#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS16	170690	genome.wustl.edu	37	5	5318312	5318312	+	Silent	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr5:5318312G>A	ENST00000274181.7	+	22	3615	c.3477G>A	c.(3475-3477)ccG>ccA	p.P1159P		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1159	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GGGGCCGGCCGGCCTCAGGCT	0.652																																						dbGAP											0													31.0	37.0	35.0					5																	5318312		2058	4173	6231	-	-	-	SO:0001819	synonymous_variant	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3477G>A	5.37:g.5318312G>A			C6G490|Q8IVE2	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P1159	ENST00000274181.7	37	c.3477	CCDS43299.1	5																																																																																			ADAMTS16	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000145536		0.652	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	72	0.00	0	G	NM_139056		5318312	5318312	+1	no_errors	ENST00000274181	ensembl	human	known	69_37n	silent	91	18.75	21	SNP	0.106	A
BCL6	604	genome.wustl.edu	37	3	187451419	187451419	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:187451419G>C	ENST00000406870.2	-	3	429	c.63C>G	c.(61-63)aaC>aaG	p.N21K	BCL6_ENST00000232014.4_Missense_Mutation_p.N21K|BCL6_ENST00000450123.2_Missense_Mutation_p.N21K|BCL6_ENST00000496823.1_5'Flank|RP11-211G3.3_ENST00000449623.1_Missense_Mutation_p.R79S	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	21					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GACGATTAAGGTTGAGAAGAA	0.493			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																	dbGAP		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	0													107.0	105.0	106.0					3																	187451419		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.63C>G	3.37:g.187451419G>C	ENSP00000384371:p.Asn21Lys		A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.N21K	ENST00000406870.2	37	c.63	CCDS3289.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.9|21.9	4.210688|4.210688	0.79240|0.79240	.|.	.|.	ENSG00000113916|ENSG00000228804	ENST00000406870;ENST00000232014;ENST00000450123;ENST00000430339;ENST00000438077|ENST00000449623	T;T;T;T;T|.	0.70045|.	-0.45;-0.45;-0.45;-0.45;-0.45|.	5.7|5.7	4.83|4.83	0.62350|0.62350	BTB/POZ fold (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56804|0.56804	0.2010|0.2010	L|L	0.38733|0.38733	1.17|1.17	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|T	0.60737|0.60737	-0.7204|-0.7204	10|6	0.87932|0.87932	D|D	0|0	.|.	10.4914|10.4914	0.44752|0.44752	0.1634:0.0:0.8366:0.0|0.1634:0.0:0.8366:0.0	.|.	21;21|.	B8PSA7;P41182|.	.;BCL6_HUMAN|.	K|S	21|79	ENSP00000384371:N21K;ENSP00000232014:N21K;ENSP00000413122:N21K;ENSP00000415574:N21K;ENSP00000414455:N21K|.	ENSP00000232014:N21K|ENSP00000407813:R79S	N|R	-|+	3|3	2|2	BCL6|RP11-211G3.3	188934113|188934113	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	0.966000|0.966000	0.29331|0.29331	1.559000|1.559000	0.49555|0.49555	0.650000|0.650000	0.86243|0.86243	AAC|AGG	BCL6	-	superfamily_BTB/POZ_fold	ENSG00000113916		0.493	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6	HGNC	protein_coding	OTTHUMT00000344202.1	192	0.00	0	G	NM_138931		187451419	187451419	-1	no_errors	ENST00000232014	ensembl	human	known	69_37n	missense	201	13.36	31	SNP	1.000	C
BRS3	680	genome.wustl.edu	37	X	135574435	135574435	+	Silent	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chrX:135574435G>A	ENST00000370648.3	+	3	1329	c.1101G>A	c.(1099-1101)gtG>gtA	p.V367V		NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	367					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					CCCTGGCTGTGATGGGAACGG	0.532																																						dbGAP											0													85.0	75.0	78.0					X																	135574435		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.1101G>A	X.37:g.135574435G>A				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Bombesin_rcpt_3,prints_Bombsn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.V367	ENST00000370648.3	37	c.1101	CCDS14656.1	X																																																																																			BRS3	-	prints_Bombesin_rcpt_3	ENSG00000102239		0.532	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRS3	HGNC	protein_coding	OTTHUMT00000059005.1	162	0.00	0	G	NM_001727		135574435	135574435	+1	no_errors	ENST00000370648	ensembl	human	known	69_37n	silent	130	15.58	24	SNP	0.036	A
C9orf69	90120	genome.wustl.edu	37	9	139008534	139008534	+	Silent	SNP	A	A	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr9:139008534A>T	ENST00000418388.1	-	2	715	c.213T>A	c.(211-213)ggT>ggA	p.G71G	C9orf69_ENST00000561457.1_Missense_Mutation_p.V96E			H0YL14	CI069_HUMAN	chromosome 9 open reading frame 69	71					cell cycle (GO:0007049)|positive regulation of cell proliferation (GO:0008284)|positive regulation of viral process (GO:0048524)|viral process (GO:0016032)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)			endometrium(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.58e-07)|Epithelial(140;6.42e-06)		CGGCCAGCGCACCCCAGAGCG	0.632																																						dbGAP											0													57.0	74.0	69.0					9																	139008534		2132	4237	6369	-	-	-	SO:0001819	synonymous_variant	0				CCDS59155.1	9q34.3	2012-11-26	2012-07-05	2012-07-05	ENSG00000238227	ENSG00000238227			31009	protein-coding gene	gene with protein product						21667337	Standard	NM_152833		Approved	bA83N9.1	uc004cgx.5	H0YL14	OTTHUMG00000020922	ENST00000418388.1:c.213T>A	9.37:g.139008534A>T				Missense_Mutation	SNP	NULL	p.V96E	ENST00000418388.1	37	c.287	CCDS59155.1	9																																																																																			C9orf69	-	NULL	ENSG00000238227		0.632	C9orf69-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C9orf69	HGNC	protein_coding	OTTHUMT00000055043.3	44	0.00	0	A	NM_152833		139008534	139008534	-1	no_errors	ENST00000561457	ensembl	human	known	69_37n	missense	32	32.69	17	SNP	0.996	T
C9orf142	286257	genome.wustl.edu	37	9	139888077	139888077	+	Missense_Mutation	SNP	G	G	A	rs558231652		TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr9:139888077G>A	ENST00000371620.3	+	6	562	c.536G>A	c.(535-537)cGg>cAg	p.R179Q	CLIC3_ENST00000480181.1_5'Flank|C9orf142_ENST00000493968.1_3'UTR	NM_183241.1	NP_899064.1	Q9BUH6	CI142_HUMAN	chromosome 9 open reading frame 142	179						extracellular vesicular exosome (GO:0070062)						all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GTCAGGAGGCGGTGTCCAGGA	0.637													G|||	1	0.000199681	0.0	0.0014	5008	,	,		14942	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													77.0	75.0	76.0					9																	139888077		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002613	CCDS7020.1	9q34.3	2008-02-05			ENSG00000148362	ENSG00000148362			27849	protein-coding gene	gene with protein product							Standard	NM_183241		Approved		uc004cki.3	Q9BUH6	OTTHUMG00000020971	ENST00000371620.3:c.536G>A	9.37:g.139888077G>A	ENSP00000360682:p.Arg179Gln		Q8IY19	Missense_Mutation	SNP	NULL	p.R179Q	ENST00000371620.3	37	c.536	CCDS7020.1	9	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100812	0.56183	.	.	ENSG00000148362	ENST00000371620	.	.	.	3.97	3.05	0.35203	.	0.350599	0.20794	N	0.085565	T	0.57315	0.2045	M	0.67953	2.075	0.35845	D	0.826361	D	0.69078	0.997	P	0.52309	0.695	T	0.66830	-0.5824	9	0.72032	D	0.01	-9.8088	7.8448	0.29419	0.1005:0.1669:0.7326:0.0	.	179	Q9BUH6	CI142_HUMAN	Q	179	.	ENSP00000360682:R179Q	R	+	2	0	C9orf142	139007898	0.001000	0.12720	0.998000	0.56505	0.304000	0.27724	0.479000	0.22228	0.843000	0.35070	0.491000	0.48974	CGG	C9orf142	-	NULL	ENSG00000148362		0.637	C9orf142-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf142	HGNC	protein_coding	OTTHUMT00000055255.1	143	0.00	0	G	NM_183241		139888077	139888077	+1	no_errors	ENST00000371620	ensembl	human	known	69_37n	missense	115	21.77	32	SNP	0.998	A
CARKD	55739	genome.wustl.edu	37	13	111274599	111274599	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr13:111274599C>T	ENST00000309957.2	+	2	151	c.137C>T	c.(136-138)tCg>tTg	p.S46L	CARKD_ENST00000424185.2_Intron|CARKD_ENST00000470164.2_3'UTR|CARKD_ENST00000397191.4_Missense_Mutation_p.S28L|CARKD_ENST00000458711.2_Intron	NM_001242881.1|NM_018210.3	NP_001229810.1|NP_060680.2			carbohydrate kinase domain containing											NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	15						AAAGCACATTCGATAAAGGAT	0.363																																						dbGAP											0													94.0	95.0	94.0					13																	111274599		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151071	CCDS9513.1, CCDS55903.1	13q34	2008-12-19			ENSG00000213995	ENSG00000213995			25576	protein-coding gene	gene with protein product		615910					Standard	NM_018210		Approved	LP3298, FLJ10769	uc001vrc.3	Q8IW45	OTTHUMG00000017345	ENST00000309957.2:c.137C>T	13.37:g.111274599C>T	ENSP00000311984:p.Ser46Leu			Missense_Mutation	SNP	pfam_UPF_carb_kinase-rel,tigrfam_UPF_carb_kinase-rel	p.S46L	ENST00000309957.2	37	c.137	CCDS9513.1	13	.	.	.	.	.	.	.	.	.	.	C	8.707	0.911108	0.17833	.	.	ENSG00000213995	ENST00000439607;ENST00000397191;ENST00000309957	T;T	0.24151	1.88;1.87	5.17	4.33	0.51752	.	0.376195	0.27841	N	0.017621	T	0.24044	0.0582	L	0.55481	1.735	0.09310	N	1	B;B;B;B	0.24317	0.012;0.014;0.101;0.022	B;B;B;B	0.16722	0.004;0.005;0.016;0.004	T	0.12477	-1.0546	10	0.24483	T	0.36	-3.8958	12.6504	0.56757	0.0:0.9186:0.0:0.0814	.	28;28;46;46	B4DKX7;B7Z3Q0;Q8IW45-2;Q8IW45	.;.;.;CARKD_HUMAN	L	28;28;46	ENSP00000380375:S28L;ENSP00000311984:S46L	ENSP00000311984:S46L	S	+	2	0	CARKD	110072600	0.005000	0.15991	0.002000	0.10522	0.014000	0.08584	2.113000	0.41902	1.184000	0.42957	-0.140000	0.14226	TCG	CARKD	-	NULL	ENSG00000213995		0.363	CARKD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARKD	HGNC	protein_coding	OTTHUMT00000045764.1	409	0.00	0	C	NM_018210		111274599	111274599	+1	no_errors	ENST00000309957	ensembl	human	known	69_37n	missense	320	22.14	91	SNP	0.020	T
CCDC141	285025	genome.wustl.edu	37	2	179730515	179730515	+	Silent	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr2:179730515G>A	ENST00000420890.2	-	17	2820	c.2703C>T	c.(2701-2703)gcC>gcT	p.A901A	CCDC141_ENST00000295723.5_Silent_p.A326A	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	901								p.A326A(1)|p.A901A(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CGTCTCTCATGGCGCAGTACT	0.522																																						dbGAP											2	Substitution - coding silent(2)	lung(2)											365.0	328.0	340.0					2																	179730515		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2703C>T	2.37:g.179730515G>A			H7C0P1|J3KNW6|Q8N8H3	Silent	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.A901	ENST00000420890.2	37	c.2703		2																																																																																			CCDC141	-	NULL	ENSG00000163492		0.522	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		309	0.00	0	G	NM_173648		179730515	179730515	-1	no_errors	ENST00000420890	ensembl	human	known	69_37n	silent	324	16.06	62	SNP	0.000	A
CCDC67	159989	genome.wustl.edu	37	11	93097377	93097377	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr11:93097377C>T	ENST00000298050.3	+	5	449	c.349C>T	c.(349-351)Caa>Taa	p.Q117*		NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	117					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				TCAGATGAAACAAAACAAAGT	0.284																																						dbGAP											0													58.0	54.0	55.0					11																	93097377		1808	4064	5872	-	-	-	SO:0001587	stop_gained	0			AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.349C>T	11.37:g.93097377C>T	ENSP00000298050:p.Gln117*		Q8NEF1|Q96LL7	Nonsense_Mutation	SNP	superfamily_MHC_II-assoc_invariant_trimer	p.Q117*	ENST00000298050.3	37	c.349	CCDS44707.1	11	.	.	.	.	.	.	.	.	.	.	C	37	6.050716	0.97236	.	.	ENSG00000165325	ENST00000534747;ENST00000298050;ENST00000532819	.	.	.	5.53	5.53	0.82687	.	0.181325	0.39146	N	0.001443	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	17.6279	0.88098	0.0:1.0:0.0:0.0	.	.	.	.	X	117	.	ENSP00000298050:Q117X	Q	+	1	0	CCDC67	92737025	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	3.174000	0.50847	2.614000	0.88457	0.591000	0.81541	CAA	CCDC67	-	superfamily_MHC_II-assoc_invariant_trimer	ENSG00000165325		0.284	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC67	HGNC	protein_coding		264	0.00	0	C	NM_181645		93097377	93097377	+1	no_errors	ENST00000298050	ensembl	human	known	69_37n	nonsense	128	34.02	66	SNP	1.000	T
CDH20	28316	genome.wustl.edu	37	18	59167643	59167643	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr18:59167643C>A	ENST00000262717.4	+	4	967	c.569C>A	c.(568-570)aCa>aAa	p.T190K	CDH20_ENST00000538374.1_Missense_Mutation_p.T190K|CDH20_ENST00000536675.2_Missense_Mutation_p.T190K			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	190	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				GTGACAGCCACAGATGCAGAT	0.502																																						dbGAP											0													129.0	121.0	123.0					18																	59167643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.569C>A	18.37:g.59167643C>A	ENSP00000262717:p.Thr190Lys		Q495S3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T190K	ENST00000262717.4	37	c.569	CCDS11977.1	18	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994921	0.93167	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.55588	0.51;0.51;0.51	5.1	5.1	0.69264	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.69079	0.3071	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71474	-0.4582	10	0.72032	D	0.01	.	18.8926	0.92410	0.0:1.0:0.0:0.0	.	190	Q9HBT6	CAD20_HUMAN	K	190	ENSP00000444767:T190K;ENSP00000442226:T190K;ENSP00000262717:T190K	ENSP00000262717:T190K	T	+	2	0	CDH20	57318623	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.747000	0.85070	2.527000	0.85204	0.561000	0.74099	ACA	CDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000101542		0.502	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH20	HGNC	protein_coding	OTTHUMT00000256141.2	341	0.00	0	C	NM_031891		59167643	59167643	+1	no_errors	ENST00000262717	ensembl	human	known	69_37n	missense	344	17.27	72	SNP	1.000	A
CHPF	79586	genome.wustl.edu	37	2	220405780	220405780	+	Missense_Mutation	SNP	C	C	T	rs527954030		TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr2:220405780C>T	ENST00000243776.6	-	3	1204	c.956G>A	c.(955-957)cGa>cAa	p.R319Q	TMEM198_ENST00000344458.2_5'Flank|TMEM198_ENST00000373883.3_5'Flank|CHPF_ENST00000535926.1_Missense_Mutation_p.R157Q	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	319					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CAGGGCACTTCGGAAATGAGG	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20380	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													75.0	61.0	66.0					2																	220405780		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.956G>A	2.37:g.220405780C>T	ENSP00000243776:p.Arg319Gln		B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	pfam_Chond_GalNAc	p.R319Q	ENST00000243776.6	37	c.956	CCDS2443.1	2	.	.	.	.	.	.	.	.	.	.	C	11.63	1.696418	0.30142	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.15718	2.4;2.4	4.63	3.75	0.43078	.	0.356756	0.26734	N	0.022779	T	0.07728	0.0194	N	0.14661	0.345	0.32004	N	0.602911	B	0.12013	0.005	B	0.12156	0.007	T	0.16041	-1.0416	10	0.16420	T	0.52	-20.6566	4.8016	0.13299	0.0:0.4313:0.4176:0.1511	.	319	Q8IZ52	CHSS2_HUMAN	Q	319;157	ENSP00000243776:R319Q;ENSP00000445571:R157Q	ENSP00000243776:R319Q	R	-	2	0	CHPF	220114024	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	2.032000	0.41127	2.575000	0.86900	0.655000	0.94253	CGA	CHPF	-	pfam_Chond_GalNAc	ENSG00000123989		0.607	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	HGNC	protein_coding	OTTHUMT00000130268.1	126	0.00	0	C	NM_024536		220405780	220405780	-1	no_errors	ENST00000243776	ensembl	human	known	69_37n	missense	115	17.86	25	SNP	0.873	T
DENND1C	79958	genome.wustl.edu	37	19	6480063	6480063	+	Splice_Site	SNP	C	C	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr19:6480063C>T	ENST00000381480.2	-	2	130		c.e2-1		DENND1C_ENST00000543576.1_Intron|DENND1C_ENST00000591030.1_Intron	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C						positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						GGAGCCCCCTCTGTGGGATGC	0.587																																						dbGAP											0													34.0	40.0	38.0					19																	6480063		2008	4167	6175	-	-	-	SO:0001630	splice_region_variant	0			AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.18-1G>A	19.37:g.6480063C>T			B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Splice_Site	SNP	-	e2-1	ENST00000381480.2	37	c.18-1	CCDS45938.1	19	.	.	.	.	.	.	.	.	.	.	c	13.70	2.315315	0.40996	.	.	ENSG00000205744	ENST00000381480	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6945	0.62569	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DENND1C	6431063	0.991000	0.36638	0.568000	0.28447	0.065000	0.16274	2.916000	0.48813	2.287000	0.76781	0.558000	0.71614	.	DENND1C	-	-	ENSG00000205744		0.587	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND1C	HGNC	protein_coding	OTTHUMT00000453332.2	128	0.78	1	C	NM_024898	Intron	6480063	6480063	-1	no_errors	ENST00000381480	ensembl	human	known	69_37n	splice_site	127	22.09	36	SNP	0.919	T
DHX30	22907	genome.wustl.edu	37	3	47891404	47891404	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:47891404C>T	ENST00000445061.1	+	22	3786	c.3379C>T	c.(3379-3381)Cgg>Tgg	p.R1127W	DHX30_ENST00000457607.1_Missense_Mutation_p.R1155W|DHX30_ENST00000446256.2_Missense_Mutation_p.R1088W|DHX30_ENST00000348968.4_Missense_Mutation_p.R1099W|MIR1226_ENST00000408658.1_RNA	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	1127						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TGACCTGCTGCGGCTGGAGGG	0.687											OREG0015550	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													39.0	40.0	40.0					3																	47891404		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.3379C>T	3.37:g.47891404C>T	ENSP00000405620:p.Arg1127Trp	950	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R1127W	ENST00000445061.1	37	c.3379	CCDS2759.1	3	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081443	0.55753	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03717	3.85;3.84;3.84;3.83	5.0	1.76	0.24704	.	0.206543	0.39341	N	0.001396	T	0.05777	0.0151	N	0.19112	0.55	0.36066	D	0.841766	D;D	0.71674	0.997;0.998	P;P	0.57776	0.639;0.827	T	0.42258	-0.9462	10	0.62326	D	0.03	.	9.6039	0.39622	0.3085:0.5892:0.1023:0.0	.	1127;1088	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	W	1088;1127;1099;1155	ENSP00000392601:R1088W;ENSP00000405620:R1127W;ENSP00000343442:R1099W;ENSP00000394682:R1155W	ENSP00000343442:R1099W	R	+	1	2	DHX30	47866408	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.605000	0.36815	0.361000	0.24292	0.462000	0.41574	CGG	DHX30	-	NULL	ENSG00000132153		0.687	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DHX30	HGNC	protein_coding	OTTHUMT00000257495.2	35	0.00	0	C	NM_138615		47891404	47891404	+1	no_errors	ENST00000445061	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	0.999	T
DNAJB4	11080	genome.wustl.edu	37	1	78481910	78481910	+	Silent	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr1:78481910G>A	ENST00000370763.5	+	3	1250	c.993G>A	c.(991-993)agG>agA	p.R331R	GIPC2_ENST00000476882.1_Intron|DNAJB4_ENST00000487931.1_3'UTR	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	331					protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						AAGTACTTAGGAAACATCTTC	0.363																																						dbGAP											0													87.0	89.0	88.0					1																	78481910		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.993G>A	1.37:g.78481910G>A			B2R824|Q13431	Silent	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.R331	ENST00000370763.5	37	c.993	CCDS684.1	1																																																																																			DNAJB4	-	superfamily_HSP40/DnaJ_pept-bd	ENSG00000162616		0.363	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB4	HGNC	protein_coding	OTTHUMT00000098248.3	308	0.32	1	G			78481910	78481910	+1	no_errors	ENST00000370763	ensembl	human	known	69_37n	silent	230	13.53	36	SNP	1.000	A
DYNC1H1	1778	genome.wustl.edu	37	14	102452485	102452486	+	Frame_Shift_Ins	INS	-	-	C			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr14:102452485_102452486insC	ENST00000360184.4	+	8	2087_2088	c.1923_1924insC	c.(1924-1926)cccfs	p.P642fs		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	642	Interaction with DYNC1I2. {ECO:0000250}.|Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TTCGTGACTTGCCCCCTGTGTC	0.53																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.1928dupC	14.37:g.102452490_102452490dupC	ENSP00000348965:p.Pro642fs		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Frame_Shift_Ins	INS	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.V643fs	ENST00000360184.4	37	c.1923_1924	CCDS9966.1	14																																																																																			DYNC1H1	-	pfam_Dynein_heavy_dom-1	ENSG00000197102		0.530	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	46	0.00	0	-	NM_001376		102452485	102452486	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	frame_shift_ins	71	12.35	10	INS	1.000:1.000	C
FES	2242	genome.wustl.edu	37	15	91436887	91436887	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr15:91436887C>A	ENST00000328850.3	+	17	2191	c.2049C>A	c.(2047-2049)gaC>gaA	p.D683E	FES_ENST00000450438.2_Missense_Mutation_p.D555E|FES_ENST00000414248.2_Missense_Mutation_p.D555E|FES_ENST00000394300.3_Missense_Mutation_p.D625E|FES_ENST00000394302.1_Missense_Mutation_p.D542E|FES_ENST00000444422.2_Missense_Mutation_p.D613E	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	683	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CACCCAGGGACCTGGCTGCTC	0.592																																						dbGAP											0													46.0	50.0	49.0					15																	91436887		2198	4298	6496	-	-	-	SO:0001583	missense	0			X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.2049C>A	15.37:g.91436887C>A	ENSP00000331504:p.Asp683Glu		B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_FCH,superfamily_Kinase-like_dom,superfamily_t-SNARE,smart_FCH,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_FCH,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.D683E	ENST00000328850.3	37	c.2049	CCDS10365.1	15	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996475	0.74818	.	.	ENSG00000182511	ENST00000328850;ENST00000414248;ENST00000394302;ENST00000444422;ENST00000394300;ENST00000450438	T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	5.36	3.44	0.39384	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93449	0.7910	H	0.99117	4.435	0.58432	D	0.999999	D;D;B;D;D;D	0.89917	1.0;0.999;0.078;1.0;0.999;1.0	D;D;B;D;D;D	0.91635	0.999;0.999;0.201;0.997;0.999;0.999	D	0.94461	0.7676	10	0.66056	D	0.02	-47.9121	11.609	0.51049	0.0:0.8544:0.0:0.1456	.	665;555;542;625;613;683	B4DUD9;P07332-2;E7ENM8;P07332-3;P07332-4;P07332	.;.;.;.;.;FES_HUMAN	E	683;555;542;613;625;555	ENSP00000331504:D683E;ENSP00000414629:D555E;ENSP00000377839:D542E;ENSP00000400868:D613E;ENSP00000377837:D625E;ENSP00000409915:D555E	ENSP00000331504:D683E	D	+	3	2	FES	89237891	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.152000	0.42272	1.252000	0.44001	0.555000	0.69702	GAC	FES	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000182511		0.592	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FES	HGNC	protein_coding	OTTHUMT00000313497.1	45	0.00	0	C	NM_002005		91436887	91436887	+1	no_errors	ENST00000328850	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	1.000	A
FGF4	2249	genome.wustl.edu	37	11	69588113	69588113	+	Silent	SNP	G	G	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr11:69588113G>T	ENST00000168712.1	-	3	903	c.585C>A	c.(583-585)ccC>ccA	p.P195P	AP001888.1_ENST00000602104.1_5'Flank|FGF4_ENST00000538040.1_5'Flank	NM_002007.2	NP_001998.1	P08620	FGF4_HUMAN	fibroblast growth factor 4	195					apoptotic process involved in morphogenesis (GO:0060561)|cartilage condensation (GO:0001502)|cell-cell signaling (GO:0007267)|chondroblast differentiation (GO:0060591)|cranial suture morphogenesis (GO:0060363)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)	cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			lung(3)	3	Melanoma(5;1.89e-05)		LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		Pentosan Polysulfate(DB00686)	CCTTCATGGTGGGCGACACTC	0.607																																						dbGAP											0													169.0	143.0	152.0					11																	69588113		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			M17446	CCDS8194.1	11q13.3	2014-01-30	2008-08-01		ENSG00000075388	ENSG00000075388		"""Endogenous ligands"""	3682	protein-coding gene	gene with protein product	"""human stomach cancer, transforming factor from FGF-related oncogene"", ""kaposi sarcoma oncogene"", ""transforming protein KS3"""	164980	"""heparin secretory transforming protein 1"""	HSTF1		1611909	Standard	NM_002007		Approved	K-FGF, HBGF-4, HST, HST-1, KFGF	uc001opg.1	P08620	OTTHUMG00000167887	ENST00000168712.1:c.585C>A	11.37:g.69588113G>T			B7U994	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.P195	ENST00000168712.1	37	c.585	CCDS8194.1	11																																																																																			FGF4	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	ENSG00000075388		0.607	FGF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF4	HGNC	protein_coding	OTTHUMT00000396834.2	334	0.00	0	G	NM_002007		69588113	69588113	-1	no_errors	ENST00000168712	ensembl	human	known	69_37n	silent	279	20.68	73	SNP	0.999	T
FMO1	2326	genome.wustl.edu	37	1	171251383	171251383	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr1:171251383C>A	ENST00000354841.4	+	6	1225	c.1094C>A	c.(1093-1095)aCc>aAc	p.T365N	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Missense_Mutation_p.T302N|FMO1_ENST00000367750.3_Missense_Mutation_p.T365N	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	365					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	CAAAAGCCAACCCTGGCCATT	0.478																																						dbGAP											0													112.0	101.0	105.0					1																	171251383		2203	4300	6503	-	-	-	SO:0001583	missense	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.1094C>A	1.37:g.171251383C>A	ENSP00000346901:p.Thr365Asn		A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.T365N	ENST00000354841.4	37	c.1094	CCDS1294.1	1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901544	0.92035	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.55930	0.49;0.49;0.49	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	M	0.65320	2	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.995;0.998	D;D;D	0.77557	0.99;0.984;0.982	T	0.54596	-0.8270	10	0.26408	T	0.33	-9.7098	19.3467	0.94365	0.0:1.0:0.0:0.0	.	302;365;365	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	N	365;302;365	ENSP00000356724:T365N;ENSP00000385543:T302N;ENSP00000346901:T365N	ENSP00000346901:T365N	T	+	2	0	FMO1	169518007	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	7.808000	0.86044	2.868000	0.98415	0.557000	0.71058	ACC	FMO1	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase	ENSG00000010932		0.478	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	191	0.00	0	C	NM_002021		171251383	171251383	+1	no_errors	ENST00000354841	ensembl	human	known	69_37n	missense	270	15.84	51	SNP	1.000	A
GABARAP	11337	genome.wustl.edu	37	17	7145570	7145570	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr17:7145570T>C	ENST00000302386.5	-	1	519	c.80A>G	c.(79-81)gAc>gGc	p.D27G	PHF23_ENST00000571362.1_5'Flank|PHF23_ENST00000320316.3_5'Flank|GABARAP_ENST00000571129.1_5'Flank|CTD-2545G14.7_ENST00000570760.2_Intron|GABARAP_ENST00000573928.1_Missense_Mutation_p.D27G|PHF23_ENST00000576955.1_5'Flank|GABARAP_ENST00000577035.1_5'Flank|GABARAP_ENST00000571253.1_5'UTR	NM_007278.1	NP_009209.1	O95166	GBRAP_HUMAN	GABA(A) receptor-associated protein	27					autophagy (GO:0006914)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|microtubule cytoskeleton organization (GO:0000226)|protein targeting (GO:0006605)|synaptic transmission (GO:0007268)	actin cytoskeleton (GO:0015629)|autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)|cell body (GO:0044297)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-tubulin binding (GO:0048487)|GABA receptor binding (GO:0050811)			breast(1)|lung(2)	3						CGGCACCCGGTCCGGGTATTT	0.637																																						dbGAP											0													41.0	45.0	43.0					17																	7145570		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF161586	CCDS11092.1	17p13.1	2014-02-12			ENSG00000170296	ENSG00000170296			4067	protein-coding gene	gene with protein product		605125				9892355	Standard	NM_007278		Approved	MM46, ATG8A	uc002gfb.3	O95166	OTTHUMG00000102156	ENST00000302386.5:c.80A>G	17.37:g.7145570T>C	ENSP00000306866:p.Asp27Gly			Missense_Mutation	SNP	pfam_Atg8_ubiquitin-like,pfam_Autophagy-rel_prot_12	p.D27G	ENST00000302386.5	37	c.80	CCDS11092.1	17	.	.	.	.	.	.	.	.	.	.	T	31	5.060525	0.93846	.	.	ENSG00000170296	ENST00000302386	T	0.51071	0.72	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.55625	0.1932	M	0.86502	2.82	0.80722	D	1	B	0.09022	0.002	B	0.20184	0.028	T	0.58831	-0.7567	10	0.59425	D	0.04	-4.7576	13.311	0.60380	0.0:0.0:0.0:1.0	.	27	O95166	GBRAP_HUMAN	G	27	ENSP00000306866:D27G	ENSP00000306866:D27G	D	-	2	0	GABARAP	7086294	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.158000	0.77470	2.020000	0.59435	0.528000	0.53228	GAC	GABARAP	-	pfam_Atg8_ubiquitin-like	ENSG00000170296		0.637	GABARAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABARAP	HGNC	protein_coding	OTTHUMT00000220000.2	83	0.00	0	T			7145570	7145570	-1	no_errors	ENST00000302386	ensembl	human	known	69_37n	missense	63	20.48	17	SNP	1.000	C
GDF6	392255	genome.wustl.edu	37	8	97157010	97157010	+	Silent	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr8:97157010G>A	ENST00000287020.5	-	2	1248	c.1149C>T	c.(1147-1149)tgC>tgT	p.C383C		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	383					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					ATACACCCTCGCAGTGATAGG	0.637																																						dbGAP											0													118.0	101.0	107.0					8																	97157010		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.1149C>T	8.37:g.97157010G>A			Q6PI58	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.C383	ENST00000287020.5	37	c.1149	CCDS34926.1	8	.	.	.	.	.	.	.	.	.	.	G	8.912	0.958871	0.18507	.	.	ENSG00000156466	ENST00000435084	.	.	.	4.72	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	11.8931	0.52641	0.0858:0.0:0.9142:0.0	.	.	.	.	X	300	.	ENSP00000412749:R300X	R	-	1	2	GDF6	97226186	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.412000	0.52679	1.213000	0.43380	-0.262000	0.10625	CGA	GDF6	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000156466		0.637	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF6	HGNC	protein_coding	OTTHUMT00000379862.2	175	0.00	0	G	NM_001001557		97157010	97157010	-1	no_errors	ENST00000287020	ensembl	human	known	69_37n	silent	223	20.00	56	SNP	1.000	A
HERC1	8925	genome.wustl.edu	37	15	63970199	63970199	+	Silent	SNP	G	G	C	rs183440649		TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr15:63970199G>C	ENST00000443617.2	-	37	7002	c.6915C>G	c.(6913-6915)ccC>ccG	p.P2305P	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2305					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CAGCCAGCACGGGCCACACCT	0.547																																						dbGAP											0													121.0	129.0	126.0					15																	63970199		2107	4228	6335	-	-	-	SO:0001819	synonymous_variant	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.6915C>G	15.37:g.63970199G>C			Q8IW65	Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.P2305	ENST00000443617.2	37	c.6915	CCDS45277.1	15																																																																																			HERC1	-	NULL	ENSG00000103657		0.547	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	402	0.00	0	G	NM_003922		63970199	63970199	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	silent	413	18.11	92	SNP	0.000	C
HOXB2	3212	genome.wustl.edu	37	17	46620904	46620904	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr17:46620904C>A	ENST00000330070.4	-	2	1764	c.597G>T	c.(595-597)aaG>aaT	p.K199N	HOXB-AS1_ENST00000435312.1_RNA|HOXB2_ENST00000504772.3_5'Flank|HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000504972.3_RNA	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	199					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						GCGTCTGCCGCTTGTGCTTCA	0.687																																						dbGAP											0													36.0	40.0	39.0					17																	46620904		2172	4239	6411	-	-	-	SO:0001583	missense	0				CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.597G>T	17.37:g.46620904C>A	ENSP00000331741:p.Lys199Asn		P10913|P17485	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	p.K199N	ENST00000330070.4	37	c.597	CCDS11527.1	17	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127483	0.77549	.	.	ENSG00000173917	ENST00000330070;ENST00000326226	D	0.98313	-4.86	4.56	1.29	0.21616	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99174	0.9714	H	0.97315	3.98	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98888	1.0772	10	0.87932	D	0	.	10.4677	0.44618	0.0:0.7451:0.0:0.2549	.	199	P14652	HXB2_HUMAN	N	199;108	ENSP00000331741:K199N	ENSP00000316334:K108N	K	-	3	2	HOXB2	43975903	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.519000	0.22862	0.569000	0.29329	0.556000	0.70494	AAG	HOXB2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	ENSG00000173917		0.687	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB2	HGNC	protein_coding	OTTHUMT00000358384.2	8	0.00	0	C			46620904	46620904	-1	no_errors	ENST00000330070	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	1.000	A
IFT81	28981	genome.wustl.edu	37	12	110566885	110566885	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr12:110566885G>A	ENST00000242591.5	+	4	885	c.379G>A	c.(379-381)Gta>Ata	p.V127I	IFT81_ENST00000552912.1_Missense_Mutation_p.V127I|IFT81_ENST00000361948.4_Missense_Mutation_p.V127I	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	127					cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						AAAACTTGAGGTACCAAGTGA	0.363																																						dbGAP											0													73.0	73.0	73.0					12																	110566885		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.379G>A	12.37:g.110566885G>A	ENSP00000242591:p.Val127Ile		Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Missense_Mutation	SNP	NULL	p.V127I	ENST00000242591.5	37	c.379	CCDS41831.1	12	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408067	0.42715	.	.	ENSG00000122970	ENST00000361948;ENST00000552912;ENST00000242591;ENST00000546374	T;T	0.76316	1.06;-1.01	5.55	5.55	0.83447	.	0.056058	0.64402	D	0.000001	T	0.66386	0.2784	N	0.16656	0.425	0.80722	D	1	B;P	0.35155	0.416;0.487	B;B	0.35470	0.128;0.203	T	0.63752	-0.6566	10	0.21540	T	0.41	-16.7823	19.5063	0.95118	0.0:0.0:1.0:0.0	.	127;127	Q8WYA0;Q8WYA0-3	IFT81_HUMAN;.	I	127	ENSP00000355372:V127I;ENSP00000446950:V127I	ENSP00000242591:V127I	V	+	1	0	IFT81	109051268	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.568000	0.82369	2.612000	0.88384	0.467000	0.42956	GTA	IFT81	-	NULL	ENSG00000122970		0.363	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IFT81	HGNC	protein_coding	OTTHUMT00000403529.1	195	0.00	0	G	NM_014055		110566885	110566885	+1	no_errors	ENST00000242591	ensembl	human	known	69_37n	missense	177	34.69	94	SNP	0.998	A
IGLC7	28834	genome.wustl.edu	37	22	23264956	23264956	+	RNA	SNP	C	C	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr22:23264956C>A	ENST00000390331.2	+	0	191				IGLJ7_ENST00000390330.2_RNA			A0M8Q6	LAC7_HUMAN	immunoglobulin lambda constant 7						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										AAAGCAACAACAAGTATGCGG	0.607																																						dbGAP											0													84.0	86.0	85.0					22																	23264956		2203	4300	6503	-	-	-			0			X51755		22q11.2	2012-02-08			ENSG00000211685	ENSG00000211685		"""Immunoglobulins / IGL locus"""	5861	other	immunoglobulin gene							Standard	NG_000002		Approved			A0M8Q6	OTTHUMG00000151017		22.37:g.23264956C>A				Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.T64K	ENST00000390331.2	37	c.191		22																																																																																			IGLC7	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211685		0.607	IGLC7-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGLC7	HGNC	IG_C_gene	OTTHUMT00000320966.4	217	0.00	0	C	NG_000002		23264956	23264956	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390331	ensembl	human	known	69_37n	missense	148	21.69	41	SNP	0.973	A
IRAK4	51135	genome.wustl.edu	37	12	44180307	44180307	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr12:44180307G>T	ENST00000448290.2	+	11	1365	c.1294G>T	c.(1294-1296)Gtt>Ttt	p.V432F	IRAK4_ENST00000440781.2_Missense_Mutation_p.V308F|IRAK4_ENST00000431837.1_Missense_Mutation_p.V308F|IRAK4_ENST00000551736.1_Missense_Mutation_p.V432F	NM_016123.3	NP_057207.2	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	432	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			V -> G (in Ref. 2; AAD42884). {ECO:0000305}.	cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)					all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		TATGTACTCTGTTGCTAGTCA	0.308																																						dbGAP											0													70.0	82.0	78.0					12																	44180307		2202	4295	6497	-	-	-	SO:0001583	missense	0			AF155118	CCDS8744.1, CCDS44862.1	12q12	2014-09-17				ENSG00000198001			17967	protein-coding gene	gene with protein product		606883				3772297, 10508479	Standard	NM_001114182		Approved	NY-REN-64	uc001rnt.3	Q9NWZ3		ENST00000448290.2:c.1294G>T	12.37:g.44180307G>T	ENSP00000390651:p.Val432Phe		Q69FE1|Q8TDF7|Q9Y589	Missense_Mutation	SNP	pirsf_Interleukin-1_rcpt-assoc_kin4,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V432F	ENST00000448290.2	37	c.1294	CCDS8744.1	12	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279998	0.59758	.	.	ENSG00000198001	ENST00000440781;ENST00000431837;ENST00000448290;ENST00000551736	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	6.02	0.535	0.17133	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.435811	0.24415	N	0.038737	T	0.46034	0.1372	L	0.28649	0.875	0.30326	N	0.787151	P	0.42518	0.782	B	0.41723	0.365	T	0.50101	-0.8867	10	0.87932	D	0	-10.8891	6.1969	0.20555	0.4805:0.1301:0.3894:0.0	.	432	Q9NWZ3	IRAK4_HUMAN	F	308;308;432;432	ENSP00000408734:V308F;ENSP00000390327:V308F;ENSP00000390651:V432F;ENSP00000446490:V432F	ENSP00000390327:V308F	V	+	1	0	IRAK4	42466574	0.460000	0.25776	0.971000	0.41717	0.973000	0.67179	-0.024000	0.12435	0.157000	0.19338	-0.145000	0.13849	GTT	IRAK4	-	pirsf_Interleukin-1_rcpt-assoc_kin4,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198001		0.308	IRAK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK4	HGNC	protein_coding	OTTHUMT00000403947.1	75	0.00	0	G			44180307	44180307	+1	no_errors	ENST00000448290	ensembl	human	known	69_37n	missense	78	19.59	19	SNP	0.892	T
KBTBD8	84541	genome.wustl.edu	37	3	67054333	67054333	+	Silent	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:67054333G>A	ENST00000417314.2	+	3	991	c.942G>A	c.(940-942)gtG>gtA	p.V314V	KBTBD8_ENST00000460576.1_Intron|KBTBD8_ENST00000295568.4_Silent_p.V288V			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	314						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		CAGGAAGGGTGTTTAAACTAT	0.423																																						dbGAP											0													137.0	133.0	134.0					3																	67054333		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.942G>A	3.37:g.67054333G>A			B4DTW6|Q96JI5	Silent	SNP	pfam_BACK,pfam_BTB_POZ,pfam_Kelch_1,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V314	ENST00000417314.2	37	c.942	CCDS2906.2	3																																																																																			KBTBD8	-	pirsf_Kelch-like_gigaxonin	ENSG00000163376		0.423	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD8	HGNC	protein_coding	OTTHUMT00000352189.1	133	0.00	0	G	NM_032505		67054333	67054333	+1	no_errors	ENST00000417314	ensembl	human	known	69_37n	silent	168	16.00	32	SNP	0.999	A
KCNK4	50801	genome.wustl.edu	37	11	64067025	64067026	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr11:64067025_64067026insT	ENST00000539216.1	+	6	1369_1370	c.1009_1010insT	c.(1009-1011)ctgfs	p.L337fs	KCNK4_ENST00000394525.2_Frame_Shift_Ins_p.L337fs|KCNK4_ENST00000538767.1_Frame_Shift_Ins_p.G222fs|TEX40_ENST00000328404.6_5'Flank|TEX40_ENST00000539943.1_5'Flank|KCNK4_ENST00000422670.2_Frame_Shift_Ins_p.L337fs|RP11-783K16.10_ENST00000539086.1_RNA			Q9NYG8	KCNK4_HUMAN	potassium channel, subfamily K, member 4	337					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(2)|large_intestine(2)|lung(3)|prostate(2)|urinary_tract(1)	10						GGCCTCGGCCCTGGATTATCCC	0.743																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF247042	CCDS8067.1	11q13	2012-03-07			ENSG00000182450	ENSG00000182450		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6279	protein-coding gene	gene with protein product		605720				10767409, 16382106	Standard	NM_033310		Approved	K2p4.1, TRAAK	uc001nzk.1	Q9NYG8	OTTHUMG00000168006	ENST00000539216.1:c.1010dupT	11.37:g.64067026_64067026dupT	ENSP00000444948:p.Leu337fs		B5TJL1|Q96T94	Frame_Shift_Ins	INS	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.D338fs	ENST00000539216.1	37	c.1009_1010	CCDS8067.1	11																																																																																			KCNK4	-	prints_2pore_dom_K_chnl_TRAAK	ENSG00000182450		0.743	KCNK4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNK4	HGNC	protein_coding	OTTHUMT00000396430.1	9	0.00	0	-	NM_033311		64067025	64067026	+1	no_errors	ENST00000394525	ensembl	human	known	69_37n	frame_shift_ins	2	50.00	2	INS	0.987:1.000	T
CEMIP	57214	genome.wustl.edu	37	15	81176528	81176528	+	Silent	SNP	T	T	C			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr15:81176528T>C	ENST00000394685.3	+	7	1049	c.630T>C	c.(628-630)taT>taC	p.Y210Y	KIAA1199_ENST00000220244.3_Silent_p.Y210Y|KIAA1199_ENST00000356249.5_Silent_p.Y210Y			Q8WUJ3	CEMIP_HUMAN		210					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TTGACACCTATAGATCCAAGA	0.473																																						dbGAP											0													137.0	133.0	134.0					15																	81176528		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000394685.3:c.630T>C	15.37:g.81176528T>C			Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.Y210	ENST00000394685.3	37	c.630	CCDS10315.1	15																																																																																			KIAA1199	-	NULL	ENSG00000103888		0.473	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	239	0.00	0	T			81176528	81176528	+1	no_errors	ENST00000220244	ensembl	human	known	69_37n	silent	218	23.78	68	SNP	0.125	C
KIAA1257	57501	genome.wustl.edu	37	3	128707653	128707653	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:128707653A>G	ENST00000265068.5	-	3	538	c.371T>C	c.(370-372)cTg>cCg	p.L124P	KIAA1257_ENST00000510149.1_5'UTR|KIAA1257_ENST00000511438.1_Missense_Mutation_p.L124P|KIAA1257_ENST00000515659.1_Missense_Mutation_p.L12P	NM_020741.2	NP_065792.1	Q9ULG3	K1257_HUMAN	KIAA1257	124										breast(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(2)	14						ATCGTCCGGCAGAAGGAAATA	0.388																																						dbGAP											0													112.0	115.0	114.0					3																	128707653		2027	4187	6214	-	-	-	SO:0001583	missense	0			AB033083	CCDS46905.1	3q21.3	2011-11-07			ENSG00000114656	ENSG00000114656			29231	protein-coding gene	gene with protein product						10574462	Standard	NM_020741		Approved		uc003elj.4	Q9ULG3	OTTHUMG00000159946	ENST00000265068.5:c.371T>C	3.37:g.128707653A>G	ENSP00000265068:p.Leu124Pro		Q8IXY7|Q8N5T4	Missense_Mutation	SNP	NULL	p.L124P	ENST00000265068.5	37	c.371	CCDS46905.1	3	.	.	.	.	.	.	.	.	.	.	A	16.32	3.090187	0.55968	.	.	ENSG00000114656	ENST00000511438;ENST00000265068;ENST00000515659	.	.	.	5.67	5.67	0.87782	.	0.000000	0.36972	N	0.002314	T	0.65637	0.2710	L	0.32530	0.975	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68127	-0.5491	9	0.62326	D	0.03	-15.3421	12.3033	0.54887	1.0:0.0:0.0:0.0	.	124;124	Q9ULG3;D6RH05	K1257_HUMAN;.	P	124;124;12	.	ENSP00000265068:L124P	L	-	2	0	KIAA1257	130190343	1.000000	0.71417	0.997000	0.53966	0.341000	0.28922	5.907000	0.69908	2.163000	0.67991	0.528000	0.53228	CTG	KIAA1257	-	NULL	ENSG00000114656		0.388	KIAA1257-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	KIAA1257	HGNC	protein_coding	OTTHUMT00000358430.1	469	0.00	0	A	NM_020741		128707653	128707653	-1	no_errors	ENST00000265068	ensembl	human	known	69_37n	missense	484	15.65	90	SNP	1.000	G
MAP3K1	4214	genome.wustl.edu	37	5	56160565	56160565	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr5:56160565A>C	ENST00000399503.3	+	4	839	c.839A>C	c.(838-840)cAg>cCg	p.Q280P	AC008937.2_ENST00000415589.1_RNA	NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	280					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GTGAAGTTTCAGAGTGGCAGA	0.458																																						dbGAP											0													64.0	66.0	65.0					5																	56160565		1853	4104	5957	-	-	-	SO:0001583	missense	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.839A>C	5.37:g.56160565A>C	ENSP00000382423:p.Gln280Pro			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.Q280P	ENST00000399503.3	37	c.839	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	A	16.99	3.274080	0.59649	.	.	ENSG00000095015	ENST00000399503	T	0.69175	-0.38	5.63	5.63	0.86233	.	0.134244	0.50627	D	0.000113	T	0.66973	0.2844	N	0.08118	0	0.50313	D	0.999868	D	0.67145	0.996	D	0.72982	0.979	T	0.74506	-0.3643	10	0.59425	D	0.04	.	16.1307	0.81436	1.0:0.0:0.0:0.0	.	280	Q13233	M3K1_HUMAN	P	280	ENSP00000382423:Q280P	ENSP00000382423:Q280P	Q	+	2	0	MAP3K1	56196322	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.052000	0.89448	2.263000	0.75096	0.533000	0.62120	CAG	MAP3K1	-	NULL	ENSG00000095015		0.458	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	117	0.00	0	A	XM_042066		56160565	56160565	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	missense	110	14.73	19	SNP	1.000	C
MAP3K1	4214	genome.wustl.edu	37	5	56177598	56177598	+	Frame_Shift_Del	DEL	G	G	-	rs367884272	byFrequency	TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr5:56177598delG	ENST00000399503.3	+	14	2571	c.2571delG	c.(2569-2571)atgfs	p.M857fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	857					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GCCGTTTGATGGCTATTGCAG	0.478																																						dbGAP											0													108.0	102.0	104.0					5																	56177598		1956	4155	6111	-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2571delG	5.37:g.56177598delG	ENSP00000382423:p.Met857fs			Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.A858fs	ENST00000399503.3	37	c.2571	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.478	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	216	0.00	0	G	XM_042066		56177598	56177598	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	179	20.09	45	DEL	1.000	-
MKNK2	2872	genome.wustl.edu	37	19	2041144	2041144	+	Silent	SNP	G	G	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr19:2041144G>T	ENST00000591601.1	-	11	1040	c.1005C>A	c.(1003-1005)gcC>gcA	p.A335A	MKNK2_ENST00000309340.7_Silent_p.A335A|MKNK2_ENST00000591142.1_Silent_p.A79A|MKNK2_ENST00000541165.1_Silent_p.A204A|MKNK2_ENST00000591588.1_Silent_p.A79A|MKNK2_ENST00000588014.1_Silent_p.A79A|MKNK2_ENST00000250896.3_Silent_p.A335A			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	335	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGAGATGTGGGCCCAGTCCT	0.602																																						dbGAP											0													198.0	150.0	167.0					19																	2041144		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.1005C>A	19.37:g.2041144G>T			Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A335	ENST00000591601.1	37	c.1005	CCDS12080.1	19																																																																																			MKNK2	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000099875		0.602	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKNK2	HGNC	protein_coding	OTTHUMT00000449312.1	164	0.00	0	G	NM_199054		2041144	2041144	-1	no_errors	ENST00000250896	ensembl	human	known	69_37n	silent	221	20.50	57	SNP	0.993	T
MYB	4602	genome.wustl.edu	37	6	135511399	135511399	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr6:135511399G>A	ENST00000367814.4	+	5	627	c.441G>A	c.(439-441)tgG>tgA	p.W147*	MYB_ENST00000528774.1_Nonsense_Mutation_p.W147*|MYB_ENST00000534121.1_Nonsense_Mutation_p.W147*|MYB_ENST00000316528.8_Nonsense_Mutation_p.W147*|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000420123.2_Nonsense_Mutation_p.W123*|MYB_ENST00000527615.1_Nonsense_Mutation_p.W147*|MYB_ENST00000341911.5_Nonsense_Mutation_p.W147*|MYB_ENST00000533624.1_Nonsense_Mutation_p.W147*|MYB_ENST00000525369.1_Nonsense_Mutation_p.W147*|MYB_ENST00000442647.2_Nonsense_Mutation_p.W147*|MYB_ENST00000534044.1_Nonsense_Mutation_p.W147*	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	147	HTH myb-type 3. {ECO:0000255|PROSITE- ProRule:PRU00625}.|Interaction with HIPK2 and NLK. {ECO:0000250}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		AAACCTCCTGGACAGAAGAGG	0.443			T	NFIB	adenoid cystic carcinoma																																	dbGAP		Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0													77.0	77.0	77.0					6																	135511399		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.441G>A	6.37:g.135511399G>A	ENSP00000356788:p.Trp147*		E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Nonsense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.W147*	ENST00000367814.4	37	c.441	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	G	34	5.373547	0.95923	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000420123;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624;ENST00000430686	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.6833	20.0726	0.97729	0.0:0.0:1.0:0.0	.	.	.	.	X	147;147;147;147;147;147;123;147;147;147;147;147;101	.	ENSP00000237302:W147X	W	+	3	0	MYB	135553092	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.738000	0.93877	0.655000	0.94253	TGG	MYB	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000118513		0.443	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	287	0.00	0	G			135511399	135511399	+1	no_errors	ENST00000341911	ensembl	human	known	69_37n	nonsense	234	22.00	66	SNP	1.000	A
MYBPC2	4606	genome.wustl.edu	37	19	50939058	50939058	+	Silent	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr19:50939058G>A	ENST00000357701.5	+	3	186	c.135G>A	c.(133-135)ccG>ccA	p.P45P		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	45					cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		ACCAGTCCCCGACTGCAGAGG	0.652																																						dbGAP											0													23.0	26.0	25.0					19																	50939058		1882	4101	5983	-	-	-	SO:0001819	synonymous_variant	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.135G>A	19.37:g.50939058G>A			A1L4G9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P45	ENST00000357701.5	37	c.135	CCDS46152.1	19																																																																																			MYBPC2	-	NULL	ENSG00000086967		0.652	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	118	0.00	0	G	NM_004533		50939058	50939058	+1	no_errors	ENST00000357701	ensembl	human	known	69_37n	silent	78	20.41	20	SNP	0.117	A
MYBPC2	4606	genome.wustl.edu	37	19	50964798	50964798	+	Splice_Site	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr19:50964798G>A	ENST00000357701.5	+	25	2982		c.e25-1			NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type						cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CCCCACACTAGGAGTGGTTCA	0.517											OREG0025636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													75.0	73.0	74.0					19																	50964798		2033	4193	6226	-	-	-	SO:0001630	splice_region_variant	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2932-1G>A	19.37:g.50964798G>A		973	A1L4G9	Splice_Site	SNP	-	e25-1	ENST00000357701.5	37	c.2932-1	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	g	21.2	4.116537	0.77323	.	.	ENSG00000086967	ENST00000357701	.	.	.	4.55	4.55	0.56014	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4672	0.84083	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYBPC2	55656610	1.000000	0.71417	0.993000	0.49108	0.693000	0.40251	8.921000	0.92784	2.254000	0.74563	0.550000	0.68814	.	MYBPC2	-	-	ENSG00000086967		0.517	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	114	0.00	0	G	NM_004533	Intron	50964798	50964798	+1	no_errors	ENST00000357701	ensembl	human	known	69_37n	splice_site	114	36.67	66	SNP	1.000	A
MYH13	8735	genome.wustl.edu	37	17	10213133	10213133	+	Silent	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr17:10213133G>A	ENST00000418404.3	-	33	4834	c.4671C>T	c.(4669-4671)caC>caT	p.H1557H	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Silent_p.H1557H			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1557					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TGCTCTCCTCGTGTTCCAAGG	0.498																																						dbGAP											0													24.0	22.0	23.0					17																	10213133		2004	4176	6180	-	-	-	SO:0001819	synonymous_variant	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4671C>T	17.37:g.10213133G>A			O95252|Q9P0U8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.H1557	ENST00000418404.3	37	c.4671	CCDS45613.1	17																																																																																			MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.498	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	118	0.84	1	G	NM_003802		10213133	10213133	-1	no_errors	ENST00000252172	ensembl	human	known	69_37n	silent	101	14.29	17	SNP	0.622	A
NALCN	259232	genome.wustl.edu	37	13	101756927	101756927	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr13:101756927A>T	ENST00000251127.6	-	24	2792	c.2711T>A	c.(2710-2712)aTg>aAg	p.M904K		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	904					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGACTCAAACATCATGGAAAT	0.453																																						dbGAP											0													147.0	130.0	136.0					13																	101756927		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2711T>A	13.37:g.101756927A>T	ENSP00000251127:p.Met904Lys		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.M904K	ENST00000251127.6	37	c.2711	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	28.3	4.904151	0.92035	.	.	ENSG00000102452	ENST00000251127	D	0.97505	-4.41	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.97062	0.9040	M	0.73962	2.25	0.80722	D	1	P	0.50710	0.938	P	0.47673	0.554	D	0.97427	1.0013	10	0.72032	D	0.01	.	16.2813	0.82687	1.0:0.0:0.0:0.0	.	904	Q8IZF0	NALCN_HUMAN	K	904	ENSP00000251127:M904K	ENSP00000251127:M904K	M	-	2	0	NALCN	100554928	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.528000	0.81941	2.244000	0.73946	0.533000	0.62120	ATG	NALCN	-	NULL	ENSG00000102452		0.453	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	265	0.00	0	A	NM_052867		101756927	101756927	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	missense	286	20.28	73	SNP	1.000	T
PCNXL3	399909	genome.wustl.edu	37	11	65396838	65396838	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr11:65396838G>A	ENST00000355703.3	+	25	4491	c.3952G>A	c.(3952-3954)Gtg>Atg	p.V1318M		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1318						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CACTAAACGTGTGGATCATTC	0.592																																						dbGAP											0													70.0	68.0	69.0					11																	65396838		2121	4226	6347	-	-	-	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.3952G>A	11.37:g.65396838G>A	ENSP00000347931:p.Val1318Met		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.V1318M	ENST00000355703.3	37	c.3952	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.107460	0.94292	.	.	ENSG00000197136	ENST00000355703	T	0.09350	2.99	4.92	4.92	0.64577	.	0.073064	0.53938	D	0.000046	T	0.36331	0.0963	M	0.83953	2.67	0.50632	D	0.999888	D;D	0.71674	0.97;0.998	P;D	0.78314	0.847;0.991	T	0.15435	-1.0437	10	0.59425	D	0.04	.	15.715	0.77661	0.0:0.0:1.0:0.0	.	205;1318	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	M	1318	ENSP00000347931:V1318M	ENSP00000347931:V1318M	V	+	1	0	PCNXL3	65153414	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.179000	0.71974	2.589000	0.87451	0.555000	0.69702	GTG	PCNXL3	-	NULL	ENSG00000197136		0.592	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	159	0.00	0	G	NM_032223		65396838	65396838	+1	no_errors	ENST00000355703	ensembl	human	known	69_37n	missense	118	37.57	71	SNP	1.000	A
PDHA2	5161	genome.wustl.edu	37	4	96761984	96761984	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr4:96761984G>T	ENST00000295266.4	+	1	746	c.683G>T	c.(682-684)gGa>gTa	p.G228V		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	228					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TATGGAATGGGAACATCTACT	0.463																																						dbGAP											0													99.0	102.0	101.0					4																	96761984		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.683G>T	4.37:g.96761984G>T	ENSP00000295266:p.Gly228Val		B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.G228V	ENST00000295266.4	37	c.683	CCDS3644.1	4	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469841	0.43839	.	.	ENSG00000163114	ENST00000295266	D	0.96619	-4.07	4.91	4.07	0.47477	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98720	0.9570	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98839	1.0754	10	0.87932	D	0	-5.2755	11.3377	0.49513	0.0887:0.0:0.9113:0.0	.	228	P29803	ODPAT_HUMAN	V	228	ENSP00000295266:G228V	ENSP00000295266:G228V	G	+	2	0	PDHA2	96981007	1.000000	0.71417	0.872000	0.34217	0.185000	0.23345	8.897000	0.92532	1.449000	0.47699	0.467000	0.42956	GGA	PDHA2	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	ENSG00000163114		0.463	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	352	0.00	0	G			96761984	96761984	+1	no_errors	ENST00000295266	ensembl	human	known	69_37n	missense	322	13.44	50	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	273	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	141	50.70	145	SNP	1.000	G
PLEKHG1	57480	genome.wustl.edu	37	6	151055039	151055039	+	Silent	SNP	G	G	A	rs147707807	byFrequency	TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr6:151055039G>A	ENST00000358517.2	+	2	433	c.222G>A	c.(220-222)acG>acA	p.T74T	PLEKHG1_ENST00000367328.1_Silent_p.T74T			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	74							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T74T(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ACCCCGCCACGGGGCAACAGA	0.607																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											38.0	42.0	41.0					6																	151055039		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.222G>A	6.37:g.151055039G>A			Q5T1F2	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T74	ENST00000358517.2	37	c.222	CCDS34552.1	6																																																																																			PLEKHG1	-	NULL	ENSG00000120278		0.607	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	HGNC	protein_coding	OTTHUMT00000042691.1	76	0.00	0	G			151055039	151055039	+1	no_errors	ENST00000358517	ensembl	human	known	69_37n	silent	64	22.89	19	SNP	0.011	A
POLR2J4	84820	genome.wustl.edu	37	7	44009429	44009429	+	RNA	DEL	A	A	-	rs545588215		TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr7:44009429delA	ENST00000427076.1	-	0	1101				RP5-1165K10.2_ENST00000454572.1_RNA	NR_003655.2				polymerase (RNA) II (DNA directed) polypeptide J4, pseudogene																		CATCAGGGTCAACCTCCGTCA	0.687																																						dbGAP											0																																										-	-	-			0					7p13	2008-08-21			ENSG00000214783	ENSG00000214783			28195	pseudogene	pseudogene						15586814	Standard	NR_003655		Approved	MGC13098	uc010kxw.2		OTTHUMG00000155253		7.37:g.44009429delA				RNA	DEL	-	NULL	ENST00000427076.1	37	NULL		7																																																																																			POLR2J4	-	-	ENSG00000214783		0.687	POLR2J4-002	KNOWN	basic|readthrough_transcript	processed_transcript	POLR2J4	HGNC	processed_transcript	OTTHUMT00000473169.1	8	0.00	0	A	NR_003655		44009429	44009429	-1	no_errors	ENST00000427076	ensembl	human	known	69_37n	rna	3	33.33	2	DEL	0.991	-
POLR3B	55703	genome.wustl.edu	37	12	106824180	106824180	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr12:106824180G>A	ENST00000228347.4	+	14	1615	c.1393G>A	c.(1393-1395)Gtg>Atg	p.V465M	POLR3B_ENST00000539066.1_Missense_Mutation_p.V407M	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	465					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						AACGAGAAAAGTGAGTGGTCC	0.512																																						dbGAP											0													119.0	113.0	115.0					12																	106824180		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.1393G>A	12.37:g.106824180G>A	ENSP00000228347:p.Val465Met		A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_4,pfam_RNA_pol_Rpb2_5	p.V465M	ENST00000228347.4	37	c.1393	CCDS9105.1	12	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005752	0.93287	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066	T;T	0.75938	-0.98;-0.98	5.56	5.56	0.83823	RNA polymerase Rpb2, domain 3 (1);	0.000000	0.85682	D	0.000000	D	0.83101	0.5181	L	0.48362	1.52	0.80722	D	1	D	0.64830	0.994	D	0.69479	0.964	D	0.84270	0.0488	10	0.87932	D	0	-24.374	19.5257	0.95206	0.0:0.0:1.0:0.0	.	465	Q9NW08	RPC2_HUMAN	M	465;465;407	ENSP00000228347:V465M;ENSP00000445721:V407M	ENSP00000228347:V465M	V	+	1	0	POLR3B	105348310	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.429000	0.97481	2.589000	0.87451	0.655000	0.94253	GTG	POLR3B	-	pfam_RNA_pol_Rpb2_3	ENSG00000013503		0.512	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3B	HGNC	protein_coding	OTTHUMT00000407166.1	172	0.00	0	G	NM_018082		106824180	106824180	+1	no_errors	ENST00000228347	ensembl	human	known	69_37n	missense	197	16.17	38	SNP	1.000	A
PRNT	149830	genome.wustl.edu	37	20	4713295	4713296	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr20:4713295_4713296insA	ENST00000326539.2	-	2	964_965	c.27_28insT	c.(25-30)tttgcafs	p.A10fs	PRNT_ENST00000423718.2_Frame_Shift_Ins_p.A10fs|PRNT_ENST00000418528.1_Frame_Shift_Ins_p.A10fs			Q86SH4	PRNT_HUMAN	prion protein (testis specific)	10						extracellular region (GO:0005576)				endometrium(2)|lung(5)	7						agaatcactgcaaaaaagaaaa	0.49																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL137296, AJ427539		20p13	2013-04-02			ENSG00000180259	ENSG00000180259			18046	other	unknown	"""M8 protein"""					12514748	Standard	NR_024267		Approved	M8	uc010zqq.2	Q86SH4	OTTHUMG00000031785	ENST00000326539.2:c.28dupT	20.37:g.4713301_4713301dupA	ENSP00000321242:p.Ala10fs		B2RPD9|B7ZBI9	Frame_Shift_Ins	INS	NULL	p.A9fs	ENST00000326539.2	37	c.28_27		20																																																																																			PRNT	-	NULL	ENSG00000180259		0.490	PRNT-002	KNOWN	basic|appris_principal	protein_coding	PRNT	HGNC	protein_coding	OTTHUMT00000253006.2	387	0.00	0	-	NM_177549		4713295	4713296	-1	no_errors	ENST00000326539	ensembl	human	known	69_37n	frame_shift_ins	405	16.67	81	INS	0.000:0.002	A
RARS2	57038	genome.wustl.edu	37	6	88279250	88279250	+	Missense_Mutation	SNP	G	G	T	rs374955606		TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr6:88279250G>T	ENST00000369536.5	-	2	140	c.95C>A	c.(94-96)cCa>cAa	p.P32Q		NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	32					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		TTGGGAAATTGGAACTGCAGA	0.308																																						dbGAP											0													108.0	112.0	110.0					6																	88279250		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.95C>A	6.37:g.88279250G>T	ENSP00000358549:p.Pro32Gln		B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	pfam_Arg-tRNA-synth_Ia_core,pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Arg-tRNA-synth_N,smart_DALR_anticod-bd,prints_Arg-tRNA-synth_Ia_core,tigrfam_Arg-tRNA-synth_Ia	p.P32Q	ENST00000369536.5	37	c.95	CCDS5011.1	6	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058713	0.55325	.	.	ENSG00000146282	ENST00000369536;ENST00000451155	T	0.70631	-0.5	5.45	4.58	0.56647	Arginyl tRNA synthetase, class Ia, N-terminal (2);	0.048043	0.85682	D	0.000000	T	0.62368	0.2422	M	0.70275	2.135	0.51767	D	0.999934	P	0.44776	0.843	P	0.45449	0.481	T	0.64960	-0.6284	10	0.38643	T	0.18	.	11.9865	0.53151	0.0:0.0:0.8269:0.1731	.	32	Q5T160	SYRM_HUMAN	Q	32;20	ENSP00000358549:P32Q	ENSP00000358549:P32Q	P	-	2	0	RARS2	88335969	1.000000	0.71417	0.987000	0.45799	0.960000	0.62799	5.296000	0.65698	1.418000	0.47098	0.655000	0.94253	CCA	RARS2	-	superfamily_Arg-tRNA-synth_N,tigrfam_Arg-tRNA-synth_Ia	ENSG00000146282		0.308	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS2	HGNC	protein_coding	OTTHUMT00000041448.1	478	0.00	0	G	NM_020320		88279250	88279250	-1	no_errors	ENST00000369536	ensembl	human	known	69_37n	missense	354	16.71	71	SNP	0.996	T
RNF103	7844	genome.wustl.edu	37	2	86832076	86832076	+	Silent	SNP	C	C	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr2:86832076C>T	ENST00000237455.4	-	4	1916	c.948G>A	c.(946-948)ttG>ttA	p.L316L	RNF103-CHMP3_ENST00000604011.1_Intron|AC015971.2_ENST00000439077.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000597638.1_RNA|RNF103_ENST00000477307.1_5'UTR|CHMP3_ENST00000439940.2_Intron	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	316					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						GTAATGAGCGCAAAAATGAAT	0.383																																						dbGAP											0													97.0	106.0	103.0					2																	86832076		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.948G>A	2.37:g.86832076C>T			A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Thioredoxin-like_fold,smart_Znf_RING,pfscan_Znf_RING	p.L316	ENST00000237455.4	37	c.948	CCDS33237.1	2																																																																																			RNF103	-	superfamily_Thioredoxin-like_fold	ENSG00000239305		0.383	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF103	HGNC	protein_coding	OTTHUMT00000330041.2	335	0.00	0	C	NM_005667		86832076	86832076	-1	no_errors	ENST00000237455	ensembl	human	known	69_37n	silent	251	14.86	44	SNP	1.000	T
ROBO2	6092	genome.wustl.edu	37	3	77623847	77623847	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:77623847T>G	ENST00000461745.1	+	14	3069	c.2169T>G	c.(2167-2169)gaT>gaG	p.D723E	ROBO2_ENST00000487694.3_Missense_Mutation_p.D739E|ROBO2_ENST00000332191.8_Missense_Mutation_p.D723E	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	723	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AAGGAATGGATAGTGAATCTA	0.363																																						dbGAP											0													46.0	42.0	43.0					3																	77623847		1841	4092	5933	-	-	-	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2169T>G	3.37:g.77623847T>G	ENSP00000417164:p.Asp723Glu		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D723E	ENST00000461745.1	37	c.2169	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	T	18.18	3.567167	0.65651	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.52754	0.65;0.65;0.65	5.67	-5.57	0.02521	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.48286	D	0.000189	T	0.54615	0.1869	L	0.50333	1.59	0.36678	D	0.878900	D;D;D	0.65815	0.995;0.988;0.995	D;D;D	0.87578	0.994;0.993;0.998	T	0.65869	-0.6063	9	0.12103	T	0.63	.	17.9616	0.89087	0.0:0.7476:0.0:0.2524	.	739;723;723	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	E	739;739;743;723;723;444	ENSP00000417335:D739E;ENSP00000417164:D723E;ENSP00000327536:D723E	ENSP00000327536:D723E	D	+	3	2	ROBO2	77706537	0.955000	0.32602	0.936000	0.37596	0.948000	0.59901	0.140000	0.16056	-0.984000	0.03507	-0.472000	0.04984	GAT	ROBO2	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000185008		0.363	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	91	0.00	0	T	XM_031246		77623847	77623847	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	missense	63	30.00	27	SNP	0.996	G
RRP1	8568	genome.wustl.edu	37	21	45217847	45217847	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr21:45217847C>T	ENST00000497547.1	+	8	794	c.677C>T	c.(676-678)cCg>cTg	p.P226L	RRP1_ENST00000471909.1_3'UTR	NM_003683.5	NP_003674.1	P05386	RLA1_HUMAN	ribosomal RNA processing 1	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|lung(4)|stomach(2)	8				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		GAGCAGGCCCCGCTTGCCATT	0.577																																						dbGAP											0													83.0	91.0	89.0					21																	45217847		2127	4240	6367	-	-	-	SO:0001583	missense	0			U79775	CCDS42951.1	21q22.3	2013-07-02	2013-07-02		ENSG00000160214	ENSG00000160214			18785	protein-coding gene	gene with protein product	"""DNA segment on chromosome 21 (unique) 2056 expressed sequence"", ""Nnp1 homolog, nucleolar protein (Drosophila)"""	610653	"""ribosomal RNA processing 1 homolog (S. cerevisiae)"""			10830953, 10341208	Standard	NM_003683		Approved	NNP-1, Nop52, NOP52, RRP1A, D21S2056E	uc002zds.2	P56182	OTTHUMG00000086884	ENST00000497547.1:c.677C>T	21.37:g.45217847C>T	ENSP00000417464:p.Pro226Leu		A6NIB2	Missense_Mutation	SNP	pfam_Nop52	p.P226L	ENST00000497547.1	37	c.677	CCDS42951.1	21	.	.	.	.	.	.	.	.	.	.	C	16.31	3.086996	0.55861	.	.	ENSG00000160214	ENST00000497547;ENST00000400387	T	0.34275	1.37	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.62245	0.2412	M	0.82193	2.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.68372	-0.5426	10	0.87932	D	0	.	13.3577	0.60638	0.0:1.0:0.0:0.0	.	226;93;226	B4DZM3;Q96J73;P56182	.;.;RRP1_HUMAN	L	226	ENSP00000417464:P226L	ENSP00000383237:P226L	P	+	2	0	RRP1	44042275	0.997000	0.39634	0.907000	0.35723	0.029000	0.11900	4.754000	0.62191	2.211000	0.71520	0.655000	0.94253	CCG	RRP1	-	NULL	ENSG00000160214		0.577	RRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP1	HGNC	protein_coding	OTTHUMT00000195680.1	150	0.00	0	C	NM_003683		45217847	45217847	+1	no_errors	ENST00000497547	ensembl	human	known	69_37n	missense	97	35.95	55	SNP	0.990	T
SBF2	81846	genome.wustl.edu	37	11	9989966	9989966	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr11:9989966T>A	ENST00000256190.8	-	14	1659	c.1522A>T	c.(1522-1524)Aat>Tat	p.N508Y		NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	508					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TTAGCAACATTTTCCTGTATT	0.443																																						dbGAP											0													154.0	150.0	152.0					11																	9989966		2201	4294	6495	-	-	-	SO:0001583	missense	0			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.1522A>T	11.37:g.9989966T>A	ENSP00000256190:p.Asn508Tyr		Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	pfam_SBF2,pfam_DENN_dom,pfam_uDENN_dom,pfam_Myotub-related,pfam_dDENN_dom,pfam_Pleckstrin_homology,pfam_GRAM,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_GRAM,smart_Pleckstrin_homology,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_Pleckstrin_homology	p.N508Y	ENST00000256190.8	37	c.1522	CCDS31427.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.49|16.49	3.137348|3.137348	0.56936|0.56936	.|.	.|.	ENSG00000133812|ENSG00000133812	ENST00000420722|ENST00000256190	.|D	.|0.85556	.|-2.0	5.21|5.21	4.08|4.08	0.47627|0.47627	.|.	.|0.336305	.|0.30630	.|N	.|0.009209	T|T	0.68860|0.68860	0.3047|0.3047	N|N	0.08118|0.08118	0|0	0.34648|0.34648	D|D	0.721308|0.721308	.|B;B	.|0.29232	.|0.238;0.153	.|B;B	.|0.34452	.|0.183;0.139	T|T	0.71800|0.71800	-0.4483|-0.4483	5|10	.|0.87932	.|D	.|0	.|.	3.1351|3.1351	0.06436|0.06436	0.0:0.3841:0.0:0.6158|0.0:0.3841:0.0:0.6158	.|.	.|508;508	.|Q86WG5-3;Q86WG5	.|.;MTMRD_HUMAN	I|Y	114|508	.|ENSP00000256190:N508Y	.|ENSP00000256190:N508Y	K|N	-|-	2|1	0|0	SBF2|SBF2	9946542|9946542	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.905000|0.905000	0.53344|0.53344	4.707000|4.707000	0.61852|0.61852	1.955000|1.955000	0.56771|0.56771	0.374000|0.374000	0.22700|0.22700	AAA|AAT	SBF2	-	NULL	ENSG00000133812		0.443	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SBF2	HGNC	protein_coding	OTTHUMT00000386911.2	281	0.00	0	T	NM_030962		9989966	9989966	-1	no_errors	ENST00000256190	ensembl	human	known	69_37n	missense	261	15.53	48	SNP	1.000	A
SLC16A12	387700	genome.wustl.edu	37	10	91198855	91198855	+	Silent	SNP	G	G	A	rs192441993	byFrequency	TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr10:91198855G>A	ENST00000341233.4	-	6	834	c.444C>T	c.(442-444)atC>atT	p.I148I	SLC16A12_ENST00000371790.4_Silent_p.I178I	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						CTGACATGGCGATACCATAAG	0.498													G|||	2	0.000399361	0.0	0.0	5008	,	,		19857	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													120.0	115.0	117.0					10																	91198855		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.444C>T	10.37:g.91198855G>A			Q5M9M9|Q5T7J2|Q6ZV76	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I178	ENST00000341233.4	37	c.534		10																																																																																			SLC16A12	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000152779		0.498	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	SLC16A12	HGNC	protein_coding		74	0.00	0	G	NM_213606		91198855	91198855	-1	no_errors	ENST00000371790	ensembl	human	known	69_37n	silent	61	15.28	11	SNP	0.937	A
SLC5A9	200010	genome.wustl.edu	37	1	48703432	48703432	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr1:48703432C>A	ENST00000438567.2	+	11	1426	c.1374C>A	c.(1372-1374)gaC>gaA	p.D458E	SLC5A9_ENST00000533824.1_Missense_Mutation_p.D479E|SLC5A9_ENST00000236495.5_Missense_Mutation_p.D483E	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	458					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						AGCTCTTCGACTACATCCAGG	0.567																																						dbGAP											0													170.0	133.0	146.0					1																	48703432		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.1374C>A	1.37:g.48703432C>A	ENSP00000401730:p.Asp458Glu		B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.D483E	ENST00000438567.2	37	c.1449	CCDS30709.2	1	.	.	.	.	.	.	.	.	.	.	c	15.88	2.962976	0.53507	.	.	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495	D;D;D	0.87729	-2.29;-2.29;-2.29	5.04	4.13	0.48395	.	0.000000	0.85682	D	0.000000	D	0.85261	0.5656	L	0.60957	1.885	0.80722	D	1	P;P;P	0.46457	0.878;0.661;0.661	P;B;B	0.46796	0.527;0.297;0.41	T	0.82100	-0.0624	10	0.28530	T	0.3	.	8.9557	0.35816	0.0:0.832:0.0:0.168	.	479;458;483	E9PJ08;Q2M3M2;E9PAK4	.;SC5A9_HUMAN;.	E	479;458;483	ENSP00000431900:D479E;ENSP00000401730:D458E;ENSP00000236495:D483E	ENSP00000236495:D483E	D	+	3	2	SLC5A9	48476019	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.664000	0.37439	1.344000	0.45657	0.651000	0.88453	GAC	SLC5A9	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000117834		0.567	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A9	HGNC	protein_coding	OTTHUMT00000022061.3	228	0.00	0	C	XM_117174		48703432	48703432	+1	no_errors	ENST00000236495	ensembl	human	known	69_37n	missense	244	19.74	60	SNP	1.000	A
SRGAP3	9901	genome.wustl.edu	37	3	9027246	9027246	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:9027246T>C	ENST00000383836.3	-	22	3684	c.3257A>G	c.(3256-3258)aAg>aGg	p.K1086R	SRGAP3_ENST00000360413.3_Missense_Mutation_p.K1062R	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	1086					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GGGGAACATCTTCTCGGTGGG	0.741			T	RAF1	pilocytic astrocytoma																																	dbGAP		Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													45.0	42.0	43.0					3																	9027246		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.3257A>G	3.37:g.9027246T>C	ENSP00000373347:p.Lys1086Arg		Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.K1086R	ENST00000383836.3	37	c.3257	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	T	16.71	3.198006	0.58126	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.27720	1.65;2.05	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.17789	0.0427	N	0.08118	0	0.39858	D	0.973338	B;B	0.17667	0.023;0.014	B;B	0.14023	0.01;0.004	T	0.08432	-1.0722	10	0.26408	T	0.33	.	15.0524	0.71885	0.0:0.0:0.0:1.0	.	1062;1086	O43295-2;O43295	.;SRGP2_HUMAN	R	1086;1062	ENSP00000373347:K1086R;ENSP00000353587:K1062R	ENSP00000353587:K1062R	K	-	2	0	SRGAP3	9002246	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.629000	0.61290	2.039000	0.60335	0.482000	0.46254	AAG	SRGAP3	-	NULL	ENSG00000196220		0.741	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	20	0.00	0	T			9027246	9027246	-1	no_errors	ENST00000383836	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	1.000	C
TAF3	83860	genome.wustl.edu	37	10	8006835	8006835	+	Silent	SNP	C	C	G			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr10:8006835C>G	ENST00000344293.5	+	3	1568	c.1362C>G	c.(1360-1362)tcC>tcG	p.S454S		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	454					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						TGCCTCTTTCCGGTGGAACCT	0.488																																						dbGAP											0													87.0	86.0	86.0					10																	8006835		1941	4155	6096	-	-	-	SO:0001819	synonymous_variant	0			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.1362C>G	10.37:g.8006835C>G			Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Silent	SNP	pfam_BTP,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Histone-fold,smart_BTP,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S454	ENST00000344293.5	37	c.1362	CCDS41487.1	10																																																																																			TAF3	-	NULL	ENSG00000165632		0.488	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF3	HGNC	protein_coding	OTTHUMT00000046725.1	101	0.00	0	C	NM_031923		8006835	8006835	+1	no_errors	ENST00000344293	ensembl	human	known	69_37n	silent	68	31.00	31	SNP	0.065	G
TAOK3	51347	genome.wustl.edu	37	12	118590144	118590144	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr12:118590144A>G	ENST00000392533.3	-	20	2913	c.2423T>C	c.(2422-2424)cTg>cCg	p.L808P	TAOK3_ENST00000537952.1_Missense_Mutation_p.L348P|TAOK3_ENST00000419821.2_Missense_Mutation_p.L808P|TAOK3_ENST00000543709.1_5'UTR|TAOK3_ENST00000536979.1_Missense_Mutation_p.L3P	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	808					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCGTTGAGCAGCTCCATTTC	0.532																																						dbGAP											0													174.0	130.0	145.0					12																	118590144		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.2423T>C	12.37:g.118590144A>G	ENSP00000376317:p.Leu808Pro		Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L808P	ENST00000392533.3	37	c.2423	CCDS9188.1	12	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524167	0.85600	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000536979;ENST00000537952	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000002	T	0.78824	0.4344	M	0.79123	2.44	0.80722	D	1	D	0.71674	0.998	D	0.71414	0.973	T	0.81850	-0.0743	10	0.72032	D	0.01	.	15.3135	0.74056	1.0:0.0:0.0:0.0	.	808	Q9H2K8	TAOK3_HUMAN	P	808;808;3;348	ENSP00000416374:L808P;ENSP00000376317:L808P;ENSP00000441932:L3P;ENSP00000443834:L348P	ENSP00000376317:L808P	L	-	2	0	TAOK3	117074527	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.139000	0.94554	2.203000	0.70933	0.482000	0.46254	CTG	TAOK3	-	NULL	ENSG00000135090		0.532	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK3	HGNC	protein_coding	OTTHUMT00000401456.2	174	0.00	0	A	NM_016281		118590144	118590144	-1	no_errors	ENST00000392533	ensembl	human	known	69_37n	missense	191	22.04	54	SNP	1.000	G
TBL1XR1	79718	genome.wustl.edu	37	3	176744190	176744190	+	Nonsense_Mutation	SNP	T	T	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:176744190T>A	ENST00000430069.1	-	15	1748	c.1489A>T	c.(1489-1491)Aaa>Taa	p.K497*	TBL1XR1_ENST00000457928.2_Nonsense_Mutation_p.K497*			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	497					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			GCTCCAACTTTGTCTCCTGCT	0.403																																						dbGAP											0													143.0	130.0	134.0					3																	176744190		1902	4123	6025	-	-	-	SO:0001587	stop_gained	0			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.1489A>T	3.37:g.176744190T>A	ENSP00000405574:p.Lys497*		D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K497*	ENST00000430069.1	37	c.1489	CCDS46961.1	3	.	.	.	.	.	.	.	.	.	.	T	44	10.605726	0.99436	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000536758	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.9085	16.0034	0.80327	0.0:0.0:0.0:1.0	.	.	.	.	X	497;497;359	.	ENSP00000405574:K497X	K	-	1	0	TBL1XR1	178226884	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	AAA	TBL1XR1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000177565		0.403	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1XR1	HGNC	protein_coding	OTTHUMT00000347587.3	535	0.00	0	T	NM_024665		176744190	176744190	-1	no_errors	ENST00000430069	ensembl	human	known	69_37n	nonsense	583	15.34	106	SNP	1.000	A
TBL1XR1	79718	genome.wustl.edu	37	3	176771659	176771659	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr3:176771659G>A	ENST00000430069.1	-	4	365	c.106C>T	c.(106-108)Cag>Tag	p.Q36*	TBL1XR1_ENST00000457928.2_Nonsense_Mutation_p.Q36*			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	36	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.				canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			ATATTGGACTGACTGATATGG	0.378																																						dbGAP											0													104.0	97.0	100.0					3																	176771659		1868	4108	5976	-	-	-	SO:0001587	stop_gained	0			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.106C>T	3.37:g.176771659G>A	ENSP00000405574:p.Gln36*		D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q36*	ENST00000430069.1	37	c.106	CCDS46961.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.191508	0.94923	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000352800;ENST00000437738;ENST00000450267;ENST00000431674;ENST00000422066;ENST00000443315;ENST00000422442;ENST00000427349	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-20.5183	18.1089	0.89528	0.0:0.0:1.0:0.0	.	.	.	.	X	36	.	ENSP00000263964:Q36X	Q	-	1	0	TBL1XR1	178254353	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.601000	0.87937	0.655000	0.94253	CAG	TBL1XR1	-	smart_LisH_dimerisation,pfscan_LisH_dimerisation	ENSG00000177565		0.378	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1XR1	HGNC	protein_coding	OTTHUMT00000347587.3	381	0.00	0	G	NM_024665		176771659	176771659	-1	no_errors	ENST00000430069	ensembl	human	known	69_37n	nonsense	382	18.03	84	SNP	1.000	A
TLN2	83660	genome.wustl.edu	37	15	63102180	63102180	+	Silent	SNP	C	C	T			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr15:63102180C>T	ENST00000561311.1	+	51	6950	c.6720C>T	c.(6718-6720)ttC>ttT	p.F2240F	TLN2_ENST00000306829.6_Silent_p.F2240F			Q9Y4G6	TLN2_HUMAN	talin 2	2240					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CCTTGCGTTTCGGGACGGAGT	0.552																																						dbGAP											0													137.0	103.0	115.0					15																	63102180		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6720C>T	15.37:g.63102180C>T			A6NLB8	Silent	SNP	pfam_Talin_cent,pfam_ILWEQ,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.F2240	ENST00000561311.1	37	c.6720	CCDS32261.1	15																																																																																			TLN2	-	NULL	ENSG00000171914		0.552	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	215	0.00	0	C			63102180	63102180	+1	no_errors	ENST00000306829	ensembl	human	known	69_37n	silent	250	13.36	39	SNP	0.567	T
USP6	9098	genome.wustl.edu	37	17	5072218	5072218	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr17:5072218G>A	ENST00000574788.1	+	35	5615	c.3385G>A	c.(3385-3387)Gag>Aag	p.E1129K	USP6_ENST00000332776.4_3'UTR|USP6_ENST00000304328.5_Missense_Mutation_p.E812K|USP6_ENST00000250066.6_Missense_Mutation_p.E1129K			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	1129	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CCAGGGGGATGAGCTCTCCAA	0.522			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																	dbGAP		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													91.0	98.0	96.0					17																	5072218		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3385G>A	17.37:g.5072218G>A	ENSP00000460380:p.Glu1129Lys		Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Peptidase_C19	p.E1129K	ENST00000574788.1	37	c.3385	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	G	5.177	0.218279	0.09810	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.13307	3.01;2.6	2.35	1.32	0.21799	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.473412	0.25205	N	0.032347	T	0.07863	0.0197	N	0.22421	0.69	0.24516	N	0.994184	P;P	0.40794	0.629;0.729	B;B	0.41271	0.16;0.352	T	0.31110	-0.9955	10	0.12430	T	0.62	.	6.9219	0.24393	0.1561:0.0:0.8439:0.0	.	812;1129	P35125-2;P35125	.;UBP6_HUMAN	K	1129;812	ENSP00000250066:E1129K;ENSP00000305473:E812K	ENSP00000250066:E1129K	E	+	1	0	USP6	5012942	1.000000	0.71417	0.239000	0.24122	0.114000	0.19823	4.794000	0.62482	0.319000	0.23209	0.184000	0.17185	GAG	USP6	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000129204		0.522	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	HGNC	protein_coding	OTTHUMT00000438990.1	223	0.00	0	G	NM_004505		5072218	5072218	+1	no_errors	ENST00000250066	ensembl	human	known	69_37n	missense	185	20.26	47	SNP	0.949	A
ZFHX3	463	genome.wustl.edu	37	16	72830186	72830186	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr16:72830186T>C	ENST00000268489.5	-	9	7067	c.6395A>G	c.(6394-6396)tAc>tGc	p.Y2132C	ZFHX3_ENST00000397992.5_Missense_Mutation_p.Y1218C	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2132					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CTGATGCTGGTAGAGTTGGGC	0.602																																						dbGAP											0													46.0	44.0	44.0					16																	72830186		2198	4300	6498	-	-	-	SO:0001583	missense	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6395A>G	16.37:g.72830186T>C	ENSP00000268489:p.Tyr2132Cys		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.Y2132C	ENST00000268489.5	37	c.6395	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	T	12.23	1.875753	0.33162	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.73152	-0.72;-0.7	5.64	5.64	0.86602	.	0.000000	0.45606	D	0.000356	T	0.69260	0.3091	N	0.05177	-0.1	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.74359	-0.3691	10	0.38643	T	0.18	.	15.8626	0.79038	0.0:0.0:0.0:1.0	.	2132	Q15911	ZFHX3_HUMAN	C	2132;1218	ENSP00000268489:Y2132C;ENSP00000438926:Y1218C	ENSP00000268489:Y2132C	Y	-	2	0	ZFHX3	71387687	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.040000	0.89188	2.132000	0.65825	0.533000	0.62120	TAC	ZFHX3	-	NULL	ENSG00000140836		0.602	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	61	0.00	0	T	NM_006885		72830186	72830186	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	1.000	C
ZFYVE27	118813	genome.wustl.edu	37	10	99502856	99502856	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E2-A15G-01A-11D-A12B-09	TCGA-E2-A15G-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d45bb60a-e73b-4b95-8637-e8d17fcca745	9b5d1a2f-ccca-45de-b995-85754015b39c	g.chr10:99502856delA	ENST00000393677.4	+	3	407	c.203delA	c.(202-204)cagfs	p.Q68fs	ZFYVE27_ENST00000337540.7_Intron|ZFYVE27_ENST00000356257.4_Frame_Shift_Del_p.Q68fs|ZFYVE27_ENST00000370610.3_Intron|ZFYVE27_ENST00000453958.2_Frame_Shift_Del_p.Q68fs|ZFYVE27_ENST00000359980.3_Frame_Shift_Del_p.Q68fs|ZFYVE27_ENST00000357540.4_Intron|ZFYVE27_ENST00000370613.3_Intron	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	68					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		TGTAGGTGGCAGATGCCTTTG	0.537																																						dbGAP											0													308.0	209.0	243.0					10																	99502856		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.203delA	10.37:g.99502856delA	ENSP00000377282:p.Gln68fs		B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Frame_Shift_Del	DEL	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.Q68fs	ENST00000393677.4	37	c.203	CCDS31263.1	10																																																																																			ZFYVE27	-	NULL	ENSG00000155256		0.537	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	ZFYVE27	HGNC	protein_coding	OTTHUMT00000049745.2	430	0.00	0	A	NM_144588		99502856	99502856	+1	no_errors	ENST00000356257	ensembl	human	known	69_37n	frame_shift_del	461	15.83	88	DEL	1.000	-
