#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ASXL3	80816	genome.wustl.edu	37	18	31326555	31326555	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr18:31326555G>A	ENST00000269197.5	+	12	6743	c.6743G>A	c.(6742-6744)cGa>cAa	p.R2248Q		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	2248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CTGGTTGTACGATAAGAGCTG	0.458																																						dbGAP											0													107.0	102.0	103.0					18																	31326555		1990	4172	6162	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.6743G>A	18.37:g.31326555G>A	ENSP00000269197:p.Arg2248Gln		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.R2248Q	ENST00000269197.5	37	c.6743	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637822	0.87760	.	.	ENSG00000141431	ENST00000269197	T	0.49720	0.77	6.03	6.03	0.97812	.	.	.	.	.	T	0.53045	0.1772	N	0.08118	0	0.52501	D	0.999956	D	0.89917	1.0	D	0.80764	0.994	T	0.62845	-0.6768	9	0.72032	D	0.01	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	2248	Q9C0F0	ASXL3_HUMAN	Q	2248	ENSP00000269197:R2248Q	ENSP00000269197:R2248Q	R	+	2	0	ASXL3	29580553	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	9.476000	0.97823	2.854000	0.98071	0.655000	0.94253	CGA	ASXL3	-	NULL	ENSG00000141431		0.458	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	67	0.00	0	G			31326555	31326555	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	31	17.95	7	SNP	1.000	A
SNX5	27131	genome.wustl.edu	37	20	17950658	17950658	+	5'Flank	SNP	C	C	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr20:17950658C>T	ENST00000377768.3	-	0	0				SNX5_ENST00000486039.1_5'Flank|SNX5_ENST00000481323.1_5'Flank|MGME1_ENST00000377704.4_Silent_p.Y52Y|MGME1_ENST00000377709.1_Silent_p.Y52Y|SNX5_ENST00000377759.4_5'Flank|SNX5_ENST00000606602.1_5'Flank|SNX5_ENST00000606557.1_5'Flank|MGME1_ENST00000377710.5_Silent_p.Y52Y	NM_152227.1	NP_689413.1	Q9Y5X3	SNX5_HUMAN	sorting nexin 5						intracellular protein transport (GO:0006886)|pinocytosis (GO:0006907)	cytoplasmic vesicle (GO:0031410)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|extrinsic component of endosome membrane (GO:0031313)|macropinocytic cup (GO:0070685)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	11						AAGAAAAATACTCTAATTTAG	0.493																																						dbGAP											0													73.0	73.0	73.0					20																	17950658		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AF121855	CCDS13130.1	20p11	2008-05-22			ENSG00000089006	ENSG00000089006		"""Sorting nexins"""	14969	protein-coding gene	gene with protein product		605937				10600472, 17148574	Standard	NM_152227		Approved		uc002wqc.3	Q9Y5X3	OTTHUMG00000031953		20.37:g.17950658C>T	Exception_encountered		B7ZKN3|D3DW26|Q52LC4|Q7KZN0|Q9BWP0	Silent	SNP	superfamily_Restrct_endonuc-II-like	p.Y52	ENST00000377768.3	37	c.156	CCDS13130.1	20																																																																																			C20orf72	-	NULL	ENSG00000125871		0.493	SNX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf72	HGNC	protein_coding	OTTHUMT00000078137.4	36	0.00	0	C			17950658	17950658	+1	no_errors	ENST00000377710	ensembl	human	known	69_37n	silent	22	21.43	6	SNP	0.229	T
C5orf56	441108	genome.wustl.edu	37	5	131796262	131796262	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr5:131796262C>T	ENST00000337752.2	+	4	228	c.97C>T	c.(97-99)Caa>Taa	p.Q33*	C5orf56_ENST00000407797.1_Intron|C5orf56_ENST00000378953.4_Intron			Q8N8D9	CE056_HUMAN	chromosome 5 open reading frame 56	33										breast(1)|endometrium(1)|large_intestine(1)|lung(3)	6						agggaatcttcaaactcttct	0.552																																						dbGAP											0													215.0	212.0	213.0					5																	131796262		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC130299		5q31.1	2009-04-20			ENSG00000197536	ENSG00000197536			33838	protein-coding gene	gene with protein product							Standard	NR_045116		Approved		uc010jds.2	Q8N8D9	OTTHUMG00000059493	ENST00000337752.2:c.97C>T	5.37:g.131796262C>T	ENSP00000338228:p.Gln33*		A1L3V9|A6NKA0	Nonsense_Mutation	SNP	NULL	p.Q33*	ENST00000337752.2	37	c.97		5	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389955	0.25118	.	.	ENSG00000197536	ENST00000337752	.	.	.	3.0	1.07	0.20283	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	5.3375	0.15965	0.2358:0.535:0.2292:0.0	.	.	.	.	X	33	.	ENSP00000338228:Q33X	Q	+	1	0	C5orf56	131824161	0.003000	0.15002	0.001000	0.08648	0.006000	0.05464	2.062000	0.41413	0.261000	0.21753	-0.243000	0.11985	CAA	C5orf56	-	NULL	ENSG00000197536		0.552	C5orf56-001	NOVEL	basic|appris_candidate_longest	protein_coding	C5orf56	HGNC	protein_coding	OTTHUMT00000132329.1	154	0.65	1	C	NM_001013717		131796262	131796262	+1	no_errors	ENST00000337752	ensembl	human	novel	69_37n	nonsense	69	15.85	13	SNP	0.001	T
CHD7	55636	genome.wustl.edu	37	8	61766023	61766023	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr8:61766023G>T	ENST00000423902.2	+	31	7218	c.6739G>T	c.(6739-6741)Gat>Tat	p.D2247Y	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2247	Glu-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AAAGCTGGAGGATGACGATAA	0.512																																						dbGAP											0													68.0	71.0	70.0					8																	61766023		2023	4174	6197	-	-	-	SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6739G>T	8.37:g.61766023G>T	ENSP00000392028:p.Asp2247Tyr		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D2247Y	ENST00000423902.2	37	c.6739	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501681	0.44455	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	T	0.76839	-1.05	5.3	5.3	0.74995	.	0.124973	0.53938	D	0.000058	T	0.60702	0.2289	N	0.08118	0	0.41835	D	0.990098	B	0.06786	0.001	B	0.04013	0.001	T	0.59064	-0.7524	10	0.48119	T	0.1	-21.6506	13.8709	0.63617	0.0:0.0:0.8475:0.1525	.	2247	Q9P2D1	CHD7_HUMAN	Y	2247	ENSP00000392028:D2247Y	ENSP00000307304:D2247Y	D	+	1	0	CHD7	61928577	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	6.246000	0.72405	2.479000	0.83701	0.655000	0.94253	GAT	CHD7	-	NULL	ENSG00000171316		0.512	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	34	0.00	0	G	XM_098762		61766023	61766023	+1	no_errors	ENST00000307121	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	1.000	T
DOCK10	55619	genome.wustl.edu	37	2	225662592	225662592	+	Missense_Mutation	SNP	G	G	T	rs369419030		TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr2:225662592G>T	ENST00000258390.7	-	42	4668	c.4601C>A	c.(4600-4602)gCg>gAg	p.A1534E	DOCK10_ENST00000409592.3_Missense_Mutation_p.A1528E	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1534					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A72V(1)|p.A1532V(1)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATGCTTCAGCGCTGTGGCTGA	0.413																																						dbGAP											2	Substitution - Missense(2)	pancreas(2)											173.0	168.0	170.0					2																	225662592		1938	4139	6077	-	-	-	SO:0001583	missense	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4601C>A	2.37:g.225662592G>T	ENSP00000258390:p.Ala1534Glu		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A1534E	ENST00000258390.7	37	c.4601	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339126	0.81911	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.66099	3.55;-0.19	5.95	5.95	0.96441	.	0.048262	0.85682	D	0.000000	T	0.72447	0.3461	L	0.61218	1.895	0.53688	D	0.999973	P;P;P;P	0.49253	0.768;0.91;0.643;0.921	B;P;P;P	0.51895	0.414;0.492;0.483;0.683	T	0.71623	-0.4537	10	0.51188	T	0.08	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	1534;388;1528;196	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	E	1528;1534;72	ENSP00000386694:A1528E;ENSP00000258390:A1534E	ENSP00000258390:A1534E	A	-	2	0	DOCK10	225370836	1.000000	0.71417	0.953000	0.39169	0.966000	0.64601	9.230000	0.95299	2.824000	0.97209	0.655000	0.94253	GCG	DOCK10	-	superfamily_ARM-type_fold	ENSG00000135905		0.413	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	61	0.00	0	G			225662592	225662592	-1	no_errors	ENST00000258390	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	T
METTL21B	25895	genome.wustl.edu	37	12	58177049	58177049	+	IGR	SNP	G	G	A			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr12:58177049G>A	ENST00000300209.8	+	0	2563				TSFM_ENST00000540550.1_Missense_Mutation_p.G72S|TSFM_ENST00000350762.5_5'UTR|RP11-571M6.15_ENST00000553083.1_3'UTR|TSFM_ENST00000497617.1_3'UTR|TSFM_ENST00000543727.1_Missense_Mutation_p.G72S|TSFM_ENST00000550559.1_Missense_Mutation_p.G72S|TSFM_ENST00000323833.8_Missense_Mutation_p.G72S|RP11-571M6.15_ENST00000471530.1_Silent_p.V86V|TSFM_ENST00000548851.1_Missense_Mutation_p.G72S|TSFM_ENST00000454289.3_Missense_Mutation_p.G72S	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						GGAGACTTGTGGCGGGGACCT	0.577																																						dbGAP											0													98.0	112.0	108.0					12																	58177049		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58177049G>A			Q9H749|Q9Y3W2	Nonsense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.W78*	ENST00000300209.8	37	c.233	CCDS8957.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.474433|4.474433	0.84640|0.84640	.|.	.|.	ENSG00000123297|ENSG00000257921	ENST00000454289;ENST00000543727;ENST00000540550;ENST00000323833;ENST00000550559;ENST00000548851;ENST00000434359;ENST00000457189|ENST00000546504	T;T;T;T;T;T;T;T|.	0.25749|.	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78|.	5.29|5.29	4.4|4.4	0.53042|0.53042	Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);|.	0.152660|.	0.64402|.	D|.	0.000014|.	T|.	0.64136|.	0.2571|.	M|M	0.68728|0.68728	2.09|2.09	0.80722|0.80722	D|D	1|1	B;B;B|.	0.20052|.	0.008;0.004;0.041|.	B;B;B|.	0.25291|.	0.011;0.017;0.059|.	T|.	0.63559|.	-0.6610|.	10|.	0.22706|.	T|.	0.39|.	.|.	9.4451|9.4451	0.38693|0.38693	0.1641:0.0:0.8359:0.0|0.1641:0.0:0.8359:0.0	.|.	72;72;72|.	B4E391;P43897;P43897-2|.	.;EFTS_HUMAN;.|.	S|X	72;72;72;72;72;72;22;22|78	ENSP00000388330:G72S;ENSP00000439342:G72S;ENSP00000440987:G72S;ENSP00000313877:G72S;ENSP00000448575:G72S;ENSP00000450041:G72S;ENSP00000390679:G22S;ENSP00000389162:G22S|.	ENSP00000313877:G72S|.	G|W	+|+	1|2	0|0	TSFM|RP11-571M6.15	56463316|56463316	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	2.215000|2.215000	0.42862|0.42862	1.464000|1.464000	0.47987|0.47987	0.462000|0.462000	0.41574|0.41574	GGC|TGG	RP11-571M6.15	-	NULL	ENSG00000257921		0.577	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000257921	Clone_based_vega_gene	protein_coding	OTTHUMT00000409268.1	68	0.00	0	G	NM_015433		58177049	58177049	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000546504	ensembl	human	putative	69_37n	nonsense	18	28.00	7	SNP	1.000	A
EIF2B1	1967	genome.wustl.edu	37	12	124110991	124110991	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr12:124110991C>G	ENST00000424014.2	-	6	740	c.532G>C	c.(532-534)Gtg>Ctg	p.V178L	EIF2B1_ENST00000539951.1_Missense_Mutation_p.V165L|EIF2B1_ENST00000537073.1_3'UTR	NM_001414.3	NP_001405.1	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa	178					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme regulator activity (GO:0030234)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			breast(1)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		GCATCTAGCACCACAGTGACA	0.493																																						dbGAP											0													145.0	122.0	130.0					12																	124110991		2203	4300	6503	-	-	-	SO:0001583	missense	0			X95648	CCDS31924.1	12q24.3	1998-10-16	2002-08-29		ENSG00000111361	ENSG00000111361			3257	protein-coding gene	gene with protein product		606686	"""eukaryotic translation initiation factor 2B, subunit 1 (alpha, 26kD)"""	EIF2B			Standard	NM_001414		Approved	EIF-2Balpha, EIF-2B, EIF2BA	uc001ufm.3	Q14232	OTTHUMG00000168696	ENST00000424014.2:c.532G>C	12.37:g.124110991C>G	ENSP00000416250:p.Val178Leu		A6NLY9|B4DGX0|Q3SXP4	Missense_Mutation	SNP	pfam_IF-2B-related	p.V178L	ENST00000424014.2	37	c.532	CCDS31924.1	12	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350575	0.41599	.	.	ENSG00000111361	ENST00000424014;ENST00000228958;ENST00000539951	D;D;D	0.93426	-3.22;-3.22;-3.22	5.27	3.41	0.39046	.	0.230124	0.44285	D	0.000474	D	0.86883	0.6040	L	0.46885	1.475	0.80722	D	1	P;B	0.36712	0.566;0.005	B;B	0.26416	0.069;0.022	D	0.84522	0.0628	10	0.48119	T	0.1	-21.2885	6.757	0.23520	0.0:0.6431:0.0:0.3569	.	165;178	F5H0D0;Q14232	.;EI2BA_HUMAN	L	178;176;165	ENSP00000416250:V178L;ENSP00000228958:V176L;ENSP00000438060:V165L	ENSP00000228958:V176L	V	-	1	0	EIF2B1	122676944	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.221000	0.51215	1.343000	0.45638	0.563000	0.77884	GTG	EIF2B1	-	pfam_IF-2B-related	ENSG00000111361		0.493	EIF2B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B1	HGNC	protein_coding	OTTHUMT00000400628.1	104	0.00	0	C	NM_001414		124110991	124110991	-1	no_errors	ENST00000424014	ensembl	human	known	69_37n	missense	29	49.12	28	SNP	1.000	G
EPPK1	83481	genome.wustl.edu	37	8	144945188	144945188	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr8:144945188C>G	ENST00000525985.1	-	2	2305	c.2234G>C	c.(2233-2235)cGg>cCg	p.R745P				P58107	EPIPL_HUMAN	epiplakin 1	745						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTAGCCGCGCCGGTAGGCCAC	0.652																																						dbGAP											0													86.0	93.0	91.0					8																	144945188		2057	4182	6239	-	-	-	SO:0001583	missense	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.2234G>C	8.37:g.144945188C>G	ENSP00000436337:p.Arg745Pro		Q76E58|Q9NSU9	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.R745P	ENST00000525985.1	37	c.2234		8	.	.	.	.	.	.	.	.	.	.	C	12.99	2.103286	0.37145	.	.	ENSG00000227184	ENST00000525985	T	0.76448	-1.02	5.06	1.14	0.20703	.	.	.	.	.	T	0.69540	0.3122	L	0.55990	1.75	0.22156	N	0.999329	P	0.47910	0.902	B	0.40565	0.333	T	0.57734	-0.7760	9	0.42905	T	0.14	.	7.7624	0.28959	0.0:0.2588:0.0:0.7412	.	745	E9PPU0	.	P	745	ENSP00000436337:R745P	ENSP00000436337:R745P	R	-	2	0	EPPK1	145017176	0.814000	0.29104	0.983000	0.44433	0.528000	0.34623	0.483000	0.22292	0.082000	0.17018	-0.290000	0.09829	CGG	EPPK1	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000227184		0.652	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	90	0.00	0	C	NM_031308		144945188	144945188	-1	no_errors	ENST00000525985	ensembl	human	known	69_37n	missense	35	12.20	5	SNP	0.854	G
FAM160A2	84067	genome.wustl.edu	37	11	6239328	6239328	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr11:6239328delG	ENST00000449352.2	-	9	1751	c.1488delC	c.(1486-1488)cccfs	p.P496fs	FAM160A2_ENST00000265978.4_Frame_Shift_Del_p.P510fs|FAM160A2_ENST00000524416.1_Frame_Shift_Del_p.P496fs|FAM160A2_ENST00000529360.1_5'Flank			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	496					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ATGGTGTGGAGGGCCGGGGTA	0.572																																						dbGAP											0													20.0	22.0	21.0					11																	6239328		2201	4295	6496	-	-	-	SO:0001589	frameshift_variant	0				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1488delC	11.37:g.6239328delG	ENSP00000416918:p.Pro496fs		Q9C0A4|Q9H0N3|Q9H624	Frame_Shift_Del	DEL	pfam_RetinoicA-induced_16-like	p.S511fs	ENST00000449352.2	37	c.1530	CCDS44530.1	11																																																																																			FAM160A2	-	NULL	ENSG00000051009		0.572	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	HGNC	protein_coding	OTTHUMT00000383759.1	31	0.00	0	G	NM_032127		6239328	6239328	-1	no_errors	ENST00000265978	ensembl	human	known	69_37n	frame_shift_del	9	18.18	2	DEL	1.000	-
FAM71B	153745	genome.wustl.edu	37	5	156589497	156589497	+	Silent	SNP	C	C	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr5:156589497C>T	ENST00000302938.4	-	2	1874	c.1779G>A	c.(1777-1779)gaG>gaA	p.E593E		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	593						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCTCCGTCTTCTCGGATGTCA	0.522																																						dbGAP											0													213.0	211.0	212.0					5																	156589497		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1779G>A	5.37:g.156589497C>T			Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	pfam_DUF3699	p.E593	ENST00000302938.4	37	c.1779	CCDS4335.1	5																																																																																			FAM71B	-	NULL	ENSG00000170613		0.522	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	99	0.00	0	C	NM_130899		156589497	156589497	-1	no_errors	ENST00000302938	ensembl	human	known	69_37n	silent	46	24.59	15	SNP	0.077	T
FRG1B	284802	genome.wustl.edu	37	20	29612261	29612261	+	Intron	SNP	G	G	A	rs375470243		TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr20:29612261G>A	ENST00000278882.3	+	1	257				FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000468180.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AGGCCGGACCGCGGTTCCTGG	0.692																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+148G>A	20.37:g.29612261G>A			C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.692	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	31	0.00	0	G	NR_003579		29612261	29612261	+1	no_errors	ENST00000482423	ensembl	human	known	69_37n	rna	14	17.65	3	SNP	0.000	A
GMDS	2762	genome.wustl.edu	37	6	1930370	1930370	+	Silent	SNP	T	T	C			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr6:1930370T>C	ENST00000380815.4	-	7	1007	c.738A>G	c.(736-738)aaA>aaG	p.K246K	GMDS_ENST00000530927.1_Silent_p.K216K	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	246					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)		GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		CCCAATCTCGTTTGGCATCCA	0.413																																						dbGAP											0													145.0	126.0	133.0					6																	1930370		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.738A>G	6.37:g.1930370T>C			E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Silent	SNP	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,tigrfam_GDP_Man_deHydtase	p.K246	ENST00000380815.4	37	c.738	CCDS4474.1	6																																																																																			GMDS	-	pfam_Epimerase_deHydtase,tigrfam_GDP_Man_deHydtase	ENSG00000112699		0.413	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GMDS	HGNC	protein_coding	OTTHUMT00000043380.3	77	0.00	0	T			1930370	1930370	-1	no_errors	ENST00000380815	ensembl	human	known	69_37n	silent	26	31.58	12	SNP	0.991	C
HIST1H2AK	8330	genome.wustl.edu	37	6	27805735	27805735	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr6:27805735T>C	ENST00000330180.2	-	1	382	c.383A>G	c.(382-384)aAg>aGg	p.K128R	HIST1H2BN_ENST00000606613.1_5'Flank|HIST1H2BN_ENST00000396980.3_5'Flank	NM_003510.2	NP_003501.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	128						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(2)|endometrium(2)|kidney(1)|lung(3)|upper_aerodigestive_tract(2)	10						CTACTTGCCCTTGGCCTTGTG	0.522																																						dbGAP											0													82.0	83.0	82.0					6																	27805735		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z83739	CCDS4632.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000184348	ENSG00000275221		"""Histones / Replication-dependent"""	4726	protein-coding gene	gene with protein product		602788	"""H2A histone family, member D"", ""histone 1, H2ak"""	H2AFD		9439656, 12408966	Standard	NM_003510		Approved	H2A/d	uc003njs.3	P0C0S8	OTTHUMG00000016382	ENST00000330180.2:c.383A>G	6.37:g.27805735T>C	ENSP00000330307:p.Lys128Arg		P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.K128R	ENST00000330180.2	37	c.383	CCDS4632.1	6	.	.	.	.	.	.	.	.	.	.	.	13.45	2.242220	0.39598	.	.	ENSG00000184348	ENST00000330180	T	0.44881	0.91	4.39	4.39	0.52855	.	0.000000	0.32343	U	0.006225	T	0.40473	0.1118	.	.	.	0.31535	N	0.660688	.	.	.	.	.	.	T	0.41910	-0.9482	7	0.66056	D	0.02	.	13.4866	0.61369	0.0:0.0:0.0:1.0	.	.	.	.	R	128	ENSP00000330307:K128R	ENSP00000330307:K128R	K	-	2	0	HIST1H2AK	27913714	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	6.419000	0.73345	1.910000	0.55303	0.459000	0.35465	AAG	HIST1H2AK	-	NULL	ENSG00000184348		0.522	HIST1H2AK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AK	HGNC	protein_coding	OTTHUMT00000043814.1	127	0.00	0	T	NM_003510		27805735	27805735	-1	no_errors	ENST00000330180	ensembl	human	known	69_37n	missense	39	26.42	14	SNP	1.000	C
NAMPTL	646309	genome.wustl.edu	37	10	36811974	36811974	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr10:36811974C>A	ENST00000543053.1	-	1	349	c.133G>T	c.(133-135)Gac>Tac	p.D45Y						nicotinamide phosphoribosyltransferase-like											biliary_tract(1)|breast(3)|lung(9)|stomach(1)	14						GCAACCGGGTCCTTGAAGACG	0.433																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					10p11.21	2013-03-27	2008-11-06	2008-11-06	ENSG00000229644	ENSG00000229644			17633	other	unknown			"""pre-B-cell colony enhancing factor 2"""	PBEF2		8289818	Standard	NG_005593		Approved	bA92J19.4			OTTHUMG00000017964	ENST00000543053.1:c.133G>T	10.37:g.36811974C>A	ENSP00000439553:p.Asp45Tyr			Missense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C	p.D45Y	ENST00000543053.1	37	c.133		10	.	.	.	.	.	.	.	.	.	.	c	11.18	1.562757	0.27915	.	.	ENSG00000229644	ENST00000440465;ENST00000543053	.	.	.	2.02	1.06	0.20224	.	0.000000	0.85682	D	0.000000	T	0.59595	0.2205	.	.	.	0.44234	D	0.997078	.	.	.	.	.	.	T	0.57682	-0.7769	6	0.72032	D	0.01	-13.1403	6.2208	0.20681	0.0:0.8256:0.0:0.1744	.	.	.	.	Y	397;45	.	ENSP00000407952:D397Y	D	-	1	0	NAMPTL	36851980	1.000000	0.71417	0.113000	0.21522	0.622000	0.37654	2.514000	0.45503	0.218000	0.20820	0.271000	0.19318	GAC	NAMPTL	-	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C	ENSG00000229644		0.433	NAMPTL-201	KNOWN	basic|appris_principal	protein_coding	NAMPTL	HGNC	protein_coding		124	0.00	0	C	NG_005593		36811974	36811974	-1	no_errors	ENST00000543053	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	1.000	A
OR8U1	219417	genome.wustl.edu	37	11	56143720	56143720	+	Silent	SNP	C	C	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr11:56143720C>T	ENST00000302270.1	+	1	621	c.621C>T	c.(619-621)ttC>ttT	p.F207F		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					GTATCATGTTCATTTCCTCCC	0.463																																						dbGAP											0													190.0	189.0	190.0					11																	56143720		2054	4214	6268	-	-	-	SO:0001819	synonymous_variant	0			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.621C>T	11.37:g.56143720C>T				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F207	ENST00000302270.1	37	c.621	CCDS41647.1	11																																																																																			OR8U1	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172199		0.463	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8U1	HGNC	protein_coding	OTTHUMT00000391607.1	171	0.00	0	C	NM_001005204		56143720	56143720	+1	no_errors	ENST00000302270	ensembl	human	known	69_37n	silent	72	20.00	18	SNP	0.001	T
PFKL	5211	genome.wustl.edu	37	21	45745847	45745847	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr21:45745847delG	ENST00000349048.4	+	20	2048	c.1993delG	c.(1993-1995)ggcfs	p.G665fs	PFKL_ENST00000403390.1_Frame_Shift_Del_p.G712fs|AP001062.8_ENST00000422357.1_RNA	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	665	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		TTTCCAGGGTGGCGCTCCAAC	0.652																																						dbGAP											0													67.0	61.0	63.0					21																	45745847		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.1993delG	21.37:g.45745847delG	ENSP00000269848:p.Gly665fs		Q96A64|Q96IH4|Q9BR91	Frame_Shift_Del	DEL	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.G712fs	ENST00000349048.4	37	c.2134	CCDS33582.1	21																																																																																			PFKL	-	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk	ENSG00000141959		0.652	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKL	HGNC	protein_coding	OTTHUMT00000195805.1	63	0.00	0	G			45745847	45745847	+1	no_errors	ENST00000403390	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	1.000	-
PI4KAP1	728233	genome.wustl.edu	37	22	20383855	20383855	+	RNA	SNP	C	C	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr22:20383855C>T	ENST00000430523.3	-	0	2235					NR_003563.1		Q8N8J0	PI4P1_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 1						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)												CAGAGGCCCTCGAAGGTCCCC	0.597																																						dbGAP											0																																										-	-	-			0					22q11.21	2007-08-14	2007-08-14			ENSG00000274602			33576	pseudogene	pseudogene							Standard	NR_003563		Approved		uc010gsg.2	Q8N8J0			22.37:g.20383855C>T				RNA	SNP	-	NULL	ENST00000430523.3	37	NULL		22																																																																																			PI4KAP1	-	-	ENSG00000215513		0.597	PI4KAP1-005	KNOWN	basic	processed_transcript	PI4KAP1	HGNC	pseudogene	OTTHUMT00000319534.5	60	0.00	0	C			20383855	20383855	-1	no_errors	ENST00000430523	ensembl	human	known	69_37n	rna	19	13.64	3	SNP	0.000	T
PRKACA	5566	genome.wustl.edu	37	19	14208444	14208444	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr19:14208444A>T	ENST00000308677.4	-	7	785	c.589T>A	c.(589-591)Tgg>Agg	p.W197R	PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000589994.1_Missense_Mutation_p.W189R|PRKACA_ENST00000350356.3_5'UTR	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						CACAAGGTCCAAGTGCGGCCC	0.642																																						dbGAP											0													49.0	52.0	51.0					19																	14208444		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.589T>A	19.37:g.14208444A>T	ENSP00000309591:p.Trp197Arg		Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.W197R	ENST00000308677.4	37	c.589	CCDS12304.1	19	.	.	.	.	.	.	.	.	.	.	A	20.4	3.978706	0.74360	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695;ENST00000536649	T	0.63744	-0.06	4.68	4.68	0.58851	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40640	N	0.001051	T	0.51126	0.1656	N	0.00985	-1.075	0.47994	D	0.999564	D;D;P;D	0.65815	0.986;0.975;0.674;0.995	D;D;D;D	0.70487	0.918;0.941;0.929;0.969	T	0.69179	-0.5213	10	0.87932	D	0	.	12.0852	0.53693	1.0:0.0:0.0:0.0	.	139;180;197;189	B7Z708;Q15136;P17612;P17612-2	.;.;KAPCA_HUMAN;.	R	197;189;197;139	ENSP00000309591:W197R	ENSP00000309591:W197R	W	-	1	0	PRKACA	14069444	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	9.067000	0.93955	1.741000	0.51731	0.482000	0.46254	TGG	PRKACA	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000072062		0.642	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	HGNC	protein_coding	OTTHUMT00000459004.1	65	0.00	0	A	NM_002730		14208444	14208444	-1	no_errors	ENST00000308677	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	1.000	T
TMPRSS2	7113	genome.wustl.edu	37	21	42838079	42838079	+	Splice_Site	SNP	G	G	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr21:42838079G>T	ENST00000332149.5	-	14	1603	c.1469C>A	c.(1468-1470)gCa>gAa	p.A490E	TMPRSS2_ENST00000398585.3_Splice_Site_p.A527E|TMPRSS2_ENST00000458356.1_Splice_Site_p.A490E	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2	490				RAD -> KAN (in Ref. 1; AAC51784). {ECO:0000305}.	positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)		TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				TTAGCCGTCTGCCTGTTCAAA	0.388			T	"""ERG, ETV1, ETV4, ETV5"""	prostate																																	dbGAP		Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	0													80.0	80.0	80.0					21																	42838079		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.1468-1C>A	21.37:g.42838079G>T			A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Srcr_rcpt,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_LDrepeatLR_classA_rpt,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.A527E	ENST00000332149.5	37	c.1580	CCDS33564.1	21	.	.	.	.	.	.	.	.	.	.	G	5.870	0.344662	0.11126	.	.	ENSG00000184012	ENST00000332149;ENST00000398585;ENST00000458356	D;D;D	0.88124	-2.31;-2.34;-2.31	4.13	3.24	0.37175	Peptidase cysteine/serine, trypsin-like (1);	0.785142	0.11066	N	0.603429	T	0.72558	0.3475	N	0.10782	0.045	0.44142	D	0.996936	B;B	0.24920	0.114;0.04	B;B	0.21917	0.037;0.022	T	0.61103	-0.7130	10	0.14656	T	0.56	.	8.3045	0.32034	0.1149:0.0:0.8851:0.0	.	527;490	F8WES1;O15393	.;TMPS2_HUMAN	E	490;527;490	ENSP00000330330:A490E;ENSP00000381588:A527E;ENSP00000391216:A490E	ENSP00000330330:A490E	A	-	2	0	TMPRSS2	41759949	0.866000	0.29940	0.658000	0.29665	0.188000	0.23474	0.887000	0.28254	1.032000	0.39892	0.643000	0.83706	GCA	TMPRSS2	-	superfamily_Pept_cys/ser_Trypsin-like	ENSG00000184012		0.388	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS2	HGNC	protein_coding	OTTHUMT00000195189.1	68	0.00	0	G		Missense_Mutation	42838079	42838079	-1	no_errors	ENST00000398585	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	0.780	T
TRA2A	29896	genome.wustl.edu	37	7	23545185	23545185	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr7:23545185delC	ENST00000297071.4	-	8	1058	c.842delG	c.(841-843)cgcfs	p.R281fs	TRA2A_ENST00000392502.4_Frame_Shift_Del_p.R179fs|TRA2A_ENST00000474586.1_5'Flank|TRA2A_ENST00000538367.1_Frame_Shift_Del_p.R180fs	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	281	Arg/Ser-rich (RS2 domain).				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						TTATCAATAGCGTCCTaaaag	0.279																																					Pancreas(121;2137 2973 46590)	dbGAP											0													11.0	11.0	11.0					7																	23545185		1218	2257	3475	-	-	-	SO:0001589	frameshift_variant	0			U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.842delG	7.37:g.23545185delC	ENSP00000297071:p.Arg281fs		B4DUA9	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R281fs	ENST00000297071.4	37	c.842	CCDS5383.1	7																																																																																			TRA2A	-	NULL	ENSG00000164548		0.279	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRA2A	HGNC	protein_coding	OTTHUMT00000250257.1	21	0.00	0	C	NM_013293		23545185	23545185	-1	no_errors	ENST00000297071	ensembl	human	known	69_37n	frame_shift_del	10	23.08	3	DEL	1.000	-
TYRP1	7306	genome.wustl.edu	37	9	12698600	12698600	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr9:12698600G>A	ENST00000388918.5	+	4	987	c.858G>A	c.(856-858)tgG>tgA	p.W286*	RP11-3L8.3_ENST00000417638.1_RNA|TYRP1_ENST00000381136.2_Intron|TYRP1_ENST00000381137.2_Intron	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	286					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		TTTCTCAATGGCGAGTGGTCT	0.413									Oculocutaneous Albinism																													dbGAP											0													97.0	92.0	94.0					9																	12698600		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.858G>A	9.37:g.12698600G>A	ENSP00000373570:p.Trp286*		P78468|P78469|Q13721|Q15679	Nonsense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.W286*	ENST00000388918.5	37	c.858	CCDS34990.1	9	.	.	.	.	.	.	.	.	.	.	G	40	8.242273	0.98722	.	.	ENSG00000107165	ENST00000388918	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.3292	20.4238	0.99064	0.0:0.0:1.0:0.0	.	.	.	.	X	286	.	ENSP00000373570:W286X	W	+	3	0	TYRP1	12688600	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.828000	0.97474	0.655000	0.94253	TGG	TYRP1	-	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre	ENSG00000107165		0.413	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRP1	HGNC	protein_coding	OTTHUMT00000055502.3	112	0.00	0	G	NM_000550		12698600	12698600	+1	no_errors	ENST00000388918	ensembl	human	known	69_37n	nonsense	38	17.39	8	SNP	1.000	A
ZBED1	9189	genome.wustl.edu	37	X	2407843	2407843	+	Silent	SNP	C	C	T			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chrX:2407843C>T	ENST00000381223.4	-	2	1121	c.918G>A	c.(916-918)ccG>ccA	p.P306P	DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000381218.3_Silent_p.P306P|ZBED1_ENST00000381222.2_Silent_p.P306P|ZBED1_ENST00000515319.1_5'Flank	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	306					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCCCCAGCTTCGGGAGCTGGA	0.622																																						dbGAP											0													57.0	60.0	59.0					X																	2407843		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.918G>A	X.37:g.2407843C>T			Q96BY4	Silent	SNP	pfam_HATC,pfam_Znf_BED_prd,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.P306	ENST00000381223.4	37	c.918	CCDS14118.1	X																																																																																			ZBED1	-	superfamily_RNaseH-like_dom	ENSG00000214717		0.622	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED1	HGNC	protein_coding	OTTHUMT00000144310.3	71	0.00	0	C	NM_004729		2407843	2407843	-1	no_errors	ENST00000381218	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	0.028	T
ZNF462	58499	genome.wustl.edu	37	9	109687060	109687060	+	Silent	SNP	G	G	A	rs201859562	byFrequency	TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr9:109687060G>A	ENST00000277225.5	+	3	1156	c.867G>A	c.(865-867)ccG>ccA	p.P289P	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Silent_p.P289P			Q96JM2	ZN462_HUMAN	zinc finger protein 462	289					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CTGATGTGCCGAACAAGAGTG	0.512													G|||	2	0.000399361	0.0	0.0	5008	,	,		19134	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	76.0	78.0					9																	109687060		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.867G>A	9.37:g.109687060G>A			Q5T0T4|Q8N408	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P289	ENST00000277225.5	37	c.867	CCDS35096.1	9																																																																																			ZNF462	-	NULL	ENSG00000148143		0.512	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	47	0.00	0	G	NM_021224		109687060	109687060	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	silent	17	19.05	4	SNP	0.936	A
ZNF532	55205	genome.wustl.edu	37	18	56586060	56586060	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A1IU-01A-11D-A14G-09	TCGA-E2-A1IU-11A-61D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7fcd5fda-8155-4b48-afb9-9e7958627113	48e5f4e0-7f51-47f6-a508-347ed3638a6d	g.chr18:56586060G>C	ENST00000336078.4	+	4	1317	c.541G>C	c.(541-543)Ggg>Cgg	p.G181R	ZNF532_ENST00000591083.1_Missense_Mutation_p.G181R|ZNF532_ENST00000591230.1_Missense_Mutation_p.G181R|ZNF532_ENST00000589288.1_Missense_Mutation_p.G181R|ZNF532_ENST00000591808.1_Missense_Mutation_p.G181R	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						GGCACTCGGAGGGGAAAACTC	0.507																																						dbGAP											0													95.0	100.0	98.0					18																	56586060		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.541G>C	18.37:g.56586060G>C	ENSP00000338217:p.Gly181Arg		Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G181R	ENST00000336078.4	37	c.541	CCDS11969.1	18	.	.	.	.	.	.	.	.	.	.	g	9.914	1.210390	0.22289	.	.	ENSG00000074657	ENST00000336078	T	0.01505	4.82	5.4	5.4	0.78164	.	0.470794	0.23065	N	0.052333	T	0.04363	0.0120	M	0.65975	2.015	0.58432	D	0.99999	B	0.12013	0.005	B	0.16722	0.016	T	0.35126	-0.9801	10	0.66056	D	0.02	-11.0195	18.7979	0.92003	0.0:0.0:1.0:0.0	.	181	Q9HCE3	ZN532_HUMAN	R	181	ENSP00000338217:G181R	ENSP00000338217:G181R	G	+	1	0	ZNF532	54737040	1.000000	0.71417	0.567000	0.28434	0.031000	0.12232	3.889000	0.56212	2.542000	0.85734	0.550000	0.68814	GGG	ZNF532	-	NULL	ENSG00000074657		0.507	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	HGNC	protein_coding	OTTHUMT00000256130.1	36	0.00	0	G	NM_018181		56586060	56586060	+1	no_errors	ENST00000336078	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.999	C
