#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS7	11173	genome.wustl.edu	37	15	79068549	79068549	+	Silent	SNP	G	G	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr15:79068549G>T	ENST00000388820.4	-	11	1897	c.1687C>A	c.(1687-1689)Cgg>Agg	p.R563R	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	563	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GTGCACTGCCGCTCGGCGCTC	0.677																																						dbGAP											0													30.0	35.0	33.0					15																	79068549		2192	4290	6482	-	-	-	SO:0001819	synonymous_variant	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1687C>A	15.37:g.79068549G>T			Q14F51|Q6P7J9	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R563	ENST00000388820.4	37	c.1687	CCDS32303.1	15																																																																																			ADAMTS7	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS	ENSG00000136378		0.677	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	39	0.00	0	G	NM_014272		79068549	79068549	-1	no_errors	ENST00000388820	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	1.000	T
APOBEC3C	27350	genome.wustl.edu	37	22	39413893	39413893	+	Missense_Mutation	SNP	C	C	G	rs143646385	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr22:39413893C>G	ENST00000361441.4	+	3	577	c.297C>G	c.(295-297)gaC>gaG	p.D99E	APOBEC3D_ENST00000381568.4_Intron	NM_014508.2	NP_055323.2	Q9NRW3	ABC3C_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C	99	CMP/dCMP deaminase zinc-binding.				cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6	Melanoma(58;0.04)					CTTGCCCAGACTGTGCAGGGG	0.547													g|||	3	0.000599042	0.0	0.0	5008	,	,		18598	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													137.0	135.0	136.0					22																	39413893		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF165520	CCDS13983.1	22q13.1-q13.2	2014-01-28			ENSG00000244509	ENSG00000244509		"""Apolipoprotein B mRNA editing enzymes"""	17353	protein-coding gene	gene with protein product		607750				11863358	Standard	NM_014508		Approved	APOBEC1L, PBI, bK150C2.3, ARDC2, ARDC4, ARP5	uc003awr.3	Q9NRW3	OTTHUMG00000151087	ENST00000361441.4:c.297C>G	22.37:g.39413893C>G	ENSP00000355340:p.Asp99Glu		B2R884|Q5JZ92|Q7Z2N7|Q96F12	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.D99E	ENST00000361441.4	37	c.297	CCDS13983.1	22	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	.	0.248	-1.008832	0.02112	.	.	ENSG00000244509	ENST00000361441	T	0.64618	-0.11	2.01	-4.03	0.04021	APOBEC-like, N-terminal (1);APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);	.	.	.	.	T	0.25531	0.0621	N	0.02842	-0.48	0.22253	N	0.999253	B	0.02656	0.0	B	0.01281	0.0	T	0.04386	-1.0955	9	0.02654	T	1	.	4.0036	0.09590	0.1725:0.349:0.3814:0.0971	.	99	Q9NRW3	ABC3C_HUMAN	E	99	ENSP00000355340:D99E	ENSP00000355340:D99E	D	+	3	2	APOBEC3C	37743839	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.823000	0.00748	-5.002000	0.00024	-4.545000	0.00004	GAC	APOBEC3C	-	pfam_APOBEC_N,superfamily_Cytidine_deaminase-like	ENSG00000244509		0.547	APOBEC3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3C	HGNC	protein_coding	OTTHUMT00000321241.2	207	0.00	0	C	NM_014508		39413893	39413893	+1	no_errors	ENST00000361441	ensembl	human	known	69_37n	missense	89	15.24	16	SNP	0.001	G
APOBEC3C	27350	genome.wustl.edu	37	22	39414291	39414291	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr22:39414291G>A	ENST00000361441.4	+	4	752	c.472G>A	c.(472-474)Gaa>Aaa	p.E158K	APOBEC3D_ENST00000216099.8_5'Flank|APOBEC3D_ENST00000381568.4_Intron	NM_014508.2	NP_055323.2	Q9NRW3	ABC3C_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C	158					cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6	Melanoma(58;0.04)					ATATTGTTGGGAAAACTTTGT	0.478																																						dbGAP											0													174.0	187.0	183.0					22																	39414291		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF165520	CCDS13983.1	22q13.1-q13.2	2014-01-28			ENSG00000244509	ENSG00000244509		"""Apolipoprotein B mRNA editing enzymes"""	17353	protein-coding gene	gene with protein product		607750				11863358	Standard	NM_014508		Approved	APOBEC1L, PBI, bK150C2.3, ARDC2, ARDC4, ARP5	uc003awr.3	Q9NRW3	OTTHUMG00000151087	ENST00000361441.4:c.472G>A	22.37:g.39414291G>A	ENSP00000355340:p.Glu158Lys		B2R884|Q5JZ92|Q7Z2N7|Q96F12	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.E158K	ENST00000361441.4	37	c.472	CCDS13983.1	22	.	.	.	.	.	.	.	.	.	.	.	4.701	0.130333	0.08981	.	.	ENSG00000244509	ENST00000361441	T	0.64438	-0.1	2.01	-0.915	0.10494	APOBEC-like, C-terminal (1);Cytidine deaminase-like (1);	.	.	.	.	T	0.41351	0.1155	L	0.33137	0.985	0.09310	N	0.999996	B	0.06786	0.001	B	0.15052	0.012	T	0.25117	-1.0141	9	0.10111	T	0.7	.	4.476	0.11739	0.5806:0.0:0.4194:0.0	.	158	Q9NRW3	ABC3C_HUMAN	K	158	ENSP00000355340:E158K	ENSP00000355340:E158K	E	+	1	0	APOBEC3C	37744237	0.032000	0.19561	0.044000	0.18714	0.036000	0.12997	-0.007000	0.12810	-0.165000	0.10908	0.479000	0.44913	GAA	APOBEC3C	-	pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	ENSG00000244509		0.478	APOBEC3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3C	HGNC	protein_coding	OTTHUMT00000321241.2	132	0.00	0	G	NM_014508		39414291	39414291	+1	no_errors	ENST00000361441	ensembl	human	known	69_37n	missense	87	21.62	24	SNP	0.056	A
DQX1	165545	genome.wustl.edu	37	2	74754622	74754622	+	5'Flank	SNP	A	A	G			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr2:74754622A>G	ENST00000404568.3	-	0	0				AUP1_ENST00000377526.3_Silent_p.L313L|DQX1_ENST00000393951.2_5'Flank|HTRA2_ENST00000258080.3_5'Flank|HTRA2_ENST00000352222.3_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						ATGACACCCAATGGCACATGG	0.547																																						dbGAP											0													124.0	126.0	125.0					2																	74754622		1907	4117	6024	-	-	-	SO:0001631	upstream_gene_variant	0			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74754622A>G	Exception_encountered		Q6B017|Q8NAM8	Silent	SNP	pfam_CUE,smart_CUE,pfscan_CUE	p.L313	ENST00000404568.3	37	c.937	CCDS1949.2	2																																																																																			AUP1	-	pfam_CUE,smart_CUE,pfscan_CUE	ENSG00000115307		0.547	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUP1	HGNC	protein_coding	OTTHUMT00000252230.3	77	0.00	0	A	NM_133637		74754622	74754622	-1	no_errors	ENST00000377526	ensembl	human	known	69_37n	silent	49	10.91	6	SNP	0.997	G
BCL9	607	genome.wustl.edu	37	1	147087614	147087614	+	Missense_Mutation	SNP	C	C	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr1:147087614C>A	ENST00000234739.3	+	7	1312	c.572C>A	c.(571-573)gCt>gAt	p.A191D	BCL9_ENST00000473292.1_3'UTR	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	191	Interacts with PYGO1.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					GCTGCAGAAGCTGTTTTGAAG	0.413			T	"""IGH@, IGL@"""	B-ALL																																	dbGAP		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0													89.0	92.0	91.0					1																	147087614		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.572C>A	1.37:g.147087614C>A	ENSP00000234739:p.Ala191Asp		Q5T489	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.A191D	ENST00000234739.3	37	c.572	CCDS30833.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.388509	0.95988	.	.	ENSG00000116128	ENST00000234739	T	0.66099	-0.19	5.91	5.91	0.95273	.	0.055309	0.64402	D	0.000001	T	0.71829	0.3386	L	0.54323	1.7	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64595	0.927;0.927	T	0.72874	-0.4160	10	0.87932	D	0	-13.3094	20.2985	0.98592	0.0:1.0:0.0:0.0	.	191;191	Q1JQ81;O00512	.;BCL9_HUMAN	D	191	ENSP00000234739:A191D	ENSP00000234739:A191D	A	+	2	0	BCL9	145554238	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.866000	0.69590	2.793000	0.96121	0.655000	0.94253	GCT	BCL9	-	NULL	ENSG00000116128		0.413	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	127	0.00	0	C	NM_004326		147087614	147087614	+1	no_errors	ENST00000234739	ensembl	human	known	69_37n	missense	94	17.54	20	SNP	1.000	A
BRSK2	9024	genome.wustl.edu	37	11	1477889	1477889	+	Silent	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr11:1477889C>T	ENST00000528841.1	+	18	2295	c.1911C>T	c.(1909-1911)caC>caT	p.H637H	BRSK2_ENST00000308230.5_Silent_p.H659H|BRSK2_ENST00000308219.9_Silent_p.H637H|BRSK2_ENST00000526678.1_Silent_p.H659H|BRSK2_ENST00000528710.1_Silent_p.H577H|BRSK2_ENST00000382179.1_Silent_p.H683H|BRSK2_ENST00000544817.1_Silent_p.H332H|BRSK2_ENST00000531197.1_Silent_p.H637H			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	637					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		TGAGCACACACGACCCGCCTG	0.711																																						dbGAP											0													14.0	19.0	17.0					11																	1477889		2140	4264	6404	-	-	-	SO:0001819	synonymous_variant	0			AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1911C>T	11.37:g.1477889C>T			B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Nonsense_Mutation	SNP	NULL	p.R176*	ENST00000528841.1	37	c.526	CCDS58107.1	11	.	.	.	.	.	.	.	.	.	.	c	6.095	0.385726	0.11524	.	.	ENSG00000174672	ENST00000533606	.	.	.	3.52	-1.74	0.08056	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2734	0.43495	0.0:0.267:0.0:0.733	.	.	.	.	X	176	.	.	R	+	1	2	BRSK2	1434465	0.124000	0.22315	0.891000	0.34965	0.606000	0.37113	-0.598000	0.05706	-0.709000	0.05008	-0.461000	0.05368	CGA	BRSK2	-	NULL	ENSG00000174672		0.711	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRSK2	HGNC	protein_coding	OTTHUMT00000393033.1	15	0.00	0	C	NM_003957		1477889	1477889	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000533606	ensembl	human	putative	69_37n	nonsense	15	46.43	13	SNP	0.992	T
C4orf51	646603	genome.wustl.edu	37	4	146601433	146601433	+	Silent	SNP	C	C	A	rs143157259		TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr4:146601433C>A	ENST00000438731.1	+	1	78	c.78C>A	c.(76-78)atC>atA	p.I26I		NM_001080531.1	NP_001074000.1	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	26										haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	6						TTGATCTGATCAGACGCAAGG	0.458																																						dbGAP											0													166.0	161.0	162.0					4																	146601433		1961	4156	6117	-	-	-	SO:0001819	synonymous_variant	0				CCDS47140.1	4q31.21	2009-09-09			ENSG00000237136	ENSG00000237136			37264	protein-coding gene	gene with protein product							Standard	NM_001080531		Approved		uc003ikk.3	C9J302	OTTHUMG00000161367	ENST00000438731.1:c.78C>A	4.37:g.146601433C>A				Silent	SNP	NULL	p.I26	ENST00000438731.1	37	c.78	CCDS47140.1	4																																																																																			C4orf51	-	NULL	ENSG00000237136		0.458	C4orf51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf51	HGNC	protein_coding		177	0.00	0	C	NM_001080531		146601433	146601433	+1	no_errors	ENST00000438731	ensembl	human	known	69_37n	silent	100	25.93	35	SNP	0.948	A
TBC1D32	221322	genome.wustl.edu	37	6	121631945	121631945	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr6:121631945C>T	ENST00000398212.2	-	4	593	c.544G>A	c.(544-546)Gat>Aat	p.D182N	TBC1D32_ENST00000275159.6_Missense_Mutation_p.D182N	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	182					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										tgcccaggatccaactggtct	0.333																																						dbGAP											0													58.0	55.0	55.0					6																	121631945		1815	4071	5886	-	-	-	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.544G>A	6.37:g.121631945C>T	ENSP00000381270:p.Asp182Asn		Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.D182N	ENST00000398212.2	37	c.544	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016816	0.75161	.	.	ENSG00000146350	ENST00000275159;ENST00000398212;ENST00000422369	T;T;T	0.26810	1.71;1.71;1.71	4.96	4.96	0.65561	.	0.265470	0.41396	D	0.000887	T	0.22820	0.0551	M	0.71581	2.175	0.45427	D	0.998405	P	0.52061	0.95	P	0.46389	0.515	T	0.01643	-1.1305	10	0.26408	T	0.33	-15.4796	14.4442	0.67338	0.0:1.0:0.0:0.0	.	182	Q96NH3	BROMI_HUMAN	N	182	ENSP00000275159:D182N;ENSP00000381270:D182N;ENSP00000397993:D182N	ENSP00000275159:D182N	D	-	1	0	C6orf170	121673644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.290000	0.51755	2.683000	0.91414	0.591000	0.81541	GAT	C6orf170	-	NULL	ENSG00000146350		0.333	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C6orf170	HGNC	protein_coding	OTTHUMT00000380937.2	107	0.00	0	C	NM_152730		121631945	121631945	-1	no_errors	ENST00000275159	ensembl	human	putative	69_37n	missense	48	33.33	24	SNP	1.000	T
CCDC85A	114800	genome.wustl.edu	37	2	56420362	56420362	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr2:56420362G>A	ENST00000407595.2	+	2	1529	c.1027G>A	c.(1027-1029)Gct>Act	p.A343T	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	343	His-rich.									breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCAGAAACACGCTCTTGGGGG	0.622																																						dbGAP											0													44.0	52.0	49.0					2																	56420362		2059	4210	6269	-	-	-	SO:0001583	missense	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1027G>A	2.37:g.56420362G>A	ENSP00000384040:p.Ala343Thr			Missense_Mutation	SNP	pfam_DUF2216_coiled-coil	p.A343T	ENST00000407595.2	37	c.1027	CCDS46290.1	2	.	.	.	.	.	.	.	.	.	.	G	2.140	-0.396928	0.04899	.	.	ENSG00000055813	ENST00000407595	T	0.41758	0.99	5.19	3.11	0.35812	.	0.316966	0.29594	N	0.011712	T	0.12135	0.0295	N	0.01874	-0.695	0.24709	N	0.993218	B	0.15719	0.014	B	0.04013	0.001	T	0.30297	-0.9983	10	0.05959	T	0.93	-23.9591	4.1245	0.10121	0.5145:0.0:0.4855:0.0	.	343	Q96PX6	CC85A_HUMAN	T	343	ENSP00000384040:A343T	ENSP00000384040:A343T	A	+	1	0	CCDC85A	56273866	0.010000	0.17322	0.241000	0.24154	0.135000	0.20990	1.762000	0.38451	1.184000	0.42957	0.467000	0.42956	GCT	CCDC85A	-	NULL	ENSG00000055813		0.622	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	40	0.00	0	G			56420362	56420362	+1	no_errors	ENST00000407595	ensembl	human	known	69_37n	missense	38	25.49	13	SNP	0.018	A
CCT3	7203	genome.wustl.edu	37	1	156288708	156288708	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr1:156288708C>T	ENST00000295688.3	-	8	990	c.710G>A	c.(709-711)cGc>cAc	p.R237H	CCT3_ENST00000368261.3_Missense_Mutation_p.R192H|CCT3_ENST00000472765.2_Missense_Mutation_p.R192H|CCT3_ENST00000368259.2_Missense_Mutation_p.R199H	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	237					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CAGCACAATGCGAGGGTTCTT	0.463																																						dbGAP											0													90.0	84.0	86.0					1																	156288708		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.710G>A	1.37:g.156288708C>T	ENSP00000295688:p.Arg237His		A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_gamma	p.R237H	ENST00000295688.3	37	c.710	CCDS1140.2	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.057569	0.76074	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765;ENST00000413555	T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44	5.94	5.04	0.67666	.	0.059794	0.64402	D	0.000010	D	0.82967	0.5152	H	0.95982	3.75	0.51482	D	0.999924	D;D;P	0.89917	1.0;1.0;0.927	D;D;P	0.70487	0.961;0.969;0.59	D	0.87752	0.2592	10	0.87932	D	0	-4.9147	11.0891	0.48104	0.0:0.9156:0.0:0.0844	.	199;236;237	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	H	237;199;192;192;261	ENSP00000295688:R237H;ENSP00000357242:R199H;ENSP00000357244:R192H;ENSP00000431543:R192H;ENSP00000413308:R261H	ENSP00000295688:R237H	R	-	2	0	CCT3	154555332	1.000000	0.71417	0.935000	0.37517	0.284000	0.27059	7.458000	0.80787	1.532000	0.49169	0.643000	0.83706	CGC	CCT3	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_gamma	ENSG00000163468		0.463	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	89	0.00	0	C	NM_005998		156288708	156288708	-1	no_errors	ENST00000295688	ensembl	human	known	69_37n	missense	46	56.07	60	SNP	0.802	T
CLDN5	7122	genome.wustl.edu	37	22	19511925	19511925	+	Nonsense_Mutation	SNP	G	G	A	rs885985	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr22:19511925G>A	ENST00000406028.1	-	2	1169	c.109C>T	c.(109-111)Cag>Tag	p.Q37*	CLDN5_ENST00000403084.1_Nonsense_Mutation_p.Q37*|CLDN5_ENST00000413119.2_Nonsense_Mutation_p.Q37*			O00501	CLD5_HUMAN	claudin 5	0					calcium-independent cell-cell adhesion (GO:0016338)|myelination (GO:0042552)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			liver(1)|lung(2)|prostate(1)	4	Colorectal(54;0.0993)					CGCACCTCCTGGGTCTGCCAG	0.751													A|||	2488	0.496805	0.2073	0.5879	5008	,	,		11791	0.5298		0.5567	False		,,,				2504	0.728					dbGAP											0													3.0	4.0	4.0					22																	19511925		571	1393	1964	-	-	-	SO:0001587	stop_gained	0			AF000959	CCDS13763.2	22q11.21	2008-08-01	2008-08-01		ENSG00000184113	ENSG00000184113		"""Claudins"""	2047	protein-coding gene	gene with protein product		602101	"""transmembrane protein deleted in velocardiofacial syndrome"""	AWAL, TMVCF		9441748, 9192844	Standard	NM_003277		Approved	CPETRL1, BEC1	uc002zpu.2	O00501	OTTHUMG00000150441	ENST00000406028.1:c.109C>T	22.37:g.19511925G>A	ENSP00000385477:p.Gln37*		B3KS11|Q53XW2|Q8WUW3	Nonsense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin5	p.Q37*	ENST00000406028.1	37	c.109	CCDS13763.2	22	1017	0.46565934065934067	109	0.22154471544715448	199	0.5497237569060773	287	0.5017482517482518	422	0.5567282321899736	A	23.9	4.466684	0.84425	.	.	ENSG00000184113	ENST00000406028;ENST00000403084;ENST00000413119	.	.	.	5.24	-6.49	0.01890	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	3.0235	0.06083	0.3175:0.1814:0.409:0.0921	rs885985;rs17209295;rs885985	.	.	.	X	37	.	ENSP00000384554:Q37X	Q	-	1	0	CLDN5	17891925	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.689000	0.05144	-1.461000	0.01909	-2.530000	0.00182	CAG	CLDN5	-	NULL	ENSG00000184113		0.751	CLDN5-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLDN5	HGNC	protein_coding	OTTHUMT00000318122.3	8	0.00	0	G	NM_003277		19511925	19511925	-1	no_errors	ENST00000403084	ensembl	human	known	69_37n	nonsense	5	44.44	4	SNP	0.000	A
DLX6	1750	genome.wustl.edu	37	7	96639271	96639271	+	Missense_Mutation	SNP	G	G	C			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr7:96639271G>C	ENST00000518156.2	+	3	1224	c.794G>C	c.(793-795)aGt>aCt	p.S265T	DLX6-AS1_ENST00000452769.2_RNA|DLX6_ENST00000555308.1_Missense_Mutation_p.S137T|DLX6-AS1_ENST00000458352.2_RNA|DLX6_ENST00000007660.5_Missense_Mutation_p.S237T|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6_ENST00000493273.2_3'UTR|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000430404.2_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	147					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					AAGGGTGTCAGTATGCCCCCC	0.627																																						dbGAP											0													35.0	37.0	36.0					7																	96639271		2180	4291	6471	-	-	-	SO:0001583	missense	0				CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.794G>C	7.37:g.96639271G>C	ENSP00000428480:p.Ser265Thr		A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa,pfscan_Homeodomain	p.S265T	ENST00000518156.2	37	c.794	CCDS47647.2	7	.	.	.	.	.	.	.	.	.	.	G	5.876	0.345747	0.11126	.	.	ENSG00000006377	ENST00000518156;ENST00000007660;ENST00000555308	D;D;D	0.91945	-2.94;-2.86;-2.94	5.76	4.7	0.59300	.	0.167850	0.64402	D	0.000003	T	0.81922	0.4925	N	0.13235	0.315	0.36601	D	0.874686	B	0.06786	0.001	B	0.12837	0.008	T	0.76266	-0.3022	10	0.09843	T	0.71	-5.6358	10.3052	0.43676	0.1467:0.0:0.8533:0.0	.	237	P56179-2	.	T	265;237;137	ENSP00000428480:S265T;ENSP00000007660:S237T;ENSP00000451635:S137T	ENSP00000007660:S237T	S	+	2	0	DLX6	96477207	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.129000	0.50500	2.732000	0.93576	0.655000	0.94253	AGT	DLX6	-	NULL	ENSG00000006377		0.627	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLX6	HGNC	protein_coding	OTTHUMT00000334373.4	68	0.00	0	G	NM_005222		96639271	96639271	+1	no_errors	ENST00000518156	ensembl	human	known	69_37n	missense	36	32.73	18	SNP	1.000	C
DNM1P46	196968	genome.wustl.edu	37	15	100340174	100340175	+	RNA	INS	-	-	A	rs200691929	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr15:100340174_100340175insA	ENST00000341853.1	-	0	751_752					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										CAGGAGTGTCTTCTCGTTCCCA	0.614																																						dbGAP											0																																										-	-	-			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340174_100340175insA			Q3ZCN3	RNA	INS	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.614	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	11	0.00	0	-	NR_003260		100340174	100340175	-1	no_errors	ENST00000341853	ensembl	human	known	69_37n	rna	8	33.33	4	INS	0.948:0.931	A
DNM1P46	196968	genome.wustl.edu	37	15	100340179	100340179	+	RNA	DEL	G	G	-	rs200037202	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr15:100340179delG	ENST00000341853.1	-	0	747					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										GTGTCTTCTCGTTCCCACGCG	0.617																																						dbGAP											0													16.0	17.0	17.0					15																	100340179		1390	3429	4819	-	-	-			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340179delG			Q3ZCN3	RNA	DEL	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.617	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	9	0.00	0	G	NR_003260		100340179	100340179	-1	no_errors	ENST00000341853	ensembl	human	known	69_37n	rna	8	33.33	4	DEL	0.957	-
DSEL	92126	genome.wustl.edu	37	18	65178250	65178250	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr18:65178250C>T	ENST00000310045.7	-	2	5099	c.3626G>A	c.(3625-3627)tGg>tAg	p.W1209*	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1199					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				CATCAGAGTCCAGCAGATGTT	0.373																																						dbGAP											0													101.0	98.0	99.0					18																	65178250		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.3626G>A	18.37:g.65178250C>T	ENSP00000310565:p.Trp1209*		Q17RH1|Q6P5Z3	Nonsense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_Chondroitin_lyas	p.W1209*	ENST00000310045.7	37	c.3626	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	C	51	18.326255	0.99903	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	.	.	.	5.63	5.63	0.86233	.	0.319538	0.30446	U	0.009606	.	.	.	.	.	.	0.54753	D	0.999985	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-1.3637	10.9061	0.47081	0.2342:0.646:0.1199:0.0	.	.	.	.	X	1209;1199	.	ENSP00000310565:W1209X	W	-	2	0	DSEL	63329230	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	2.428000	0.44749	2.808000	0.96608	0.655000	0.94253	TGG	DSEL	-	pfam_Sulfotransferase_dom	ENSG00000171451		0.373	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	116	0.00	0	C	NM_032160		65178250	65178250	-1	no_errors	ENST00000310045	ensembl	human	known	69_37n	nonsense	80	27.68	31	SNP	0.809	T
DVL3	1857	genome.wustl.edu	37	3	183882690	183882690	+	Missense_Mutation	SNP	T	T	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr3:183882690T>A	ENST00000313143.3	+	5	818	c.570T>A	c.(568-570)ttT>ttA	p.F190L	DVL3_ENST00000462665.1_3'UTR|EIF2B5_ENST00000444495.1_Intron|DVL3_ENST00000431765.1_Missense_Mutation_p.F190L	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	190					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CCAGCTTCTTTGACTCAGATG	0.572																																						dbGAP											0													70.0	71.0	71.0					3																	183882690		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.570T>A	3.37:g.183882690T>A	ENSP00000316054:p.Phe190Leu		B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	SNP	pfam_Dishevelled_C-dom,pfam_DIX,pfam_Dishevelled_protein_dom,pfam_PDZ,pfam_DEP_dom,superfamily_PDZ,smart_DIX,smart_PDZ,smart_DEP_dom,pfscan_DEP_dom,pfscan_DIX,pfscan_PDZ,prints_Dishevelled,prints_Dishevelled_3,prints_Dishevelled_1	p.F190L	ENST00000313143.3	37	c.570	CCDS3253.1	3	.	.	.	.	.	.	.	.	.	.	T	8.878	0.950992	0.18431	.	.	ENSG00000161202	ENST00000313143;ENST00000415612;ENST00000431765;ENST00000423300	T;T;T	0.05081	3.93;3.92;3.5	5.18	1.2	0.21068	Dishevelled protein domain (1);	0.151419	0.64402	D	0.000013	T	0.04724	0.0128	L	0.41632	1.29	0.80722	D	1	B;B	0.19583	0.037;0.037	B;B	0.22152	0.038;0.038	T	0.34576	-0.9823	10	0.07813	T	0.8	-6.2707	8.2374	0.31634	0.0:0.3586:0.0:0.6414	.	190;190	B4E3E5;Q92997	.;DVL3_HUMAN	L	190;190;190;88	ENSP00000316054:F190L;ENSP00000405885:F190L;ENSP00000393849:F88L	ENSP00000316054:F190L	F	+	3	2	DVL3	185365384	0.114000	0.22134	0.999000	0.59377	0.996000	0.88848	-0.476000	0.06591	0.403000	0.25479	0.533000	0.62120	TTT	DVL3	-	pfam_Dishevelled_protein_dom	ENSG00000161202		0.572	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DVL3	HGNC	protein_coding	OTTHUMT00000346184.1	61	0.00	0	T	NM_004423		183882690	183882690	+1	no_errors	ENST00000313143	ensembl	human	known	69_37n	missense	35	14.63	6	SNP	1.000	A
EEF1A1	1915	genome.wustl.edu	37	6	74227940	74227940	+	Silent	SNP	A	A	C	rs11556677	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr6:74227940A>C	ENST00000316292.9	-	6	2068	c.1077T>G	c.(1075-1077)ccT>ccG	p.P359P	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000309268.6_Silent_p.P359P|EEF1A1_ENST00000331523.2_Silent_p.P359P	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	359					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						AATCCAATACAGGGGCATAGC	0.448																																						dbGAP											0													36.0	40.0	38.0					6																	74227940		2195	4298	6493	-	-	-	SO:0001819	synonymous_variant	0			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1077T>G	6.37:g.74227940A>C			P04719|P04720|Q6IQ15	Silent	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd,tigrfam_Transl_elong_EF1A_euk/arc	p.P359	ENST00000316292.9	37	c.1077	CCDS4980.1	6																																																																																			EEF1A1	-	pfam_Transl_elong_EFTu/EF1A_C,superfamily_Transl_elong_EF1A/Init_IF2_C,tigrfam_Transl_elong_EF1A_euk/arc	ENSG00000156508		0.448	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A1	HGNC	protein_coding	OTTHUMT00000041210.2	47	0.00	0	A	NM_001402		74227940	74227940	-1	no_errors	ENST00000309268	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	1.000	C
EP400	57634	genome.wustl.edu	37	12	132547138	132547138	+	Silent	SNP	A	A	G	rs111782215|rs561398509	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr12:132547138A>G	ENST00000333577.4	+	48	8443	c.8334A>G	c.(8332-8334)caA>caG	p.Q2778Q	EP400_ENST00000389562.2_Silent_p.Q2741Q|EP400_ENST00000389561.2_Silent_p.Q2742Q|EP400_ENST00000330386.6_Silent_p.Q2661Q|EP400_ENST00000332482.4_Silent_p.Q2705Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2778	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2741Q(3)|p.Q2742Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacagcagcagc	0.602													G|||	74	0.0147764	0.028	0.0086	5008	,	,		14914	0.0079		0.0119	False		,,,				2504	0.0112					dbGAP											4	Substitution - coding silent(4)	prostate(2)|endometrium(1)|kidney(1)											48.0	40.0	43.0					12																	132547138		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8334A>G	12.37:g.132547138A>G			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2778	ENST00000333577.4	37	c.8334		12																																																																																			EP400	-	NULL	ENSG00000183495		0.602	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		47	0.00	0	A	NM_015409		132547138	132547138	+1	no_errors	ENST00000333577	ensembl	human	known	69_37n	silent	79	17.71	17	SNP	0.021	G
EXOC3	11336	genome.wustl.edu	37	5	465362	465362	+	Missense_Mutation	SNP	G	G	A	rs543578098		TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr5:465362G>A	ENST00000512944.1	+	11	2102	c.1913G>A	c.(1912-1914)cGc>cAc	p.R638H	EXOC3_ENST00000315013.5_Missense_Mutation_p.R638H|CTD-2228K2.5_ENST00000510714.1_5'Flank	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	649					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)				breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GAGCAGCTGCGCTTCCTGTTC	0.672													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15805	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													58.0	72.0	67.0					5																	465362		2096	4192	6288	-	-	-	SO:0001583	missense	0			BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.1913G>A	5.37:g.465362G>A	ENSP00000425587:p.Arg638His		Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Missense_Mutation	SNP	pfam_Sec6	p.R638H	ENST00000512944.1	37	c.1913	CCDS54830.1	5	.	.	.	.	.	.	.	.	.	.	G	9.077	0.998440	0.19121	.	.	ENSG00000180104	ENST00000512944;ENST00000315013;ENST00000340158	T;T	0.06608	3.28;3.28	4.9	3.09	0.35607	.	0.107157	0.64402	D	0.000007	T	0.04407	0.0121	L	0.36672	1.1	0.40268	D	0.978257	B	0.25809	0.135	B	0.22152	0.038	T	0.43393	-0.9394	10	0.15499	T	0.54	-11.3142	4.6435	0.12561	0.1822:0.0:0.6419:0.1759	.	649	O60645	EXOC3_HUMAN	H	638;638;533	ENSP00000425587:R638H;ENSP00000323377:R638H	ENSP00000323377:R638H	R	+	2	0	EXOC3	518362	1.000000	0.71417	0.997000	0.53966	0.925000	0.55904	3.189000	0.50965	0.574000	0.29417	0.460000	0.39030	CGC	EXOC3	-	pfam_Sec6	ENSG00000180104		0.672	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3	HGNC	protein_coding	OTTHUMT00000367882.1	126	0.00	0	G	NM_007277		465362	465362	+1	no_errors	ENST00000315013	ensembl	human	known	69_37n	missense	70	28.57	28	SNP	1.000	A
FGFR4	2264	genome.wustl.edu	37	5	176519685	176519685	+	Nonsense_Mutation	SNP	C	C	G			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr5:176519685C>G	ENST00000292408.4	+	8	1202	c.957C>G	c.(955-957)taC>taG	p.Y319*	FGFR4_ENST00000393648.2_Nonsense_Mutation_p.Y319*|FGFR4_ENST00000393637.1_Nonsense_Mutation_p.Y319*|FGFR4_ENST00000292410.3_Nonsense_Mutation_p.Y319*|FGFR4_ENST00000502906.1_Nonsense_Mutation_p.Y319*	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	319	Ig-like C2-type 3.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	AGGTCCTGTACCTGCGGAACG	0.637										TSP Lung(9;0.080)																												dbGAP											0													74.0	70.0	71.0					5																	176519685		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.957C>G	5.37:g.176519685C>G	ENSP00000292408:p.Tyr319*		G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Y319*	ENST00000292408.4	37	c.957	CCDS4410.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.663341	0.96745	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	.	.	.	4.6	3.71	0.42584	.	0.061993	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6571	0.51324	0.0:0.9106:0.0:0.0894	.	.	.	.	X	319;319;319;319;319;431	.	ENSP00000292408:Y319X	Y	+	3	2	FGFR4	176452291	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.260000	0.32968	1.031000	0.39867	0.561000	0.74099	TAC	FGFR4	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfscan_Ig-like	ENSG00000160867		0.637	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1	55	0.00	0	C			176519685	176519685	+1	no_errors	ENST00000292408	ensembl	human	known	69_37n	nonsense	90	10.89	11	SNP	1.000	G
FLG	2312	genome.wustl.edu	37	1	152280540	152280540	+	Silent	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr1:152280540C>T	ENST00000368799.1	-	3	6857	c.6822G>A	c.(6820-6822)caG>caA	p.Q2274Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2274	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATCTCTTGACTGCTCCTGAG	0.562									Ichthyosis																													dbGAP											0													211.0	213.0	213.0					1																	152280540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6822G>A	1.37:g.152280540C>T			Q01720|Q5T583|Q9UC71	Silent	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.Q2274	ENST00000368799.1	37	c.6822	CCDS30860.1	1																																																																																			FLG	-	NULL	ENSG00000143631		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	402	0.00	0	C	NM_002016		152280540	152280540	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	silent	240	38.14	148	SNP	0.000	T
GCC2	9648	genome.wustl.edu	37	2	109087385	109087385	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr2:109087385C>G	ENST00000309863.6	+	6	2314	c.1600C>G	c.(1600-1602)Ctc>Gtc	p.L534V		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	534					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						agatgcccttctcgaaactgt	0.383																																						dbGAP											0													62.0	64.0	63.0					2																	109087385		2202	4298	6500	-	-	-	SO:0001583	missense	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.1600C>G	2.37:g.109087385C>G	ENSP00000307939:p.Leu534Val		A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.L534V	ENST00000309863.6	37	c.1600	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	C	12.50	1.957376	0.34565	.	.	ENSG00000135968	ENST00000309863;ENST00000409896;ENST00000393318	T	0.58652	0.32	5.4	4.49	0.54785	.	0.080339	0.51477	N	0.000094	T	0.53610	0.1807	M	0.71581	2.175	0.51767	D	0.999935	P	0.46220	0.874	B	0.36378	0.223	T	0.56655	-0.7943	10	0.24483	T	0.36	.	16.0688	0.80909	0.0:0.8655:0.1345:0.0	.	534	Q8IWJ2	GCC2_HUMAN	V	534;497;279	ENSP00000307939:L534V	ENSP00000307939:L534V	L	+	1	0	GCC2	108453817	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	3.700000	0.54786	1.338000	0.45544	0.650000	0.86243	CTC	GCC2	-	NULL	ENSG00000135968		0.383	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3	9	0.00	0	C	NM_014635		109087385	109087385	+1	no_errors	ENST00000309863	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	1.000	G
HMGB1	3146	genome.wustl.edu	37	13	31037698	31037698	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr13:31037698C>G	ENST00000405805.1	-	2	1060	c.120G>C	c.(118-120)gaG>gaC	p.E40D	HMGB1_ENST00000399494.1_Missense_Mutation_p.E40D|HMGB1_ENST00000468384.1_5'UTR|HMGB1_ENST00000339872.4_Missense_Mutation_p.E40D|HMGB1_ENST00000326004.4_Missense_Mutation_p.E40D|HMGB1_ENST00000399489.1_Missense_Mutation_p.E40D|HMGB1_ENST00000341423.5_Missense_Mutation_p.E40D			P09429	HMGB1_HUMAN	high mobility group box 1	40					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		TCTTAGAAAACTCTGAGAAGT	0.408																																						dbGAP											0													135.0	140.0	139.0					13																	31037698		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.120G>C	13.37:g.31037698C>G	ENSP00000384678:p.Glu40Asp		A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.E40D	ENST00000405805.1	37	c.120	CCDS9335.1	13	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352360	0.61293	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399489;ENST00000399494;ENST00000426225;ENST00000326004;ENST00000398908	T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19	5.53	2.84	0.33178	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.53938	D	0.000054	T	0.21801	0.0525	L	0.52759	1.655	0.80722	D	1	B;B;B	0.19583	0.002;0.037;0.006	B;B;B	0.31547	0.037;0.132;0.085	T	0.04593	-1.0940	10	0.46703	T	0.11	.	9.9468	0.41613	0.0:0.7235:0.0:0.2765	.	40;40;40	B7Z965;P09429;Q5T7C4	.;HMGB1_HUMAN;.	D	40	ENSP00000384678:E40D;ENSP00000343040:E40D;ENSP00000345347:E40D;ENSP00000382412:E40D;ENSP00000382417:E40D;ENSP00000369904:E40D;ENSP00000410465:E40D	ENSP00000369904:E40D	E	-	3	2	HMGB1	29935698	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.657000	0.37366	0.697000	0.31718	0.549000	0.68633	GAG	HMGB1	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000189403		0.408	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGB1	HGNC	protein_coding	OTTHUMT00000303998.2	226	0.00	0	C	NM_002128		31037698	31037698	-1	no_errors	ENST00000339872	ensembl	human	known	69_37n	missense	148	25.63	51	SNP	1.000	G
KCNN3	3782	genome.wustl.edu	37	1	154842243	154842244	+	Missense_Mutation	DNP	AA	AA	CT			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr1:154842243_154842244AA>CT	ENST00000271915.4	-	1	512_513	c.197_198TT>AG	c.(196-198)cTT>cAG	p.L66Q	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	66	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	gctgctgctgaagctgcggagg	0.703																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.197_198delinsCT	1.37:g.154842243_154842244delinsCT	ENSP00000271915:p.Leu66Gln		B1ANX0|O43517|Q86VF9|Q8WXG7	Silent|Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.L66|p.L66H	ENST00000271915.4	37	c.198|c.197	CCDS30880.1	1																																																																																			KCNN3	-	NULL	ENSG00000143603		0.703	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	18|19	0.00	0	A	NM_002249		154842243|154842244	154842243|154842244	-1	no_errors	ENST00000271915	ensembl	human	known	69_37n	silent|missense	44	45.68	37	SNP	0.000|0.166	C|T
MAP6	4135	genome.wustl.edu	37	11	75298416	75298416	+	Silent	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr11:75298416G>A	ENST00000304771.3	-	4	2880	c.2130C>T	c.(2128-2130)ccC>ccT	p.P710P	CTD-2530H12.4_ENST00000527803.1_RNA|MAP6_ENST00000526689.1_5'Flank|MAP6_ENST00000526740.1_Silent_p.P381P	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	710	Pro-rich.				dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)		p.P710P(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					TCACGGACTCGGGGACCACAG	0.507																																					Esophageal Squamous(181;1115 2007 8647 17065 22697)	dbGAP											1	Substitution - coding silent(1)	lung(1)											146.0	149.0	148.0					11																	75298416		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.2130C>T	11.37:g.75298416G>A			A7E2A1|Q6P3T0|Q6ZWB8	Silent	SNP	pfam_STOP/FAM154	p.P710	ENST00000304771.3	37	c.2130	CCDS31641.1	11																																																																																			MAP6	-	NULL	ENSG00000171533		0.507	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP6	HGNC	protein_coding	OTTHUMT00000383527.1	186	0.53	1	G	NM_033063		75298416	75298416	-1	no_errors	ENST00000304771	ensembl	human	known	69_37n	silent	134	29.47	56	SNP	0.005	A
MARS	4141	genome.wustl.edu	37	12	57908826	57908826	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr12:57908826G>A	ENST00000262027.5	+	17	2323	c.2189G>A	c.(2188-2190)gGc>gAc	p.G730D	RN7SL312P_ENST00000582079.1_RNA|MARS_ENST00000315473.5_Missense_Mutation_p.G496D	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	730					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)	p.G730D(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CGGATTAAAGGCAGTGAGGCT	0.512																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											70.0	66.0	67.0					12																	57908826		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2189G>A	12.37:g.57908826G>A	ENSP00000262027:p.Gly730Asp		B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	pfam_Methionyl/Leucyl_tRNA_Synth,pfam_WHEP-TRS,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_S15_NS1_RNA-bd,superfamily_Thioredoxin-like_fold,pfscan_WHEP-TRS,prints_Met-tRNA_synth,tigrfam_Met-tRNA_synth	p.G730D	ENST00000262027.5	37	c.2189	CCDS8942.1	12	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025879	0.75390	.	.	ENSG00000166986	ENST00000262027;ENST00000315473	T;T	0.38401	1.14;1.14	5.32	4.42	0.53409	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.054686	0.64402	D	0.000001	T	0.59609	0.2206	M	0.83953	2.67	0.80722	D	1	P;D	0.69078	0.923;0.997	P;D	0.67382	0.613;0.951	T	0.63211	-0.6688	10	0.54805	T	0.06	-17.0655	12.6964	0.57005	0.0819:0.0:0.9181:0.0	.	496;730	A6NC17;P56192	.;SYMC_HUMAN	D	730;496	ENSP00000262027:G730D;ENSP00000314653:G496D	ENSP00000262027:G730D	G	+	2	0	MARS	56195093	1.000000	0.71417	0.966000	0.40874	0.976000	0.68499	5.582000	0.67477	2.650000	0.89964	0.591000	0.81541	GGC	MARS	-	superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Met-tRNA_synth	ENSG00000166986		0.512	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS	HGNC	protein_coding	OTTHUMT00000407014.1	111	0.00	0	G	NM_004990		57908826	57908826	+1	no_errors	ENST00000262027	ensembl	human	known	69_37n	missense	69	19.77	17	SNP	0.996	A
MBP	4155	genome.wustl.edu	37	18	74701956	74701956	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr18:74701956G>A	ENST00000397869.3	-	2	284	c.238C>T	c.(238-240)Cgg>Tgg	p.R80W	MBP_ENST00000580402.1_Missense_Mutation_p.R213W|MBP_ENST00000526111.1_Missense_Mutation_p.R58W|MBP_ENST00000528160.1_Intron|MBP_ENST00000355994.2_Missense_Mutation_p.R213W|MBP_ENST00000578193.1_Missense_Mutation_p.R80W|MBP_ENST00000527041.1_Intron|MBP_ENST00000579129.1_Missense_Mutation_p.R213W|MBP_ENST00000397875.3_Missense_Mutation_p.R80W|MBP_ENST00000397865.5_Missense_Mutation_p.R80W|MBP_ENST00000359645.3_Missense_Mutation_p.R106W|MBP_ENST00000397866.4_Missense_Mutation_p.R80W|MBP_ENST00000354542.4_Intron|MBP_ENST00000382582.3_Missense_Mutation_p.R106W			P13727	PRG2_HUMAN	myelin basic protein	0					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	TCTTGGGTCCGGCCGTGTGAC	0.572																																					NSCLC(17;72 1131 19392)	dbGAP											0													160.0	146.0	151.0					18																	74701956		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397869.3:c.238C>T	18.37:g.74701956G>A	ENSP00000380967:p.Arg80Trp		A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	pfam_Myelin_BP,prints_Myelin_BP	p.R213W	ENST00000397869.3	37	c.637		18	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586863	0.66105	.	.	ENSG00000197971	ENST00000382582;ENST00000355994;ENST00000397875;ENST00000397866;ENST00000397865;ENST00000359645;ENST00000397869;ENST00000526111;ENST00000397868;ENST00000447114;ENST00000498683	.	.	.	3.78	3.78	0.43462	.	0.076414	0.49916	D	0.000123	T	0.75042	0.3796	M	0.64404	1.975	0.41345	D	0.987323	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.85130	0.997;0.997;0.951;0.982;0.982	T	0.78710	-0.2098	9	0.87932	D	0	0.9848	13.296	0.60296	0.0:0.0:1.0:0.0	.	80;213;80;106;106	B7Z3Y6;P02686;P02686-6;P02686-4;P02686-3	.;MBP_HUMAN;.;.;.	W	106;213;80;80;80;106;80;58;80;24;80	.	ENSP00000348273:R213W	R	-	1	2	MBP	72830944	1.000000	0.71417	0.987000	0.45799	0.670000	0.39368	2.320000	0.43797	2.115000	0.64714	0.563000	0.77884	CGG	MBP	-	pfam_Myelin_BP,prints_Myelin_BP	ENSG00000197971		0.572	MBP-024	NOVEL	basic|exp_conf	protein_coding	MBP	HGNC	protein_coding	OTTHUMT00000267964.1	374	0.00	0	G	NM_001025081		74701956	74701956	-1	no_errors	ENST00000355994	ensembl	human	known	69_37n	missense	167	32.39	80	SNP	0.999	A
NBEAL1	65065	genome.wustl.edu	37	2	204037478	204037478	+	Silent	SNP	T	T	G			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr2:204037478T>G	ENST00000449802.1	+	40	6471	c.6138T>G	c.(6136-6138)acT>acG	p.T2046T		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2046	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.									NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AAGATTATACTTCGGAAGAGT	0.343																																						dbGAP											0													147.0	139.0	141.0					2																	204037478		1799	4067	5866	-	-	-	SO:0001819	synonymous_variant	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6138T>G	2.37:g.204037478T>G			A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T2046	ENST00000449802.1	37	c.6138	CCDS46495.1	2																																																																																			NBEAL1	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000144426		0.343	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	97	0.00	0	T			204037478	204037478	+1	no_errors	ENST00000449802	ensembl	human	known	69_37n	silent	62	21.52	17	SNP	1.000	G
NBPF1	55672	genome.wustl.edu	37	1	16891340	16891340	+	Missense_Mutation	SNP	T	T	A	rs3962237	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr1:16891340T>A	ENST00000430580.2	-	28	4025	c.3138A>T	c.(3136-3138)agA>agT	p.R1046S		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	1026	NBPF 7. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ccccttcttttcttccccttc	0.433																																						dbGAP											0													59.0	26.0	42.0					1																	16891340		621	667	1288	-	-	-	SO:0001583	missense	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.3138A>T	1.37:g.16891340T>A	ENSP00000474456:p.Arg1046Ser		Q8N4E8|Q9C0H0	RNA	SNP	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.433	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	35	0.00	0	T	NM_017940		16891340	16891340	-1	no_errors	ENST00000401007	ensembl	human	known	69_37n	rna	30	14.29	5	SNP	0.060	A
OR2A7	401427	genome.wustl.edu	37	7	143956461	143956461	+	Silent	SNP	T	T	C	rs199974780	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr7:143956461T>C	ENST00000493325.1	-	1	354	c.261A>G	c.(259-261)ccA>ccG	p.P87P	OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA|ARHGEF35_ENST00000543357.1_Intron	NM_001005328.1	NP_001005328.1	Q96R45	OR2A7_HUMAN	olfactory receptor, family 2, subfamily A, member 7	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	6	Melanoma(164;0.14)					TGGGCTTGGCTGGATGCAGGA	0.572																																						dbGAP											0													5.0	6.0	5.0					7																	143956461		1342	3122	4464	-	-	-	SO:0001819	synonymous_variant	0				CCDS55177.1	7q35	2013-09-20			ENSG00000243896	ENSG00000243896		"""GPCR / Class A : Olfactory receptors"""	8234	protein-coding gene	gene with protein product							Standard	NM_001005328		Approved	HSDJ0798C17	uc011kuc.2	Q96R45	OTTHUMG00000158002	ENST00000493325.1:c.261A>G	7.37:g.143956461T>C			B2RN57|Q6IFP4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.P87	ENST00000493325.1	37	c.261	CCDS55177.1	7																																																																																			OR2A7	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000243896		0.572	OR2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A7	HGNC	protein_coding	OTTHUMT00000349979.1	8	0.00	0	T			143956461	143956461	-1	no_errors	ENST00000493325	ensembl	human	known	69_37n	silent	5	64.29	9	SNP	0.000	C
OR51F2	119694	genome.wustl.edu	37	11	4842865	4842865	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr11:4842865G>A	ENST00000322110.5	+	1	315	c.250G>A	c.(250-252)Gac>Aac	p.D84N	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTCAGCCACAGACCTGAGCTT	0.473																																						dbGAP											0													188.0	179.0	182.0					11																	4842865		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.250G>A	11.37:g.4842865G>A	ENSP00000323952:p.Asp84Asn		Q6IFI1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D84N	ENST00000322110.5	37	c.250	CCDS31361.1	11	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314360	0.81358	.	.	ENSG00000176925	ENST00000322110	T	0.66280	-0.2	4.43	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	U	0.000666	D	0.84284	0.5438	H	0.94462	3.54	0.37645	D	0.922194	D	0.89917	1.0	D	0.80764	0.994	D	0.90508	0.4479	10	0.87932	D	0	.	16.1233	0.81375	0.0:0.0:1.0:0.0	.	84	Q8NH61	O51F2_HUMAN	N	84	ENSP00000323952:D84N	ENSP00000323952:D84N	D	+	1	0	OR51F2	4799441	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.145000	0.64839	2.461000	0.83175	0.561000	0.74099	GAC	OR51F2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000176925		0.473	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51F2	HGNC	protein_coding	OTTHUMT00000142181.1	123	0.00	0	G	NM_001004753		4842865	4842865	+1	no_errors	ENST00000322110	ensembl	human	known	69_37n	missense	60	26.83	22	SNP	1.000	A
OR6T1	219874	genome.wustl.edu	37	11	123813896	123813896	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr11:123813896G>T	ENST00000321252.2	-	1	684	c.650C>A	c.(649-651)tCc>tAc	p.S217Y		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S217Y(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		GCAGGCATAGGAAACTGAGGT	0.542																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											82.0	77.0	79.0					11																	123813896		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.650C>A	11.37:g.123813896G>T	ENSP00000325203:p.Ser217Tyr		Q6IFE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S217Y	ENST00000321252.2	37	c.650	CCDS31700.1	11	.	.	.	.	.	.	.	.	.	.	G	12.36	1.914481	0.33815	.	.	ENSG00000181499	ENST00000321252	T	0.46063	0.88	3.7	3.7	0.42460	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.74099	0.3672	H	0.96239	3.79	0.21064	N	0.999799	D	0.89917	1.0	D	0.79784	0.993	T	0.67921	-0.5545	9	0.87932	D	0	-11.4192	12.9791	0.58554	0.0:0.0:1.0:0.0	.	217	Q8NGN1	OR6T1_HUMAN	Y	217	ENSP00000325203:S217Y	ENSP00000325203:S217Y	S	-	2	0	OR6T1	123319106	1.000000	0.71417	0.019000	0.16419	0.335000	0.28730	4.553000	0.60753	1.872000	0.54250	0.563000	0.77884	TCC	OR6T1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181499		0.542	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6T1	HGNC	protein_coding	OTTHUMT00000387264.1	94	0.00	0	G	NM_001005187		123813896	123813896	-1	no_errors	ENST00000321252	ensembl	human	known	69_37n	missense	58	18.31	13	SNP	0.717	T
PCDH10	57575	genome.wustl.edu	37	4	134072136	134072136	+	Nonsense_Mutation	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr4:134072136C>T	ENST00000264360.5	+	1	1667	c.841C>T	c.(841-843)Cag>Tag	p.Q281*	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	281	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GGACGAGGGCCAGAACGGTGA	0.642																																						dbGAP											0													70.0	69.0	69.0					4																	134072136		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.841C>T	4.37:g.134072136C>T	ENSP00000264360:p.Gln281*		Q4W5F6|Q96SF0	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q281*	ENST00000264360.5	37	c.841	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	C	41	8.738967	0.98935	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	.	.	.	4.33	2.52	0.30459	.	0.170283	0.28262	N	0.015995	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	13.6847	0.62508	0.0:0.704:0.296:0.0	.	.	.	.	X	281	.	ENSP00000264360:Q281X	Q	+	1	0	PCDH10	134291586	0.290000	0.24343	0.977000	0.42913	0.148000	0.21650	3.076000	0.50081	0.402000	0.25451	-0.416000	0.06073	CAG	PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000138650		0.642	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	56	0.00	0	C	NM_032961		134072136	134072136	+1	no_errors	ENST00000264360	ensembl	human	known	69_37n	nonsense	38	17.02	8	SNP	1.000	T
PHKA1	5255	genome.wustl.edu	37	X	71830973	71830973	+	Missense_Mutation	SNP	T	T	C			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chrX:71830973T>C	ENST00000373542.4	-	22	2590	c.2431A>G	c.(2431-2433)Acc>Gcc	p.T811A	PHKA1_ENST00000339490.3_Missense_Mutation_p.T811A|PHKA1_ENST00000541944.1_Missense_Mutation_p.T752A|PHKA1_ENST00000373539.3_Missense_Mutation_p.T811A|PHKA1_ENST00000373545.3_Missense_Mutation_p.T752A	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	811	Calmodulin-binding. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TACAGCTCGGTAAGAAGCTCT	0.433																																						dbGAP											0													91.0	77.0	82.0					X																	71830973		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2431A>G	X.37:g.71830973T>C	ENSP00000362643:p.Thr811Ala		B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.T811A	ENST00000373542.4	37	c.2431	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	T	8.503	0.864705	0.17250	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39	5.85	3.51	0.40186	Glycoside hydrolase 15-related (1);	0.416279	0.27971	N	0.017117	T	0.77205	0.4096	N	0.20807	0.61	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.002;0.002;0.003	T	0.60845	-0.7182	10	0.23302	T	0.38	-30.0032	6.2384	0.20776	0.0:0.2651:0.0:0.7349	.	752;811;811	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	A	752;811;752;811;811	ENSP00000362646:T752A;ENSP00000362643:T811A;ENSP00000441251:T752A;ENSP00000342469:T811A;ENSP00000362640:T811A	ENSP00000342469:T811A	T	-	1	0	PHKA1	71747698	0.004000	0.15560	0.993000	0.49108	0.631000	0.37964	0.553000	0.23391	0.832000	0.34804	0.486000	0.48141	ACC	PHKA1	-	pfam_Glyco_hydro_15	ENSG00000067177		0.433	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	165	0.00	0	T			71830973	71830973	-1	no_errors	ENST00000373539	ensembl	human	known	69_37n	missense	78	21.57	22	SNP	0.005	C
PPEF2	5470	genome.wustl.edu	37	4	76788502	76788502	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr4:76788502delG	ENST00000286719.7	-	14	2076	c.1720delC	c.(1720-1722)ctcfs	p.L574fs		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	574	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AATTCACTGAGAAGATCTGAA	0.428																																					NSCLC(105;1359 1603 15961 44567 47947)	dbGAP											0													68.0	70.0	69.0					4																	76788502		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1720delC	4.37:g.76788502delG	ENSP00000286719:p.Leu574fs		O14831	Frame_Shift_Del	DEL	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,pfam_PPP_dom,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,prints_Ser/Thr-sp_prot-phosphatase,pfscan_EF_HAND_2	p.L574fs	ENST00000286719.7	37	c.1720	CCDS34013.1	4																																																																																			PPEF2	-	pirsf_Ser/Thr-Pase_EF-hand_contain,smart_EF_hand_Ca-bd	ENSG00000156194		0.428	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	HGNC	protein_coding	OTTHUMT00000362929.1	113	0.00	0	G	NM_006239		76788502	76788502	-1	no_errors	ENST00000286719	ensembl	human	known	69_37n	frame_shift_del	59	23.08	18	DEL	1.000	-
PRRC2B	84726	genome.wustl.edu	37	9	134360104	134360104	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr9:134360104G>A	ENST00000357304.4	+	23	5547	c.5492G>A	c.(5491-5493)cGg>cAg	p.R1831Q	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Missense_Mutation_p.R1137Q|PRRC2B_ENST00000405995.1_Missense_Mutation_p.R1137Q|SNORD62A_ENST00000428514.1_RNA	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1831							poly(A) RNA binding (GO:0044822)	p.R1831L(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						CCCATCCTGCGGCGGGACCAT	0.572																																						dbGAP											2	Substitution - Missense(2)	lung(2)											139.0	139.0	139.0					9																	134360104		1982	4159	6141	-	-	-	SO:0001583	missense	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.5492G>A	9.37:g.134360104G>A	ENSP00000349856:p.Arg1831Gln		O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.R1831Q	ENST00000357304.4	37	c.5492	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875197	0.91664	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550	T;T;T	0.03801	3.8;4.11;3.8	5.28	4.38	0.52667	.	0.000000	0.37178	U	0.002210	T	0.14743	0.0356	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.978	T	0.01874	-1.1256	10	0.33940	T	0.23	-34.3545	12.8819	0.58022	0.0788:0.0:0.9212:0.0	.	563;1831	Q5JSZ8;Q5JSZ5	.;PRC2B_HUMAN	Q	1137;1831;1137	ENSP00000384606:R1137Q;ENSP00000349856:R1831Q;ENSP00000398853:R1137Q	ENSP00000349856:R1831Q	R	+	2	0	PRRC2B	133349925	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.141000	0.94612	1.208000	0.43306	0.561000	0.74099	CGG	PRRC2B	-	NULL	ENSG00000130723		0.572	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		207	0.48	1	G			134360104	134360104	+1	no_errors	ENST00000357304	ensembl	human	known	69_37n	missense	129	28.57	52	SNP	1.000	A
RHOXF2	84528	genome.wustl.edu	37	X	119293091	119293091	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chrX:119293091G>A	ENST00000371388.3	+	2	440	c.250G>A	c.(250-252)Gga>Aga	p.G84R		NM_032498.1	NP_115887.1	Q9BQY4	RHXF2_HUMAN	Rhox homeobox family, member 2	84					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G84K(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(2)	8						CGGCGGCGCCGGAGTTCCTGG	0.602													G|||	1	0.000264901	0.0	0.0	3775	,	,		13081	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	skin(1)											41.0	46.0	44.0					X																	119293091		2159	4288	6447	-	-	-	SO:0001583	missense	0				CCDS14594.1	Xq24	2012-12-20			ENSG00000131721	ENSG00000131721		"""Homeoboxes / PRD class"""	30011	protein-coding gene	gene with protein product	"""cancer/testis antigen 107"""	300447				12490318	Standard	NM_032498		Approved	THG1, PEPP-2, PEPP2, CT107		Q9BQY4	OTTHUMG00000022296	ENST00000371388.3:c.250G>A	X.37:g.119293091G>A	ENSP00000360441:p.Gly84Arg		Q9BR00	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.G84R	ENST00000371388.3	37	c.250	CCDS14594.1	X	.	.	.	.	.	.	.	.	.	.	G	7.039	0.562206	0.13498	.	.	ENSG00000131721	ENST00000371388	D	0.92199	-2.99	2.02	1.14	0.20703	.	.	.	.	.	D	0.88407	0.6428	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	P	0.56751	0.805	T	0.78534	-0.2167	9	0.49607	T	0.09	-1.8425	4.1161	0.10083	0.2228:0.0:0.7772:0.0	.	84	Q9BQY4	RHXF2_HUMAN	R	84	ENSP00000360441:G84R	ENSP00000360441:G84R	G	+	1	0	RHOXF2	119177119	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.211000	0.17474	0.303000	0.22785	0.436000	0.28706	GGA	RHOXF2	-	NULL	ENSG00000131721		0.602	RHOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF2	HGNC	protein_coding	OTTHUMT00000411977.1	103	0.00	0	G	NM_032498		119293091	119293091	+1	no_errors	ENST00000371388	ensembl	human	known	69_37n	missense	75	29.63	32	SNP	0.000	A
RPGRIP1L	23322	genome.wustl.edu	37	16	53686660	53686660	+	Missense_Mutation	SNP	C	C	A	rs145572901		TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr16:53686660C>A	ENST00000379925.3	-	15	1989	c.1939G>T	c.(1939-1941)Gta>Tta	p.V647L	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.V647L|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.V647L|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.V647L	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	647	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.		V -> I (in dbSNP:rs145572901). {ECO:0000269|PubMed:19430481}.		camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CCTCGCACTACGGGAGTTGTC	0.368																																						dbGAP											0													103.0	103.0	103.0					16																	53686660		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.1939G>T	16.37:g.53686660C>A	ENSP00000369257:p.Val647Leu		A0PJ88|Q9Y2K8	Missense_Mutation	SNP	pfam_DUF3250,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.V647L	ENST00000379925.3	37	c.1939	CCDS32447.1	16	.	.	.	.	.	.	.	.	.	.	C	8.140	0.784992	0.16189	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	D;D	0.94576	-3.46;-3.46	5.45	-5.18	0.02840	C2 calcium-dependent membrane targeting (1);	0.242961	0.39909	N	0.001235	D	0.88254	0.6387	L	0.39566	1.225	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.17979	0.02;0.012;0.02;0.004	T	0.67201	-0.5730	10	0.66056	D	0.02	-2.4564	8.8166	0.35000	0.0:0.5149:0.2265:0.2587	.	647;647;647;647	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	L	647	ENSP00000369257:V647L;ENSP00000262135:V647L	ENSP00000262135:V647L	V	-	1	0	RPGRIP1L	52244161	0.000000	0.05858	0.143000	0.22291	0.683000	0.39861	-0.263000	0.08670	-0.926000	0.03770	-0.471000	0.05019	GTA	RPGRIP1L	-	pfam_DUF3250,smart_C2_Ca-dep	ENSG00000103494		0.368	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	HGNC	protein_coding	OTTHUMT00000422187.1	106	0.00	0	C	NM_015272		53686660	53686660	-1	no_errors	ENST00000379925	ensembl	human	known	69_37n	missense	61	29.89	26	SNP	0.032	A
SCN1A	6323	genome.wustl.edu	37	2	166847987	166847987	+	Missense_Mutation	SNP	C	C	T	rs556893466|rs587780446	byFrequency	TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr2:166847987C>T	ENST00000303395.4	-	26	5797	c.5798G>A	c.(5797-5799)cGa>cAa	p.R1933Q	AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.R1922Q|SCN1A_ENST00000409050.1_Missense_Mutation_p.R1905Q|SCN1A_ENST00000423058.2_Missense_Mutation_p.R1933Q			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1933	IQ.				adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.R1922Q(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTTACAGTTCGCTTTAAAAG	0.353																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											83.0	80.0	81.0					2																	166847987		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5798G>A	2.37:g.166847987C>T	ENSP00000303540:p.Arg1933Gln		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.R1933Q	ENST00000303395.4	37	c.5798	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	9.117	1.008118	0.19199	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96522	-4.04;-4.04;-3.99;-3.99	5.76	5.76	0.90799	.	0.000000	0.52532	D	0.000074	D	0.88377	0.6420	N	0.04655	-0.195	0.29128	N	0.879821	B	0.12013	0.005	B	0.08055	0.003	T	0.78247	-0.2278	10	0.17832	T	0.49	.	10.3785	0.44096	0.0:0.8557:0.0:0.1443	.	1922	P35498-2	.	Q	1933;1933;1922;1905	ENSP00000407030:R1933Q;ENSP00000303540:R1933Q;ENSP00000364554:R1922Q;ENSP00000386312:R1905Q	ENSP00000303540:R1933Q	R	-	2	0	SCN1A	166556233	0.921000	0.31238	1.000000	0.80357	0.994000	0.84299	0.597000	0.24059	2.719000	0.93026	0.555000	0.69702	CGA	SCN1A	-	NULL	ENSG00000144285		0.353	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	83	0.00	0	C	NM_006920		166847987	166847987	-1	no_errors	ENST00000303395	ensembl	human	known	69_37n	missense	53	28.38	21	SNP	1.000	T
SPTBN2	6712	genome.wustl.edu	37	11	66463885	66463885	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr11:66463885C>G	ENST00000533211.1	-	21	4472	c.4141G>C	c.(4141-4143)Gat>Cat	p.D1381H	SPTBN2_ENST00000309996.2_Missense_Mutation_p.D1381H|SPTBN2_ENST00000529997.1_Missense_Mutation_p.D1381H			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1381					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CGGTTGGCATCAAAGAGGCTG	0.637																																						dbGAP											0													79.0	83.0	82.0					11																	66463885		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.4141G>C	11.37:g.66463885C>G	ENSP00000432568:p.Asp1381His		O14872|O14873	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,prints_PH_dom-spectrin-type	p.D1381H	ENST00000533211.1	37	c.4141	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503581	0.85176	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.72505	-0.66;-0.66;-0.66	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.86356	0.5913	M	0.89478	3.035	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.88801	0.3285	10	0.66056	D	0.02	.	16.8872	0.86078	0.0:1.0:0.0:0.0	.	1381	O15020	SPTN2_HUMAN	H	1381	ENSP00000432568:D1381H;ENSP00000311489:D1381H;ENSP00000433593:D1381H	ENSP00000311489:D1381H	D	-	1	0	SPTBN2	66220461	1.000000	0.71417	0.999000	0.59377	0.847000	0.48162	7.591000	0.82666	2.531000	0.85337	0.557000	0.71058	GAT	SPTBN2	-	pirsf_Spectrin_bsu	ENSG00000173898		0.637	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	97	0.00	0	C	NM_006946		66463885	66463885	-1	no_errors	ENST00000309996	ensembl	human	known	69_37n	missense	84	23.64	26	SNP	1.000	G
SYT1	6857	genome.wustl.edu	37	12	79679692	79679692	+	Frame_Shift_Del	DEL	G	G	-			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr12:79679692delG	ENST00000261205.4	+	5	949	c.292delG	c.(292-294)gggfs	p.G98fs	SYT1_ENST00000457153.2_Frame_Shift_Del_p.G98fs|SYT1_ENST00000393240.3_Frame_Shift_Del_p.G98fs|SYT1_ENST00000552744.1_Frame_Shift_Del_p.G98fs	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	98					calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						GGAAAAAGGAGGGAAGAATGC	0.343																																						dbGAP											0													135.0	128.0	130.0					12																	79679692		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.292delG	12.37:g.79679692delG	ENSP00000261205:p.Gly98fs		Q6AI31	Frame_Shift_Del	DEL	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting	p.K99fs	ENST00000261205.4	37	c.292	CCDS9017.1	12																																																																																			SYT1	-	NULL	ENSG00000067715		0.343	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT1	HGNC	protein_coding	OTTHUMT00000259415.1	223	0.00	0	G	NM_005639		79679692	79679692	+1	no_errors	ENST00000261205	ensembl	human	known	69_37n	frame_shift_del	154	23.67	49	DEL	1.000	-
TNIP3	79931	genome.wustl.edu	37	4	122078381	122078381	+	Silent	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr4:122078381C>T	ENST00000509841.1	-	7	540	c.462G>A	c.(460-462)acG>acA	p.T154T	TNIP3_ENST00000454328.1_Silent_p.T77T|TNIP3_ENST00000057513.3_Silent_p.T77T|TNIP3_ENST00000507879.1_Silent_p.T147T	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						CGTCCAGTTTCGTCTTCAGCT	0.552																																						dbGAP											0													191.0	207.0	202.0					4																	122078381		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.462G>A	4.37:g.122078381C>T				Silent	SNP	NULL	p.T77	ENST00000509841.1	37	c.231	CCDS58926.1	4																																																																																			TNIP3	-	NULL	ENSG00000050730		0.552	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000364000.4	112	0.00	0	C	NM_024873		122078381	122078381	-1	no_errors	ENST00000057513	ensembl	human	known	69_37n	silent	42	27.59	16	SNP	0.057	T
TP53	7157	genome.wustl.edu	37	17	7577112	7577112	+	Missense_Mutation	SNP	C	C	G			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr17:7577112C>G	ENST00000269305.4	-	8	1015	c.826G>C	c.(826-828)Gcc>Ccc	p.A276P	TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.A276P|TP53_ENST00000445888.2_Missense_Mutation_p.A276P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.A276P|TP53_ENST00000359597.4_Missense_Mutation_p.A276P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	276	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A276P(15)|p.A276S(9)|p.0?(8)|p.A276T(7)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.A276fs*68(1)|p.L265_K305del41(1)|p.A276_C277delAC(1)|p.F270_D281del12(1)|p.C275_A276ins10(1)|p.V274_P278del(1)|p.A276fs*70(1)|p.A276fs*31(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCAGGACAGGCACAAACACGC	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	56	Substitution - Missense(31)|Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(5)|Insertion - Frameshift(2)|Unknown(2)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(13)|bone(6)|upper_aerodigestive_tract(4)|biliary_tract(4)|large_intestine(4)|breast(4)|stomach(3)|central_nervous_system(3)|thymus(3)|urinary_tract(3)|ovary(2)|soft_tissue(1)|kidney(1)|endometrium(1)|oesophagus(1)|skin(1)|lung(1)|prostate(1)											72.0	62.0	65.0					17																	7577112		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.826G>C	17.37:g.7577112C>G	ENSP00000269305:p.Ala276Pro		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.A276P	ENST00000269305.4	37	c.826	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	28.5	4.925704	0.92319	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.77103	2.36	0.80722	D	1	P;D;P;P	0.89917	0.768;1.0;0.909;0.455	P;D;P;P	0.77557	0.498;0.99;0.631;0.5	D	0.96498	0.9369	10	0.87932	D	0	-17.5913	15.662	0.77193	0.0:1.0:0.0:0.0	.	276;276;276;276	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	P	276;276;276;276;276;265;144	ENSP00000352610:A276P;ENSP00000269305:A276P;ENSP00000398846:A276P;ENSP00000391127:A276P;ENSP00000391478:A276P;ENSP00000425104:A144P	ENSP00000269305:A276P	A	-	1	0	TP53	7517837	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	GCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	157	0.00	0	C	NM_000546		7577112	7577112	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	54	43.16	41	SNP	1.000	G
TRPA1	8989	genome.wustl.edu	37	8	72973917	72973917	+	Missense_Mutation	SNP	G	G	A			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr8:72973917G>A	ENST00000262209.4	-	7	1094	c.887C>T	c.(886-888)tCt>tTt	p.S296F		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	296					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CACGCTACCAGAATAGGACGA	0.423																																						dbGAP											0													228.0	182.0	198.0					8																	72973917		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.887C>T	8.37:g.72973917G>A	ENSP00000262209:p.Ser296Phe		A6NIN6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S296F	ENST00000262209.4	37	c.887	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535483	0.45176	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.54479	0.57;2.37	4.94	4.05	0.47172	Ankyrin repeat-containing domain (3);	0.701643	0.14730	N	0.301806	T	0.58032	0.2094	M	0.63428	1.95	0.09310	N	1	P	0.48162	0.906	P	0.47206	0.541	T	0.54289	-0.8316	10	0.87932	D	0	-10.0191	13.909	0.63855	0.0:0.2904:0.7096:0.0	.	296	O75762	TRPA1_HUMAN	F	148;296	ENSP00000428151:S148F;ENSP00000262209:S296F	ENSP00000262209:S296F	S	-	2	0	TRPA1	73136471	0.589000	0.26807	0.391000	0.26233	0.859000	0.49053	3.339000	0.52135	1.288000	0.44600	0.655000	0.94253	TCT	TRPA1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104321		0.423	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	200	0.00	0	G	NM_007332		72973917	72973917	-1	no_errors	ENST00000262209	ensembl	human	known	69_37n	missense	85	24.78	28	SNP	0.013	A
TRPC3	7222	genome.wustl.edu	37	4	122853631	122853631	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr4:122853631C>T	ENST00000379645.3	-	2	855	c.782G>A	c.(781-783)cGg>cAg	p.R261Q	TRPC3_ENST00000264811.5_Missense_Mutation_p.R188Q|TRPC3_ENST00000513531.1_Missense_Mutation_p.R188Q	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	176					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GTCGTGCGGCCGCTCGATCCT	0.602																																						dbGAP											0													54.0	50.0	51.0					4																	122853631		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.782G>A	4.37:g.122853631C>T	ENSP00000368966:p.Arg261Gln		A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPC3_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R261Q	ENST00000379645.3	37	c.782	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369792	0.82573	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.70631	-0.5;-0.5;-0.5	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.69797	0.3151	L	0.48362	1.52	0.54753	D	0.999982	B;B	0.31989	0.35;0.258	B;B	0.35607	0.206;0.119	T	0.68750	-0.5326	10	0.51188	T	0.08	-24.7501	19.7417	0.96234	0.0:1.0:0.0:0.0	.	188;261	E9PCJ9;Q5G1L5	.;.	Q	188;261;188	ENSP00000264811:R188Q;ENSP00000368966:R261Q;ENSP00000426899:R188Q	ENSP00000264811:R188Q	R	-	2	0	TRPC3	123073081	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.010000	0.70753	2.661000	0.90470	0.655000	0.94253	CGG	TRPC3	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,tigrfam_TRP_channel	ENSG00000138741		0.602	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	HGNC	protein_coding	OTTHUMT00000364252.1	86	0.00	0	C	NM_003305		122853631	122853631	-1	no_errors	ENST00000379645	ensembl	human	known	69_37n	missense	51	36.25	29	SNP	1.000	T
YTHDF1	54915	genome.wustl.edu	37	20	61834555	61834555	+	Missense_Mutation	SNP	G	G	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr20:61834555G>T	ENST00000370339.3	-	4	1078	c.737C>A	c.(736-738)cCt>cAt	p.P246H	YTHDF1_ENST00000370334.4_Intron|YTHDF1_ENST00000370333.4_Missense_Mutation_p.P196H	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	246	Gln/Pro-rich.						N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						TTTCATTTTAGGCTGTGGTTT	0.547																																						dbGAP											0													69.0	79.0	76.0					20																	61834555		2201	4300	6501	-	-	-	SO:0001583	missense	0			AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.737C>A	20.37:g.61834555G>T	ENSP00000359364:p.Pro246His		Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	pfam_YTH_domain,pfscan_YTH_domain	p.P246H	ENST00000370339.3	37	c.737	CCDS13511.1	20	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628004	0.66901	.	.	ENSG00000149658	ENST00000370339;ENST00000370333	T;T	0.48201	0.82;0.82	5.15	5.15	0.70609	.	0.054398	0.85682	D	0.000000	T	0.66025	0.2748	M	0.73217	2.22	0.58432	D	0.999997	D	0.64830	0.994	P	0.60345	0.873	T	0.68375	-0.5425	10	0.52906	T	0.07	-19.9532	18.6283	0.91349	0.0:0.0:1.0:0.0	.	246	Q9BYJ9	YTHD1_HUMAN	H	246;196	ENSP00000359364:P246H;ENSP00000359358:P196H	ENSP00000359358:P196H	P	-	2	0	YTHDF1	61305000	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.463000	0.80869	2.400000	0.81607	0.491000	0.48974	CCT	YTHDF1	-	NULL	ENSG00000149658		0.547	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF1	HGNC	protein_coding	OTTHUMT00000080110.2	51	0.00	0	G	NM_017798		61834555	61834555	-1	no_errors	ENST00000370339	ensembl	human	known	69_37n	missense	29	19.44	7	SNP	1.000	T
ZNF419	79744	genome.wustl.edu	37	19	58003544	58003544	+	Missense_Mutation	SNP	C	C	T			TCGA-D8-A1XT-01A-11D-A14K-09	TCGA-D8-A1XT-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	bc13601e-3e03-4d7d-8e6e-5b05ff500ea3	5b149a6b-4032-4d61-89da-1b30733c2977	g.chr19:58003544C>T	ENST00000221735.7	+	4	449	c.263C>T	c.(262-264)cCt>cTt	p.P88L	ZNF419_ENST00000518999.1_Missense_Mutation_p.P89L|ZNF419_ENST00000426954.2_Missense_Mutation_p.P76L|ZNF419_ENST00000424930.2_Missense_Mutation_p.P89L|ZNF419_ENST00000354197.4_Missense_Mutation_p.P76L|ZNF419_ENST00000347466.6_Intron|ZNF419_ENST00000415379.2_Intron|ZNF419_ENST00000520540.1_Missense_Mutation_p.P76L|AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000442920.2_Missense_Mutation_p.P75L			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	88	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		CCCTTCATGCCTGCTTGGGAA	0.522																																						dbGAP											0													117.0	111.0	113.0					19																	58003544		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.263C>T	19.37:g.58003544C>T	ENSP00000221735:p.Pro88Leu		B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P89L	ENST00000221735.7	37	c.266	CCDS54326.1	19	.	.	.	.	.	.	.	.	.	.	C	9.689	1.151351	0.21371	.	.	ENSG00000105136	ENST00000524372;ENST00000424930;ENST00000426954;ENST00000354197;ENST00000520540;ENST00000442920;ENST00000517598;ENST00000221735;ENST00000518999	T;T;T;T;T;T;T	0.06528	3.32;3.34;3.29;5.59;3.33;3.31;5.59	2.05	0.996	0.19844	Krueppel-associated box (1);	.	.	.	.	T	0.02970	0.0088	N	0.11892	0.195	0.09310	N	1	B;B;B;B	0.34103	0.437;0.198;0.345;0.017	B;B;B;B	0.34180	0.049;0.081;0.177;0.003	T	0.44065	-0.9352	9	0.10636	T	0.68	.	4.6281	0.12488	0.0:0.8089:0.0:0.1911	.	75;76;89;88	E9PCP4;E9PET3;E9PED0;Q96HQ0	.;.;.;ZN419_HUMAN	L	76;89;76;76;76;75;89;88;89	ENSP00000388864:P89L;ENSP00000390916:P76L;ENSP00000346136:P76L;ENSP00000429471:P76L;ENSP00000414709:P75L;ENSP00000221735:P88L;ENSP00000427723:P89L	ENSP00000221735:P88L	P	+	2	0	ZNF419	62695356	0.006000	0.16342	0.007000	0.13788	0.130000	0.20726	-0.024000	0.12435	0.410000	0.25675	0.407000	0.27541	CCT	ZNF419	-	pfscan_Krueppel-associated_box	ENSG00000105136		0.522	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	ZNF419	HGNC	protein_coding	OTTHUMT00000378506.1	246	0.00	0	C	NM_024691		58003544	58003544	+1	no_errors	ENST00000424930	ensembl	human	known	69_37n	missense	80	36.00	45	SNP	0.009	T
