427Q(1)		central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						CAAATGTAATGAATGTGGCAA	0.423																																						dbGAP											1	Substitution - Missense(1)	prostate(1)											110.0	98.0	101.0					19																	52941953		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1279G>T	19.37:g.52941953G>T	ENSP00000327538:p.Glu427*		Q76KX9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E427*	ENST00000332323.6	37	c.1279	CCDS46165.1	19	.	.	.	.	.	.	.	.	.	.	G	14.72	2.619824	0.46736	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	.	.	.	1.82	-0.866	0.10659	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	9.825	0.40905	0.1428:0.0:0.8572:0.0	.	.	.	.	X	427;414;426	.	ENSP00000327538:E427X	E	+	1	0	ZNF534	57633765	0.001000	0.12720	0.024000	0.17045	0.004000	0.04260	0.208000	0.17415	-0.354000	0.08212	-1.314000	0.01303	GAA	ZNF534	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198633		0.423	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000460877.1	49	0.00	0	G	NM_182512		52941953	52941953	+1	no_errors	ENST00000332323	ensembl	human	known	69_37n	nonsense	86	13.13	13	SNP	0.052	T
ZSCAN12	9753	genome.wustl.edu	37	6	28365909	28365909	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JG-01B-11D-A13L-09	TCGA-D8-A1JG-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0b15c6f7-8e3e-48ad-a4a2-97d2ada56c44	56cc7ef4-ecf0-41d0-a692-88b352939918	g.chr6:28365909C>T	ENST00000361028.1	-	2	419	c.274G>A	c.(274-276)Gag>Aag	p.E92K	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.E92K			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	92	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						AGGAACTGCTCCAGCACCAGC	0.587																																						dbGAP											0													82.0	73.0	76.0					6																	28365909		692	1591	2283	-	-	-	SO:0001583	missense	0			AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.274G>A	6.37:g.28365909C>T	ENSP00000354305:p.Glu92Lys		O43724	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E92K	ENST00000361028.1	37	c.274		6	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056535	0.76074	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.16457	2.34;2.34	3.34	3.34	0.38264	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.34291	N	0.004088	T	0.25717	0.0626	H	0.99454	4.575	0.33905	D	0.639006	P;P	0.37914	0.611;0.611	B;B	0.33846	0.131;0.171	T	0.50154	-0.8861	10	0.87932	D	0	.	10.3846	0.44132	0.0:1.0:0.0:0.0	.	92;92	A8K187;O43309	.;ZSC12_HUMAN	K	92	ENSP00000354305:E92K;ENSP00000380039:E92K	ENSP00000354305:E92K	E	-	1	0	ZSCAN12	28473888	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.754000	0.38369	1.857000	0.53885	0.655000	0.94253	GAG	ZSCAN12	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000158691		0.587	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	94	0.00	0	C	NM_014724		28365909	28365909	-1	no_errors	ENST00000361028	ensembl	human	known	69_37n	missense	138	17.37	29	SNP	1.000	T
