#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTSL1	92949	genome.wustl.edu	37	9	18887969	18887969	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr9:18887969C>G	ENST00000380548.4	+	24	4729	c.4390C>G	c.(4390-4392)Caa>Gaa	p.Q1464E	ADAMTSL1_ENST00000380545.5_Missense_Mutation_p.Q165E	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1464	Ig-like C2-type 4.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CGGTGGGTCTCAAGGGGAATT	0.507																																						dbGAP											0													82.0	79.0	80.0					9																	18887969		1983	4163	6146	-	-	-	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.4390C>G	9.37:g.18887969C>G	ENSP00000369921:p.Gln1464Glu		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q165E	ENST00000380548.4	37	c.493	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	C	9.420	1.082666	0.20309	.	.	ENSG00000178031	ENST00000380548;ENST00000380545;ENST00000316239;ENST00000380541;ENST00000380538	T;T;T	0.64260	-0.09;-0.09;-0.09	5.5	5.5	0.81552	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.270585	0.33591	N	0.004746	T	0.42653	0.1212	N	0.13140	0.3	0.32850	D	0.506572	B;B	0.18461	0.001;0.028	B;B	0.19391	0.003;0.025	T	0.36601	-0.9741	10	0.02654	T	1	.	16.283	0.82707	0.0:0.8589:0.1411:0.0	.	165;1464	Q8N6G6-6;Q8N6G6	.;ATL1_HUMAN	E	1464;165;168;168;66	ENSP00000369921:Q1464E;ENSP00000369918:Q165E;ENSP00000369911:Q66E	ENSP00000325584:Q168E	Q	+	1	0	ADAMTSL1	18877969	0.978000	0.34361	0.985000	0.45067	0.995000	0.86356	2.872000	0.48467	2.735000	0.93741	0.655000	0.94253	CAA	ADAMTSL1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000178031		0.507	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	121	0.00	0	C			18887969	18887969	+1	no_errors	ENST00000388710	ensembl	human	known	69_37n	missense	44	22.81	13	SNP	0.992	G
APBB1IP	54518	genome.wustl.edu	37	10	26830613	26830613	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr10:26830613G>A	ENST00000376236.4	+	11	1602	c.1147G>A	c.(1147-1149)Gtt>Att	p.V383I		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	383	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						CTATTGCTTTGTTTTAAAGGT	0.289																																						dbGAP											0													63.0	64.0	64.0					10																	26830613		2201	4300	6501	-	-	-	SO:0001583	missense	0			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.1147G>A	10.37:g.26830613G>A	ENSP00000365411:p.Val383Ile		Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.V383I	ENST00000376236.4	37	c.1147	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434666	0.83885	.	.	ENSG00000077420	ENST00000445780;ENST00000376236	T	0.76186	-1.0	5.87	5.87	0.94306	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.051392	0.85682	D	0.000000	T	0.68897	0.3051	N	0.12746	0.255	0.80722	D	1	B;P	0.36086	0.236;0.536	B;B	0.44224	0.444;0.395	T	0.70212	-0.4934	10	0.52906	T	0.07	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	383;383	B4E100;Q7Z5R6	.;AB1IP_HUMAN	I	383	ENSP00000365411:V383I	ENSP00000365411:V383I	V	+	1	0	APBB1IP	26870619	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.692000	0.74578	2.941000	0.99782	0.655000	0.94253	GTT	APBB1IP	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000077420		0.289	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	100	0.00	0	G	NM_019043		26830613	26830613	+1	no_errors	ENST00000376236	ensembl	human	known	69_37n	missense	78	26.42	28	SNP	1.000	A
ARHGEF7	8874	genome.wustl.edu	37	13	111806290	111806290	+	Silent	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr13:111806290C>T	ENST00000375741.2	+	2	454	c.204C>T	c.(202-204)agC>agT	p.S68S	ARHGEF7_ENST00000375736.4_5'UTR|ARHGEF7_ENST00000218789.5_5'UTR|ARHGEF7_ENST00000375739.2_Intron|ARHGEF7_ENST00000544132.1_5'UTR|ARHGEF7_ENST00000370623.3_Silent_p.S68S|ARHGEF7_ENST00000317133.5_Silent_p.S68S	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	68	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			AGTGCCTGAGCAACATCCGCG	0.736																																						dbGAP											0													24.0	26.0	25.0					13																	111806290		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.204C>T	13.37:g.111806290C>T			B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_CH-domain,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,prints_SH3_domain,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.S68	ENST00000375741.2	37	c.204	CCDS45068.1	13																																																																																			ARHGEF7	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000102606		0.736	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	ARHGEF7	HGNC	protein_coding		20	0.00	0	C	NM_001113511		111806290	111806290	+1	no_errors	ENST00000375741	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	1.000	T
ATAD2	29028	genome.wustl.edu	37	8	124371840	124371840	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr8:124371840C>G	ENST00000287394.5	-	10	1350	c.1243G>C	c.(1243-1245)Gat>Cat	p.D415H	ATAD2_ENST00000534257.1_5'UTR|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	415					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TGCATTGGATCAACATCGGCA	0.323																																						dbGAP											0													108.0	99.0	102.0					8																	124371840		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1243G>C	8.37:g.124371840C>G	ENSP00000287394:p.Asp415His		Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D415H	ENST00000287394.5	37	c.1243	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723742	0.89298	.	.	ENSG00000156802	ENST00000287394	D	0.93953	-3.32	5.03	5.03	0.67393	.	0.459833	0.22302	N	0.061849	D	0.96405	0.8827	M	0.72118	2.19	0.80722	D	1	D;P	0.89917	1.0;0.949	D;P	0.77557	0.99;0.642	D	0.96595	0.9440	10	0.62326	D	0.03	-22.0353	18.7086	0.91648	0.0:1.0:0.0:0.0	.	245;415	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	H	415	ENSP00000287394:D415H	ENSP00000287394:D415H	D	-	1	0	ATAD2	124441021	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.705000	0.84606	2.490000	0.84030	0.491000	0.48974	GAT	ATAD2	-	NULL	ENSG00000156802		0.323	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	148	0.00	0	C	NM_014109		124371840	124371840	-1	no_errors	ENST00000287394	ensembl	human	known	69_37n	missense	104	24.64	34	SNP	1.000	G
BCAT2	587	genome.wustl.edu	37	19	49299687	49299687	+	Nonsense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr19:49299687G>A	ENST00000316273.6	-	10	1150	c.1138C>T	c.(1138-1140)Cag>Tag	p.Q380*	BCAT2_ENST00000402551.1_Nonsense_Mutation_p.Q340*|BCAT2_ENST00000599246.1_Nonsense_Mutation_p.Q288*|BCAT2_ENST00000598162.1_Nonsense_Mutation_p.Q380*|BCAT2_ENST00000597011.1_Nonsense_Mutation_p.Q340*|BCAT2_ENST00000545387.2_Nonsense_Mutation_p.Q288*	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	380					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	CAGCTCACCTGGATCTCCTTC	0.582																																						dbGAP											0													130.0	117.0	122.0					19																	49299687		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.1138C>T	19.37:g.49299687G>A	ENSP00000322991:p.Gln380*		B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Nonsense_Mutation	SNP	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.Q380*	ENST00000316273.6	37	c.1138	CCDS12735.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.922178	0.97105	.	.	ENSG00000105552	ENST00000316273;ENST00000545387;ENST00000402551	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-3.2055	15.4539	0.75297	0.0:0.0:1.0:0.0	.	.	.	.	X	380;288;340	.	ENSP00000322991:Q380X	Q	-	1	0	BCAT2	53991499	1.000000	0.71417	0.997000	0.53966	0.934000	0.57294	6.960000	0.76036	2.577000	0.86979	0.561000	0.74099	CAG	BCAT2	-	superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	ENSG00000105552		0.582	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAT2	HGNC	protein_coding	OTTHUMT00000466202.1	133	0.00	0	G			49299687	49299687	-1	no_errors	ENST00000316273	ensembl	human	known	69_37n	nonsense	38	33.90	20	SNP	1.000	A
C11orf57	55216	genome.wustl.edu	37	11	111953459	111953459	+	Silent	SNP	C	C	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr11:111953459C>G	ENST00000280352.9	+	6	1278	c.642C>G	c.(640-642)ctC>ctG	p.L214L	C11orf57_ENST00000393047.3_Silent_p.L215L|C11orf57_ENST00000532163.1_Silent_p.L186L|TIMM8B_ENST00000507614.1_5'Flank|C11orf57_ENST00000420986.2_Silent_p.L214L	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	214	Lys-rich.									autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AAAAGTCTCTCAAAAAACCTG	0.413																																						dbGAP											0													73.0	78.0	76.0					11																	111953459		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.642C>G	11.37:g.111953459C>G			Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Silent	SNP	NULL	p.L215	ENST00000280352.9	37	c.645	CCDS41715.1	11																																																																																			C11orf57	-	NULL	ENSG00000150776		0.413	C11orf57-001	KNOWN	basic|CCDS	protein_coding	C11orf57	HGNC	protein_coding	OTTHUMT00000316852.1	60	0.00	0	C	NM_018195		111953459	111953459	+1	no_errors	ENST00000393047	ensembl	human	known	69_37n	silent	47	25.40	16	SNP	0.987	G
REC114	283677	genome.wustl.edu	37	15	73852248	73852248	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr15:73852248G>C	ENST00000331090.6	+	6	820	c.792G>C	c.(790-792)ttG>ttC	p.L264F	C15orf60_ENST00000560581.1_Missense_Mutation_p.L236F	NM_001042367.1	NP_001035826.1	Q7Z4M0	RE114_HUMAN		264					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)					endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|pancreas(1)|prostate(2)	17						TGGCGGGTTTGAGAAATTAAT	0.348																																						dbGAP											0													65.0	67.0	66.0					15																	73852248		1804	4067	5871	-	-	-	SO:0001583	missense	0																														ENST00000331090.6:c.792G>C	15.37:g.73852248G>C	ENSP00000328423:p.Leu264Phe			Missense_Mutation	SNP	NULL	p.L264F	ENST00000331090.6	37	c.792	CCDS45296.1	15	.	.	.	.	.	.	.	.	.	.	G	5.731	0.319383	0.10845	.	.	ENSG00000183324	ENST00000331090	T	0.55588	0.51	5.42	3.43	0.39272	.	1.098820	0.07052	N	0.832178	T	0.41050	0.1142	L	0.31294	0.92	0.09310	N	1	B	0.29646	0.253	B	0.29663	0.105	T	0.32824	-0.9892	10	0.42905	T	0.14	-24.4073	6.9219	0.24393	0.094:0.2636:0.6424:0.0	.	264	Q7Z4M0	CO060_HUMAN	F	264	ENSP00000328423:L264F	ENSP00000328423:L264F	L	+	3	2	C15orf60	71639301	0.626000	0.27120	0.034000	0.17996	0.067000	0.16453	0.121000	0.15667	1.291000	0.44653	0.460000	0.39030	TTG	C15orf60	-	NULL	ENSG00000183324		0.348	C15orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf60	HGNC	protein_coding	OTTHUMT00000419069.1	73	0.00	0	G			73852248	73852248	+1	no_errors	ENST00000331090	ensembl	human	known	69_37n	missense	43	30.65	19	SNP	0.013	C
RSRP1	57035	genome.wustl.edu	37	1	25572975	25572975	+	Silent	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr1:25572975C>T	ENST00000243189.7	-	2	756	c.480G>A	c.(478-480)acG>acA	p.T160T	C1orf63_ENST00000417642.2_Silent_p.T153T|C1orf63_ENST00000431849.2_Silent_p.T160T|RP3-465N24.6_ENST00000607698.1_lincRNA	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN		160	Arg/Ser-rich.									breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TCCGCGACCTCGTCCTGGATC	0.567																																						dbGAP											0													148.0	145.0	146.0					1																	25572975		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000243189.7:c.480G>A	1.37:g.25572975C>T			A8K917|Q49AA4|Q5TH71|Q9GZP6	Missense_Mutation	SNP	NULL	p.E53K	ENST00000243189.7	37	c.157	CCDS260.1	1																																																																																			C1orf63	-	NULL	ENSG00000117616		0.567	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf63	HGNC	protein_coding	OTTHUMT00000101966.2	86	0.00	0	C			25572975	25572975	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000565733	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	0.000	T
CCL28	56477	genome.wustl.edu	37	5	43382081	43382081	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr5:43382081C>T	ENST00000361115.4	-	3	339	c.265G>A	c.(265-267)Gct>Act	p.A89T	CCL28_ENST00000513525.1_Missense_Mutation_p.A42T	NM_148672.2	NP_683513.1	Q9NRJ3	CCL28_HUMAN	chemokine (C-C motif) ligand 28	89					cell chemotaxis (GO:0060326)|chemotaxis (GO:0006935)|immune response (GO:0006955)|negative regulation of leukocyte tethering or rolling (GO:1903237)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	chemokine activity (GO:0008009)			kidney(3)|lung(3)|ovary(1)	7						TTCTTGGCAGCTTGCACTTTC	0.453																																					Esophageal Squamous(178;1549 1997 2043 22794 27051)	dbGAP											0													219.0	175.0	190.0					5																	43382081		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF110384	CCDS3944.1	5p12	2013-02-25			ENSG00000151882	ENSG00000151882		"""Chemokine ligands"", ""Endogenous ligands"""	17700	protein-coding gene	gene with protein product	"""CC chemokine CCL28"", ""mucosae-associated epithelial chemokine"", ""small inducible cytokine subfamily A (Cys-Cys), member 28"", ""small inducible cytokine A28"""	605240				10781587, 11295038	Standard	XR_241707		Approved	SCYA28, MEC, CCK1	uc003jnu.3	Q9NRJ3	OTTHUMG00000094811	ENST00000361115.4:c.265G>A	5.37:g.43382081C>T	ENSP00000354416:p.Ala89Thr		D7RIE7	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom	p.A89T	ENST00000361115.4	37	c.265	CCDS3944.1	5	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848814	0.32699	.	.	ENSG00000151882	ENST00000361115;ENST00000513525	T;T	0.03831	3.79;3.79	5.31	1.31	0.21738	Chemokine interleukin-8-like domain (1);	0.988205	0.08239	N	0.976362	T	0.03695	0.0105	L	0.29908	0.895	0.09310	N	1	B	0.21520	0.057	B	0.15052	0.012	T	0.46527	-0.9185	10	0.30854	T	0.27	-0.7246	3.2742	0.06892	0.1843:0.5201:0.0:0.2956	.	89	Q9NRJ3	CCL28_HUMAN	T	89;42	ENSP00000354416:A89T;ENSP00000422369:A42T	ENSP00000354416:A89T	A	-	1	0	CCL28	43417838	0.000000	0.05858	0.020000	0.16555	0.382000	0.30200	-0.031000	0.12287	0.392000	0.25172	-0.253000	0.11424	GCT	CCL28	-	superfamily_Chemokine_IL8-like_dom	ENSG00000151882		0.453	CCL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL28	HGNC	protein_coding	OTTHUMT00000211631.2	355	0.00	0	C	NM_148672		43382081	43382081	-1	no_errors	ENST00000361115	ensembl	human	known	69_37n	missense	243	26.81	89	SNP	0.010	T
CCNE2	9134	genome.wustl.edu	37	8	95905064	95905064	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr8:95905064G>A	ENST00000520509.1	-	5	551	c.299C>T	c.(298-300)tCa>tTa	p.S100L	CCNE2_ENST00000396133.3_Missense_Mutation_p.S100L|CCNE2_ENST00000523476.1_5'UTR|CCNE2_ENST00000308108.4_Missense_Mutation_p.S100L|NDUFAF6_ENST00000396113.1_5'Flank			O96020	CCNE2_HUMAN	cyclin E2	100					cell cycle checkpoint (GO:0000075)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|prostate(1)	11	Breast(36;8.75e-07)					AGGCAAAGGTGAAGGATTAAT	0.279																																						dbGAP											0													31.0	34.0	33.0					8																	95905064		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF091433	CCDS6264.1	8q22.1	2005-10-18			ENSG00000175305	ENSG00000175305			1590	protein-coding gene	gene with protein product		603775				9840927, 9840943	Standard	NM_057749		Approved	CYCE2	uc003yhc.3	O96020	OTTHUMG00000164696	ENST00000520509.1:c.299C>T	8.37:g.95905064G>A	ENSP00000429089:p.Ser100Leu		O95439	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.S100L	ENST00000520509.1	37	c.299	CCDS6264.1	8	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883859	0.91814	.	.	ENSG00000175305	ENST00000520509;ENST00000308108;ENST00000396133	T;T;T	0.35605	1.71;1.71;1.3	5.84	5.84	0.93424	Cyclin-like (1);	0.000000	0.85682	D	0.000000	T	0.51466	0.1676	M	0.73962	2.25	0.80722	D	1	P;P	0.49358	0.923;0.883	P;B	0.49597	0.616;0.36	T	0.41016	-0.9532	10	0.25751	T	0.34	.	20.1386	0.98045	0.0:0.0:1.0:0.0	.	100;100	Q8WUE3;O96020	.;CCNE2_HUMAN	L	100	ENSP00000429089:S100L;ENSP00000309181:S100L;ENSP00000379437:S100L	ENSP00000309181:S100L	S	-	2	0	CCNE2	95974240	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.764000	0.74960	2.767000	0.95098	0.561000	0.74099	TCA	CCNE2	-	superfamily_Cyclin-like,pirsf_Cyclin_A/B/D/E	ENSG00000175305		0.279	CCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNE2	HGNC	protein_coding	OTTHUMT00000379808.1	52	0.00	0	G	NM_057749, NM_004702		95905064	95905064	-1	no_errors	ENST00000308108	ensembl	human	known	69_37n	missense	65	12.99	10	SNP	1.000	A
COL4A4	1286	genome.wustl.edu	37	2	227924262	227924262	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr2:227924262C>T	ENST00000396625.3	-	28	2449	c.2242G>A	c.(2242-2244)Ggc>Agc	p.G748S	COL4A4_ENST00000329662.7_Missense_Mutation_p.G748S	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	748	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.G748C(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCTGGTGAGCCGGGAGGGCCT	0.552																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											65.0	70.0	68.0					2																	227924262		1831	4076	5907	-	-	-	SO:0001583	missense	0				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2242G>A	2.37:g.227924262C>T	ENSP00000379866:p.Gly748Ser		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G748S	ENST00000396625.3	37	c.2242	CCDS42828.1	2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366107	0.82463	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.99167	-5.51;-5.51	5.89	4.99	0.66335	.	.	.	.	.	D	0.98153	0.9390	M	0.92507	3.315	0.58432	D	0.999994	P	0.52577	0.954	B	0.33890	0.172	D	0.96986	0.9718	9	0.87932	D	0	.	11.0063	0.47635	0.0:0.9083:0.0:0.0916	.	748	P53420	CO4A4_HUMAN	S	748	ENSP00000379866:G748S;ENSP00000328553:G748S	ENSP00000328553:G748S	G	-	1	0	COL4A4	227632506	0.915000	0.31059	0.052000	0.19188	0.898000	0.52572	2.674000	0.46867	1.403000	0.46800	0.655000	0.94253	GGC	COL4A4	-	NULL	ENSG00000081052		0.552	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	50	0.00	0	C	NM_000092		227924262	227924262	-1	no_errors	ENST00000396625	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	0.855	T
CRYZL1	9946	genome.wustl.edu	37	21	34963501	34963501	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr21:34963501T>A	ENST00000381554.3	-	12	1002	c.917A>T	c.(916-918)gAt>gTt	p.D306V	DONSON_ENST00000303113.6_5'Flank|CRYZL1_ENST00000381540.3_Silent_p.G307G|AP000304.12_ENST00000429238.1_Intron|DONSON_ENST00000303071.5_5'Flank|CRYZL1_ENST00000290244.5_Missense_Mutation_p.D291V|CRYZL1_ENST00000445393.1_Intron|DONSON_ENST00000453626.1_5'Flank|DONSON_ENST00000432378.1_5'Flank|CRYZL1_ENST00000480893.1_5'UTR	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	306					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						CTCCATCACATCCTTTAAGAT	0.398																																						dbGAP											0													184.0	170.0	175.0					21																	34963501		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.917A>T	21.37:g.34963501T>A	ENSP00000370966:p.Asp306Val		B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.D306V	ENST00000381554.3	37	c.917	CCDS13633.2	21	.	.	.	.	.	.	.	.	.	.	T	22.8	4.335432	0.81801	.	.	ENSG00000205758	ENST00000381554;ENST00000290244	T;T	0.18338	2.28;2.22	5.28	5.28	0.74379	.	0.107611	0.64402	D	0.000008	T	0.30510	0.0767	M	0.69823	2.125	0.80722	D	1	D	0.53151	0.958	P	0.50490	0.642	T	0.05937	-1.0855	10	0.59425	D	0.04	-7.8485	13.802	0.63206	0.0:0.0:0.0:1.0	.	306	O95825	QORL1_HUMAN	V	306;291	ENSP00000370966:D306V;ENSP00000290244:D291V	ENSP00000290244:D291V	D	-	2	0	CRYZL1	33885371	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.771000	0.68881	1.990000	0.58119	0.533000	0.62120	GAT	CRYZL1	-	smart_PKS_ER	ENSG00000205758		0.398	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYZL1	HGNC	protein_coding	OTTHUMT00000141282.2	178	0.00	0	T	NM_145858		34963501	34963501	-1	no_errors	ENST00000381554	ensembl	human	known	69_37n	missense	109	19.85	27	SNP	1.000	A
CTPS1	1503	genome.wustl.edu	37	1	41473185	41473185	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr1:41473185G>A	ENST00000372621.4	+	14	1869	c.1361G>A	c.(1360-1362)aGa>aAa	p.R454K	CTPS1_ENST00000541520.1_Missense_Mutation_p.R223K|CTPS1_ENST00000372616.1_Missense_Mutation_p.R454K	NM_001905.2	NP_001896.2			CTP synthase 1											endometrium(3)|lung(10)	13						GGCAAGAGGAGAACCCTGTTC	0.557																																						dbGAP											0													113.0	88.0	97.0					1																	41473185		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009408	CCDS459.1	1p34.1	2012-05-02	2012-05-02	2012-05-02	ENSG00000171793	ENSG00000171793	6.3.4.2		2519	protein-coding gene	gene with protein product		123860	"""CTP synthase"""	CTPS		1783378	Standard	XM_005270536		Approved		uc001cgk.4	P17812	OTTHUMG00000005712	ENST00000372621.4:c.1361G>A	1.37:g.41473185G>A	ENSP00000361704:p.Arg454Lys			Missense_Mutation	SNP	pfam_CTP_synthase_N,pfam_GATASE_1,pfam_Peptidase_C26,tigrfam_CTP_synthase	p.R454K	ENST00000372621.4	37	c.1361	CCDS459.1	1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648676	0.47258	.	.	ENSG00000171793	ENST00000372621;ENST00000541520;ENST00000372616	D;D;D	0.89123	-2.47;-2.47;-2.47	5.31	5.31	0.75309	Glutamine amidotransferase type 1 (2);	0.045565	0.85682	D	0.000000	D	0.84383	0.5460	L	0.33792	1.035	0.58432	D	0.999998	B;B	0.10296	0.003;0.001	B;B	0.13407	0.009;0.005	T	0.79460	-0.1794	10	0.42905	T	0.14	.	16.8359	0.85957	0.0:0.0:1.0:0.0	.	223;454	B4DR64;P17812	.;PYRG1_HUMAN	K	454;223;454	ENSP00000361704:R454K;ENSP00000442646:R223K;ENSP00000361699:R454K	ENSP00000361699:R454K	R	+	2	0	CTPS	41245772	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.394000	0.97261	2.638000	0.89438	0.655000	0.94253	AGA	CTPS1	-	pfam_GATASE_1,pfam_Peptidase_C26,tigrfam_CTP_synthase	ENSG00000171793		0.557	CTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS1	HGNC	protein_coding	OTTHUMT00000015629.1	103	0.00	0	G	NM_001905		41473185	41473185	+1	no_errors	ENST00000372616	ensembl	human	known	69_37n	missense	44	21.43	12	SNP	1.000	A
PRR32	100130613	genome.wustl.edu	37	X	125955390	125955390	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chrX:125955390C>T	ENST00000371125.3	+	2	849	c.769C>T	c.(769-771)Ccc>Tcc	p.P257S		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		257	Pro-rich.																GATTTTCAATCCCTTTCTCAC	0.483																																						dbGAP											0													325.0	221.0	253.0					X																	125955390		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000371125.3:c.769C>T	X.37:g.125955390C>T	ENSP00000360166:p.Pro257Ser			Missense_Mutation	SNP	NULL	p.P257S	ENST00000371125.3	37	c.769	CCDS48163.1	X	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816453	0.32145	.	.	ENSG00000183631	ENST00000371125	T	0.57436	0.4	3.99	3.1	0.35709	.	0.259107	0.20529	N	0.090543	T	0.56645	0.1999	L	0.34521	1.04	0.09310	N	1	D	0.71674	0.998	D	0.66979	0.948	T	0.44236	-0.9341	10	0.87932	D	0	-7.8415	8.4936	0.33115	0.0:0.7676:0.2324:0.0	.	257	B1ATL7	CX064_HUMAN	S	257	ENSP00000360166:P257S	ENSP00000360166:P257S	P	+	1	0	CXorf64	125783071	0.014000	0.17966	0.005000	0.12908	0.016000	0.09150	0.675000	0.25232	1.011000	0.39340	0.513000	0.50165	CCC	CXorf64	-	NULL	ENSG00000183631		0.483	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf64	HGNC	protein_coding	OTTHUMT00000058188.1	589	0.00	0	C			125955390	125955390	+1	no_errors	ENST00000371125	ensembl	human	known	69_37n	missense	225	22.41	65	SNP	0.005	T
DCTN2	10540	genome.wustl.edu	37	12	57929272	57929272	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr12:57929272C>T	ENST00000548249.1	-	4	526	c.259G>A	c.(259-261)Gag>Aag	p.E87K	DCTN2_ENST00000543672.1_Missense_Mutation_p.E92K|DCTN2_ENST00000551400.1_5'UTR|DCTN2_ENST00000537439.1_Missense_Mutation_p.E64K|DCTN2_ENST00000434715.3_Missense_Mutation_p.E92K	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	87					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						CAAACCATCTCATATTCTCCA	0.453																																						dbGAP											0													137.0	129.0	132.0					12																	57929272		1929	4134	6063	-	-	-	SO:0001583	missense	0			U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.259G>A	12.37:g.57929272C>T	ENSP00000447824:p.Glu87Lys		B2RBK5|Q86YN2|Q9BW17	Missense_Mutation	SNP	pfam_Dynamitin_2su	p.E92K	ENST00000548249.1	37	c.274	CCDS58245.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.465092	0.96257	.	.	ENSG00000175203	ENST00000548249;ENST00000434715;ENST00000543672;ENST00000537439;ENST00000354743;ENST00000550086;ENST00000550954;ENST00000546670;ENST00000550750	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.80171	0.4574	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.997;0.998	T	0.78170	-0.2308	9	0.36615	T	0.2	-16.0905	18.0982	0.89497	0.0:1.0:0.0:0.0	.	87;92;87	F8WAG8;F5H2S7;Q13561	.;.;DCTN2_HUMAN	K	87;92;92;64;87;52;101;87;64	.	ENSP00000346785:E87K	E	-	1	0	DCTN2	56215539	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.926000	0.75835	2.894000	0.99253	0.655000	0.94253	GAG	DCTN2	-	pfam_Dynamitin_2su	ENSG00000175203		0.453	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN2	HGNC	protein_coding	OTTHUMT00000407393.2	209	0.00	0	C	NM_006400		57929272	57929272	-1	no_errors	ENST00000434715	ensembl	human	known	69_37n	missense	103	25.36	35	SNP	1.000	T
DLG1	1739	genome.wustl.edu	37	3	196817851	196817851	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr3:196817851C>T	ENST00000419354.1	-	16	1978	c.1692G>A	c.(1690-1692)atG>atA	p.M564I	DLG1_ENST00000314062.3_Missense_Mutation_p.M513I|DLG1_ENST00000448528.2_Missense_Mutation_p.M564I|DLG1_ENST00000357674.4_Missense_Mutation_p.M531I|DLG1_ENST00000443183.1_Missense_Mutation_p.M448I|DLG1_ENST00000346964.2_Missense_Mutation_p.M564I|DLG1_ENST00000452595.1_Missense_Mutation_p.M448I|DLG1_ENST00000450955.1_Missense_Mutation_p.M531I|DLG1_ENST00000392382.2_Missense_Mutation_p.M531I|DLG1_ENST00000422288.1_Missense_Mutation_p.M513I			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	564					actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TACTATTCATCATCTGCTCCC	0.318																																						dbGAP											0													122.0	115.0	118.0					3																	196817851		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.1692G>A	3.37:g.196817851C>T	ENSP00000407531:p.Met564Ile		A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.M564I	ENST00000419354.1	37	c.1692	CCDS43194.1	3	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951745	0.73787	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955	D;D;D;D;D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	5.64	5.64	0.86602	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	D	0.84083	0.5394	L	0.43152	1.355	0.80722	D	1	P;B;B;P;B;P	0.46621	0.881;0.083;0.157;0.753;0.028;0.753	P;B;B;B;B;B	0.49528	0.614;0.049;0.064;0.406;0.021;0.406	D	0.84265	0.0485	10	0.49607	T	0.09	.	18.6893	0.91577	0.0:1.0:0.0:0.0	.	531;448;448;531;564;564	Q12959-4;E9PG21;E7EWL7;Q12959-3;Q12959;Q12959-2	.;.;.;.;DLG1_HUMAN;.	I	564;564;531;564;513;564;448;513;564;448;531;531	ENSP00000345731:M564I;ENSP00000350303:M531I;ENSP00000321087:M513I;ENSP00000407531:M564I;ENSP00000398939:M448I;ENSP00000413238:M513I;ENSP00000391732:M564I;ENSP00000396658:M448I;ENSP00000376187:M531I;ENSP00000411278:M531I	ENSP00000321087:M513I	M	-	3	0	DLG1	198302248	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.015000	0.70791	2.637000	0.89404	0.563000	0.77884	ATG	DLG1	-	superfamily_SH3_domain,pirsf_M-assoc_guanylate_kinase	ENSG00000075711		0.318	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	99	0.00	0	C	NM_004087		196817851	196817851	-1	no_errors	ENST00000346964	ensembl	human	known	69_37n	missense	68	40.87	47	SNP	1.000	T
DOCK11	139818	genome.wustl.edu	37	X	117815153	117815153	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chrX:117815153C>T	ENST00000276202.7	+	50	5867	c.5804C>T	c.(5803-5805)tCt>tTt	p.S1935F	DOCK11_ENST00000276204.6_Missense_Mutation_p.S1935F	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1935	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CTTTGCTCCTCTACTGACGTG	0.383																																						dbGAP											0													93.0	76.0	82.0					X																	117815153		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.5804C>T	X.37:g.117815153C>T	ENSP00000276202:p.Ser1935Phe		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S1935F	ENST00000276202.7	37	c.5804	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	C	13.90	2.373816	0.42105	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.19105	2.17;2.17	5.78	5.78	0.91487	.	0.329786	0.36932	N	0.002331	T	0.35770	0.0943	M	0.81802	2.56	0.19775	N	0.999953	P;P	0.37688	0.605;0.605	P;B	0.45538	0.484;0.383	T	0.39563	-0.9608	10	0.59425	D	0.04	-22.1724	11.3353	0.49500	0.0:0.9159:0.0:0.0841	.	1935;1935	A6NIW2;Q5JSL3	.;DOC11_HUMAN	F	1935	ENSP00000276204:S1935F;ENSP00000276202:S1935F	ENSP00000276202:S1935F	S	+	2	0	DOCK11	117699181	0.000000	0.05858	1.000000	0.80357	0.995000	0.86356	1.325000	0.33724	2.426000	0.82243	0.544000	0.68410	TCT	DOCK11	-	pfam_DOCK	ENSG00000147251		0.383	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	70	0.00	0	C	NM_144658		117815153	117815153	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	0.313	T
EHBP1	23301	genome.wustl.edu	37	2	63217952	63217952	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr2:63217952G>A	ENST00000263991.5	+	18	3405	c.2923G>A	c.(2923-2925)Gag>Aag	p.E975K	EHBP1_ENST00000354487.3_Missense_Mutation_p.E940K|EHBP1_ENST00000405289.1_Missense_Mutation_p.E940K|EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000431489.1_Missense_Mutation_p.E904K|EHBP1_ENST00000405015.3_Missense_Mutation_p.E904K	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	975						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AGCTGTAACTGAGAGCTCAGA	0.428																																						dbGAP											0													86.0	90.0	89.0					2																	63217952		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.2923G>A	2.37:g.63217952G>A	ENSP00000263991:p.Glu975Lys		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.E975K	ENST00000263991.5	37	c.2923	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161162	0.78226	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T	0.75704	-0.96;-0.96;-0.92;-0.91;-0.91	5.46	5.46	0.80206	.	0.214173	0.40302	N	0.001136	T	0.65069	0.2656	L	0.34521	1.04	0.43885	D	0.996501	P;B;P	0.36753	0.515;0.361;0.568	B;B;B	0.34652	0.108;0.187;0.101	T	0.62091	-0.6927	10	0.16420	T	0.52	.	19.3061	0.94163	0.0:0.0:1.0:0.0	.	940;904;975	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	K	904;904;975;940;940	ENSP00000384143:E904K;ENSP00000403783:E904K;ENSP00000263991:E975K;ENSP00000346482:E940K;ENSP00000385524:E940K	ENSP00000263991:E975K	E	+	1	0	EHBP1	63071456	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	6.778000	0.75043	2.576000	0.86940	0.655000	0.94253	GAG	EHBP1	-	NULL	ENSG00000115504		0.428	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	128	0.00	0	G	NM_015252		63217952	63217952	+1	no_errors	ENST00000263991	ensembl	human	known	69_37n	missense	88	20.00	22	SNP	0.972	A
EZR	7430	genome.wustl.edu	37	6	159188099	159188099	+	Silent	SNP	G	G	A	rs537707819		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr6:159188099G>A	ENST00000367075.3	-	14	1776	c.1608C>T	c.(1606-1608)agC>agT	p.S536S	MIR3918_ENST00000581555.1_RNA|EZR_ENST00000392177.4_Silent_p.S504S|EZR_ENST00000337147.7_Silent_p.S536S	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	536	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		GGGACAGCTCGCTGCTCAGCG	0.572			T	ROS1	NSCLC								G|||	1	0.000199681	0.0	0.0	5008	,	,		19159	0.0		0.001	False		,,,				2504	0.0					dbGAP		Dom	yes		6	6q25.3	7430	ezrin		E	0													167.0	148.0	154.0					6																	159188099		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1608C>T	6.37:g.159188099G>A			E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Silent	SNP	pirsf_ERM,pfam_ERM_C,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin,smart_Band_41_domain,prints_Ez/rad/moesin,prints_Band_41_fam,pfscan_FERM_domain	p.S536	ENST00000367075.3	37	c.1608	CCDS5258.1	6																																																																																			EZR	-	pirsf_ERM,pfam_ERM_C,superfamily_Moesin	ENSG00000092820		0.572	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EZR	HGNC	protein_coding	OTTHUMT00000042878.1	289	0.00	0	G	NM_003379		159188099	159188099	-1	no_errors	ENST00000337147	ensembl	human	known	69_37n	silent	189	28.14	74	SNP	0.001	A
AMER1	139285	genome.wustl.edu	37	X	63410674	63410674	+	Silent	SNP	A	A	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chrX:63410674A>G	ENST00000330258.3	-	2	2765	c.2493T>C	c.(2491-2493)gaT>gaC	p.D831D	AMER1_ENST00000403336.1_Intron|AMER1_ENST00000374869.3_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	831					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CAAGATCTTCATCATTGTGGA	0.512																																						dbGAP											67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											41.0	41.0	41.0					X																	63410674		2193	4285	6478	-	-	-	SO:0001819	synonymous_variant	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2493T>C	X.37:g.63410674A>G			A2IB86|Q8N885	Silent	SNP	pfam_Uncharacterised_FAM123	p.D831	ENST00000330258.3	37	c.2493	CCDS14377.2	X																																																																																			FAM123B	-	NULL	ENSG00000184675		0.512	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123B	HGNC	protein_coding	OTTHUMT00000316584.1	88	0.00	0	A	NM_152424		63410674	63410674	-1	no_errors	ENST00000330258	ensembl	human	known	69_37n	silent	30	36.17	17	SNP	0.358	G
FNDC3A	22862	genome.wustl.edu	37	13	49781423	49781423	+	Silent	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr13:49781423G>A	ENST00000492622.2	+	26	3794	c.3489G>A	c.(3487-3489)agG>agA	p.R1163R	FNDC3A_ENST00000541916.1_Silent_p.R1163R|FNDC3A_ENST00000398316.3_Silent_p.R1107R	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	1163					fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		AAAGCACAAGGACCCGACGGG	0.507																																						dbGAP											0													119.0	99.0	106.0					13																	49781423		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.3489G>A	13.37:g.49781423G>A			B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R1163	ENST00000492622.2	37	c.3489	CCDS41886.1	13																																																																																			FNDC3A	-	NULL	ENSG00000102531		0.507	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC3A	HGNC	protein_coding	OTTHUMT00000354845.2	201	0.00	0	G	NM_014923		49781423	49781423	+1	no_errors	ENST00000492622	ensembl	human	known	69_37n	silent	102	36.65	59	SNP	0.999	A
FOCAD	54914	genome.wustl.edu	37	9	20982406	20982406	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr9:20982406G>C	ENST00000380249.1	+	41	5053	c.4689G>C	c.(4687-4689)atG>atC	p.M1563I	FOCAD_ENST00000338382.6_Missense_Mutation_p.M1563I|FOCAD_ENST00000605086.1_Missense_Mutation_p.M999I	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1563						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)		p.M1563I(1)									TCTTAGAAATGACAGATGATG	0.343																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											128.0	134.0	132.0					9																	20982406		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.4689G>C	9.37:g.20982406G>C	ENSP00000369599:p.Met1563Ile		D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	pfam_DUF3028,pfam_DUF3730,superfamily_ARM-type_fold	p.M1563I	ENST00000380249.1	37	c.4689	CCDS34993.1	9	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646991	0.87958	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.20069	2.1;2.1	5.83	5.83	0.93111	.	0.040459	0.85682	D	0.000000	T	0.49218	0.1544	M	0.73598	2.24	0.58432	D	0.999998	D	0.69078	0.997	D	0.79108	0.992	T	0.45160	-0.9280	10	0.66056	D	0.02	-18.1345	18.3023	0.90168	0.0:0.0:1.0:0.0	.	1563	Q5VW36	K1797_HUMAN	I	1563	ENSP00000369599:M1563I;ENSP00000344307:M1563I	ENSP00000344307:M1563I	M	+	3	0	KIAA1797	20972406	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	6.061000	0.71148	2.763000	0.94921	0.561000	0.74099	ATG	FOCAD	-	pfam_DUF3028	ENSG00000188352		0.343	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOCAD	HGNC	protein_coding	OTTHUMT00000143442.1	146	0.00	0	G	NM_017794		20982406	20982406	+1	no_errors	ENST00000338382	ensembl	human	known	69_37n	missense	56	39.78	37	SNP	1.000	C
FRG1B	284802	genome.wustl.edu	37	20	29612303	29612303	+	Intron	SNP	T	T	G	rs76953255	byFrequency	TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr20:29612303T>G	ENST00000278882.3	+	1	257				FRG1B_ENST00000358464.4_Intron|FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000468180.2_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CCTCCCGTGCTGACGACCCTG	0.682																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+190T>G	20.37:g.29612303T>G			C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.682	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	18	0.00	0	T	NR_003579		29612303	29612303	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	15	21.05	4	SNP	0.000	G
GATA3	2625	genome.wustl.edu	37	10	8106058	8106058	+	Missense_Mutation	SNP	T	T	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr10:8106058T>G	ENST00000346208.3	+	4	1333	c.878T>G	c.(877-879)aTg>aGg	p.M293R	GATA3_ENST00000379328.3_Missense_Mutation_p.M294R|GATA3_ENST00000461472.1_Intron			P23771	GATA3_HUMAN	GATA binding protein 3	293	Flexible linker.				anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.M294K(2)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TATCACAAAATGAACGGACAG	0.572			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	2	Substitution - Missense(2)	breast(2)											118.0	106.0	110.0					10																	8106058		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.878T>G	10.37:g.8106058T>G	ENSP00000341619:p.Met293Arg		Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.M294R	ENST00000346208.3	37	c.881	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	T	25.6	4.653912	0.88056	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.99429	-5.89;-5.89	5.59	5.59	0.84812	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (4);	0.000000	0.85682	D	0.000000	D	0.99133	0.9701	L	0.38838	1.175	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.91635	0.999;0.963	D	0.99900	1.1158	10	0.87932	D	0	-15.2486	15.7811	0.78260	0.0:0.0:0.0:1.0	.	293;294	P23771;P23771-2	GATA3_HUMAN;.	R	294;293	ENSP00000368632:M294R;ENSP00000341619:M293R	ENSP00000341619:M293R	M	+	2	0	GATA3	8146064	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.123000	0.65237	0.533000	0.62120	ATG	GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	ENSG00000107485		0.572	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	138	0.00	0	T	NM_001002295		8106058	8106058	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	missense	94	28.24	37	SNP	1.000	G
GLG1	2734	genome.wustl.edu	37	16	74505129	74505129	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr16:74505129T>C	ENST00000422840.2	-	15	2170	c.2171A>G	c.(2170-2172)aAc>aGc	p.N724S	GLG1_ENST00000205061.5_Missense_Mutation_p.N724S|GLG1_ENST00000447066.2_Missense_Mutation_p.N713S	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	724					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CTGGTGTTTGTTCTGTATCAG	0.483																																						dbGAP											0													368.0	311.0	330.0					16																	74505129		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2171A>G	16.37:g.74505129T>C	ENSP00000405984:p.Asn724Ser		B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	pfam_Cys-rich_GLG1_repeat	p.N724S	ENST00000422840.2	37	c.2171	CCDS45527.1	16	.	.	.	.	.	.	.	.	.	.	T	29.0	4.965555	0.92855	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.77226	0.4099	M	0.66939	2.045	0.80722	D	1	D;D;D	0.76494	0.989;0.999;0.999	D;D;D	0.69479	0.95;0.939;0.964	T	0.76788	-0.2830	9	0.45353	T	0.12	-5.3447	16.8222	0.85835	0.0:0.0:0.0:1.0	.	724;724;713	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	S	724;713;724	.	ENSP00000205061:N724S	N	-	2	0	GLG1	73062630	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.980000	0.88113	2.371000	0.80710	0.533000	0.62120	AAC	GLG1	-	pfam_Cys-rich_GLG1_repeat	ENSG00000090863		0.483	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	HGNC	protein_coding	OTTHUMT00000435750.1	293	0.00	0	T	NM_012201		74505129	74505129	-1	no_errors	ENST00000205061	ensembl	human	known	69_37n	missense	79	49.03	76	SNP	1.000	C
GPAT2	150763	genome.wustl.edu	37	2	96689146	96689146	+	Silent	SNP	A	A	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr2:96689146A>G	ENST00000434632.1	-	19	2398	c.1939T>C	c.(1939-1941)Ttg>Ctg	p.L647L	GPAT2_ENST00000359548.4_Silent_p.L647L|GPAT2_ENST00000377137.3_Intron|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Silent_p.L576L			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	647					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						TTTCTGCTCAATCGCTGTCGC	0.582																																						dbGAP											0													47.0	42.0	43.0					2																	96689146		2023	4175	6198	-	-	-	SO:0001819	synonymous_variant	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1939T>C	2.37:g.96689146A>G			Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Silent	SNP	smart_Acyltransferase	p.L647	ENST00000434632.1	37	c.1939	CCDS42714.1	2																																																																																			GPAT2	-	NULL	ENSG00000186281		0.582	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	48	0.00	0	A	NM_207328		96689146	96689146	-1	no_errors	ENST00000359548	ensembl	human	known	69_37n	silent	27	28.95	11	SNP	0.917	G
GTPBP10	85865	genome.wustl.edu	37	7	89982152	89982152	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr7:89982152T>C	ENST00000222511.6	+	2	122	c.56T>C	c.(55-57)cTa>cCa	p.L19P	GTPBP10_ENST00000257659.8_Missense_Mutation_p.L19P	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	19					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						ATCGATAAGCTAAGACTCTTC	0.403											OREG0003797	type=REGULATORY REGION|Gene=BC021573|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													129.0	127.0	127.0					7																	89982152		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.56T>C	7.37:g.89982152T>C	ENSP00000222511:p.Leu19Pro	1271	B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_GTP1_OBG_dom,pfam_Fe2_transport_prot_B_N,pfam_ProtSyn_GTP-bd,superfamily_GTP1_OBG_dom,pirsf_GTP-bd_Obg/CgtA,prints_GTP_binding_domain	p.L19P	ENST00000222511.6	37	c.56	CCDS5617.1	7	.	.	.	.	.	.	.	.	.	.	T	17.33	3.362340	0.61403	.	.	ENSG00000105793	ENST00000426366;ENST00000450619;ENST00000257659;ENST00000222511;ENST00000417207	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	6.07	6.07	0.98685	GTP1/OBG subdomain (2);	0.068802	0.64402	D	0.000013	T	0.57814	0.2079	M	0.86864	2.845	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.76575	0.988;0.988;0.981;0.988	T	0.63550	-0.6612	9	.	.	.	-6.451	16.635	0.85050	0.0:0.0:0.0:1.0	.	19;19;10;36	A4D1E9-2;A4D1E9;C9J8R7;C9JNI1	.;GTPBA_HUMAN;.;.	P	10;36;19;19;19	ENSP00000405697:L10P;ENSP00000389510:L36P;ENSP00000257659:L19P;ENSP00000222511:L19P;ENSP00000416596:L19P	.	L	+	2	0	GTPBP10	89820088	1.000000	0.71417	0.934000	0.37439	0.158000	0.22134	7.439000	0.80444	2.330000	0.79161	0.477000	0.44152	CTA	GTPBP10	-	superfamily_GTP1_OBG_dom,pirsf_GTP-bd_Obg/CgtA	ENSG00000105793		0.403	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP10	HGNC	protein_coding	OTTHUMT00000059976.3	234	0.00	0	T	NM_033107		89982152	89982152	+1	no_errors	ENST00000222511	ensembl	human	known	69_37n	missense	152	14.61	26	SNP	0.998	C
HBG2	3048	genome.wustl.edu	37	11	5275627	5275627	+	Silent	SNP	A	A	C			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr11:5275627A>C	ENST00000380259.2	-	7	1450	c.210T>G	c.(208-210)acT>acG	p.T70T	HBG2_ENST00000336906.4_Silent_p.T70T|HBG2_ENST00000380252.1_Silent_p.T60T			P69892	HBG2_HUMAN	hemoglobin, gamma G	70					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	13		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCCCAAGGAAGTCAGCACCT	0.532																																						dbGAP											0													314.0	243.0	267.0					11																	5275627		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			BC029387	CCDS7755.1	11p15.5	2014-05-19			ENSG00000196565	ENSG00000196565			4832	protein-coding gene	gene with protein product		142250				2649166	Standard	NM_000184		Approved	HBG-T1		P69892	OTTHUMG00000066673	ENST00000380259.2:c.210T>G	11.37:g.5275627A>C			A8MZE0|P02096|P62027|Q14491|Q68NH9|Q96FH6|Q96FH7	Silent	SNP	pfam_Globin,superfamily_Globin-like,prints_Haemoglobin_b,prints_Myoglobin,pfscan_Globin	p.T70	ENST00000380259.2	37	c.210	CCDS7755.1	11																																																																																			HBG2	-	pfam_Globin,superfamily_Globin-like,prints_Myoglobin,pfscan_Globin	ENSG00000196565		0.532	HBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBG2	HGNC	protein_coding	OTTHUMT00000142967.2	520	0.00	0	A	NM_000184		5275627	5275627	-1	no_errors	ENST00000336906	ensembl	human	known	69_37n	silent	325	11.68	43	SNP	0.000	C
HEPH	9843	genome.wustl.edu	37	X	65417628	65417628	+	Silent	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chrX:65417628C>T	ENST00000343002.2	+	9	2269	c.1605C>T	c.(1603-1605)ctC>ctT	p.L535L	HEPH_ENST00000519389.1_Silent_p.L589L|HEPH_ENST00000419594.1_Intron|HEPH_ENST00000374727.3_Silent_p.L538L|HEPH_ENST00000441993.2_Silent_p.L538L|HEPH_ENST00000336279.5_Silent_p.L268L			Q9BQS7	HEPH_HUMAN	hephaestin	535	Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CTGCTTGTCTCACTTGGATGT	0.567																																						dbGAP											0													80.0	63.0	69.0					X																	65417628		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1605C>T	X.37:g.65417628C>T			B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.L589	ENST00000343002.2	37	c.1767		X																																																																																			HEPH	-	pfam_Cu-oxidase_3,superfamily_Cupredoxin	ENSG00000089472		0.567	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1	165	0.00	0	C	NM_138737		65417628	65417628	+1	no_errors	ENST00000519389	ensembl	human	known	69_37n	silent	74	32.11	35	SNP	0.659	T
HERC2	8924	genome.wustl.edu	37	15	28515846	28515846	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr15:28515846G>A	ENST00000261609.7	-	10	1360	c.1252C>T	c.(1252-1254)Cat>Tat	p.H418Y		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CACACCTTATGAGATGTCGGA	0.522																																						dbGAP											0													84.0	68.0	73.0					15																	28515846		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1252C>T	15.37:g.28515846G>A	ENSP00000261609:p.His418Tyr			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.H418Y	ENST00000261609.7	37	c.1252	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	10.88	1.474464	0.26423	.	.	ENSG00000128731	ENST00000261609	T	0.38077	1.16	5.7	5.7	0.88788	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (1);	0.000000	0.85682	D	0.000000	T	0.22085	0.0532	N	0.22421	0.69	0.58432	D	0.999998	P	0.35745	0.518	B	0.26416	0.069	T	0.11227	-1.0596	10	0.02654	T	1	.	19.8985	0.96975	0.0:0.0:1.0:0.0	.	418	O95714	HERC2_HUMAN	Y	418	ENSP00000261609:H418Y	ENSP00000261609:H418Y	H	-	1	0	HERC2	26189441	1.000000	0.71417	0.633000	0.29310	0.066000	0.16364	6.589000	0.74080	2.702000	0.92279	0.644000	0.83932	CAT	HERC2	-	superfamily_Reg_csome_cond/b-lactamase_inh	ENSG00000128731		0.522	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	103	0.00	0	G	NM_004667		28515846	28515846	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	39	33.90	20	SNP	1.000	A
HRCT1	646962	genome.wustl.edu	37	9	35906348	35906350	+	In_Frame_Del	DEL	CTG	CTG	-	rs370606246		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr9:35906348_35906350delCTG	ENST00000354323.2	+	1	160_162	c.64_66delCTG	c.(64-66)ctgdel	p.L28del		NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	28						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						TGTGGCGGTCctgctgctgctgc	0.67																																						dbGAP											0										367,3839		38,291,1774						-8.3	0.0			23	737,7385		88,561,3412	no	coding	HRCT1	NM_001039792.1		126,852,5186	A1A1,A1R,RR		9.0741,8.7256,8.9552				1104,11224				-	-	-	SO:0001651	inframe_deletion	0				CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.64_66delCTG	9.37:g.35906357_35906359delCTG	ENSP00000346283:p.Leu28del		B7ZBJ1	In_Frame_Del	DEL	NULL	p.L25in_frame_del	ENST00000354323.2	37	c.64_66	CCDS35012.1	9																																																																																			HRCT1	-	NULL	ENSG00000196196		0.670	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	HGNC	protein_coding	OTTHUMT00000334099.1	35	0.00	0	CTG	NM_001039792		35906348	35906350	+1	no_errors	ENST00000354323	ensembl	human	known	69_37n	in_frame_del	16	15.79	3	DEL	0.168:0.493:0.516	-
HTATSF1	27336	genome.wustl.edu	37	X	135582352	135582352	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chrX:135582352G>A	ENST00000218364.4	+	3	577	c.403G>A	c.(403-405)Gta>Ata	p.V135I	HTATSF1_ENST00000535601.1_Missense_Mutation_p.V135I	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	135	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AAATACAAATGTATACGTGTC	0.274																																						dbGAP											0													81.0	92.0	88.0					X																	135582352		2201	4291	6492	-	-	-	SO:0001583	missense	0			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.403G>A	X.37:g.135582352G>A	ENSP00000218364:p.Val135Ile		D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V135I	ENST00000218364.4	37	c.403	CCDS14657.1	X	.	.	.	.	.	.	.	.	.	.	G	24.7	4.554900	0.86231	.	.	ENSG00000102241	ENST00000535601;ENST00000448450;ENST00000425695;ENST00000218364;ENST00000415377	T;T;T;T	0.35605	3.28;1.3;1.3;3.28	5.73	4.87	0.63330	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.055575	0.64402	N	0.000001	T	0.52725	0.1752	L	0.48260	1.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53365	-0.8449	10	0.59425	D	0.04	-14.6043	13.7268	0.62763	0.0755:0.0:0.9245:0.0	.	135	O43719	HTSF1_HUMAN	I	135	ENSP00000442699:V135I;ENSP00000411381:V135I;ENSP00000412420:V135I;ENSP00000218364:V135I	ENSP00000218364:V135I	V	+	1	0	HTATSF1	135410018	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.909000	0.63314	1.185000	0.42971	0.506000	0.49869	GTA	HTATSF1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000102241		0.274	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATSF1	HGNC	protein_coding	OTTHUMT00000058497.1	97	0.00	0	G	NM_014500		135582352	135582352	+1	no_errors	ENST00000218364	ensembl	human	known	69_37n	missense	49	15.52	9	SNP	1.000	A
IGKV1D-16	28901	genome.wustl.edu	37	2	90139366	90139366	+	RNA	SNP	G	G	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr2:90139366G>T	ENST00000492446.1	+	0	164									immunoglobulin kappa variable 1D-16																		ATCACTTGTCGGGCGAGTCAG	0.502																																						dbGAP											0													105.0	111.0	109.0					2																	90139366		1916	4148	6064	-	-	-			0			K01323		2p11.2	2012-02-08			ENSG00000241244	ENSG00000241244		"""Immunoglobulins / IGK locus"""	5748	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151569		2.37:g.90139366G>T				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R46L	ENST00000492446.1	37	c.137		2																																																																																			IGKV1D-16	-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000241244		0.502	IGKV1D-16-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-16	HGNC	IG_V_gene	OTTHUMT00000323144.2	335	0.00	0	G	NG_000833		90139366	90139366	+1	no_stop_codon	ENST00000492446	ensembl	human	known	69_37n	missense	268	16.51	53	SNP	0.009	T
IGKV1D-16	28901	genome.wustl.edu	37	2	90139462	90139462	+	RNA	SNP	G	G	T	rs542346733		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr2:90139462G>T	ENST00000492446.1	+	0	260									immunoglobulin kappa variable 1D-16																		AGTTTGCAAAGTGGGGTCCCA	0.512																																						dbGAP											0													108.0	113.0	111.0					2																	90139462		1859	4097	5956	-	-	-			0			K01323		2p11.2	2012-02-08			ENSG00000241244	ENSG00000241244		"""Immunoglobulins / IGK locus"""	5748	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151569		2.37:g.90139462G>T				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S78I	ENST00000492446.1	37	c.233		2																																																																																			IGKV1D-16	-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000241244		0.512	IGKV1D-16-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-16	HGNC	IG_V_gene	OTTHUMT00000323144.2	314	0.00	0	G	NG_000833		90139462	90139462	+1	no_stop_codon	ENST00000492446	ensembl	human	known	69_37n	missense	265	15.87	50	SNP	0.047	T
IZUMO4	113177	genome.wustl.edu	37	19	2097595	2097595	+	Intron	SNP	C	C	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr19:2097595C>A	ENST00000395301.3	+	3	434				MOB3A_ENST00000357066.3_5'Flank|IZUMO4_ENST00000395307.2_Intron|IZUMO4_ENST00000588003.1_Intron|IZUMO4_ENST00000395296.1_Missense_Mutation_p.P128T	NM_001039846.1	NP_001034935.1	Q1ZYL8	IZUM4_HUMAN	IZUMO family member 4							extracellular region (GO:0005576)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	6						GCACCTGGCACCAGGCAGCTG	0.642																																						dbGAP											0													14.0	14.0	14.0					19																	2097595		870	1986	2856	-	-	-	SO:0001627	intron_variant	0			BC014609	CCDS35499.1, CCDS42458.1	19p13.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000099840	ENSG00000099840		"""-"""	26950	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 36"""	C19orf36		12975309, 19658160, 22957301	Standard	XM_005259480		Approved		uc002luw.1	Q1ZYL8	OTTHUMG00000141290	ENST00000395301.3:c.370+101C>A	19.37:g.2097595C>A			A7RA93|A7RA94|Q6UXA2|Q96FT6|Q96L02	Missense_Mutation	SNP	NULL	p.P128T	ENST00000395301.3	37	c.382	CCDS42458.1	19	.	.	.	.	.	.	.	.	.	.	C	3.297	-0.143623	0.06627	.	.	ENSG00000099840	ENST00000395296	T	0.33438	1.41	2.6	-5.19	0.02832	.	.	.	.	.	T	0.22513	0.0543	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36383	-0.9750	6	0.62326	D	0.03	.	2.7616	0.05308	0.3584:0.2085:0.0:0.4332	.	.	.	.	T	128	ENSP00000378709:P128T	ENSP00000378709:P128T	P	+	1	0	IZUMO4	2048595	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.309000	0.01130	-1.062000	0.03181	-0.500000	0.04577	CCA	IZUMO4	-	NULL	ENSG00000099840		0.642	IZUMO4-004	KNOWN	basic|CCDS	protein_coding	IZUMO4	HGNC	protein_coding	OTTHUMT00000280536.3	23	0.00	0	C	NM_052878		2097595	2097595	+1	no_errors	ENST00000395296	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.000	A
JUN	3725	genome.wustl.edu	37	1	59248409	59248409	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr1:59248409C>T	ENST00000371222.2	-	1	1376	c.334G>A	c.(334-336)Gag>Aag	p.E112K	RP4-794H19.2_ENST00000419531.2_lincRNA	NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	112					aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.E112Q(1)|p.E112K(1)		breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	ACGAAGCCCTCGGCGAAGCCC	0.672			A		sarcoma																																	dbGAP		Dom	yes		1	1p32-p31	3725	jun oncogene		M	2	Substitution - Missense(2)	lung(2)											52.0	56.0	55.0					1																	59248409		2197	4294	6491	-	-	-	SO:0001583	missense	0			AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.334G>A	1.37:g.59248409C>T	ENSP00000360266:p.Glu112Lys		Q6FHM7|Q96G93	Missense_Mutation	SNP	pfam_JNK,pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.E112K	ENST00000371222.2	37	c.334	CCDS610.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.121203	0.94385	.	.	ENSG00000177606	ENST00000371222	T	0.35421	1.31	4.16	4.16	0.48862	Jun-like transcription factor (1);	0.000000	0.64402	U	0.000001	T	0.52613	0.1745	L	0.45470	1.425	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.57820	-0.7745	10	0.72032	D	0.01	-3.6967	16.6844	0.85301	0.0:1.0:0.0:0.0	.	112	P05412	JUN_HUMAN	K	112	ENSP00000360266:E112K	ENSP00000360266:E112K	E	-	1	0	JUN	59020997	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.278000	0.78587	2.139000	0.66308	0.561000	0.74099	GAG	JUN	-	pfam_JNK	ENSG00000177606		0.672	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUN	HGNC	protein_coding	OTTHUMT00000023042.1	68	0.00	0	C	NM_002228		59248409	59248409	-1	no_errors	ENST00000371222	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
KIAA1456	57604	genome.wustl.edu	37	8	12863718	12863718	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr8:12863718C>T	ENST00000524591.2	+	3	496	c.7C>T	c.(7-9)Cat>Tat	p.H3Y	KIAA1456_ENST00000528753.2_Missense_Mutation_p.H3Y|KIAA1456_ENST00000528335.1_3'UTR|KIAA1456_ENST00000400069.3_Missense_Mutation_p.H3Y|KIAA1456_ENST00000447063.2_Missense_Mutation_p.H3Y	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	3							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						CAGGATGGATCATGAAGCCGC	0.547																																						dbGAP											0													53.0	54.0	53.0					8																	12863718		2071	4210	6281	-	-	-	SO:0001583	missense	0			BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.7C>T	8.37:g.12863718C>T	ENSP00000432695:p.His3Tyr		Q96AW6	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransferase-rel	p.H3Y	ENST00000524591.2	37	c.7	CCDS47808.1	8	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780528	0.31502	.	.	ENSG00000250305	ENST00000447063;ENST00000524591;ENST00000532376	T	0.09723	2.95	5.56	2.65	0.31530	.	.	.	.	.	T	0.05593	0.0147	N	0.08118	0	0.23787	N	0.996849	B;B	0.18166	0.026;0.0	B;B	0.15052	0.012;0.0	T	0.34079	-0.9843	9	0.54805	T	0.06	.	6.4493	0.21894	0.0:0.6593:0.1309:0.2098	.	3;3	E9PK20;Q9P272	.;K1456_HUMAN	Y	3	ENSP00000432695:H3Y	ENSP00000443288:H3Y	H	+	1	0	AC135352.2	12908089	0.640000	0.27243	0.779000	0.31741	0.626000	0.37791	1.361000	0.34136	0.844000	0.35094	-0.137000	0.14449	CAT	KIAA1456	-	NULL	ENSG00000250305		0.547	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1456	Clone_based_vega_gene	protein_coding	OTTHUMT00000383262.2	173	0.00	0	C	NM_001099677		12863718	12863718	+1	no_errors	ENST00000524591	ensembl	human	known	69_37n	missense	53	22.06	15	SNP	0.839	T
KIR3DL1	3811	genome.wustl.edu	37	19	55324735	55324735	+	Intron	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr19:55324735G>A	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000463062.1_Intron|KIR2DL4_ENST00000345540.5_Intron|KIR2DL4_ENST00000359085.4_Intron|KIR2DL4_ENST00000396284.2_Missense_Mutation_p.G286R|KIR2DL4_ENST00000346587.4_Intron|KIR2DL4_ENST00000396293.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000357494.4_Intron|KIR3DL1_ENST00000541392.1_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TGCGGAAGCAGGATGGGAGCA	0.557																																						dbGAP											0													25.0	44.0	37.0					19																	55324735		1136	2160	3296	-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-4254G>A	19.37:g.55324735G>A			O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.G286R	ENST00000538269.1	37	c.856		19	.	.	.	.	.	.	.	.	.	.	G	4.269	0.048963	0.08243	.	.	ENSG00000189013	ENST00000396284;ENST00000396289	T;T	0.00456	7.3;7.3	0.569	-1.14	0.09741	.	.	.	.	.	T	0.00178	0.0005	.	.	.	0.09310	N	1	B	0.17667	0.023	B	0.11329	0.006	T	0.15093	-1.0449	6	.	.	.	.	.	.	.	.	286	E7EST5	.	R	286	ENSP00000379580:G286R;ENSP00000379584:G286R	.	G	+	1	0	KIR2DL4	60016547	0.002000	0.14202	0.001000	0.08648	0.004000	0.04260	0.369000	0.20416	-0.384000	0.07845	0.184000	0.17185	GGA	KIR2DL4	-	NULL	ENSG00000189013		0.557	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL4	HGNC	protein_coding		213	0.00	0	G	NM_013289		55324735	55324735	+1	no_errors	ENST00000396284	ensembl	human	known	69_37n	missense	92	56.60	120	SNP	0.001	A
LINC00202-1	387644	genome.wustl.edu	37	10	27223345	27223345	+	lincRNA	SNP	C	C	T	rs112468009		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr10:27223345C>T	ENST00000431296.1	-	0	3259					NR_026795.1				long intergenic non-protein coding RNA 202-1																		GTTTTACCTTCGATGTTTCAG	0.478																																						dbGAP											0																																										-	-	-			0			AK097405		10p12.1	2012-12-18	2012-12-18	2012-12-18	ENSG00000232224	ENSG00000232224		"""Long non-coding RNAs"""	24672	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 51"", ""non-protein coding RNA 202"", ""long intergenic non-protein coding RNA 202"""	C10orf51, NCRNA00202, LINC00202			Standard	NR_026795		Approved	bB27G4.1	uc001itf.2		OTTHUMG00000017849		10.37:g.27223345C>T				RNA	SNP	-	NULL	ENST00000431296.1	37	NULL		10																																																																																			LINC00202	-	-	ENSG00000232224		0.478	LINC00202-1-002	KNOWN	basic	lincRNA	LINC00202	HGNC	lincRNA	OTTHUMT00000047293.1	59	0.00	0	C	NR_026795		27223345	27223345	-1	no_errors	ENST00000431296	ensembl	human	known	69_37n	rna	35	16.67	7	SNP	0.152	T
LINC00313	114038	genome.wustl.edu	37	21	44898013	44898013	+	IGR	SNP	A	A	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr21:44898013A>T								LINC00313 (6541 upstream) : HSF2BP (51058 downstream)																							CAGAGTTGTCATGCACCTTTG	0.577																																						dbGAP											0													161.0	134.0	142.0					21																	44898013		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0																															21.37:g.44898013A>T				RNA	SNP	-	NULL		37	NULL		21																																																																																			LINC00313	-	-	ENSG00000185186	0	0.577					LINC00313	HGNC			233	0.00	0	A			44898013	44898013	-1	no_errors	ENST00000332440	ensembl	human	known	69_37n	rna	112	34.88	60	SNP	0.003	T
LRP2	4036	genome.wustl.edu	37	2	170081851	170081851	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr2:170081851T>C	ENST00000263816.3	-	33	5792	c.5507A>G	c.(5506-5508)tAt>tGt	p.Y1836C		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1836					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ATTGGTAGAATAAAGGTTTCT	0.383																																						dbGAP											0													98.0	94.0	95.0					2																	170081851		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5507A>G	2.37:g.170081851T>C	ENSP00000263816:p.Tyr1836Cys		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.Y1836C	ENST00000263816.3	37	c.5507	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	T	17.14	3.313704	0.60414	.	.	ENSG00000081479	ENST00000263816	D	0.94330	-3.4	5.78	4.6	0.57074	Six-bladed beta-propeller, TolB-like (1);	0.057670	0.64402	D	0.000001	D	0.97864	0.9298	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97936	1.0323	10	0.87932	D	0	.	12.1643	0.54120	0.1282:0.0:0.0:0.8718	.	1836	P98164	LRP2_HUMAN	C	1836	ENSP00000263816:Y1836C	ENSP00000263816:Y1836C	Y	-	2	0	LRP2	169790097	1.000000	0.71417	0.783000	0.31826	0.492000	0.33523	6.256000	0.72473	0.967000	0.38186	0.528000	0.53228	TAT	LRP2	-	smart_LDLR_classB_rpt	ENSG00000081479		0.383	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	114	0.00	0	T	NM_004525		170081851	170081851	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	67	20.24	17	SNP	1.000	C
MACF1	23499	genome.wustl.edu	37	1	39895660	39895660	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr1:39895660G>A	ENST00000372915.3	+	63	16825	c.16738G>A	c.(16738-16740)Gag>Aag	p.E5580K	MACF1_ENST00000539005.1_Missense_Mutation_p.E3492K|MACF1_ENST00000567887.1_Missense_Mutation_p.E5721K|MACF1_ENST00000317713.7_Missense_Mutation_p.E3622K|MACF1_ENST00000545844.1_Missense_Mutation_p.E3622K|MACF1_ENST00000564288.1_Missense_Mutation_p.E5684K|MACF1_ENST00000289893.4_Missense_Mutation_p.E4124K|MACF1_ENST00000361689.2_Missense_Mutation_p.E3622K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5580					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTGGCTGAGGGAGGTGGAGGA	0.552																																						dbGAP											0													39.0	39.0	39.0					1																	39895660		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16738G>A	1.37:g.39895660G>A	ENSP00000362006:p.Glu5580Lys		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E3622K	ENST00000372915.3	37	c.10864		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.307|5.307	0.242069|0.242069	0.10077|0.10077	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.64085|.	-0.08;1.01;-0.08;1.01;-0.06;1.09|.	6.08|6.08	4.02|4.02	0.46733|0.46733	.|.	0.567279|.	0.16549|.	N|.	0.209567|.	T|T	0.08670|0.08670	0.0215|0.0215	N|N	0.01228|0.01228	-0.945|-0.945	0.09310|0.09310	N|N	0.999999|0.999999	B;B;B|.	0.09022|.	0.001;0.002;0.001|.	B;B;B|.	0.11329|.	0.002;0.006;0.003|.	T|T	0.22906|0.22906	-1.0203|-1.0203	10|5	0.05620|.	T|.	0.96|.	.|.	4.0499|4.0499	0.09790|0.09790	0.2395:0.3861:0.3744:0.0|0.2395:0.3861:0.3744:0.0	.|.	5580;3622;3566|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	K|E	3622;5580;3622;3622;3492;4124|2625	ENSP00000439537:E3622K;ENSP00000362006:E5580K;ENSP00000354573:E3622K;ENSP00000313438:E3622K;ENSP00000444364:E3492K;ENSP00000289893:E4124K|.	ENSP00000289893:E4124K|.	E|G	+|+	1|2	0|0	MACF1|MACF1	39668247|39668247	0.019000|0.019000	0.18553|0.18553	0.998000|0.998000	0.56505|0.56505	0.991000|0.991000	0.79684|0.79684	0.468000|0.468000	0.22051|0.22051	1.589000|1.589000	0.49982|0.49982	0.591000|0.591000	0.81541|0.81541	GAG|GGA	MACF1	-	smart_Spectrin/alpha-actinin	ENSG00000127603		0.552	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	85	0.00	0	G	NM_033044		39895660	39895660	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	0.079	A
MYH11	4629	genome.wustl.edu	37	16	15841442	15841442	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr16:15841442C>T	ENST00000300036.5	-	19	2505	c.2396G>A	c.(2395-2397)gGc>gAc	p.G799D	MYH11_ENST00000452625.2_Missense_Mutation_p.G806D|MYH11_ENST00000576790.2_Missense_Mutation_p.G799D|MYH11_ENST00000396324.3_Missense_Mutation_p.G806D	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	799	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGCCAAGTAGCCACGACACAT	0.498			T	CBFB	AML																																	dbGAP		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													106.0	97.0	100.0					16																	15841442		2197	4300	6497	-	-	-	SO:0001583	missense	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2396G>A	16.37:g.15841442C>T	ENSP00000300036:p.Gly799Asp		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G806D	ENST00000300036.5	37	c.2417	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977026	0.92982	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.90981	0.7164	H	0.96547	3.84	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0	D	0.93601	0.6930	10	0.87932	D	0	.	18.3008	0.90163	0.0:1.0:0.0:0.0	.	806;799;806;799;806	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	D	799;799;806;806;806	ENSP00000300036:G799D;ENSP00000345136:G799D;ENSP00000379616:G806D;ENSP00000407821:G806D	ENSP00000300036:G799D	G	-	2	0	MYH11	15748943	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.818000	0.86416	2.565000	0.86533	0.561000	0.74099	GGC	MYH11	-	smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000133392		0.498	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	113	0.00	0	C	NM_001040113		15841442	15841442	-1	no_errors	ENST00000396324	ensembl	human	known	69_37n	missense	88	23.48	27	SNP	1.000	T
MYO9B	4650	genome.wustl.edu	37	19	17314024	17314024	+	Silent	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr19:17314024C>T	ENST00000594824.1	+	30	5094	c.4947C>T	c.(4945-4947)tgC>tgT	p.C1649C	MYO9B_ENST00000595618.1_Silent_p.C1649C|MYO9B_ENST00000397274.2_Silent_p.C1649C			Q13459	MYO9B_HUMAN	myosin IXB	1649	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GCGAGCAGTGCCTCTCCTATA	0.642																																						dbGAP											0													45.0	47.0	46.0					19																	17314024		2060	4193	6253	-	-	-	SO:0001819	synonymous_variant	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4947C>T	19.37:g.17314024C>T			O75314|Q9NUJ2|Q9UHN0	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.C1649	ENST00000594824.1	37	c.4947		19																																																																																			MYO9B	-	smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000099331		0.642	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1	123	0.00	0	C			17314024	17314024	+1	no_errors	ENST00000397274	ensembl	human	known	69_37n	silent	70	13.41	11	SNP	0.991	T
NCOR1	9611	genome.wustl.edu	37	17	15935743	15935743	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr17:15935743G>A	ENST00000268712.3	-	46	7447	c.7190C>T	c.(7189-7191)cCa>cTa	p.P2397L	NCOR1_ENST00000395851.1_Missense_Mutation_p.P2294L|NCOR1_ENST00000395857.3_Missense_Mutation_p.P981L	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2397	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CGGTGTTGGTGGAGTACTGCT	0.498																																						dbGAP											0													130.0	116.0	121.0					17																	15935743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.7190C>T	17.37:g.15935743G>A	ENSP00000268712:p.Pro2397Leu		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.P2397L	ENST00000268712.3	37	c.7190	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	26.7	4.763806	0.89932	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.47177	0.85;1.43;0.87	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	L	0.35487	1.065	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.998;0.999;0.999	T	0.42965	-0.9420	10	0.09590	T	0.72	-8.9593	19.1747	0.93599	0.0:0.0:1.0:0.0	.	2300;2397;2294;916;410	E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;NCOR1_HUMAN;.;.;.	L	2397;2294;2300;981	ENSP00000268712:P2397L;ENSP00000379192:P2294L;ENSP00000379198:P981L	ENSP00000268712:P2397L	P	-	2	0	NCOR1	15876468	1.000000	0.71417	0.943000	0.38184	0.989000	0.77384	9.803000	0.99136	2.775000	0.95449	0.655000	0.94253	CCA	NCOR1	-	NULL	ENSG00000141027		0.498	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	137	0.00	0	G	NM_006311		15935743	15935743	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	71	17.44	15	SNP	1.000	A
NPBWR1	2831	genome.wustl.edu	37	8	53853440	53853440	+	Missense_Mutation	SNP	C	C	T	rs146840260	byFrequency	TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr8:53853440C>T	ENST00000331251.3	+	1	2450	c.973C>T	c.(973-975)Cgc>Tgc	p.R325C		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	325					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)	p.R325C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				GATAACTTGCCGCGCGGCAGC	0.687																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											15.0	16.0	16.0					8																	53853440		2193	4284	6477	-	-	-	SO:0001583	missense	0			BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.973C>T	8.37:g.53853440C>T	ENSP00000330284:p.Arg325Cys		Q6NTC7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Neuropept_W_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,prints_Opioid_rcpt	p.R325C	ENST00000331251.3	37	c.973	CCDS6151.1	8	.	.	.	.	.	.	.	.	.	.	C	11.83	1.757157	0.31137	.	.	ENSG00000183729	ENST00000331251	T	0.37584	1.19	4.66	3.75	0.43078	.	0.000000	0.39834	U	0.001260	T	0.32315	0.0825	N	0.21583	0.68	0.53688	D	0.999975	D	0.69078	0.997	P	0.50231	0.635	T	0.12091	-1.0561	10	0.72032	D	0.01	.	10.7838	0.46393	0.5296:0.4704:0.0:0.0	.	325	P48145	NPBW1_HUMAN	C	325	ENSP00000330284:R325C	ENSP00000330284:R325C	R	+	1	0	NPBWR1	54015993	0.623000	0.27094	0.595000	0.28798	0.015000	0.08874	0.661000	0.25023	1.112000	0.41740	0.561000	0.74099	CGC	NPBWR1	-	NULL	ENSG00000183729		0.687	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR1	HGNC	protein_coding	OTTHUMT00000378047.1	23	0.00	0	C	NM_005285		53853440	53853440	+1	no_errors	ENST00000331251	ensembl	human	known	69_37n	missense	11	52.17	12	SNP	0.997	T
OSMR	9180	genome.wustl.edu	37	5	38924582	38924582	+	Silent	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr5:38924582G>A	ENST00000274276.3	+	14	2331	c.1929G>A	c.(1927-1929)ctG>ctA	p.L643L		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	643	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					CCTTCACTCTGAGTTGGAAAG	0.443																																						dbGAP											0													129.0	115.0	120.0					5																	38924582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.1929G>A	5.37:g.38924582G>A			Q6P4E8|Q96QJ6	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L643	ENST00000274276.3	37	c.1929	CCDS3928.1	5																																																																																			OSMR	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000145623		0.443	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OSMR	HGNC	protein_coding	OTTHUMT00000207609.2	108	0.00	0	G	NM_003999		38924582	38924582	+1	no_errors	ENST00000274276	ensembl	human	known	69_37n	silent	76	28.97	31	SNP	0.941	A
PCDHA2	56146	genome.wustl.edu	37	5	140175977	140175977	+	Silent	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr5:140175977G>A	ENST00000526136.1	+	1	1428	c.1428G>A	c.(1426-1428)acG>acA	p.T476T	PCDHA2_ENST00000378132.1_Silent_p.T476T|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Silent_p.T476T|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	476	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACATCTTCACGGTGTCAGCGT	0.652																																						dbGAP											0													70.0	74.0	73.0					5																	140175977		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1428G>A	5.37:g.140175977G>A			O75287|Q9BTV3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T476	ENST00000526136.1	37	c.1428	CCDS54914.1	5																																																																																			PCDHA2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000204969		0.652	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	144	0.00	0	G	NM_018905		140175977	140175977	+1	no_errors	ENST00000526136	ensembl	human	known	69_37n	silent	83	43.92	65	SNP	0.311	A
PCDHB13	56123	genome.wustl.edu	37	5	140594357	140594357	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr5:140594357C>T	ENST00000341948.4	+	1	849	c.662C>T	c.(661-663)cCg>cTg	p.P221L		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	221	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P221L(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGCTCTCCGCCCAGATCT	0.532																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											97.0	104.0	102.0					5																	140594357		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.662C>T	5.37:g.140594357C>T	ENSP00000345491:p.Pro221Leu		A8K9V6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P221L	ENST00000341948.4	37	c.662	CCDS4255.1	5	.	.	.	.	.	.	.	.	.	.	c	29.3	4.992937	0.93167	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.00792	5.69	3.51	2.6	0.31112	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.06554	0.0168	H	0.95982	3.75	0.46478	D	0.999069	D	0.65815	0.995	D	0.71870	0.975	T	0.01162	-1.1432	9	0.66056	D	0.02	.	11.0844	0.48078	0.0:0.9018:0.0:0.0982	.	221	Q9Y5F0	PCDBD_HUMAN	L	221	ENSP00000345491:P221L	ENSP00000345491:P221L	P	+	2	0	PCDHB13	140574541	0.999000	0.42202	0.006000	0.13384	0.808000	0.45660	4.915000	0.63355	0.548000	0.28955	0.306000	0.20318	CCG	PCDHB13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000187372		0.532	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	HGNC	protein_coding	OTTHUMT00000251810.1	135	0.00	0	C	NM_018933		140594357	140594357	+1	no_errors	ENST00000341948	ensembl	human	known	69_37n	missense	89	30.47	39	SNP	0.914	T
PHLPP1	23239	genome.wustl.edu	37	18	60646275	60646275	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr18:60646275G>A	ENST00000262719.5	+	17	4999	c.4765G>A	c.(4765-4767)Gag>Aag	p.E1589K	PHLPP1_ENST00000400316.4_Missense_Mutation_p.E1077K			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1589					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						GGTGCCAGCAGAGGCCAGTGA	0.627																																						dbGAP											0													33.0	39.0	37.0					18																	60646275		2105	4219	6324	-	-	-	SO:0001583	missense	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.4765G>A	18.37:g.60646275G>A	ENSP00000262719:p.Glu1589Lys		A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	pfam_PP2C-like,pfam_Leu-rich_rpt,superfamily_PP2C-like,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like,pfscan_Pleckstrin_homology	p.E1589K	ENST00000262719.5	37	c.4765	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539743	0.65085	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.26518	1.87;1.73	4.18	4.18	0.49190	.	.	.	.	.	T	0.26629	0.0651	L	0.52573	1.65	0.58432	D	0.999999	P	0.52842	0.956	B	0.41764	0.366	T	0.08953	-1.0697	9	0.36615	T	0.2	-18.6084	16.6946	0.85332	0.0:0.0:1.0:0.0	.	1589	O60346	PHLP1_HUMAN	K	1077;1589	ENSP00000383170:E1077K;ENSP00000262719:E1589K	ENSP00000262719:E1589K	E	+	1	0	PHLPP1	58797255	1.000000	0.71417	0.984000	0.44739	0.951000	0.60555	7.281000	0.78621	2.173000	0.68751	0.561000	0.74099	GAG	PHLPP1	-	NULL	ENSG00000081913		0.627	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2	58	0.00	0	G	NM_194449		60646275	60646275	+1	no_errors	ENST00000262719	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	112	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	48	36.00	27	SNP	1.000	G
PRAMEF10	343071	genome.wustl.edu	37	1	12954760	12954760	+	Silent	SNP	T	T	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr1:12954760T>G	ENST00000235347.4	-	3	602	c.523A>C	c.(523-525)Aga>Cga	p.R175R		NM_001039361.3	NP_001034450.2	O60809	PRA10_HUMAN	PRAME family member 10	175					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|breast(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACTAGGCCTCTTCTGTAGTGG	0.463																																						dbGAP											0													1.0	1.0	1.0					1																	12954760		299	619	918	-	-	-	SO:0001819	synonymous_variant	0			AL049682	CCDS41255.1	1p36.21	2013-01-17			ENSG00000187545	ENSG00000187545		"""-"""	27997	protein-coding gene	gene with protein product							Standard	NM_001039361		Approved		uc001auo.3	O60809	OTTHUMG00000001981	ENST00000235347.4:c.523A>C	1.37:g.12954760T>G			Q2M1V2	Silent	SNP	NULL	p.R175	ENST00000235347.4	37	c.523	CCDS41255.1	1																																																																																			PRAMEF10	-	NULL	ENSG00000187545		0.463	PRAMEF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF10	HGNC	protein_coding	OTTHUMT00000005512.2	89	0.00	0	T	XM_496342		12954760	12954760	-1	no_errors	ENST00000235347	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	0.000	G
REPS2	9185	genome.wustl.edu	37	X	17024441	17024441	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chrX:17024441C>T	ENST00000357277.3	+	2	542	c.371C>T	c.(370-372)cCg>cTg	p.P124L	REPS2_ENST00000380064.4_5'UTR|REPS2_ENST00000303843.7_Missense_Mutation_p.P124L	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	124	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.				epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					TCTGGCCTCCCGGTACGGATA	0.413																																						dbGAP											0													193.0	162.0	172.0					X																	17024441		1872	4107	5979	-	-	-	SO:0001583	missense	0			AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.371C>T	X.37:g.17024441C>T	ENSP00000349824:p.Pro124Leu		A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.P124L	ENST00000357277.3	37	c.371	CCDS14180.2	X	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946394	0.92593	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843	T;T	0.42513	0.97;0.97	5.65	5.65	0.86999	EPS15 homology (EH) (1);EF-hand-like domain (1);	0.000000	0.56097	D	0.000028	T	0.62756	0.2454	L	0.58510	1.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.65138	-0.6241	10	0.87932	D	0	-11.9257	17.334	0.87275	0.0:1.0:0.0:0.0	.	124;124	Q8NFH8-4;Q8NFH8	.;REPS2_HUMAN	L	124	ENSP00000349824:P124L;ENSP00000306033:P124L	ENSP00000306033:P124L	P	+	2	0	REPS2	16934362	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.105000	0.77031	2.362000	0.80069	0.600000	0.82982	CCG	REPS2	-	pfscan_EPS15_homology	ENSG00000169891		0.413	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REPS2	HGNC	protein_coding	OTTHUMT00000316778.1	236	0.00	0	C	NM_004726		17024441	17024441	+1	no_errors	ENST00000357277	ensembl	human	known	69_37n	missense	205	15.64	38	SNP	1.000	T
RLF	6018	genome.wustl.edu	37	1	40697288	40697288	+	Silent	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr1:40697288G>A	ENST00000372771.4	+	7	1074	c.1047G>A	c.(1045-1047)acG>acA	p.T349T		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	349					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TAGCTAAAACGCAGCAGCATT	0.403																																						dbGAP											0													129.0	122.0	124.0					1																	40697288		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.1047G>A	1.37:g.40697288G>A			Q14CQ1|Q9NU60	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T349	ENST00000372771.4	37	c.1047	CCDS448.1	1																																																																																			RLF	-	NULL	ENSG00000117000		0.403	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	273	0.00	0	G	NM_012421		40697288	40697288	+1	no_errors	ENST00000372771	ensembl	human	known	69_37n	silent	120	22.93	36	SNP	0.999	A
RPS6KB1	6198	genome.wustl.edu	37	17	58013897	58013897	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr17:58013897C>A	ENST00000225577.4	+	12	1135	c.1114C>A	c.(1114-1116)Ctg>Atg	p.L372M	RPS6KB1_ENST00000443572.2_Missense_Mutation_p.L349M|RPS6KB1_ENST00000406116.3_Missense_Mutation_p.L372M|RPS6KB1_ENST00000393021.3_Missense_Mutation_p.L319M	NM_001272042.1|NM_001272044.1|NM_001272060.1|NM_003161.2	NP_001258971.1|NP_001258973.1|NP_001258989.1|NP_003152.1	P23443	KS6B1_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 1	372	AGC-kinase C-terminal.				aging (GO:0007568)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell development (GO:0007281)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue growth (GO:0048633)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of glucose import (GO:0046324)|response to drug (GO:0042493)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to leucine (GO:0043201)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to testosterone (GO:0033574)|response to toxic substance (GO:0009636)|response to tumor necrosis factor (GO:0034612)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)			CTTTAAACCTCTGTTGGTAAG	0.448																																						dbGAP											0													127.0	140.0	136.0					17																	58013897		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60724	CCDS11621.1, CCDS62271.1, CCDS62272.1, CCDS62273.1	17q23.1	2011-04-05	2002-08-29		ENSG00000108443	ENSG00000108443			10436	protein-coding gene	gene with protein product		608938	"""ribosomal protein S6 kinase, 70kD, polypeptide 1"""	STK14A		1922062	Standard	NM_003161		Approved	S6K1, p70(S6K)-alpha, PS6K	uc002ixy.4	P23443	OTTHUMG00000150642	ENST00000225577.4:c.1114C>A	17.37:g.58013897C>A	ENSP00000225577:p.Leu372Met		B2R779|B4DLT4|B4DTG1|E7ESB8|F6UYM1|Q7Z721	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase,pfscan_Prot_kinase_cat_dom	p.L372M	ENST00000225577.4	37	c.1114	CCDS11621.1	17	.	.	.	.	.	.	.	.	.	.	C	14.45	2.537672	0.45176	.	.	ENSG00000108443	ENST00000443572;ENST00000406116;ENST00000225577;ENST00000393021	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.12	5.12	0.69794	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.130106	0.51477	D	0.000081	T	0.35653	0.0939	L	0.28649	0.875	0.49389	D	0.999789	B;B;P	0.37101	0.005;0.438;0.582	B;B;B	0.37198	0.033;0.243;0.243	T	0.28038	-1.0056	10	0.56958	D	0.05	.	9.8612	0.41116	0.0:0.8721:0.0:0.1279	.	349;372;372	F6UYM1;Q7Z721;P23443	.;.;KS6B1_HUMAN	M	349;372;372;319	ENSP00000441993:L349M;ENSP00000384335:L372M;ENSP00000225577:L372M;ENSP00000376744:L319M	ENSP00000225577:L372M	L	+	1	2	RPS6KB1	55368679	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.815000	0.55651	2.379000	0.81126	0.484000	0.47621	CTG	RPS6KB1	-	superfamily_Kinase-like_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase	ENSG00000108443		0.448	RPS6KB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KB1	HGNC	protein_coding	OTTHUMT00000319324.1	74	0.00	0	C	NM_003161		58013897	58013897	+1	no_errors	ENST00000225577	ensembl	human	known	69_37n	missense	77	14.44	13	SNP	1.000	A
SCAF8	22828	genome.wustl.edu	37	6	155143458	155143458	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr6:155143458C>G	ENST00000367178.3	+	16	2417	c.1841C>G	c.(1840-1842)aCa>aGa	p.T614R	SCAF8_ENST00000417268.1_Missense_Mutation_p.T614R|SCAF8_ENST00000367186.4_Missense_Mutation_p.T680R|RNU6-824P_ENST00000363724.1_RNA	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	614					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						ACGGTCCAGACAACTCAGAGC	0.438																																						dbGAP											0													132.0	129.0	130.0					6																	155143458		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.1841C>G	6.37:g.155143458C>G	ENSP00000356146:p.Thr614Arg		B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD,smart_RRM_dom,pfscan_RRM_dom	p.T680R	ENST00000367178.3	37	c.2039	CCDS5247.1	6	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685759	0.68157	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.46451	0.89;0.89;0.87	5.8	5.8	0.92144	.	0.183879	0.35677	U	0.003044	T	0.45518	0.1346	L	0.47716	1.5	0.53005	D	0.999962	P;D;D;D	0.69078	0.917;0.996;0.997;0.996	B;P;D;P	0.72982	0.446;0.802;0.979;0.802	T	0.21109	-1.0255	10	0.28530	T	0.3	.	13.2712	0.60161	0.0:0.9276:0.0:0.0724	.	659;680;692;614	B7Z876;B7Z888;B7Z3A4;Q9UPN6	.;.;.;SCAF8_HUMAN	R	614;614;680	ENSP00000356146:T614R;ENSP00000413098:T614R;ENSP00000356154:T680R	ENSP00000356146:T614R	T	+	2	0	SCAF8	155185150	0.961000	0.32948	0.858000	0.33744	0.989000	0.77384	3.922000	0.56462	2.745000	0.94114	0.650000	0.86243	ACA	SCAF8	-	NULL	ENSG00000213079		0.438	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF8	HGNC	protein_coding	OTTHUMT00000042798.1	127	0.00	0	C	NM_014892		155143458	155143458	+1	no_errors	ENST00000367186	ensembl	human	known	69_37n	missense	128	11.72	17	SNP	0.768	G
SELE	6401	genome.wustl.edu	37	1	169698645	169698645	+	Silent	SNP	C	C	T	rs34155859		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr1:169698645C>T	ENST00000333360.7	-	6	1024	c.885G>A	c.(883-885)gaG>gaA	p.E295E	SELE_ENST00000367782.4_Silent_p.E295E|SELE_ENST00000367779.4_Silent_p.E295E|SELE_ENST00000367776.1_Silent_p.E295E|SELE_ENST00000367777.1_Silent_p.E295E|SELE_ENST00000367781.4_Silent_p.E295E|SELE_ENST00000367775.1_Silent_p.E233E|SELE_ENST00000367780.4_Silent_p.E233E|SELE_ENST00000367774.1_Silent_p.E295E|C1orf112_ENST00000498289.1_Intron	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	295	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.		E -> K (in dbSNP:rs5364). {ECO:0000269|Ref.4}.		actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	ACGTTGGCTTCTCGTTGTCCC	0.458																																						dbGAP											0													145.0	135.0	139.0					1																	169698645		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.885G>A	1.37:g.169698645C>T			A2RRD6|P16111	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,pfam_EGF-like_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_EGF-like,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.E295	ENST00000333360.7	37	c.885	CCDS1283.1	1																																																																																			SELE	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000007908		0.458	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELE	HGNC	protein_coding	OTTHUMT00000084333.1	151	0.00	0	C	NM_000450		169698645	169698645	-1	no_errors	ENST00000333360	ensembl	human	known	69_37n	silent	157	12.22	22	SNP	0.022	T
SLC5A3	6526	genome.wustl.edu	37	21	35467531	35467531	+	Missense_Mutation	SNP	A	A	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr21:35467531A>G	ENST00000381151.3	+	2	546	c.34A>G	c.(34-36)Ata>Gta	p.I12V	MRPS6_ENST00000399312.2_Intron|SLC5A3_ENST00000608209.1_Missense_Mutation_p.I12V|AP000320.7_ENST00000362077.4_RNA			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	12					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						AGACATTGCCATAGTGGCCCT	0.428																																						dbGAP											0													175.0	167.0	170.0					21																	35467531		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.34A>G	21.37:g.35467531A>G	ENSP00000370543:p.Ile12Val		O43489	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.I12V	ENST00000381151.3	37	c.34	CCDS33549.1	21	.	.	.	.	.	.	.	.	.	.	A	0.025	-1.379268	0.01204	.	.	ENSG00000198743	ENST00000381151	D	0.85171	-1.95	6.08	3.66	0.41972	.	0.169473	0.49916	N	0.000126	T	0.53610	0.1807	N	0.00554	-1.385	0.26929	N	0.966502	B	0.02656	0.0	B	0.01281	0.0	T	0.51268	-0.8727	10	0.02654	T	1	.	9.9624	0.41704	0.8599:0.0:0.1401:0.0	.	12	P53794	SC5A3_HUMAN	V	12	ENSP00000370543:I12V	ENSP00000370543:I12V	I	+	1	0	SLC5A3	34389401	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.921000	0.63397	0.506000	0.28125	0.481000	0.45027	ATA	SLC5A3	-	pfscan_Na/solute_symporter	ENSG00000198743		0.428	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	SLC5A3	HGNC	protein_coding	OTTHUMT00000141037.1	330	0.30	1	A			35467531	35467531	+1	no_errors	ENST00000381151	ensembl	human	known	69_37n	missense	207	33.12	103	SNP	1.000	G
SLITRK4	139065	genome.wustl.edu	37	X	142718155	142718155	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chrX:142718155T>C	ENST00000381779.4	-	2	995	c.770A>G	c.(769-771)aAc>aGc	p.N257S	SLITRK4_ENST00000338017.4_Missense_Mutation_p.N257S|SLITRK4_ENST00000356928.1_Missense_Mutation_p.N257S	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	257	LRRCT 1.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					CTCTTGTTTGTTGGTTTCTTT	0.453																																						dbGAP											0													72.0	64.0	67.0					X																	142718155		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.770A>G	X.37:g.142718155T>C	ENSP00000371198:p.Asn257Ser		Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.N257S	ENST00000381779.4	37	c.770	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	T	0.042	-1.281035	0.01398	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.30182	1.54;1.54;1.54	5.88	5.88	0.94601	Cysteine-rich flanking region, C-terminal (1);	0.049654	0.85682	D	0.000000	T	0.11495	0.0280	N	0.01874	-0.695	0.58432	D	0.999998	B	0.17667	0.023	B	0.15870	0.014	T	0.16660	-1.0395	10	0.02654	T	1	-12.7831	13.9231	0.63945	0.0:0.0:0.0:1.0	.	257	Q8IW52	SLIK4_HUMAN	S	257	ENSP00000371198:N257S;ENSP00000349400:N257S;ENSP00000336627:N257S	ENSP00000336627:N257S	N	-	2	0	SLITRK4	142545821	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	4.140000	0.58031	1.973000	0.57446	0.486000	0.48141	AAC	SLITRK4	-	smart_Cys-rich_flank_reg_C	ENSG00000179542		0.453	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	75	0.00	0	T	NM_173078		142718155	142718155	-1	no_errors	ENST00000338017	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	1.000	C
SMYD2	56950	genome.wustl.edu	37	1	214498008	214498008	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr1:214498008G>A	ENST00000366957.5	+	6	581	c.559G>A	c.(559-561)Gaa>Aaa	p.E187K	SMYD2_ENST00000491455.1_3'UTR|SMYD2_ENST00000415093.2_Missense_Mutation_p.E187K	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	187	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		CTTCACAATTGAAGATGAAGA	0.343																																						dbGAP											0													196.0	193.0	194.0					1																	214498008		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.559G>A	1.37:g.214498008G>A	ENSP00000355924:p.Glu187Lys		B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.E187K	ENST00000366957.5	37	c.559	CCDS31022.1	1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.563580	0.86335	.	.	ENSG00000143499	ENST00000366957;ENST00000415093	T;T	0.14516	2.5;2.5	5.27	5.27	0.74061	SET domain (2);	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	L	0.37697	1.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.01238	-1.1409	10	0.29301	T	0.29	-2.5834	18.9031	0.92451	0.0:0.0:1.0:0.0	.	187;171	Q9NRG4;Q05C86	SMYD2_HUMAN;.	K	187	ENSP00000355924:E187K;ENSP00000388682:E187K	ENSP00000355924:E187K	E	+	1	0	SMYD2	212564631	1.000000	0.71417	0.984000	0.44739	0.852000	0.48524	9.209000	0.95087	2.460000	0.83146	0.655000	0.94253	GAA	SMYD2	-	pfam_SET_dom,smart_SET_dom	ENSG00000143499		0.343	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD2	HGNC	protein_coding	OTTHUMT00000089998.1	355	0.28	1	G	NM_020197		214498008	214498008	+1	no_errors	ENST00000366957	ensembl	human	known	69_37n	missense	445	13.42	69	SNP	1.000	A
SNRK	54861	genome.wustl.edu	37	3	43388879	43388879	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr3:43388879C>G	ENST00000296088.7	+	7	1432	c.1128C>G	c.(1126-1128)gaC>gaG	p.D376E	SNRK-AS1_ENST00000422681.1_RNA|SNRK_ENST00000429705.2_Missense_Mutation_p.D376E|SNRK_ENST00000454177.1_Missense_Mutation_p.D376E|RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000437827.1_Missense_Mutation_p.D170E	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		TTGAGGATGACCTCACGGCCA	0.517																																						dbGAP											0													88.0	95.0	93.0					3																	43388879		2014	4183	6197	-	-	-	SO:0001583	missense	0			D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1128C>G	3.37:g.43388879C>G	ENSP00000296088:p.Asp376Glu			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.D376E	ENST00000296088.7	37	c.1128	CCDS43075.1	3	.	.	.	.	.	.	.	.	.	.	C	12.04	1.817255	0.32145	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	T;T;T;T	0.63580	-0.05;-0.05;-0.05;2.86	5.07	3.26	0.37387	.	0.153798	0.64402	D	0.000020	T	0.40498	0.1119	N	0.14661	0.345	0.33844	D	0.631748	B	0.16396	0.017	B	0.12837	0.008	T	0.41016	-0.9532	10	0.28530	T	0.3	.	8.3265	0.32160	0.0:0.7555:0.0:0.2445	.	376	Q9NRH2	SNRK_HUMAN	E	376;376;376;170	ENSP00000401246:D376E;ENSP00000411375:D376E;ENSP00000296088:D376E;ENSP00000409516:D170E	ENSP00000296088:D376E	D	+	3	2	SNRK	43363883	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	0.945000	0.29056	0.644000	0.30656	0.655000	0.94253	GAC	SNRK	-	NULL	ENSG00000163788		0.517	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRK	HGNC	protein_coding	OTTHUMT00000344325.1	40	0.00	0	C	NM_017719		43388879	43388879	+1	no_errors	ENST00000296088	ensembl	human	known	69_37n	missense	13	51.85	14	SNP	1.000	G
SRF	6722	genome.wustl.edu	37	6	43141677	43141677	+	Silent	SNP	G	G	C			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr6:43141677G>C	ENST00000265354.4	+	2	964	c.606G>C	c.(604-606)ctG>ctC	p.L202L	SRF_ENST00000457278.2_5'UTR	NM_003131.2	NP_003122.1	P11831	SRF_HUMAN	serum response factor (c-fos serum response element-binding transcription factor)	202	Involved in dimerization.				angiogenesis involved in wound healing (GO:0060055)|associative learning (GO:0008306)|cardiac myofibril assembly (GO:0055003)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular senescence (GO:0090398)|contractile actin filament bundle assembly (GO:0030038)|developmental growth (GO:0048589)|dorsal aorta morphogenesis (GO:0035912)|epithelial cell-cell adhesion (GO:0090136)|epithelial structure maintenance (GO:0010669)|erythrocyte development (GO:0048821)|eyelid development in camera-type eye (GO:0061029)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|hematopoietic stem cell differentiation (GO:0060218)|hippocampus development (GO:0021766)|long term synaptic depression (GO:0060292)|long-term memory (GO:0007616)|megakaryocyte development (GO:0035855)|mesoderm formation (GO:0001707)|morphogenesis of an epithelial sheet (GO:0002011)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet formation (GO:0030220)|positive regulation of cell differentiation (GO:0045597)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription by glucose (GO:0046016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive thymic T cell selection (GO:0045059)|primitive streak formation (GO:0090009)|regulation of cell adhesion (GO:0030155)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of water loss via skin (GO:0033561)|response to cytokine (GO:0034097)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|sarcomere organization (GO:0045214)|skin morphogenesis (GO:0043589)|stress fiber assembly (GO:0043149)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|tight junction assembly (GO:0070830)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	12			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			CCCGAAAACTGCAGCCCATGA	0.582																																						dbGAP											0													165.0	129.0	141.0					6																	43141677		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J03161	CCDS4889.1	6p	2008-02-05			ENSG00000112658	ENSG00000112658			11291	protein-coding gene	gene with protein product		600589				3203386	Standard	NM_003131		Approved	MCM1	uc003oui.3	P11831	OTTHUMG00000014722	ENST00000265354.4:c.606G>C	6.37:g.43141677G>C			Q5T648	Silent	SNP	pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.L202	ENST00000265354.4	37	c.606	CCDS4889.1	6																																																																																			SRF	-	superfamily_TF_MADSbox	ENSG00000112658		0.582	SRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRF	HGNC	protein_coding	OTTHUMT00000040581.1	285	0.35	1	G	NM_003131		43141677	43141677	+1	no_errors	ENST00000265354	ensembl	human	known	69_37n	silent	107	35.93	60	SNP	1.000	C
STK32C	282974	genome.wustl.edu	37	10	134022579	134022579	+	Silent	SNP	G	G	A	rs150156301		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr10:134022579G>A	ENST00000368622.1	-	11	1308	c.927C>T	c.(925-927)ctC>ctT	p.L309L	STK32C_ENST00000368625.4_Silent_p.L439L					serine/threonine kinase 32C											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GGATGGCATCGAGGCAGTCTT	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		18725	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													233.0	179.0	197.0					10																	134022579		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368622.1:c.927C>T	10.37:g.134022579G>A				Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L439	ENST00000368622.1	37	c.1317		10																																																																																			STK32C	-	NULL	ENSG00000165752		0.547	STK32C-001	KNOWN	basic	protein_coding	STK32C	HGNC	protein_coding	OTTHUMT00000051068.2	321	0.00	0	G	NM_173575		134022579	134022579	-1	no_errors	ENST00000368625	ensembl	human	known	69_37n	silent	148	15.91	28	SNP	0.991	A
TMED8	283578	genome.wustl.edu	37	14	77818056	77818056	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr14:77818056C>A	ENST00000216468.7	-	2	212	c.157G>T	c.(157-159)Gct>Tct	p.A53S	RN7SL137P_ENST00000584622.1_RNA	NM_213601.1	NP_998766.1	Q6PL24	TMED8_HUMAN	transmembrane emp24 protein transport domain containing 8	53					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)	15			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		GTGGCAGAAGCCAATAAAGAG	0.398																																						dbGAP											0													124.0	132.0	129.0					14																	77818056		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095650	CCDS32125.1	14q24.3	2005-08-26	2005-08-26	2005-01-07		ENSG00000100580			18633	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member B"", ""transmembrane emp24 domain containing 8"""	FAM15B			Standard	NM_213601		Approved		uc001xto.1	Q6PL24		ENST00000216468.7:c.157G>T	14.37:g.77818056C>A	ENSP00000216468:p.Ala53Ser		B3KTI6|Q3MJB0|Q9P1V9	Missense_Mutation	SNP	superfamily_GOLD,pfscan_GOLD	p.A53S	ENST00000216468.7	37	c.157	CCDS32125.1	14	.	.	.	.	.	.	.	.	.	.	C	5.358	0.251268	0.10130	.	.	ENSG00000100580	ENST00000216468	T	0.24908	1.83	5.47	3.31	0.37934	.	0.564961	0.19314	N	0.117318	T	0.15739	0.0379	N	0.24115	0.695	0.09310	N	1	B	0.16603	0.018	B	0.19391	0.025	T	0.18304	-1.0341	10	0.25751	T	0.34	0.4904	8.5756	0.33597	0.0:0.7954:0.0:0.2046	.	53	Q6PL24	TMED8_HUMAN	S	53	ENSP00000216468:A53S	ENSP00000216468:A53S	A	-	1	0	TMED8	76887809	0.456000	0.25744	0.707000	0.30419	0.041000	0.13682	0.325000	0.19628	1.320000	0.45209	-0.151000	0.13558	GCT	TMED8	-	NULL	ENSG00000100580		0.398	TMED8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED8	HGNC	protein_coding	OTTHUMT00000414100.1	145	0.00	0	C	NM_213601		77818056	77818056	-1	no_errors	ENST00000216468	ensembl	human	known	69_37n	missense	106	19.70	26	SNP	0.012	A
TP53	7157	genome.wustl.edu	37	17	7578508	7578508	+	Missense_Mutation	SNP	C	C	T	rs587781288		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr17:7578508C>T	ENST00000269305.4	-	5	611	c.422G>A	c.(421-423)tGc>tAc	p.C141Y	TP53_ENST00000455263.2_Missense_Mutation_p.C141Y|TP53_ENST00000420246.2_Missense_Mutation_p.C141Y|TP53_ENST00000413465.2_Missense_Mutation_p.C141Y|TP53_ENST00000445888.2_Missense_Mutation_p.C141Y|TP53_ENST00000359597.4_Missense_Mutation_p.C141Y|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141Y(79)|p.0?(8)|p.C9Y(5)|p.C48Y(5)|p.A138_P142delAKTCP(4)|p.C141F(4)|p.C141S(3)|p.N131fs*27(2)|p.C9S(1)|p.K139_C141>N(1)|p.L137_W146del10(1)|p.C141A(1)|p.A6_P10delAKTCP(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.C48S(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCACAGGGCAGGTCTTGGC	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	121	Substitution - Missense(99)|Whole gene deletion(8)|Deletion - In frame(8)|Deletion - Frameshift(5)|Complex - deletion inframe(1)	large_intestine(23)|breast(17)|ovary(12)|haematopoietic_and_lymphoid_tissue(7)|oesophagus(7)|liver(7)|upper_aerodigestive_tract(6)|central_nervous_system(6)|endometrium(6)|urinary_tract(6)|lung(5)|prostate(5)|bone(5)|stomach(4)|soft_tissue(2)|biliary_tract(1)|testis(1)|pancreas(1)	GRCh37	CM993216	TP53	M							56.0	55.0	55.0					17																	7578508		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.422G>A	17.37:g.7578508C>T	ENSP00000269305:p.Cys141Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C141Y	ENST00000269305.4	37	c.422	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720132	0.48728	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.48	4.5	0.54988	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.046412	0.85682	D	0.000000	D	0.99832	0.9924	M	0.90309	3.105	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.987;1.0;0.999;1.0;1.0	D	0.96735	0.9542	10	0.87932	D	0	-26.1094	13.743	0.62860	0.1552:0.8448:0.0:0.0	.	102;141;141;48;141;141;141	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	141;141;141;141;141;141;130;48;9;48;9;141	ENSP00000410739:C141Y;ENSP00000352610:C141Y;ENSP00000269305:C141Y;ENSP00000398846:C141Y;ENSP00000391127:C141Y;ENSP00000391478:C141Y;ENSP00000425104:C9Y;ENSP00000423862:C48Y;ENSP00000424104:C141Y	ENSP00000269305:C141Y	C	-	2	0	TP53	7519233	1.000000	0.71417	0.996000	0.52242	0.022000	0.10575	6.016000	0.70798	1.427000	0.47276	-0.182000	0.12963	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	101	0.00	0	C	NM_000546		7578508	7578508	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	18	56.10	23	SNP	1.000	T
TSPAN14	81619	genome.wustl.edu	37	10	82249013	82249013	+	Silent	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr10:82249013C>T	ENST00000429989.3	+	2	247	c.24C>T	c.(22-24)aaC>aaT	p.N8N	TSPAN14_ENST00000481124.1_Silent_p.N8N|TSPAN14_ENST00000341863.6_Silent_p.N8N|TSPAN14_ENST00000372164.3_Silent_p.N8N|TSPAN14_ENST00000372158.1_Silent_p.N8N|TSPAN14_ENST00000372156.1_Silent_p.N8N	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14	8					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			GATACTCTAACGCCAAGGTCA	0.463																																						dbGAP											0													159.0	111.0	127.0					10																	82249013		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.24C>T	10.37:g.82249013C>T			A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.N8	ENST00000429989.3	37	c.24	CCDS7369.1	10																																																																																			TSPAN14	-	NULL	ENSG00000108219		0.463	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN14	HGNC	protein_coding	OTTHUMT00000049081.2	205	0.49	1	C	NM_030927		82249013	82249013	+1	no_errors	ENST00000372156	ensembl	human	known	69_37n	silent	100	30.07	43	SNP	0.195	T
VEZF1	7716	genome.wustl.edu	37	17	56056604	56056605	+	In_Frame_Ins	INS	-	-	TGC	rs61731354|rs57786397|rs138088904|rs369163670	byFrequency	TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr17:56056604_56056605insTGC	ENST00000581208.1	-	5	1086_1087	c.1046_1047insGCA	c.(1045-1047)caa>caGCAa	p.349_349Q>QQ	VEZF1_ENST00000584396.1_In_Frame_Ins_p.340_340Q>QQ	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	349	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgctgctgctg	0.465																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1044_1046dupGCA	17.37:g.56056611_56056613dupTGC	ENSP00000462337:p.Gln354dup			In_Frame_Ins	INS	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.353in_frame_insQ	ENST00000581208.1	37	c.1047_1046	CCDS32687.1	17																																																																																			VEZF1	-	NULL	ENSG00000136451		0.465	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VEZF1	HGNC	protein_coding	OTTHUMT00000443321.1	227	0.44	1	-			56056604	56056605	-1	no_errors	ENST00000581208	ensembl	human	known	69_37n	in_frame_ins	286	14.88	50	INS	0.934:0.940	TGC
XRN2	22803	genome.wustl.edu	37	20	21314591	21314591	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr20:21314591C>T	ENST00000377191.3	+	12	1179	c.1084C>T	c.(1084-1086)Cgt>Tgt	p.R362C	XRN2_ENST00000430571.2_Missense_Mutation_p.R286C|XRN2_ENST00000539513.1_Missense_Mutation_p.R308C	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	362					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TGCAATTGACCGTTTGGTTAA	0.348																																						dbGAP											0													172.0	161.0	165.0					20																	21314591		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1084C>T	20.37:g.21314591C>T	ENSP00000366396:p.Arg362Cys		Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	pfam_Put_53exo,superfamily_Znf_CCHC,pirsf_5_3_exoribonuclease_2	p.R362C	ENST00000377191.3	37	c.1084	CCDS13144.1	20	.	.	.	.	.	.	.	.	.	.	C	23.7	4.441744	0.83993	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.32753	1.45;1.44;1.44	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.62048	0.2396	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.63346	-0.6658	10	0.44086	T	0.13	-14.2271	19.6	0.95557	0.0:1.0:0.0:0.0	.	362	Q9H0D6	XRN2_HUMAN	C	362;286;308	ENSP00000366396:R362C;ENSP00000413548:R286C;ENSP00000441113:R308C	ENSP00000366396:R362C	R	+	1	0	XRN2	21262591	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.794000	0.85869	2.640000	0.89533	0.561000	0.74099	CGT	XRN2	-	pirsf_5_3_exoribonuclease_2	ENSG00000088930		0.348	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRN2	HGNC	protein_coding	OTTHUMT00000078273.2	264	0.00	0	C	NM_012255		21314591	21314591	+1	no_errors	ENST00000377191	ensembl	human	known	69_37n	missense	196	15.88	37	SNP	1.000	T
ZBED4	9889	genome.wustl.edu	37	22	50278870	50278870	+	Silent	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr22:50278870G>A	ENST00000216268.5	+	2	2037	c.1560G>A	c.(1558-1560)ctG>ctA	p.L520L		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	520						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GTGCAAGTCTGGCAAACTCTC	0.512																																						dbGAP											0													101.0	105.0	104.0					22																	50278870		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.1560G>A	22.37:g.50278870G>A			B2RZH1|Q1ECU0|Q9UGG8	Silent	SNP	pfam_Znf_BED_prd,pfam_HATC,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.L520	ENST00000216268.5	37	c.1560	CCDS33677.1	22																																																																																			ZBED4	-	NULL	ENSG00000100426		0.512	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED4	HGNC	protein_coding	OTTHUMT00000317408.2	76	0.00	0	G	NM_014838		50278870	50278870	+1	no_errors	ENST00000216268	ensembl	human	known	69_37n	silent	31	18.42	7	SNP	0.999	A
ZBTB12	221527	genome.wustl.edu	37	6	31867836	31867836	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr6:31867836C>T	ENST00000375527.2	-	2	1422	c.1247G>A	c.(1246-1248)cGc>cAc	p.R416H	EHMT2_ENST00000375530.4_5'Flank|C2_ENST00000469372.1_Intron|EHMT2_ENST00000375528.4_5'Flank|C2_ENST00000452323.2_5'Flank|EHMT2_ENST00000375537.4_5'Flank|EHMT2_ENST00000395728.3_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						GTAGGAGCAGCGGTAGGGCCG	0.637																																						dbGAP											0													60.0	42.0	48.0					6																	31867836		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.1247G>A	6.37:g.31867836C>T	ENSP00000364677:p.Arg416His		B0UY00|Q5JQ98	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R416H	ENST00000375527.2	37	c.1247	CCDS4727.1	6	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663845	0.67700	.	.	ENSG00000204366	ENST00000375527	T	0.07688	3.17	3.82	3.82	0.43975	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.404823	0.24625	U	0.036922	T	0.03095	0.0091	L	0.39020	1.185	0.43698	D	0.996152	P	0.35011	0.48	B	0.35655	0.207	T	0.44697	-0.9311	10	0.14656	T	0.56	.	14.4835	0.67599	0.0:1.0:0.0:0.0	.	416	Q9Y330	ZBT12_HUMAN	H	416	ENSP00000364677:R416H	ENSP00000364677:R416H	R	-	2	0	ZBTB12	31975815	0.089000	0.21612	1.000000	0.80357	0.985000	0.73830	0.707000	0.25704	1.679000	0.50963	0.313000	0.20887	CGC	ZBTB12	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204366		0.637	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB12	HGNC	protein_coding	OTTHUMT00000076315.2	31	0.00	0	C	NM_181842		31867836	31867836	-1	no_errors	ENST00000375527	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77767078	77767078	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr8:77767078G>A	ENST00000521891.2	+	10	8369	c.7921G>A	c.(7921-7923)Gaa>Aaa	p.E2641K	ZFHX4_ENST00000518282.1_Missense_Mutation_p.E2615K|ZFHX4_ENST00000455469.2_Missense_Mutation_p.E2596K|ZFHX4_ENST00000050961.6_Missense_Mutation_p.E2596K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2596					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TATTGCCCGCGAAGTCGGGCT	0.512										HNSCC(33;0.089)																												dbGAP											0													40.0	41.0	40.0					8																	77767078		1861	4109	5970	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7921G>A	8.37:g.77767078G>A	ENSP00000430497:p.Glu2641Lys		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E2641K	ENST00000521891.2	37	c.7921	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305656	0.40795	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81	5.25	5.25	0.73442	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.45126	U	0.000391	D	0.95166	0.8433	N	0.16833	0.445	0.80722	D	1	P;P;P	0.51449	0.824;0.789;0.945	P;P;P	0.61874	0.842;0.755;0.895	D	0.96101	0.9069	10	0.72032	D	0.01	.	19.0315	0.92959	0.0:0.0:1.0:0.0	.	2596;2596;2641	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	K	2641;2625;2596;2596;2615	ENSP00000430497:E2641K;ENSP00000399605:E2596K;ENSP00000050961:E2596K;ENSP00000430848:E2615K	ENSP00000050961:E2596K	E	+	1	0	ZFHX4	77929633	1.000000	0.71417	0.361000	0.25849	0.021000	0.10359	9.657000	0.98554	2.728000	0.93425	0.650000	0.86243	GAA	ZFHX4	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000091656		0.512	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	34	0.00	0	G	NM_024721		77767078	77767078	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	1.000	A
ZFR	51663	genome.wustl.edu	37	5	32403302	32403302	+	Silent	SNP	C	C	T	rs200869684		TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr5:32403302C>T	ENST00000265069.8	-	8	1527	c.1425G>A	c.(1423-1425)tcG>tcA	p.S475S		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	475					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		TATTAAGAGACGAGTTTCCTG	0.413																																						dbGAP											0													197.0	184.0	188.0					5																	32403302		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.1425G>A	5.37:g.32403302C>T			B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Silent	SNP	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.S475	ENST00000265069.8	37	c.1425	CCDS34139.1	5																																																																																			ZFR	-	NULL	ENSG00000056097		0.413	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	201	0.00	0	C			32403302	32403302	-1	no_errors	ENST00000265069	ensembl	human	known	69_37n	silent	140	33.96	72	SNP	0.574	T
ZNF425	155054	genome.wustl.edu	37	7	148800755	148800755	+	Silent	SNP	C	C	T			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr7:148800755C>T	ENST00000378061.2	-	4	2340	c.2208G>A	c.(2206-2208)gcG>gcA	p.A736A		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	736					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GGGTCTTGAGCGCCCCCACGT	0.577																																						dbGAP											0													61.0	54.0	57.0					7																	148800755		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.2208G>A	7.37:g.148800755C>T			B3KPM1|Q08AG3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.A736	ENST00000378061.2	37	c.2208	CCDS34773.1	7																																																																																			ZNF425	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204947		0.577	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1	53	0.00	0	C	XM_088140		148800755	148800755	-1	no_errors	ENST00000378061	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	0.000	T
ZNF677	342926	genome.wustl.edu	37	19	53741204	53741204	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1JJ-01A-31D-A14K-09	TCGA-D8-A1JJ-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	412f96a6-6599-40a6-9dd2-afba8c643910	a022c9a2-3e8a-4377-abed-33cdfbc85b18	g.chr19:53741204C>G	ENST00000598513.1	-	5	926	c.776G>C	c.(775-777)aGa>aCa	p.R259T	ZNF677_ENST00000333952.4_Missense_Mutation_p.R259T|CTD-2245F17.6_ENST00000596041.1_RNA	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TGATTTTTCTCTAATGTGTGT	0.348																																						dbGAP											0													71.0	66.0	68.0					19																	53741204		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.776G>C	19.37:g.53741204C>G	ENSP00000469391:p.Arg259Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R259T	ENST00000598513.1	37	c.776	CCDS12861.1	19	.	.	.	.	.	.	.	.	.	.	C	8.909	0.958277	0.18507	.	.	ENSG00000197928	ENST00000333952	T	0.39592	1.07	1.79	0.736	0.18307	.	.	.	.	.	T	0.22551	0.0544	N	0.17474	0.49	0.25503	N	0.987536	B	0.33073	0.396	B	0.26864	0.074	T	0.14811	-1.0459	9	0.87932	D	0	.	6.3018	0.21117	0.0:0.8284:0.0:0.1716	.	259	Q86XU0	ZN677_HUMAN	T	259	ENSP00000334394:R259T	ENSP00000334394:R259T	R	-	2	0	ZNF677	58433016	0.000000	0.05858	0.003000	0.11579	0.379000	0.30106	0.713000	0.25794	0.324000	0.23333	0.557000	0.71058	AGA	ZNF677	-	NULL	ENSG00000197928		0.348	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	57	0.00	0	C	NM_182609		53741204	53741204	-1	no_errors	ENST00000333952	ensembl	human	known	69_37n	missense	39	18.37	9	SNP	1.000	G
