#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTL6B	51412	genome.wustl.edu	37	7	100244424	100244424	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr7:100244424C>G	ENST00000160382.5	-	11	1073	c.967G>C	c.(967-969)Ggc>Cgc	p.G323R		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	323					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					ACCACGTGGCCCACACCCAAC	0.652																																						dbGAP											0													49.0	47.0	48.0					7																	100244424		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.967G>C	7.37:g.100244424C>G	ENSP00000160382:p.Gly323Arg		A4D2D0|O75421	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.G323R	ENST00000160382.5	37	c.967	CCDS5702.1	7	.	.	.	.	.	.	.	.	.	.	C	18.63	3.664750	0.67700	.	.	ENSG00000077080	ENST00000160382	D	0.94376	-3.41	5.56	4.67	0.58626	.	0.156649	0.40144	N	0.001163	D	0.93733	0.7997	M	0.70595	2.14	0.53005	D	0.999967	P	0.49307	0.922	P	0.53360	0.724	D	0.92777	0.6237	10	0.52906	T	0.07	.	7.5294	0.27674	0.0:0.8237:0.0:0.1763	.	323	O94805	ACL6B_HUMAN	R	323	ENSP00000160382:G323R	ENSP00000160382:G323R	G	-	1	0	ACTL6B	100082360	0.987000	0.35691	1.000000	0.80357	0.977000	0.68977	1.383000	0.34385	2.608000	0.88229	0.655000	0.94253	GGC	ACTL6B	-	pfam_Actin-like,smart_Actin-like	ENSG00000077080		0.652	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6B	HGNC	protein_coding	OTTHUMT00000356745.1	9	0.00	0	C	NM_016188		100244424	100244424	-1	no_errors	ENST00000160382	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	1.000	G
ADAMTS7	11173	genome.wustl.edu	37	15	79058631	79058631	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr15:79058631G>T	ENST00000388820.4	-	19	3832	c.3622C>A	c.(3622-3624)Cct>Act	p.P1208T	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1208					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGCCATGGAGGGGGCAGCTGG	0.627																																						dbGAP											0													31.0	34.0	33.0					15																	79058631		2194	4285	6479	-	-	-	SO:0001583	missense	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3622C>A	15.37:g.79058631G>T	ENSP00000373472:p.Pro1208Thr		Q14F51|Q6P7J9	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P1208T	ENST00000388820.4	37	c.3622	CCDS32303.1	15	.	.	.	.	.	.	.	.	.	.	g	4.018	0.000716	0.07819	.	.	ENSG00000136378	ENST00000388820	T	0.58210	0.35	3.83	-0.95	0.10372	.	0.933113	0.09060	N	0.854504	T	0.26085	0.0636	N	0.14661	0.345	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.18745	-1.0327	10	0.12430	T	0.62	.	2.0591	0.03587	0.1886:0.1527:0.4923:0.1663	.	1208	Q9UKP4	ATS7_HUMAN	T	1208	ENSP00000373472:P1208T	ENSP00000373472:P1208T	P	-	1	0	ADAMTS7	76845686	0.050000	0.20438	0.003000	0.11579	0.648000	0.38561	0.175000	0.16762	-0.119000	0.11830	0.472000	0.43445	CCT	ADAMTS7	-	NULL	ENSG00000136378		0.627	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	12	0.00	0	G	NM_014272		79058631	79058631	-1	no_errors	ENST00000388820	ensembl	human	known	69_37n	missense	15	50.00	15	SNP	0.001	T
AMBRA1	55626	genome.wustl.edu	37	11	46419045	46419045	+	Silent	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr11:46419045G>A	ENST00000458649.2	-	18	4270	c.3852C>T	c.(3850-3852)agC>agT	p.S1284S	AMBRA1_ENST00000298834.3_Silent_p.S1224S|AMBRA1_ENST00000426438.1_Silent_p.S1255S|AMBRA1_ENST00000534300.1_Silent_p.S1224S|AMBRA1_ENST00000314845.3_Silent_p.S1194S|AMBRA1_ENST00000528950.1_Silent_p.S1255S|AMBRA1_ENST00000533727.1_Silent_p.S1165S			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1284					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CGTCCCCCCTGCTGCTGCCAC	0.612																																						dbGAP											0													93.0	87.0	89.0					11																	46419045		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3852C>T	11.37:g.46419045G>A			A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1284	ENST00000458649.2	37	c.3852		11																																																																																			AMBRA1	-	NULL	ENSG00000110497		0.612	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	59	0.00	0	G	NM_017749		46419045	46419045	-1	no_errors	ENST00000458649	ensembl	human	known	69_37n	silent	77	22.22	22	SNP	0.994	A
ATXN7	6314	genome.wustl.edu	37	3	63981414	63981414	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr3:63981414G>C	ENST00000295900.6	+	12	2466	c.1916G>C	c.(1915-1917)tGc>tCc	p.C639S	ATXN7_ENST00000398590.3_Missense_Mutation_p.C639S|ATXN7_ENST00000484332.1_Missense_Mutation_p.C494S|ATXN7_ENST00000487717.1_Missense_Mutation_p.C639S|ATXN7_ENST00000538065.1_Missense_Mutation_p.C639S	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	639					cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		GATCCTGTGTGCAGTATGCAA	0.542																																						dbGAP											0													170.0	181.0	177.0					3																	63981414		2176	4257	6433	-	-	-	SO:0001583	missense	0			AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.1916G>C	3.37:g.63981414G>C	ENSP00000295900:p.Cys639Ser		B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	pfam_SCA7_dom	p.C639S	ENST00000295900.6	37	c.1916	CCDS43102.1	3	.	.	.	.	.	.	.	.	.	.	G	13.24	2.179474	0.38511	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000484332	T;T;T;T;T	0.14893	2.47;2.48;2.48;2.47;2.47	4.84	4.84	0.62591	.	0.271873	0.42821	N	0.000654	T	0.13157	0.0319	N	0.22421	0.69	0.40018	D	0.975376	B;B;B	0.16603	0.001;0.018;0.005	B;B;B	0.14578	0.001;0.011;0.002	T	0.11372	-1.0590	10	0.15499	T	0.54	-4.535	18.3822	0.90454	0.0:0.0:1.0:0.0	.	494;639;639	E9PHP9;O15265-2;O15265	.;.;ATX7_HUMAN	S	639;639;639;639;494	ENSP00000381590:C639S;ENSP00000295900:C639S;ENSP00000420234:C639S;ENSP00000439585:C639S;ENSP00000428277:C494S	ENSP00000295900:C639S	C	+	2	0	ATXN7	63956454	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.576000	0.74023	2.429000	0.82318	0.650000	0.86243	TGC	ATXN7	-	NULL	ENSG00000163635		0.542	ATXN7-001	KNOWN	basic|CCDS	protein_coding	ATXN7	HGNC	protein_coding	OTTHUMT00000352070.1	95	0.00	0	G	NM_000333		63981414	63981414	+1	no_errors	ENST00000398590	ensembl	human	known	69_37n	missense	149	36.86	87	SNP	1.000	C
BRD3	8019	genome.wustl.edu	37	9	136918532	136918532	+	Missense_Mutation	SNP	G	G	A	rs200460874		TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr9:136918532G>A	ENST00000303407.7	-	2	253	c.68C>T	c.(67-69)cCc>cTc	p.P23L	BRD3_ENST00000357885.2_Missense_Mutation_p.P23L|BRD3_ENST00000371834.2_Missense_Mutation_p.P23L|RP11-374P20.4_ENST00000412181.1_RNA	NM_007371.3	NP_031397.1	Q15059	BRD3_HUMAN	bromodomain containing 3	23					chromatin modification (GO:0016568)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)		BRD3/C15orf55(3)	kidney(1)|skin(1)|stomach(4)	6				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		GACCTCCGGGGGGGGTGGGTT	0.657			T	C15orf55	lethal midline carcinoma of young people																																	dbGAP		Dom	yes		9	9q34	8019	bromodomain containing 3		E	0													24.0	29.0	27.0					9																	136918532		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS6980.1	9q34	2010-12-23	2002-01-14		ENSG00000169925	ENSG00000169925			1104	protein-coding gene	gene with protein product	"""RING3-like"""	601541	"""bromodomain-containing 3"""			7584044, 8781126	Standard	NM_007371		Approved	RING3L, ORFX, KIAA0043	uc004cew.3	Q15059	OTTHUMG00000021004	ENST00000303407.7:c.68C>T	9.37:g.136918532G>A	ENSP00000305918:p.Pro23Leu		B1APD9|Q4G5Y3|Q5T1R7|Q8N5M3|Q92645	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.P23L	ENST00000303407.7	37	c.68	CCDS6980.1	9	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971454	0.74246	.	.	ENSG00000169925	ENST00000303407;ENST00000371834;ENST00000357885;ENST00000371842	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	5.0	5.0	0.66597	Bromodomain (1);	0.000000	0.64402	D	0.000001	T	0.40145	0.1105	M	0.78344	2.41	0.80722	D	1	D;P	0.54047	0.964;0.837	P;B	0.57468	0.821;0.35	T	0.39563	-0.9608	10	0.87932	D	0	-28.7141	17.2937	0.87164	0.0:0.0:1.0:0.0	.	23;23	Q15059-2;Q15059	.;BRD3_HUMAN	L	23	ENSP00000305918:P23L;ENSP00000360900:P23L;ENSP00000350557:P23L;ENSP00000360908:P23L	ENSP00000305918:P23L	P	-	2	0	BRD3	135908353	1.000000	0.71417	0.983000	0.44433	0.052000	0.14988	9.369000	0.97156	2.310000	0.77875	0.563000	0.77884	CCC	BRD3	-	superfamily_Bromodomain	ENSG00000169925		0.657	BRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD3	HGNC	protein_coding	OTTHUMT00000055390.4	29	0.00	0	G	NM_007371		136918532	136918532	-1	no_errors	ENST00000303407	ensembl	human	known	69_37n	missense	14	68.89	31	SNP	1.000	A
PQLC2L	152078	genome.wustl.edu	37	3	157289743	157289743	+	Splice_Site	SNP	G	G	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr3:157289743G>T	ENST00000449199.2	+	4	354		c.e4-1		C3orf55_ENST00000459838.1_Intron|C3orf55_ENST00000312275.5_Splice_Site|C3orf55_ENST00000461040.1_Intron|C3orf55_ENST00000426338.2_Intron	NM_001130002.2	NP_001123474.1	A1A4F0	CC055_HUMAN												breast(1)|lung(1)	2			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)			TACCACTCCAGATTTTTACAG	0.338																																						dbGAP											0													107.0	94.0	98.0					3																	157289743		1838	4075	5913	-	-	-	SO:0001630	splice_region_variant	0																														ENST00000449199.2:c.214-1G>T	3.37:g.157289743G>T			C9JP04|C9JXB5|Q8N6Q6	Splice_Site	SNP	-	e3-1	ENST00000449199.2	37	c.214-1	CCDS46943.1	3	.	.	.	.	.	.	.	.	.	.	G	6.401	0.442177	0.12164	.	.	ENSG00000174899	ENST00000312275;ENST00000449199	.	.	.	4.44	1.62	0.23740	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.3216	0.32132	0.2737:0.0:0.7263:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C3orf55	158772437	0.857000	0.29778	0.000000	0.03702	0.005000	0.04900	2.975000	0.49281	0.097000	0.17492	-0.142000	0.14014	.	C3orf55	-	-	ENSG00000174899		0.338	C3orf55-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf55	HGNC	protein_coding	OTTHUMT00000352018.1	82	0.00	0	G		Intron	157289743	157289743	+1	no_errors	ENST00000449199	ensembl	human	known	69_37n	splice_site	144	42.46	107	SNP	0.008	T
CCDC23	374969	genome.wustl.edu	37	1	43282112	43282112	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr1:43282112T>C	ENST00000372521.4	-	2	202	c.104A>G	c.(103-105)cAa>cGa	p.Q35R	ERMAP_ENST00000372517.2_5'Flank|CCDC23_ENST00000372522.1_Missense_Mutation_p.Q35R|CCDC23_ENST00000497437.1_5'UTR|CCDC23_ENST00000537227.1_Missense_Mutation_p.Q35R	NM_199342.3	NP_955374.1	Q8N300	CCD23_HUMAN	coiled-coil domain containing 23	35					negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein ubiquitination (GO:0031397)|protein secretion (GO:0009306)	apical part of cell (GO:0045177)				large_intestine(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTCTGCTCTTTGTCTCTGCTT	0.478																																						dbGAP											0													203.0	189.0	194.0					1																	43282112		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL512353, CAH72714	CCDS474.1	1p34.2	2008-02-05			ENSG00000177868	ENSG00000177868			29204	protein-coding gene	gene with protein product							Standard	NM_199342		Approved	MGC45441	uc001cib.2	Q8N300	OTTHUMG00000007566	ENST00000372521.4:c.104A>G	1.37:g.43282112T>C	ENSP00000361599:p.Gln35Arg		A8K5P1|D3DPW7	Missense_Mutation	SNP	NULL	p.Q35R	ENST00000372521.4	37	c.104	CCDS474.1	1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.526779	0.64860	.	.	ENSG00000177868	ENST00000372522;ENST00000372521;ENST00000537227	.	.	.	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000016	T	0.74876	0.3774	.	.	.	0.39776	D	0.972233	P	0.51449	0.945	D	0.67900	0.954	T	0.75399	-0.3331	8	0.35671	T	0.21	.	11.3127	0.49372	0.0:0.0:0.0:1.0	.	35	Q8N300	CCD23_HUMAN	R	35	.	ENSP00000361599:Q35R	Q	-	2	0	CCDC23	43054699	1.000000	0.71417	0.974000	0.42286	0.936000	0.57629	5.611000	0.67674	1.915000	0.55452	0.455000	0.32223	CAA	CCDC23	-	NULL	ENSG00000177868		0.478	CCDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC23	HGNC	protein_coding	OTTHUMT00000019997.1	128	0.00	0	T	NM_199342		43282112	43282112	-1	no_errors	ENST00000372521	ensembl	human	known	69_37n	missense	203	39.58	133	SNP	1.000	C
CTCF	10664	genome.wustl.edu	37	16	67644736	67644736	+	Start_Codon_SNP	SNP	A	A	G			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr16:67644736A>G	ENST00000264010.4	+	3	445	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	1					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GGCAGGGGAAATGGAAGGTGA	0.403																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											0													58.0	64.0	62.0					16																	67644736		2198	4300	6498	-	-	-	SO:0001582	initiator_codon_variant	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1A>G	16.37:g.67644736A>G	ENSP00000264010:p.Met1Val		B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M1V	ENST00000264010.4	37	c.1	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	A	13.45	2.239665	0.39598	.	.	ENSG00000102974	ENST00000264010	T	0.10192	2.9	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.12518	0.0304	.	.	.	0.80722	D	1	B	0.15141	0.012	B	0.12156	0.007	T	0.02774	-1.1112	9	0.87932	D	0	-2.7778	15.2015	0.73142	1.0:0.0:0.0:0.0	.	1	P49711	CTCF_HUMAN	V	1	ENSP00000264010:M1V	ENSP00000264010:M1V	M	+	1	0	CTCF	66202237	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.791000	0.69045	2.178000	0.69098	0.533000	0.62120	ATG	CTCF	-	NULL	ENSG00000102974		0.403	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	9	0.00	0	A	NM_006565	Missense_Mutation	67644736	67644736	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	1.000	G
DSC1	1823	genome.wustl.edu	37	18	28714069	28714069	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr18:28714069C>T	ENST00000257198.5	-	13	2162	c.1901G>A	c.(1900-1902)cGg>cAg	p.R634Q	RP11-408H20.2_ENST00000581836.1_RNA|RP11-408H20.3_ENST00000582307.1_RNA|DSC1_ENST00000257197.3_Missense_Mutation_p.R634Q	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	634	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			AAGATTTTGCCGTTGACGAAG	0.343																																						dbGAP											0													90.0	92.0	92.0					18																	28714069		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1901G>A	18.37:g.28714069C>T	ENSP00000257198:p.Arg634Gln		Q9HB01	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_pro_dom,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Desmocollin,prints_Cadherin,prints_Desmo_cadherin	p.R634Q	ENST00000257198.5	37	c.1901	CCDS11894.1	18	.	.	.	.	.	.	.	.	.	.	C	6.966	0.548267	0.13312	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.60797	0.16;0.16	5.61	1.52	0.23074	Cadherin (2);Cadherin-like (1);	0.158161	0.30159	N	0.010277	T	0.43656	0.1257	L	0.55743	1.74	0.09310	N	1	B;B	0.30193	0.07;0.272	B;B	0.15052	0.005;0.012	T	0.21484	-1.0244	10	0.19147	T	0.46	.	9.2195	0.37368	0.0:0.6944:0.0:0.3056	.	634;634	Q08554;Q9HB00	DSC1_HUMAN;.	Q	634	ENSP00000257197:R634Q;ENSP00000257198:R634Q	ENSP00000257197:R634Q	R	-	2	0	DSC1	26968067	0.000000	0.05858	0.000000	0.03702	0.711000	0.40976	0.555000	0.23422	0.058000	0.16222	0.585000	0.79938	CGG	DSC1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000134765		0.343	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC1	HGNC	protein_coding	OTTHUMT00000254946.1	30	0.00	0	C	NM_004948, NM_024421		28714069	28714069	-1	no_errors	ENST00000257198	ensembl	human	known	69_37n	missense	59	41.00	41	SNP	0.000	T
EXOSC9	5393	genome.wustl.edu	37	4	122735146	122735146	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr4:122735146T>C	ENST00000243498.5	+	10	1208	c.1100T>C	c.(1099-1101)aTt>aCt	p.I367T	EXOSC9_ENST00000379663.3_Missense_Mutation_p.I367T|EXOSC9_ENST00000509980.1_3'UTR|EXOSC9_ENST00000512454.1_Missense_Mutation_p.I351T	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	367					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						CAAGCTATCATTCTTGATGGT	0.423																																						dbGAP											0													155.0	156.0	156.0					4																	122735146		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.1100T>C	4.37:g.122735146T>C	ENSP00000243498:p.Ile367Thr		Q12883|Q4W5P5|Q86Y41|Q86Y48	Missense_Mutation	SNP	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2	p.I367T	ENST00000243498.5	37	c.1100	CCDS3722.2	4	.	.	.	.	.	.	.	.	.	.	T	13.37	2.217556	0.39201	.	.	ENSG00000123737	ENST00000243498;ENST00000379663;ENST00000512454	T;T;T	0.24538	1.94;1.85;1.94	5.73	4.57	0.56435	.	0.894418	0.09909	N	0.739980	T	0.11836	0.0288	N	0.12182	0.205	0.21220	N	0.999753	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.001;0.002	T	0.34354	-0.9832	10	0.13853	T	0.58	-25.3464	2.6891	0.05116	0.2101:0.16:0.0:0.6299	.	351;367;367	D6RIY6;Q06265;Q06265-2	.;EXOS9_HUMAN;.	T	367;367;351	ENSP00000243498:I367T;ENSP00000368984:I367T;ENSP00000425782:I351T	ENSP00000243498:I367T	I	+	2	0	EXOSC9	122954596	0.361000	0.24972	1.000000	0.80357	0.987000	0.75469	2.274000	0.43390	2.193000	0.70182	0.451000	0.29950	ATT	EXOSC9	-	NULL	ENSG00000123737		0.423	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC9	HGNC	protein_coding	OTTHUMT00000250708.2	39	0.00	0	T	NM_005033		122735146	122735146	+1	no_errors	ENST00000379663	ensembl	human	known	69_37n	missense	65	39.25	42	SNP	0.980	C
FAM214A	56204	genome.wustl.edu	37	15	52879367	52879367	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr15:52879367G>A	ENST00000261844.7	-	11	3010	c.2858C>T	c.(2857-2859)cCt>cTt	p.P953L	RP11-23N2.4_ENST00000566344.1_RNA|RP11-23N2.4_ENST00000562062.1_RNA|FAM214A_ENST00000546305.2_Missense_Mutation_p.P960L	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	953																	TGTTCCTGAAGGAGGTACTCG	0.368																																						dbGAP											0													145.0	134.0	138.0					15																	52879367		1850	4095	5945	-	-	-	SO:0001583	missense	0			AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.2858C>T	15.37:g.52879367G>A	ENSP00000261844:p.Pro953Leu		A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	NULL	p.P953L	ENST00000261844.7	37	c.2858	CCDS45263.1	15	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454779	0.84209	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	T;T;T	0.67345	1.43;-0.26;1.42	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.77538	0.4145	M	0.71581	2.175	0.80722	D	1	P;P	0.40180	0.705;0.58	P;P	0.51266	0.664;0.464	T	0.78309	-0.2254	10	0.51188	T	0.08	.	18.7072	0.91643	0.0:0.0:1.0:0.0	.	960;953	F5H8G0;Q32MH5	.;K1370_HUMAN	L	953;953;952;960	ENSP00000261844:P953L;ENSP00000444447:P952L;ENSP00000443598:P960L	ENSP00000261844:P953L	P	-	2	0	KIAA1370	50666659	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.400000	0.97290	2.405000	0.81733	0.650000	0.86243	CCT	FAM214A	-	NULL	ENSG00000047346		0.368	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214A	HGNC	protein_coding	OTTHUMT00000419914.1	45	0.00	0	G	NM_019600		52879367	52879367	-1	no_errors	ENST00000261844	ensembl	human	known	69_37n	missense	98	34.23	51	SNP	1.000	A
FOXG1	2290	genome.wustl.edu	37	14	29237628	29237628	+	Silent	SNP	C	C	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr14:29237628C>T	ENST00000313071.4	+	1	1342	c.1143C>T	c.(1141-1143)gcC>gcT	p.A381A	FOXG1_ENST00000382535.3_Silent_p.A381A	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	381					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		ACCTCACGGCCGCCGCGCTAG	0.697																																						dbGAP											0													42.0	36.0	38.0					14																	29237628		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1143C>T	14.37:g.29237628C>T			A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A381	ENST00000313071.4	37	c.1143	CCDS9636.1	14																																																																																			FOXG1	-	NULL	ENSG00000176165		0.697	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXG1	HGNC	protein_coding	OTTHUMT00000276559.3	15	0.00	0	C			29237628	29237628	+1	no_errors	ENST00000313071	ensembl	human	known	69_37n	silent	11	54.17	13	SNP	1.000	T
GAP43	2596	genome.wustl.edu	37	3	115439676	115439676	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr3:115439676C>T	ENST00000305124.6	+	3	1030	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	GAP43_ENST00000393780.3_Missense_Mutation_p.R258W	NM_002045.3	NP_002036.1	P17677	NEUM_HUMAN	growth associated protein 43	222					axon choice point recognition (GO:0016198)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of filopodium assembly (GO:0051489)|regulation of growth (GO:0040008)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	32				GBM - Glioblastoma multiforme(114;0.164)		GGAAAGTGCCCGGCAGGACGA	0.478																																						dbGAP											0													199.0	204.0	202.0					3																	115439676		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33830.1, CCDS46890.1	3q13.31	2013-09-19			ENSG00000172020	ENSG00000172020			4140	protein-coding gene	gene with protein product	"""neuron growth-associated protein 43"", ""neuromodulin"", ""nerve growth-related peptide GAP43"", ""axonal membrane protein GAP-43"", ""protein F1"", ""calmodulin-binding protein P-57"", ""neural phosphoprotein B-50"""	162060				3272162, 8231732	Standard	NM_002045		Approved	B-50, PP46	uc003ebr.2	P17677	OTTHUMG00000133758	ENST00000305124.6:c.664C>T	3.37:g.115439676C>T	ENSP00000305010:p.Arg222Trp		A8K0Y4	Missense_Mutation	SNP	pfam_Neuromodulin_C,pfam_Neuromodulin_gap-junction_N,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Neuromodulin,pfscan_IQ_motif_EF-hand-BS	p.R222W	ENST00000305124.6	37	c.664	CCDS33830.1	3	.	.	.	.	.	.	.	.	.	.	C	21.8	4.208328	0.79240	.	.	ENSG00000172020	ENST00000305124;ENST00000393780	T;T	0.50548	0.74;0.74	5.7	5.7	0.88788	Neuromodulin (GAP-43), C-terminal (1);	0.562555	0.17144	N	0.185328	T	0.61286	0.2335	L	0.36672	1.1	0.47994	D	0.999565	D;D	0.76494	0.999;0.998	D;P	0.64595	0.927;0.817	T	0.62015	-0.6943	10	0.72032	D	0.01	-0.6087	19.8298	0.96631	0.0:1.0:0.0:0.0	.	258;222	A8K0Y4;P17677	.;NEUM_HUMAN	W	222;258	ENSP00000305010:R222W;ENSP00000377372:R258W	ENSP00000305010:R222W	R	+	1	2	GAP43	116922366	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.677000	0.68142	2.687000	0.91594	0.591000	0.81541	CGG	GAP43	-	pfam_Neuromodulin_C	ENSG00000172020		0.478	GAP43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAP43	HGNC	protein_coding	OTTHUMT00000258216.2	65	0.00	0	C	NM_002045		115439676	115439676	+1	no_errors	ENST00000305124	ensembl	human	known	69_37n	missense	95	40.62	65	SNP	1.000	T
GATA3	2625	genome.wustl.edu	37	10	8111433	8111434	+	Splice_Site	DEL	CA	CA	-	rs111853237		TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr10:8111433_8111434delCA	ENST00000346208.3	+	5	1376		c.e5-1		GATA3_ENST00000379328.3_Splice_Site|GATA3_ENST00000461472.1_Splice_Site			P23771	GATA3_HUMAN	GATA binding protein 3						anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(7)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TCCCCACTCTCAGTCTGCAGCC	0.48			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	7	Unknown(7)	breast(7)																																								-	-	-	SO:0001630	splice_region_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.922-1CA>-	10.37:g.8111433_8111434delCA			Q5VWG7|Q5VWG8|Q96J16	Splice_Site	DEL	-	e4-2	ENST00000346208.3	37	c.925-3_925-2	CCDS7083.1	10																																																																																			GATA3	-	-	ENSG00000107485		0.480	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	43	0	0	CA	NM_001002295	Intron	8111433	8111434	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	splice_site_del	63	36.54	38	DEL	1.000:1.000	-
HCFC2	29915	genome.wustl.edu	37	12	104495851	104495851	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr12:104495851G>C	ENST00000229330.4	+	14	2088	c.1984G>C	c.(1984-1986)Ggt>Cgt	p.G662R	HCFC2_ENST00000550335.1_3'UTR	NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	662	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TTGTGGGATAGGTCCTTTCAG	0.428																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)	dbGAP											0													172.0	160.0	164.0					12																	104495851		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.1984G>C	12.37:g.104495851G>C	ENSP00000229330:p.Gly662Arg		B2R8Q5|C0H5X3	Missense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G662R	ENST00000229330.4	37	c.1984	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	G	26.3	4.727789	0.89390	.	.	ENSG00000111727	ENST00000229330	T	0.60797	0.16	5.01	5.01	0.66863	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.115257	0.64402	D	0.000016	T	0.79021	0.4376	M	0.82517	2.595	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.82592	-0.0381	10	0.87932	D	0	-11.4062	18.669	0.91504	0.0:0.0:1.0:0.0	.	662	Q9Y5Z7	HCFC2_HUMAN	R	662	ENSP00000229330:G662R	ENSP00000229330:G662R	G	+	1	0	HCFC2	103019981	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.375000	0.73137	2.462000	0.83206	0.655000	0.94253	GGT	HCFC2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000111727		0.428	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	79	0.00	0	G	NM_013320		104495851	104495851	+1	no_errors	ENST00000229330	ensembl	human	known	69_37n	missense	123	37.88	75	SNP	1.000	C
KAT2B	8850	genome.wustl.edu	37	3	20167590	20167590	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr3:20167590G>A	ENST00000263754.4	+	10	2062	c.1607G>A	c.(1606-1608)cGg>cAg	p.R536Q		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	536	N-acetyltransferase. {ECO:0000250|UniProtKB:Q92830, ECO:0000255|PROSITE-ProRule:PRU00532}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						TACATCACACGGCTCGTCTTT	0.448																																						dbGAP											0													49.0	48.0	49.0					3																	20167590		2203	4299	6502	-	-	-	SO:0001583	missense	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1607G>A	3.37:g.20167590G>A	ENSP00000263754:p.Arg536Gln		Q6NSK1	Missense_Mutation	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom,prints_Bromodomain	p.R536Q	ENST00000263754.4	37	c.1607	CCDS2634.1	3	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409474	0.62399	.	.	ENSG00000114166	ENST00000263754	T	0.38722	1.12	5.0	5.0	0.66597	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.34106	0.0886	L	0.54323	1.7	0.80722	D	1	P	0.40376	0.715	B	0.20955	0.032	T	0.28106	-1.0054	10	0.27785	T	0.31	-15.3855	18.6651	0.91486	0.0:0.0:1.0:0.0	.	536	Q92831	KAT2B_HUMAN	Q	536	ENSP00000263754:R536Q	ENSP00000263754:R536Q	R	+	2	0	KAT2B	20142594	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.813000	0.99286	2.493000	0.84123	0.655000	0.94253	CGG	KAT2B	-	pirsf_Hist_acetylase_PCAF,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000114166		0.448	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1	22	0.00	0	G	NM_003884		20167590	20167590	+1	no_errors	ENST00000263754	ensembl	human	known	69_37n	missense	43	48.19	40	SNP	1.000	A
KDM4C	23081	genome.wustl.edu	37	9	6805599	6805599	+	Splice_Site	SNP	G	G	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr9:6805599G>C	ENST00000381309.3	+	3	710	c.145G>C	c.(145-147)Gtg>Ctg	p.V49L	KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000543771.1_Splice_Site_p.V49L|KDM4C_ENST00000535193.1_Splice_Site_p.V71L|KDM4C_ENST00000381306.3_Splice_Site_p.V49L|KDM4C_ENST00000442236.2_Intron|KDM4C_ENST00000401787.3_Splice_Site_p.V49L	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	49	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						TTATTTTTAGGTGATTCCTCC	0.348																																						dbGAP											0													48.0	47.0	47.0					9																	6805599		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.145-1G>C	9.37:g.6805599G>C			B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.V49L	ENST00000381309.3	37	c.145	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925645	0.73213	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34	5.72	5.72	0.89469	Transcription factor jumonji, JmjN (3);	0.000000	0.85682	D	0.000000	T	0.57740	0.2074	M	0.91459	3.21	0.80722	D	1	B;B;P;B;B;B	0.44429	0.0;0.023;0.835;0.089;0.001;0.003	B;B;P;B;B;B	0.45343	0.004;0.105;0.477;0.064;0.017;0.017	T	0.66728	-0.5850	9	.	.	.	-10.7364	19.9401	0.97155	0.0:0.0:1.0:0.0	.	49;49;49;71;49;49	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	L	71;49;49;49;49	ENSP00000442382:V71L;ENSP00000445427:V49L;ENSP00000383990:V49L;ENSP00000370710:V49L;ENSP00000370707:V49L	.	V	+	1	0	KDM4C	6795599	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.712000	0.98738	2.712000	0.92718	0.650000	0.86243	GTG	KDM4C	-	pfam_TF_JmjN,smart_TF_JmjN,pfscan_TF_JmjN	ENSG00000107077		0.348	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	11	0.00	0	G	NM_015061	Missense_Mutation	6805599	6805599	+1	no_errors	ENST00000381309	ensembl	human	known	69_37n	missense	20	52.38	22	SNP	1.000	C
LIMS1	3987	genome.wustl.edu	37	2	109300418	109300418	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr2:109300418G>T	ENST00000393310.1	+	10	1108	c.941G>T	c.(940-942)aGa>aTa	p.R314I	LIMS1_ENST00000332345.6_Missense_Mutation_p.R314I|LIMS1_ENST00000544547.1_Missense_Mutation_p.R326I|LIMS1_ENST00000542845.1_Missense_Mutation_p.R376I|LIMS1_ENST00000338045.3_Missense_Mutation_p.R314I|LIMS1_ENST00000410093.1_Missense_Mutation_p.R318I|LIMS1_ENST00000409441.1_Missense_Mutation_p.R351I	NM_001193488.1	NP_001180417.1	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1	314					cell aging (GO:0007569)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chordate embryonic development (GO:0043009)|establishment or maintenance of cell polarity (GO:0007163)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|protein heterooligomerization (GO:0051291)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	10						CTGAAGAAAAGACTTAAGAAA	0.318																																						dbGAP											0													75.0	79.0	78.0					2																	109300418		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS2078.1, CCDS54382.1, CCDS54383.1, CCDS54384.1, CCDS54385.1	2q12.3	2008-05-23			ENSG00000169756	ENSG00000169756			6616	protein-coding gene	gene with protein product		602567				7517666, 10022929	Standard	NM_001193482		Approved	PINCH, PINCH1	uc002tek.4	P48059	OTTHUMG00000130983	ENST00000393310.1:c.941G>T	2.37:g.109300418G>T	ENSP00000376987:p.Arg314Ile		B2RAJ4|B7Z483|B7Z7R3|B7Z907|Q53TE0|Q9BS44	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH,pfscan_Znf_LIM	p.R376I	ENST00000393310.1	37	c.1127	CCDS2078.1	2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071380	0.76301	.	.	ENSG00000169756	ENST00000544547;ENST00000332345;ENST00000393310;ENST00000410093;ENST00000409441;ENST00000338045;ENST00000542845	T;T;T;T;T;T;T	0.36878	1.3;1.31;1.31;1.31;1.28;1.31;1.23	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	T	0.63710	0.2534	M	0.74258	2.255	0.80722	D	1	D;D;D;D	0.71674	0.998;0.99;0.99;0.99	D;D;D;D	0.78314	0.991;0.962;0.944;0.962	T	0.59375	-0.7466	10	0.48119	T	0.1	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	376;351;314;326	B7Z7R3;B7Z907;P48059;B7Z483	.;.;LIMS1_HUMAN;.	I	326;314;314;318;351;314;376	ENSP00000437912:R326I;ENSP00000331775:R314I;ENSP00000376987:R314I;ENSP00000386926:R318I;ENSP00000387264:R351I;ENSP00000337598:R314I;ENSP00000446121:R376I	ENSP00000331775:R314I	R	+	2	0	LIMS1	108666850	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.827000	0.99397	2.941000	0.99782	0.655000	0.94253	AGA	LIMS1	-	pirsf_PINCH	ENSG00000169756		0.318	LIMS1-001	KNOWN	basic|CCDS	protein_coding	LIMS1	HGNC	protein_coding	OTTHUMT00000253596.1	43	0.00	0	G	NM_004987		109300418	109300418	+1	no_errors	ENST00000542845	ensembl	human	known	69_37n	missense	86	21.82	24	SNP	1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56160679	56160680	+	Frame_Shift_Ins	INS	-	-	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr5:56160679_56160680insA	ENST00000399503.3	+	4	953_954	c.953_954insA	c.(952-957)ttactgfs	p.L319fs	AC008937.2_ENST00000415589.1_RNA	NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	319					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.L155*(1)|p.L318*(1)		NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		AGACTGTACTTACTGCAGCAGA	0.51																																						dbGAP											2	Substitution - Nonsense(2)	kidney(2)																																								-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.954dupA	5.37:g.56160680_56160680dupA	ENSP00000382423:p.Leu319fs			Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.L319fs	ENST00000399503.3	37	c.953_954	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.510	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	50	0.00	0	-	XM_042066		56160679	56160680	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_ins	69	63.49	120	INS	0.965:0.937	A
MARS	4141	genome.wustl.edu	37	12	57894289	57894289	+	Missense_Mutation	SNP	A	A	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr12:57894289A>T	ENST00000262027.5	+	10	1411	c.1277A>T	c.(1276-1278)aAt>aTt	p.N426I	MARS_ENST00000315473.5_Missense_Mutation_p.N192I|MARS_ENST00000447721.2_3'UTR	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	426					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	AAGCTCATCAATGCTGTCGAG	0.557																																						dbGAP											0													118.0	97.0	104.0					12																	57894289		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.1277A>T	12.37:g.57894289A>T	ENSP00000262027:p.Asn426Ile		B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	pfam_Methionyl/Leucyl_tRNA_Synth,pfam_WHEP-TRS,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_S15_NS1_RNA-bd,superfamily_Thioredoxin-like_fold,pfscan_WHEP-TRS,prints_Met-tRNA_synth,tigrfam_Met-tRNA_synth	p.N426I	ENST00000262027.5	37	c.1277	CCDS8942.1	12	.	.	.	.	.	.	.	.	.	.	A	23.7	4.446240	0.84101	.	.	ENSG00000166986	ENST00000262027;ENST00000315473	T;T	0.47177	1.35;0.85	5.35	5.35	0.76521	Aminoacyl-tRNA synthetase, class I (M) (1);	0.000000	0.85682	D	0.000000	T	0.73892	0.3645	M	0.91038	3.17	0.80722	D	1	P;D;D	0.54964	0.936;0.969;0.969	P;D;D	0.66847	0.482;0.947;0.947	T	0.80647	-0.1289	10	0.87932	D	0	-16.8099	14.6279	0.68635	1.0:0.0:0.0:0.0	.	192;299;426	A6NC17;B4E0E9;P56192	.;.;SYMC_HUMAN	I	426;192	ENSP00000262027:N426I;ENSP00000314653:N192I	ENSP00000262027:N426I	N	+	2	0	MARS	56180556	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	8.665000	0.91144	2.155000	0.67459	0.460000	0.39030	AAT	MARS	-	pfam_Methionyl/Leucyl_tRNA_Synth,tigrfam_Met-tRNA_synth	ENSG00000166986		0.557	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS	HGNC	protein_coding	OTTHUMT00000407014.1	59	0.00	0	A	NM_004990		57894289	57894289	+1	no_errors	ENST00000262027	ensembl	human	known	69_37n	missense	62	46.55	54	SNP	1.000	T
KMT2C	58508	genome.wustl.edu	37	7	151841851	151841852	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr7:151841851_151841852insCC	ENST00000262189.6	-	55	14507_14508	c.14289_14290insGG	c.(14287-14292)cggaagfs	p.K4764fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.K4821fs|KMT2C_ENST00000485655.2_5'Flank	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4764					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GTTTTCATCTTCCGGTACTGCG	0.46																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14288_14289dupGG	7.37:g.151841852_151841853dupCC	ENSP00000262189:p.Lys4764fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.K4820fs	ENST00000262189.6	37	c.14461_14460	CCDS5931.1	7																																																																																			MLL3	-	NULL	ENSG00000055609		0.460	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	99	0.00	0	-			151841851	151841852	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	frame_shift_ins	192	38.66	121	INS	0.999:1.000	CC
MTUS2	23281	genome.wustl.edu	37	13	29608146	29608146	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr13:29608146G>A	ENST00000431530.3	+	2	2418	c.2360G>A	c.(2359-2361)cGt>cAt	p.R787H		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	777	Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						GCAATGTCCCGTTTACCATCT	0.512																																						dbGAP											0													94.0	94.0	94.0					13																	29608146		2061	4205	6266	-	-	-	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2360G>A	13.37:g.29608146G>A	ENSP00000392057:p.Arg787His		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.R787H	ENST00000431530.3	37	c.2360	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451543	0.84209	.	.	ENSG00000132938	ENST00000431530	T	0.44482	0.92	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000019	T	0.65144	0.2663	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64162	-0.6472	9	.	.	.	.	18.2952	0.90143	0.0:0.0:1.0:0.0	.	777	Q5JR59	MTUS2_HUMAN	H	787	ENSP00000392057:R787H	.	R	+	2	0	MTUS2	28506146	1.000000	0.71417	0.912000	0.35992	0.768000	0.43524	6.981000	0.76166	2.543000	0.85770	0.655000	0.94253	CGT	MTUS2	-	NULL	ENSG00000132938		0.512	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	73	0.00	0	G	XM_166270		29608146	29608146	+1	no_errors	ENST00000431530	ensembl	human	known	69_37n	missense	97	46.41	84	SNP	0.992	A
NCKAP1L	3071	genome.wustl.edu	37	12	54902260	54902260	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr12:54902260C>T	ENST00000293373.6	+	5	530	c.451C>T	c.(451-453)Cgg>Tgg	p.R151W	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.R101W	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	151					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						GATTGAAGATCGGCGGATACT	0.423																																						dbGAP											0													265.0	245.0	252.0					12																	54902260		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.451C>T	12.37:g.54902260C>T	ENSP00000293373:p.Arg151Trp		B4DUT5|Q52LW0	Missense_Mutation	SNP	pfam_Nck-associated_protein-1,superfamily_Nucl_hormone_rcpt_ligand-bd	p.R151W	ENST00000293373.6	37	c.451	CCDS31813.1	12	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182095	0.78677	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.57752	0.38;0.38	6.07	5.17	0.71159	.	0.062618	0.64402	D	0.000010	T	0.68604	0.3019	M	0.68952	2.095	0.46901	D	0.999245	D	0.89917	1.0	D	0.71870	0.975	T	0.72050	-0.4407	10	0.87932	D	0	-5.4134	12.1811	0.54211	0.3105:0.6895:0.0:0.0	.	151	P55160	NCKPL_HUMAN	W	151;101	ENSP00000293373:R151W;ENSP00000445596:R101W	ENSP00000293373:R151W	R	+	1	2	NCKAP1L	53188527	0.684000	0.27642	0.973000	0.42090	0.987000	0.75469	1.613000	0.36900	1.535000	0.49220	0.655000	0.94253	CGG	NCKAP1L	-	pfam_Nck-associated_protein-1	ENSG00000123338		0.423	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1L	HGNC	protein_coding	OTTHUMT00000406195.1	61	0.00	0	C	NM_005337		54902260	54902260	+1	no_errors	ENST00000293373	ensembl	human	known	69_37n	missense	164	18.41	37	SNP	0.997	T
NEUROD2	4761	genome.wustl.edu	37	17	37761947	37761948	+	Frame_Shift_Ins	INS	-	-	G			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr17:37761947_37761948insG	ENST00000302584.4	-	2	1125_1126	c.905_906insC	c.(904-906)ccgfs	p.P302fs		NM_006160.3	NP_006151.3	Q15784	NDF2_HUMAN	neuronal differentiation 2	302					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|cellular response to calcium ion (GO:0071277)|cellular response to electrical stimulus (GO:0071257)|cerebellar cortex development (GO:0021695)|negative regulation of synapse maturation (GO:2000297)|nervous system development (GO:0007399)|neuron development (GO:0048666)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	8	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Lung(15;0.00549)|LUAD - Lung adenocarcinoma(14;0.0664)			TGAGACAGAGCGGGGGGCTGAG	0.653																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U58681	CCDS11338.1	17q12	2013-05-21	2012-02-22		ENSG00000171532	ENSG00000171532		"""Basic helix-loop-helix proteins"""	7763	protein-coding gene	gene with protein product		601725	"""neurogenic differentiation 2"""			9119405	Standard	XM_005257409		Approved	NDRF, bHLHa1	uc002hry.3	Q15784	OTTHUMG00000133211	ENST00000302584.4:c.906dupC	17.37:g.37761953_37761953dupG	ENSP00000306754:p.Pro302fs		Q8TBI7|Q9UQC6	Frame_Shift_Ins	INS	pfam_Neurogenic_DUF,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pirsf_TF_bHLH_NeuroD,pfscan_HLH_DNA-bd	p.L303fs	ENST00000302584.4	37	c.906_905	CCDS11338.1	17																																																																																			NEUROD2	-	pfam_Neurogenic_DUF,pirsf_TF_bHLH_NeuroD	ENSG00000171532		0.653	NEUROD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD2	HGNC	protein_coding	OTTHUMT00000256931.2	27	0.00	0	-	NM_006160		37761947	37761948	-1	no_errors	ENST00000302584	ensembl	human	known	69_37n	frame_shift_ins	27	30.77	12	INS	1.000:1.000	G
NFE2L2	4780	genome.wustl.edu	37	2	178098009	178098009	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr2:178098009G>C	ENST00000397062.3	-	3	925	c.371C>G	c.(370-372)gCg>gGg	p.A124G	NFE2L2_ENST00000423513.1_Missense_Mutation_p.A108G|NFE2L2_ENST00000446151.2_Missense_Mutation_p.A108G|NFE2L2_ENST00000464747.1_Missense_Mutation_p.A108G|NFE2L2_ENST00000397063.4_Missense_Mutation_p.A108G	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	124					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A124V(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAATGTCTGCGCCAAAAGCTG	0.358			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																												dbGAP		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	1	Substitution - Missense(1)	large_intestine(1)											108.0	97.0	100.0					2																	178098009		1856	4122	5978	-	-	-	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.371C>G	2.37:g.178098009G>C	ENSP00000380252:p.Ala124Gly		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,superfamily_Sepin_dom,smart_bZIP,pfscan_bZIP	p.A124G	ENST00000397062.3	37	c.371	CCDS42782.1	2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412633	0.83340	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51	5.65	4.75	0.60458	.	0.148276	0.64402	D	0.000011	T	0.34077	0.0885	M	0.72479	2.2	0.49130	D	0.999754	B;B;B	0.20988	0.041;0.05;0.041	B;B;B	0.23852	0.02;0.049;0.02	T	0.12116	-1.0560	10	0.41790	T	0.15	.	11.4261	0.50012	0.0:0.1363:0.7221:0.1416	.	108;108;124	E9PGJ7;C9JFL6;Q16236	.;.;NF2L2_HUMAN	G	108;124;108;108;108;108	ENSP00000380253:A108G;ENSP00000380252:A124G;ENSP00000411575:A108G;ENSP00000400073:A108G;ENSP00000412191:A108G;ENSP00000410015:A108G	ENSP00000380252:A124G	A	-	2	0	NFE2L2	177806255	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.021000	0.70832	1.338000	0.45544	0.491000	0.48974	GCG	NFE2L2	-	NULL	ENSG00000116044		0.358	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	92	0.00	0	G	NM_006164		178098009	178098009	-1	no_errors	ENST00000397062	ensembl	human	known	69_37n	missense	72	42.52	54	SNP	1.000	C
NHSL1	57224	genome.wustl.edu	37	6	138752045	138752045	+	Frame_Shift_Del	DEL	C	C	-			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr6:138752045delC	ENST00000427025.2	-	5	4077	c.3449delG	c.(3448-3450)agtfs	p.S1150fs	NHSL1_ENST00000343505.5_Frame_Shift_Del_p.S1146fs	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	1150										breast(2)|endometrium(4)|kidney(1)	7						GTCACCCTGACTCGAGCTCTT	0.622																																						dbGAP											0													13.0	13.0	13.0					6																	138752045		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.3449delG	6.37:g.138752045delC	ENSP00000394546:p.Ser1150fs		Q3ZCS5|Q5SYE8|Q9P2J0	Frame_Shift_Del	DEL	NULL	p.S1150fs	ENST00000427025.2	37	c.3449	CCDS55063.1	6																																																																																			NHSL1	-	NULL	ENSG00000135540		0.622	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	HGNC	protein_coding	OTTHUMT00000043700.2	23	0.00	0	C	XM_050421		138752045	138752045	-1	no_errors	ENST00000427025	ensembl	human	known	69_37n	frame_shift_del	27	38.64	17	DEL	0.029	-
P4HTM	54681	genome.wustl.edu	37	3	49044240	49044240	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr3:49044240T>C	ENST00000383729.4	+	9	1780	c.1409T>C	c.(1408-1410)tTc>tCc	p.F470S	WDR6_ENST00000448293.1_5'Flank|WDR6_ENST00000395474.3_5'Flank|WDR6_ENST00000608424.1_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.F531S|WDR6_ENST00000415265.2_5'Flank	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	470						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	CAAGCGCTGTTCCAACAGGAG	0.662																																						dbGAP											0													40.0	42.0	42.0					3																	49044240		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.1409T>C	3.37:g.49044240T>C	ENSP00000373235:p.Phe470Ser		Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.F531S	ENST00000383729.4	37	c.1592	CCDS43089.1	3	.	.	.	.	.	.	.	.	.	.	T	26.3	4.721119	0.89205	.	.	ENSG00000178467	ENST00000383729;ENST00000343546	T	0.78246	-1.16	5.51	2.97	0.34412	.	0.170938	0.53938	D	0.000047	T	0.73705	0.3621	N	0.24115	0.695	0.33325	D	0.567887	P;D	0.64830	0.937;0.994	P;P	0.56278	0.739;0.795	T	0.77819	-0.2446	10	0.49607	T	0.09	-14.8091	9.8017	0.40768	0.2749:0.0:0.0:0.7251	.	531;470	Q9NXG6-3;Q9NXG6	.;P4HTM_HUMAN	S	470;531	ENSP00000373235:F470S	ENSP00000341422:F531S	F	+	2	0	P4HTM	49019244	1.000000	0.71417	0.987000	0.45799	0.964000	0.63967	1.740000	0.38228	0.315000	0.23110	0.533000	0.62120	TTC	P4HTM	-	NULL	ENSG00000178467		0.662	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HTM	HGNC	protein_coding	OTTHUMT00000157211.1	8	0.00	0	T	NM_177938		49044240	49044240	+1	no_errors	ENST00000343546	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	1.000	C
PCDH19	57526	genome.wustl.edu	37	X	99662740	99662740	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chrX:99662740G>A	ENST00000373034.4	-	1	2531	c.856C>T	c.(856-858)Cgc>Tgc	p.R286C	PCDH19_ENST00000420881.2_Missense_Mutation_p.R286C|PCDH19_ENST00000255531.7_Missense_Mutation_p.R286C	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	286	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						AAGAGCTCGCGCGTGCGGTCG	0.602																																						dbGAP											0													102.0	107.0	106.0					X																	99662740		2164	4245	6409	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.856C>T	X.37:g.99662740G>A	ENSP00000362125:p.Arg286Cys		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R286C	ENST00000373034.4	37	c.856	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931469	0.34096	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.52983	0.64;0.64;0.64	5.95	4.14	0.48551	Cadherin (4);Cadherin-like (1);	0.047828	0.85682	D	0.000000	T	0.73860	0.3641	M	0.92459	3.31	0.40468	D	0.98031	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.68483	0.958;0.921;0.953	T	0.80144	-0.1505	10	0.72032	D	0.01	.	13.6617	0.62372	0.0:0.0:0.4694:0.5305	.	286;286;286	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	C	286	ENSP00000400327:R286C;ENSP00000362125:R286C;ENSP00000255531:R286C	ENSP00000255531:R286C	R	-	1	0	PCDH19	99549396	0.984000	0.35163	0.027000	0.17364	0.789000	0.44602	2.155000	0.42301	0.599000	0.29845	0.513000	0.50165	CGC	PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165194		0.602	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	77	0.00	0	G	NM_020766		99662740	99662740	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	60	49.58	59	SNP	0.115	A
PLD3	23646	genome.wustl.edu	37	19	40883954	40883954	+	Silent	SNP	G	G	A	rs558997903		TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr19:40883954G>A	ENST00000409587.1	+	13	1744	c.1347G>A	c.(1345-1347)acG>acA	p.T449T	PLD3_ENST00000409735.4_Silent_p.T449T|PLD3_ENST00000356508.5_Silent_p.T449T|PLD3_ENST00000409281.1_Silent_p.T449T|PLD3_ENST00000409419.1_Silent_p.T449T			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	449					cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			TGCTGGTGACGCAGAATGGGA	0.627																																						dbGAP											0													67.0	68.0	68.0					19																	40883954		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.1347G>A	19.37:g.40883954G>A			Q92853|Q9BW87	Silent	SNP	pfam_PLipase_D/transphosphatidylase,smart_PLipase_D/transphosphatidylase,pfscan_PLipase_D/transphosphatidylase	p.T449	ENST00000409587.1	37	c.1347	CCDS33027.1	19																																																																																			PLD3	-	NULL	ENSG00000105223		0.627	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLD3	HGNC	protein_coding	OTTHUMT00000327721.1	15	0.00	0	G	NM_012268		40883954	40883954	+1	no_errors	ENST00000356508	ensembl	human	known	69_37n	silent	14	53.33	16	SNP	0.495	A
PLEKHM1P	440456	genome.wustl.edu	37	17	62796759	62796759	+	RNA	SNP	A	A	C	rs2074182	byFrequency	TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr17:62796759A>C	ENST00000582986.1	-	0	1161					NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										CTCCCGCACCAGGTCCAGCCA	0.672													C|||	1360	0.271565	0.6664	0.1239	5008	,	,		15686	0.128		0.1928	False		,,,				2504	0.0716					dbGAP											0																																										-	-	-			0					17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62796759A>C				RNA	SNP	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			PLEKHM1P	-	-	ENSG00000214176		0.672	PLEKHM1P-002	KNOWN	basic	processed_transcript	PLEKHM1P	HGNC	pseudogene	OTTHUMT00000445598.1	10	0.00	0	A	NR_024386		62796759	62796759	-1	no_errors	ENST00000578036	ensembl	human	known	69_37n	rna	15	40.00	10	SNP	1.000	C
PSMA3	5684	genome.wustl.edu	37	14	58737668	58737668	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr14:58737668T>A	ENST00000216455.4	+	10	765	c.675T>A	c.(673-675)caT>caA	p.H225Q	RP11-349A22.5_ENST00000556002.1_RNA|RP11-349A22.5_ENST00000554360.1_RNA|RP11-349A22.5_ENST00000556400.1_RNA|RP11-349A22.5_ENST00000555162.1_RNA|RP11-349A22.5_ENST00000555707.1_RNA|PSMA3_ENST00000557508.1_Missense_Mutation_p.H150Q|CTD-2002H8.2_ENST00000557322.1_RNA|RP11-349A22.5_ENST00000556225.1_RNA|RP11-349A22.5_ENST00000554378.1_RNA|RP11-349A22.5_ENST00000555275.1_RNA|PSMA3_ENST00000412908.2_Missense_Mutation_p.H218Q|RP11-349A22.5_ENST00000557660.1_RNA	NM_002788.3|NM_152132.2	NP_002779.1|NP_687033.1	P25788	PSA3_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 3	225					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(2)	12						ATGGAAGACATGAAATTGTTC	0.358																																						dbGAP											0													57.0	57.0	57.0					14																	58737668		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9731.1, CCDS45113.1	14q23	2008-08-29			ENSG00000100567	ENSG00000100567		"""Proteasome (prosome, macropain) subunits"""	9532	protein-coding gene	gene with protein product		176843				2025653, 8811196	Standard	NM_002788		Approved	HC8	uc001xdj.2	P25788	OTTHUMG00000140319	ENST00000216455.4:c.675T>A	14.37:g.58737668T>A	ENSP00000216455:p.His225Gln		B2RCK6|Q86U83|Q8N1D8|Q9BS70	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.H225Q	ENST00000216455.4	37	c.675	CCDS9731.1	14	.	.	.	.	.	.	.	.	.	.	T	22.4	4.278801	0.80692	.	.	ENSG00000100567	ENST00000216455;ENST00000412908;ENST00000557508;ENST00000553677	T;T	0.46451	0.88;0.87	5.13	5.13	0.70059	.	0.085172	0.85682	D	0.000000	T	0.72946	0.3524	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	T	0.81095	-0.1088	10	0.87932	D	0	-1.6262	15.0541	0.71897	0.0:0.0:0.0:1.0	.	218;225	P25788-2;P25788	.;PSA3_HUMAN	Q	225;218;150;53	ENSP00000216455:H225Q;ENSP00000390491:H218Q	ENSP00000216455:H225Q	H	+	3	2	PSMA3	57807421	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.375000	0.44283	2.274000	0.75844	0.477000	0.44152	CAT	PSMA3	-	NULL	ENSG00000100567		0.358	PSMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA3	HGNC	protein_coding	OTTHUMT00000276923.1	15	0.00	0	T	NM_002788		58737668	58737668	+1	no_errors	ENST00000216455	ensembl	human	known	69_37n	missense	49	34.67	26	SNP	1.000	A
RGPD4	285190	genome.wustl.edu	37	2	108479165	108479165	+	Missense_Mutation	SNP	G	G	C	rs200602090	byFrequency	TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr2:108479165G>C	ENST00000408999.3	+	16	2310	c.2233G>C	c.(2233-2235)Gag>Cag	p.E745Q	RGPD4_ENST00000354986.4_Missense_Mutation_p.E745Q	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	745					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						GTCTGTAAAAGAGATGCTTAA	0.338													-|||	794	0.158546	0.1127	0.1715	5008	,	,		10608	0.0179		0.2793	False		,,,				2504	0.2321					dbGAP											0													5.0	11.0	9.0					2																	108479165		394	1012	1406	-	-	-	SO:0001583	missense	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2233G>C	2.37:g.108479165G>C	ENSP00000386810:p.Glu745Gln		B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E745Q	ENST00000408999.3	37	c.2233	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	6.720	0.501551	0.12822	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.24908	1.83;1.83	2.3	2.3	0.28687	.	.	.	.	.	T	0.22205	0.0535	M	0.62723	1.935	0.39301	P	0.03509899999999999	P	0.39022	0.655	B	0.27380	0.079	T	0.41052	-0.9530	8	0.49607	T	0.09	-11.6791	11.5619	0.50782	0.0:0.0:1.0:0.0	.	745	Q7Z3J3	RGPD4_HUMAN	Q	745;745;503	ENSP00000347081:E745Q;ENSP00000386810:E745Q	ENSP00000347081:E745Q	E	+	1	0	RGPD4	107845597	1.000000	0.71417	0.999000	0.59377	0.379000	0.30106	6.909000	0.75735	1.299000	0.44798	0.152000	0.16155	GAG	RGPD4	-	NULL	ENSG00000196862		0.338	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	9	0.00	0	G	XM_496581		108479165	108479165	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	missense	3	70.00	7	SNP	1.000	C
SAP18	10284	genome.wustl.edu	37	13	21714920	21714920	+	Intron	SNP	G	G	A	rs2281914	byFrequency	TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr13:21714920G>A	ENST00000607003.1	+	1	104				SAP18_ENST00000382533.4_Intron|SAP18_ENST00000485646.1_Intron|RN7SL80P_ENST00000580631.1_RNA|SNORD27_ENST00000516319.1_RNA			O00422	SAP18_HUMAN	Sin3A-associated protein, 18kDa						mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|lung(4)	6		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.79e-05)|Epithelial(112;0.000292)|OV - Ovarian serous cystadenocarcinoma(117;0.00276)|Lung(94;0.0941)		GGTGTTTTTGGTCTCGGGGAG	0.627													G|||	2301	0.459465	0.2239	0.5965	5008	,	,		13272	0.7163		0.4523	False		,,,				2504	0.4233					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U96915	CCDS9295.2	13q12.11	2008-02-05	2006-02-02		ENSG00000150459	ENSG00000150459			10530	protein-coding gene	gene with protein product		602949	"""sin3A-associated protein, 18kDa"""			9150135	Standard	NM_005870		Approved	SAP18p, 2HOR0202, MGC27131	uc001uns.3	O00422	OTTHUMG00000016535	ENST00000607003.1:c.72+100G>A	13.37:g.21714920G>A			B2R494|Q2TTR4|Q6IAW9|Q8N606|Q9UF14	Missense_Mutation	SNP	pfam_SAP18	p.G3D	ENST00000607003.1	37	c.8		13	1050	0.4807692307692308	116	0.23577235772357724	193	0.5331491712707183	393	0.6870629370629371	348	0.45910290237467016	G	9.596	1.127402	0.20959	.	.	ENSG00000150459	ENST00000450573	.	.	.	4.1	-8.2	0.01045	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.54753	P	1.7000000000044757E-5	.	.	.	.	.	.	T	0.30736	-0.9968	3	.	.	.	.	1.2899	0.02058	0.2639:0.1361:0.3813:0.2187	rs2281914;rs56805507;rs2281914	.	.	.	D	3	.	.	G	+	2	0	SAP18	20612920	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.590000	0.05760	-2.825000	0.00342	-0.221000	0.12465	GGT	SAP18	-	NULL	ENSG00000150459		0.627	SAP18-009	PUTATIVE	basic|appris_candidate	protein_coding	SAP18	HGNC	protein_coding	OTTHUMT00000470725.1	8	0.00	0	G	NM_005870		21714920	21714920	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000450573	ensembl	human	putative	69_37n	missense	11	35.29	6	SNP	0.000	A
SEC23IP	11196	genome.wustl.edu	37	10	121674317	121674317	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr10:121674317G>A	ENST00000369075.3	+	7	1460	c.1388G>A	c.(1387-1389)aGc>aAc	p.S463N	SEC23IP_ENST00000543134.1_Missense_Mutation_p.S252N	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	463					acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		CGCTTTAGGAGCATTATTGAG	0.383																																						dbGAP											0													431.0	386.0	401.0					10																	121674317		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.1388G>A	10.37:g.121674317G>A	ENSP00000358071:p.Ser463Asn		D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	pfam_DDHD,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_DDHD	p.S463N	ENST00000369075.3	37	c.1388	CCDS7618.1	10	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816890	0.70912	.	.	ENSG00000107651	ENST00000369075;ENST00000543134;ENST00000446561	T;T;T	0.59638	0.25;0.25;1.1	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.74504	0.3725	M	0.62016	1.91	0.80722	D	1	D;P	0.89917	1.0;0.855	D;B	0.74348	0.983;0.348	T	0.73248	-0.4043	10	0.46703	T	0.11	-15.4778	19.6512	0.95812	0.0:0.0:1.0:0.0	.	252;463	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	N	463;252;167	ENSP00000358071:S463N;ENSP00000438773:S252N;ENSP00000396906:S167N	ENSP00000358071:S463N	S	+	2	0	SEC23IP	121664307	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	6.057000	0.71119	2.712000	0.92718	0.591000	0.81541	AGC	SEC23IP	-	NULL	ENSG00000107651		0.383	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23IP	HGNC	protein_coding	OTTHUMT00000050688.1	237	0.00	0	G			121674317	121674317	+1	no_errors	ENST00000369075	ensembl	human	known	69_37n	missense	368	36.90	217	SNP	1.000	A
SLC26A6	65010	genome.wustl.edu	37	3	48668568	48668568	+	Missense_Mutation	SNP	A	A	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr3:48668568A>C	ENST00000395550.2	-	9	1039	c.992T>G	c.(991-993)gTg>gGg	p.V331G	SLC26A6_ENST00000337000.8_Missense_Mutation_p.V224G|SLC26A6_ENST00000383733.3_Missense_Mutation_p.V331G|SLC26A6_ENST00000482282.1_5'Flank|SLC26A6_ENST00000420764.2_Missense_Mutation_p.V331G|SLC26A6_ENST00000358747.6_Missense_Mutation_p.V310G|SLC26A6_ENST00000455886.2_Missense_Mutation_p.V295G			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	331					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		CACTGGGGGCACCAGCCTGTG	0.617																																					NSCLC(13;369 479 28271 30152 44026)	dbGAP											0													58.0	67.0	64.0					3																	48668568		2069	4194	6263	-	-	-	SO:0001583	missense	0			AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.992T>G	3.37:g.48668568A>C	ENSP00000378920:p.Val331Gly		B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.V331G	ENST00000395550.2	37	c.992	CCDS43087.1	3	.	.	.	.	.	.	.	.	.	.	A	8.624	0.892079	0.17613	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886;ENST00000421649	D;D;D;D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12	5.57	4.37	0.52481	Sulphate transporter (1);	.	.	.	.	D	0.91112	0.7202	L	0.43152	1.355	0.09310	N	0.999996	P;B;P;B;P;P;B	0.49961	0.89;0.43;0.93;0.005;0.607;0.607;0.351	P;B;P;B;B;B;B	0.52710	0.707;0.334;0.467;0.008;0.21;0.21;0.16	T	0.82796	-0.0280	9	0.23891	T	0.37	.	10.9034	0.47065	0.7572:0.0:0.0:0.2428	.	295;344;224;331;331;331;3736	B4DMZ1;Q86YZ4;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;.;S26A6_HUMAN;.	G	331;331;331;224;344;310;295;139	ENSP00000404684:V331G;ENSP00000378920:V331G;ENSP00000373239:V331G;ENSP00000337648:V224G;ENSP00000351597:V310G;ENSP00000401066:V295G;ENSP00000389922:V139G	ENSP00000337648:V224G	V	-	2	0	SLC26A6	48643572	0.001000	0.12720	0.374000	0.26016	0.175000	0.22909	1.124000	0.31320	2.119000	0.64992	0.533000	0.62120	GTG	SLC26A6	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000225697		0.617	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC26A6	HGNC	protein_coding	OTTHUMT00000345040.1	36	0.00	0	A	NM_022911		48668568	48668568	-1	no_errors	ENST00000395550	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	0.007	C
TAB3	257397	genome.wustl.edu	37	X	30872398	30872398	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chrX:30872398C>T	ENST00000378933.1	-	3	1561	c.1384G>A	c.(1384-1386)Gca>Aca	p.A462T	TAB3_ENST00000378928.1_5'Flank|TAB3-AS2_ENST00000445240.1_RNA|TAB3_ENST00000378932.2_Missense_Mutation_p.A462T|TAB3_ENST00000378930.3_Missense_Mutation_p.A462T|TAB3_ENST00000288422.2_Missense_Mutation_p.A462T	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	462					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						TCAGTCGTTGCTCGGCCTACG	0.448																																					Pancreas(164;1598 1985 29022 43301 49529)	dbGAP											0													102.0	98.0	100.0					X																	30872398		2202	4300	6502	-	-	-	SO:0001583	missense	0			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.1384G>A	X.37:g.30872398C>T	ENSP00000368215:p.Ala462Thr		A6NDD9|Q6VQR0	Missense_Mutation	SNP	pfam_CUE,pfam_Znf_RanBP2,superfamily_UBA-like,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.A462T	ENST00000378933.1	37	c.1384	CCDS14226.1	X	.	.	.	.	.	.	.	.	.	.	C	14.83	2.651354	0.47362	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.79	4.84	3.04	0.35103	.	0.160904	0.53938	N	0.000044	T	0.57621	0.2066	N	0.22421	0.69	0.43421	D	0.99557	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.43605	-0.9381	10	0.21540	T	0.41	-0.0209	10.9055	0.47078	0.0:0.8404:0.0:0.1596	.	462;462	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	T	462	ENSP00000368215:A462T;ENSP00000368212:A462T;ENSP00000288422:A462T;ENSP00000368214:A462T	ENSP00000288422:A462T	A	-	1	0	TAB3	30782319	1.000000	0.71417	0.997000	0.53966	0.945000	0.59286	2.498000	0.45363	0.387000	0.25024	0.462000	0.41574	GCA	TAB3	-	NULL	ENSG00000157625		0.448	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB3	HGNC	protein_coding	OTTHUMT00000056173.1	75	0.00	0	C	NM_152787		30872398	30872398	-1	no_errors	ENST00000288422	ensembl	human	known	69_37n	missense	107	26.21	38	SNP	1.000	T
TBX3	6926	genome.wustl.edu	37	12	115118782	115118782	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr12:115118782G>A	ENST00000257566.3	-	2	948	c.559C>T	c.(559-561)Cac>Tac	p.H187Y	TBX3_ENST00000349155.2_Missense_Mutation_p.H187Y	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	187					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H187Y(1)		breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CTGTCCGGGTGAATGTACATC	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	105.0	106.0					12																	115118782		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.559C>T	12.37:g.115118782G>A	ENSP00000257566:p.His187Tyr		Q8TB20|Q9UKF8	Missense_Mutation	SNP	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.H187Y	ENST00000257566.3	37	c.559	CCDS9176.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.272843	0.95429	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.93426	-3.22;-3.22	5.81	5.81	0.92471	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97813	0.9282	H	0.94925	3.6	0.80722	D	1	D;D;D	0.89917	0.98;1.0;0.999	D;D;D	0.97110	0.969;1.0;0.995	D	0.98288	1.0512	10	0.66056	D	0.02	.	19.0715	0.93140	0.0:0.0:1.0:0.0	.	187;187;187	B4E3A6;O15119-2;O15119	.;.;TBX3_HUMAN	Y	187	ENSP00000257567:H187Y;ENSP00000257566:H187Y	ENSP00000257566:H187Y	H	-	1	0	TBX3	113603165	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.476000	0.97823	2.756000	0.94617	0.655000	0.94253	CAC	TBX3	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box	ENSG00000135111		0.473	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	37	0.00	0	G	NM_016569, NM_005996		115118782	115118782	-1	no_errors	ENST00000257566	ensembl	human	known	69_37n	missense	61	37.76	37	SNP	1.000	A
TRIM49C	642612	genome.wustl.edu	37	11	89774252	89774252	+	Missense_Mutation	SNP	G	G	A	rs201409537		TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr11:89774252G>A	ENST00000448984.1	+	8	1222	c.893G>A	c.(892-894)aGt>aAt	p.S298N	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	298	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S298N(4)		endometrium(3)|kidney(1)|lung(4)	8						GAAGCCAACAGTGATATCTTT	0.323																																						dbGAP											4	Substitution - Missense(4)	endometrium(2)|kidney(2)																																								-	-	-	SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.893G>A	11.37:g.89774252G>A	ENSP00000388299:p.Ser298Asn		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S298N	ENST00000448984.1	37	c.893	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	g	0.625	-0.819420	0.02776	.	.	ENSG00000204449	ENST00000448984	T	0.04809	3.55	0.823	-0.634	0.11516	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.04452	0.0122	L	0.52206	1.635	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.43605	-0.9381	8	.	.	.	.	3.2016	0.06651	0.4432:0.0:0.5568:0.0	rs672762;rs9666958;rs16912727;rs672762	298	P0CI26	T49L2_HUMAN	N	298	ENSP00000388299:S298N	.	S	+	2	0	TRIM49L2	89413900	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	-1.058000	0.03482	-0.239000	0.09710	0.305000	0.20034	AGT	TRIM49C	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000204449		0.323	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	13	0.00	0	G	NM_001195234		89774252	89774252	+1	no_errors	ENST00000448984	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.001	A
UGT1A6	54578	genome.wustl.edu	37	2	234680995	234680995	+	Silent	SNP	T	T	C			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr2:234680995T>C	ENST00000305139.6	+	5	1528	c.1389T>C	c.(1387-1389)ttT>ttC	p.F463F	UGT1A3_ENST00000482026.1_Silent_p.F465F|UGT1A1_ENST00000608383.1_Silent_p.F464F|UGT1A4_ENST00000373409.3_Silent_p.F465F|UGT1A1_ENST00000608381.1_Silent_p.F465F|UGT1A1_ENST00000373450.4_Silent_p.F461F|UGT1A8_ENST00000305208.5_Silent_p.F464F|UGT1A1_ENST00000609637.1_Silent_p.F461F|UGT1A5_ENST00000373414.3_Silent_p.F465F|UGT1A6_ENST00000373424.1_Silent_p.F196F|UGT1A10_ENST00000344644.5_Silent_p.F461F|UGT1A9_ENST00000354728.4_Silent_p.F461F|UGT1A7_ENST00000373426.3_Silent_p.F461F|UGT1A1_ENST00000609767.1_Silent_p.F465F	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	463					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	GGGTGGAGTTTGTGATGAGGC	0.597																																						dbGAP											0													99.0	89.0	92.0					2																	234680995		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.1389T>C	2.37:g.234680995T>C			A6NKK6|B8K289|Q96TE7	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.F465	ENST00000305139.6	37	c.1395	CCDS2507.1	2																																																																																			UGT1A4	-	pfam_UDP_glucos_trans	ENSG00000244474		0.597	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A4	HGNC	protein_coding	OTTHUMT00000130988.1	25	0.00	0	T	NM_205862		234680995	234680995	+1	no_errors	ENST00000373409	ensembl	human	known	69_37n	silent	47	49.47	47	SNP	0.994	C
USP24	23358	genome.wustl.edu	37	1	55589159	55589159	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr1:55589159G>A	ENST00000294383.6	-	36	4236	c.4237C>T	c.(4237-4239)Ctt>Ttt	p.L1413F	USP24_ENST00000407756.1_Missense_Mutation_p.L1253F	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1413					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						GTAACAAGAAGAGACAAAGCC	0.502																																						dbGAP											0													62.0	61.0	61.0					1																	55589159		1932	4130	6062	-	-	-	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.4237C>T	1.37:g.55589159G>A	ENSP00000294383:p.Leu1413Phe		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19	p.L1413F	ENST00000294383.6	37	c.4237	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537048	0.85812	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.67865	-0.29;-0.29	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.69620	0.3131	L	0.43152	1.355	0.54753	D	0.999983	P	0.47841	0.901	P	0.50136	0.632	T	0.71421	-0.4598	10	0.49607	T	0.09	.	18.4963	0.90866	0.0:0.0:1.0:0.0	.	1253	B7WPF4	.	F	1413;1253	ENSP00000294383:L1413F;ENSP00000385700:L1253F	ENSP00000294383:L1413F	L	-	1	0	USP24	55361747	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.365000	0.66116	2.347000	0.79759	0.563000	0.77884	CTT	USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.502	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	35	0.00	0	G			55589159	55589159	-1	no_errors	ENST00000294383	ensembl	human	known	69_37n	missense	66	36.79	39	SNP	1.000	A
VSIG8	391123	genome.wustl.edu	37	1	159828685	159828685	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1X6-01A-11D-A14K-09	TCGA-D8-A1X6-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1951aa38-481b-464c-9a78-0819312a0a93	4a4bd36e-5543-429f-aabe-a9811e0df7ae	g.chr1:159828685G>A	ENST00000368100.1	-	2	202	c.67C>T	c.(67-69)Cgg>Tgg	p.R23W	RP11-190A12.7_ENST00000544342.1_Missense_Mutation_p.A30V	NM_001013661.1	NP_001013683.1	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	23	Ig-like V-type 1.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	8	all_hematologic(112;0.0597)					CCGTTGATCCGCACAGCAGAC	0.587																																						dbGAP											0													79.0	66.0	70.0					1																	159828685		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30913.1	1q23.2	2013-01-11			ENSG00000243284	ENSG00000243284		"""Immunoglobulin superfamily / V-set domain containing"""	32063	protein-coding gene	gene with protein product							Standard	NM_001013661		Approved		uc001fuh.3	Q5VU13	OTTHUMG00000168834	ENST00000368100.1:c.67C>T	1.37:g.159828685G>A	ENSP00000357080:p.Arg23Trp		Q5VU14	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like	p.R23W	ENST00000368100.1	37	c.67	CCDS30913.1	1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812229	0.70797	.	.	ENSG00000243284	ENST00000368100	T	0.49720	0.77	5.43	3.46	0.39613	Immunoglobulin-like (1);	0.385617	0.28940	N	0.013658	T	0.37237	0.0996	N	0.22421	0.69	0.35820	D	0.824522	D	0.89917	1.0	D	0.91635	0.999	T	0.28618	-1.0038	9	.	.	.	.	10.6906	0.45869	0.0:0.0:0.6399:0.3601	.	23	Q5VU13	VSIG8_HUMAN	W	23	ENSP00000357080:R23W	.	R	-	1	2	VSIG8	158095309	0.989000	0.36119	0.999000	0.59377	0.997000	0.91878	0.698000	0.25571	0.585000	0.29608	0.655000	0.94253	CGG	VSIG8	-	pfscan_Ig-like	ENSG00000243284		0.587	VSIG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSIG8	HGNC	protein_coding	OTTHUMT00000085978.8	18	0.00	0	G	NM_001013661		159828685	159828685	-1	no_errors	ENST00000368100	ensembl	human	known	69_37n	missense	34	40.35	23	SNP	1.000	A
