#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ARMCX4	100131755	genome.wustl.edu	37	X	100749029	100749029	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chrX:100749029G>A	ENST00000423738.3	+	2	5655	c.5453G>A	c.(5452-5454)gGg>gAg	p.G1818E		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	164						integral component of membrane (GO:0016021)				lung(1)	1						gctgaggctggggctggggct	0.672																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.5453G>A	X.37:g.100749029G>A	ENSP00000404304:p.Gly1818Glu		A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.G1818E	ENST00000423738.3	37	c.5453	CCDS59170.1	X	.	.	.	.	.	.	.	.	.	.	.	2.872	-0.233746	0.05983	.	.	ENSG00000196440	ENST00000423738	.	.	.	3.17	-5.76	0.02376	.	.	.	.	.	T	0.30510	0.0767	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33727	-0.9857	4	.	.	.	.	10.1924	0.43035	0.5782:0.0:0.4218:0.0	.	.	.	.	E	1922	.	.	G	+	2	0	ARMCX4	100635685	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.299000	0.02754	-1.581000	0.01642	-2.697000	0.00138	GGG	ARMCX4	-	NULL	ENSG00000196440		0.672	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	30	0.00	0	G	NM_001256155		100749029	100749029	+1	no_errors	ENST00000423738	ensembl	human	putative	69_37n	missense	78	12.22	11	SNP	0.001	A
BTNL2	56244	genome.wustl.edu	37	6	32372957	32372957	+	Silent	SNP	C	C	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr6:32372957C>T	ENST00000374993.1	-	2	185	c.186G>A	c.(184-186)gaG>gaA	p.E62E	BTNL2_ENST00000544175.1_5'UTR|BTNL2_ENST00000540315.1_Intron|BTNL2_ENST00000429232.2_Silent_p.E62E|BTNL2_ENST00000374995.3_Silent_p.E62E|BTNL2_ENST00000454136.3_Silent_p.E62E|BTNL2_ENST00000414363.1_Intron	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	62	Ig-like V-type 1.					integral component of membrane (GO:0016021)				central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						ACCACCTCACCTCCACGTGCA	0.577																																						dbGAP											0													174.0	167.0	169.0					6																	32372957		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.186G>A	6.37:g.32372957C>T			A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Silent	SNP	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like	p.E62	ENST00000374993.1	37	c.186		6																																																																																			BTNL2	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000204290		0.577	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	BTNL2	HGNC	protein_coding		91	0.00	0	C	NM_019602		32372957	32372957	-1	no_errors	ENST00000468270	ensembl	human	known	69_37n	silent	44	25.42	15	SNP	0.970	T
CACNA2D1	781	genome.wustl.edu	37	7	81636994	81636994	+	Splice_Site	SNP	C	C	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr7:81636994C>T	ENST00000356253.5	-	16	1696		c.e16+1		MIR1255B1_ENST00000439234.1_RNA|CACNA2D1_ENST00000464354.1_Splice_Site|CACNA2D1_ENST00000356860.3_Splice_Site|MIR1255B1_ENST00000454066.1_RNA			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1						calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TAACTTTTAACCTTTAAGTTT	0.313																																						dbGAP											0													29.0	28.0	28.0					7																	81636994		2200	4296	6496	-	-	-	SO:0001630	splice_region_variant	0			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1440+1G>A	7.37:g.81636994C>T			Q17R45|Q9UD80|Q9UD81|Q9UD82	Splice_Site	SNP	-	e16+1	ENST00000356253.5	37	c.1440+1		7	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797615	0.70567	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9728	0.64252	0.1523:0.8477:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CACNA2D1	81474930	0.989000	0.36119	1.000000	0.80357	0.995000	0.86356	0.211000	0.17474	2.626000	0.88956	0.585000	0.79938	.	CACNA2D1	-	-	ENSG00000153956		0.313	CACNA2D1-201	KNOWN	basic	protein_coding	CACNA2D1	HGNC	protein_coding		41	0.00	0	C		Intron	81636994	81636994	-1	no_errors	ENST00000356253	ensembl	human	known	69_37n	splice_site	50	38.27	31	SNP	1.000	T
CCDC157	550631	genome.wustl.edu	37	22	30766398	30766398	+	Silent	SNP	C	C	A			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr22:30766398C>A	ENST00000405659.1	+	5	1213	c.504C>A	c.(502-504)acC>acA	p.T168T	CCDC157_ENST00000338306.3_Silent_p.T168T			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	168										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						ATCTGACTACCAAGTTAATCA	0.577																																						dbGAP											0													136.0	138.0	137.0					22																	30766398		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.504C>A	22.37:g.30766398C>A			Q0VD76|Q9BYA4	Silent	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.T168	ENST00000405659.1	37	c.504	CCDS33632.2	22																																																																																			CCDC157	-	NULL	ENSG00000187860		0.577	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC157	HGNC	protein_coding	OTTHUMT00000320936.1	58	0.00	0	C	NM_001017437		30766398	30766398	+1	no_errors	ENST00000338306	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	0.997	A
CREBZF	58487	genome.wustl.edu	37	11	85375221	85375222	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr11:85375221_85375222insT	ENST00000527447.1	-	1	924_925	c.698_699insA	c.(697-699)gagfs	p.E233fs	CREBZF_ENST00000534224.1_Intron|CREBZF_ENST00000398294.2_Frame_Shift_Ins_p.E151fs|CREBZF_ENST00000531515.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	233	Leucine-zipper. {ECO:0000250}.|bZIP.				negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				GGACTCGACTCTCCAGCCCCAT	0.644											OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(172;674 2044 9050 18334 41735)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.699dupA	11.37:g.85375222_85375222dupT	ENSP00000433459:p.Glu233fs	1236	B2R8Q9|Q0P5U9|Q52LT3	Frame_Shift_Ins	INS	pfam_bZIP_1	p.S234fs	ENST00000527447.1	37	c.699_698	CCDS41697.1	11																																																																																			CREBZF	-	pfam_bZIP_1	ENSG00000137504		0.644	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBZF	HGNC	protein_coding	OTTHUMT00000390191.2	111	0.00	0	-	NM_001039618		85375221	85375222	-1	no_errors	ENST00000525639	ensembl	human	known	69_37n	frame_shift_ins	74	26.00	26	INS	1.000:1.000	T
DENND3	22898	genome.wustl.edu	37	8	142175384	142175384	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr8:142175384G>A	ENST00000262585.2	+	11	1587	c.1309G>A	c.(1309-1311)Gac>Aac	p.D437N	DENND3_ENST00000424248.1_Missense_Mutation_p.D385N|DENND3_ENST00000519811.1_Missense_Mutation_p.D517N	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	437					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GTCGGAGGAGGACAGGTGCTT	0.463																																						dbGAP											0													134.0	133.0	133.0					8																	142175384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1309G>A	8.37:g.142175384G>A	ENSP00000262585:p.Asp437Asn		B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_WD40_repeat,pfam_uDENN_dom,superfamily_WD40_repeat_dom,smart_DENN_dom,smart_dDENN_dom,smart_WD40_repeat,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_WD40_repeat_dom	p.D437N	ENST00000262585.2	37	c.1309	CCDS34947.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.78|11.78	1.741149|1.741149	0.30865|0.30865	.|.	.|.	ENSG00000105339|ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811|ENST00000518668	T;T;T|.	0.14022|.	2.93;2.54;2.94|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.250795|.	0.41097|.	D|.	0.000959|.	T|T	0.59487|0.59487	0.2197|0.2197	L|L	0.50919|0.50919	1.6|1.6	0.37592|0.37592	D|D	0.920204|0.920204	B;B;B|.	0.15141|.	0.009;0.012;0.007|.	B;B;B|.	0.15484|.	0.01;0.013;0.006|.	T|T	0.62072|0.62072	-0.6931|-0.6931	10|5	0.35671|.	T|.	0.21|.	-8.0221|-8.0221	9.8361|9.8361	0.40971|0.40971	0.1521:0.0:0.8479:0.0|0.1521:0.0:0.8479:0.0	.|.	517;385;437|.	E9PF32;A2RUS2-2;A2RUS2|.	.;.;DEND3_HUMAN|.	N|E	437;385;517|441	ENSP00000262585:D437N;ENSP00000410594:D385N;ENSP00000428714:D517N|.	ENSP00000262585:D437N|.	D|G	+|+	1|2	0|0	DENND3|DENND3	142244566|142244566	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.674000|0.674000	0.39518|0.39518	3.604000|3.604000	0.54081|0.54081	2.539000|2.539000	0.85634|0.85634	0.561000|0.561000	0.74099|0.74099	GAC|GGA	DENND3	-	NULL	ENSG00000105339		0.463	DENND3-201	KNOWN	basic|CCDS	protein_coding	DENND3	HGNC	protein_coding		87	0.00	0	G	NM_014957		142175384	142175384	+1	no_errors	ENST00000262585	ensembl	human	known	69_37n	missense	44	30.16	19	SNP	0.976	A
ELTD1	64123	genome.wustl.edu	37	1	79357336	79357336	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr1:79357336C>A	ENST00000370742.3	-	14	1946	c.1883G>T	c.(1882-1884)gGc>gTc	p.G628V		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	628					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CCAGGTGGTGCCGAGAAGGAA	0.473																																						dbGAP											0													64.0	64.0	64.0					1																	79357336		1966	4140	6106	-	-	-	SO:0001583	missense	0			AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1883G>T	1.37:g.79357336C>A	ENSP00000359778:p.Gly628Val		B1AR71|Q5KU34	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G628V	ENST00000370742.3	37	c.1883	CCDS41352.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202985	0.79127	.	.	ENSG00000162618	ENST00000370742;ENST00000401034	T;T	0.63255	-0.03;-0.03	5.59	5.59	0.84812	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.83547	0.5278	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87409	0.2374	9	.	.	.	.	19.5833	0.95478	0.0:1.0:0.0:0.0	.	628	Q9HBW9	ELTD1_HUMAN	V	628;86	ENSP00000359778:G628V;ENSP00000383813:G86V	.	G	-	2	0	ELTD1	79129924	1.000000	0.71417	0.601000	0.28877	0.695000	0.40330	7.792000	0.85828	2.612000	0.88384	0.655000	0.94253	GGC	ELTD1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000162618		0.473	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELTD1	HGNC	protein_coding	OTTHUMT00000026859.1	41	0.00	0	C	NM_022159		79357336	79357336	-1	no_errors	ENST00000370742	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	1.000	A
SSTR5-AS1	146336	genome.wustl.edu	37	16	1116376	1116376	+	RNA	SNP	G	G	A			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr16:1116376G>A	ENST00000569832.1	-	0	580				RP11-161M6.5_ENST00000564390.1_lincRNA	NR_027242.1				SSTR5 antisense RNA 1																		TCGGGGGTCCGCGGCCGCGTG	0.706																																						dbGAP											0																																										-	-	-			0			AK056814		16p13.3	2012-10-12	2012-08-15		ENSG00000261713	ENSG00000261713		"""Long non-coding RNAs"""	26502	non-coding RNA	RNA, long non-coding			"""SSTR5 antisense RNA 1 (non-protein coding)"""				Standard	NR_027242		Approved		uc002cko.3		OTTHUMG00000172831		16.37:g.1116376G>A				RNA	SNP	-	NULL	ENST00000569832.1	37	NULL		16																																																																																			RP11-161M6.5	-	-	ENSG00000261720		0.706	SSTR5-AS1-001	KNOWN	basic	lincRNA	ENSG00000261720	Clone_based_vega_gene	processed_transcript	OTTHUMT00000420783.1	31	0.00	0	G	NR_02724		1116376	1116376	+1	no_errors	ENST00000564390	ensembl	human	known	69_37n	rna	27	19.44	7	SNP	0.018	A
FAN1	22909	genome.wustl.edu	37	15	31206241	31206241	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr15:31206241T>G	ENST00000362065.4	+	5	2049	c.1758T>G	c.(1756-1758)agT>agG	p.S586R		NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	586					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						AGTTTCCTAGTTACACCATCA	0.448								Direct reversal of damage																														dbGAP											0													130.0	123.0	126.0					15																	31206241		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.1758T>G	15.37:g.31206241T>G	ENSP00000354497:p.Ser586Arg		A8K4M2|Q86WU8	Missense_Mutation	SNP	pfam_VRR_NUC,smart_Znf_Rad18_put	p.S586R	ENST00000362065.4	37	c.1758	CCDS32186.1	15	.	.	.	.	.	.	.	.	.	.	T	4.319	0.058554	0.08339	.	.	ENSG00000198690	ENST00000362065	T	0.38240	1.15	5.79	-7.62	0.01294	.	0.775342	0.13407	N	0.390155	T	0.10680	0.0261	N	0.05124	-0.11	0.80722	D	1	B;B	0.14012	0.009;0.002	B;B	0.09377	0.004;0.003	T	0.16778	-1.0391	10	0.16896	T	0.51	-0.138	3.7657	0.08622	0.0932:0.3244:0.3698:0.2127	.	586;586	Q9Y2M0;D9MXF4	FAN1_HUMAN;.	R	586	ENSP00000354497:S586R	ENSP00000354497:S586R	S	+	3	2	FAN1	28993533	0.000000	0.05858	0.000000	0.03702	0.248000	0.25809	-0.954000	0.03873	-1.194000	0.02684	0.460000	0.39030	AGT	FAN1	-	NULL	ENSG00000198690		0.448	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAN1	HGNC	protein_coding	OTTHUMT00000430740.1	65	0.00	0	T	NM_014967		31206241	31206241	+1	no_errors	ENST00000362065	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.003	G
GATA3	2625	genome.wustl.edu	37	10	8111497	8111497	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr10:8111497G>A	ENST00000346208.3	+	5	1438	c.983G>A	c.(982-984)tGg>tAg	p.W328*	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Nonsense_Mutation_p.W329*			P23771	GATA3_HUMAN	GATA binding protein 3	328					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						ACCACACTCTGGAGGAGGAAT	0.547			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	0													175.0	125.0	142.0					10																	8111497		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.983G>A	10.37:g.8111497G>A	ENSP00000341619:p.Trp328*		Q5VWG7|Q5VWG8|Q96J16	Nonsense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.W329*	ENST00000346208.3	37	c.986	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	G	42	9.424981	0.99167	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6718	19.1275	0.93391	0.0:0.0:1.0:0.0	.	.	.	.	X	329;328	.	ENSP00000341619:W328X	W	+	2	0	GATA3	8151503	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.813000	0.99286	2.590000	0.87494	0.561000	0.74099	TGG	GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA	ENSG00000107485		0.547	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	100	0.00	0	G	NM_001002295		8111497	8111497	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	nonsense	54	20.59	14	SNP	1.000	A
MYZAP	100820829	genome.wustl.edu	37	15	57929916	57929916	+	Silent	SNP	A	A	G			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr15:57929916A>G	ENST00000267853.5	+	9	1051	c.957A>G	c.(955-957)caA>caG	p.Q319Q	GCOM1_ENST00000572390.1_Silent_p.Q319Q|GCOM1_ENST00000380568.3_Silent_p.Q319Q|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000380561.2_Silent_p.Q288Q|MYZAP_ENST00000380565.4_Silent_p.Q319Q|GCOM1_ENST00000380569.2_Silent_p.Q319Q|GCOM1_ENST00000587652.1_Silent_p.Q319Q|GCOM1_ENST00000574161.1_Silent_p.Q319Q|GCOM1_ENST00000380560.2_Silent_p.Q250Q|GCOM1_ENST00000396180.1_Silent_p.Q288Q			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	319					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											TGCAACTTCAACTCCTAGAAC	0.373																																						dbGAP											0													104.0	92.0	96.0					15																	57929916		2192	4292	6484	-	-	-	SO:0001819	synonymous_variant	0			FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.957A>G	15.37:g.57929916A>G			D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Silent	SNP	NULL	p.Q319	ENST00000267853.5	37	c.957	CCDS10162.1	15																																																																																			GCOM1	-	NULL	ENSG00000137878		0.373	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCOM1	HGNC	protein_coding	OTTHUMT00000255716.2	47	0.00	0	A	NM_001018100		57929916	57929916	+1	no_errors	ENST00000380569	ensembl	human	known	69_37n	silent	16	36.00	9	SNP	0.436	G
GNAS	2778	genome.wustl.edu	37	20	57429324	57429324	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr20:57429324C>T	ENST00000371100.4	+	1	1556	c.1004C>T	c.(1003-1005)cCg>cTg	p.P335L	GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Missense_Mutation_p.P335L|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371099.2_Missense_Mutation_p.P335L|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000306120.3_Missense_Mutation_p.R272C	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.P335Q(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTGACGGCCCGCCCATCAAG	0.647			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	dbGAP		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	1	Substitution - Missense(1)	lung(1)											16.0	22.0	20.0					20																	57429324		1924	4110	6034	-	-	-	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.1004C>T	20.37:g.57429324C>T	ENSP00000360141:p.Pro335Leu		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.P335L	ENST00000371100.4	37	c.1004	CCDS46622.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.50|12.50	1.957351|1.957351	0.34565|0.34565	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102|ENST00000306120	D;D|.	0.89552|.	-2.53;-2.52|.	3.76|3.76	1.8|1.8	0.24995|0.24995	.|.	4.244870|.	0.00991|.	N|.	0.003533|.	T|T	0.46014|0.46014	0.1371|0.1371	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	B|.	0.29232|.	0.238|.	B|.	0.17979|.	0.02|.	T|T	0.40194|0.40194	-0.9576|-0.9576	10|6	0.87932|0.59425	D|D	0|0.04	.|.	7.1406|7.1406	0.25554|0.25554	0.0:0.7223:0.1753:0.1025|0.0:0.7223:0.1753:0.1025	.|.	335|.	Q5JWF2|.	GNAS1_HUMAN|.	L|C	335|272	ENSP00000360141:P335L;ENSP00000360143:P335L|.	ENSP00000360140:P335L|ENSP00000302237:R272C	P|R	+|+	2|1	0|0	GNAS|GNAS	56862719|56862719	0.472000|0.472000	0.25870|0.25870	0.994000|0.994000	0.49952|0.49952	0.592000|0.592000	0.36648|0.36648	0.494000|0.494000	0.22467|0.22467	0.567000|0.567000	0.29293|0.29293	0.462000|0.462000	0.41574|0.41574	CCG|CGC	GNAS	-	NULL	ENSG00000087460		0.647	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080417.3	33	0.00	0	C	NM_000516		57429324	57429324	+1	no_errors	ENST00000371100	ensembl	human	putative	69_37n	missense	13	31.58	6	SNP	1.000	T
HGFAC	3083	genome.wustl.edu	37	4	3443798	3443800	+	In_Frame_Del	DEL	CTG	CTG	-	rs372137428		TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr4:3443798_3443800delCTG	ENST00000382774.3	+	1	185_187	c.70_72delCTG	c.(70-72)ctgdel	p.L29del	HGFAC_ENST00000511533.1_In_Frame_Del_p.L29del	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	29					proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCTCCTCCTCCTGCTGCTGCTGC	0.714																																						dbGAP											0										1,155,2800		0,0,1,8,139,1330						2.2	1.0			15	2,247,5979		0,0,2,8,231,2873	no	codingComplex	HGFAC	NM_001528.2		0,0,3,16,370,4203	A1A1,A1A2,A1R,A2A2,A2R,RR		3.9981,5.2774,4.4098				3,402,8779				-	-	-	SO:0001651	inframe_deletion	0			D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.70_72delCTG	4.37:g.3443807_3443809delCTG	ENSP00000372224:p.Leu29del		Q14726|Q2M1W7|Q53X47	In_Frame_Del	DEL	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1_S6,pfam_Kringle,pfam_FN_type2_col-bd,pfam_Fibronectin_type1,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EGF-like,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.L27in_frame_del	ENST00000382774.3	37	c.70_72	CCDS3369.1	4																																																																																			HGFAC	-	pirsf_Coagulation_fac_XIIa/HGFA	ENSG00000109758		0.714	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGFAC	HGNC	protein_coding	OTTHUMT00000206607.3	62	0.00	0	CTG			3443798	3443800	+1	no_errors	ENST00000382774	ensembl	human	known	69_37n	in_frame_del	21	12.50	3	DEL	0.997:0.997:0.998	-
IL4	3565	genome.wustl.edu	37	5	132018264	132018264	+	Frame_Shift_Del	DEL	A	A	-	rs368386975		TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr5:132018264delA	ENST00000231449.2	+	4	512	c.447delA	c.(445-447)tcafs	p.S149fs	IL4_ENST00000350025.2_Frame_Shift_Del_p.S133fs	NM_000589.3	NP_000580.1	P05112	IL4_HUMAN	interleukin 4	149					B cell costimulation (GO:0031296)|B cell differentiation (GO:0030183)|cellular defense response (GO:0006968)|cellular response to mercury ion (GO:0071288)|chemotaxis (GO:0006935)|cholesterol metabolic process (GO:0008203)|connective tissue growth factor biosynthetic process (GO:0045189)|defense response to protozoan (GO:0042832)|dendritic cell differentiation (GO:0097028)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female pregnancy (GO:0007565)|immune response (GO:0006955)|innate immune response in mucosa (GO:0002227)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of macrophage activation (GO:0043031)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of T-helper 17 cell differentiation (GO:2000320)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of immune response (GO:0050776)|regulation of isotype switching (GO:0045191)|regulation of phosphorylation (GO:0042325)|regulation of proton transport (GO:0010155)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|T-helper 1 cell lineage commitment (GO:0002296)|T-helper 2 cell cytokine production (GO:0035745)|T-helper 2 cell differentiation (GO:0045064)|type 2 immune response (GO:0042092)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-4 receptor binding (GO:0005136)			NS(1)|large_intestine(3)|lung(3)|prostate(1)	8		all_cancers(142;2.81e-05)|all_lung(232;1.47e-05)|Lung NSC(810;2.31e-05)|all_neural(839;0.0459)|Ovarian(839;0.0481)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.00245)		AGAAATATTCAAAGTGTTCGA	0.294																																						dbGAP											0													77.0	78.0	77.0					5																	132018264		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M23442	CCDS4158.1, CCDS4159.1	5q23-q31	2011-07-14			ENSG00000113520	ENSG00000113520		"""Interleukins and interleukin receptors"""	6014	protein-coding gene	gene with protein product	"""B_cell stimulatory factor 1"", ""lymphocyte stimulatory factor 1"", ""B cell growth factor 1"""	147780				3016727	Standard	NM_000589		Approved	BSF1, IL-4, BCGF1, BCGF-1, MGC79402	uc003kxk.2	P05112	OTTHUMG00000059724	ENST00000231449.2:c.447delA	5.37:g.132018264delA	ENSP00000231449:p.Ser149fs		Q14630|Q6NZ77	Frame_Shift_Del	DEL	pfam_Interleukin-4,superfamily_4_helix_cytokine-like_core,smart_Interleukin-4/13,pirsf_Interleukin-4,prints_Interleukin-4	p.K150fs	ENST00000231449.2	37	c.447	CCDS4158.1	5																																																																																			IL4	-	superfamily_4_helix_cytokine-like_core,smart_Interleukin-4/13,pirsf_Interleukin-4	ENSG00000113520		0.294	IL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4	HGNC	protein_coding	OTTHUMT00000132786.1	87	0.00	0	A	NM_000589		132018264	132018264	+1	no_errors	ENST00000231449	ensembl	human	known	69_37n	frame_shift_del	50	23.08	15	DEL	0.008	-
IREB2	3658	genome.wustl.edu	37	15	78789556	78789556	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr15:78789556C>G	ENST00000258886.8	+	21	2833	c.2684C>G	c.(2683-2685)cCa>cGa	p.P895R		NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	895					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		CAGTTCCTTCCAGGAGAAAAT	0.383																																					NSCLC(200;764 2208 35157 49871 50830)	dbGAP											0													103.0	97.0	99.0					15																	78789556		2196	4293	6489	-	-	-	SO:0001583	missense	0			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.2684C>G	15.37:g.78789556C>G	ENSP00000258886:p.Pro895Arg		A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.P895R	ENST00000258886.8	37	c.2684	CCDS10302.1	15	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947940	0.73787	.	.	ENSG00000136381	ENST00000258886	T	0.17054	2.3	5.87	5.87	0.94306	Aconitase/3-isopropylmalate dehydratase, swivel (2);	0.096318	0.64402	D	0.000001	T	0.27063	0.0663	L	0.46885	1.475	0.80722	D	1	D	0.55385	0.971	P	0.54856	0.762	T	0.00137	-1.2004	10	0.56958	D	0.05	.	11.763	0.51914	0.1372:0.7305:0.1323:0.0	.	895	P48200	IREB2_HUMAN	R	895	ENSP00000258886:P895R	ENSP00000258886:P895R	P	+	2	0	IREB2	76576611	1.000000	0.71417	0.974000	0.42286	0.995000	0.86356	5.326000	0.65875	2.941000	0.99782	0.655000	0.94253	CCA	IREB2	-	superfamily_Aconitase/3IPM_dehydase_swvl,tigrfam_Aconitase/Fe_reg_prot_2	ENSG00000136381		0.383	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IREB2	HGNC	protein_coding	OTTHUMT00000290109.3	58	0.00	0	C	NM_004136		78789556	78789556	+1	no_errors	ENST00000258886	ensembl	human	known	69_37n	missense	33	27.66	13	SNP	0.997	G
NRIP2	83714	genome.wustl.edu	37	12	2939771	2939774	+	Intron	DEL	CTCC	CTCC	-			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	CTCC	CTCC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr12:2939771_2939774delCTCC	ENST00000337508.4	-	2	536					NM_031474.2	NP_113662.1	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GGTGCCCTTTCTCCCTCCCTCCCT	0.588																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK054740	CCDS8514.1	12p13.33	2008-02-05			ENSG00000053702	ENSG00000053702			23078	protein-coding gene	gene with protein product						11230166	Standard	NM_031474		Approved	DKFZP761G1913	uc001qlc.3	Q9BQI9	OTTHUMG00000130616	ENST00000337508.4:c.495+99GGAG>-	12.37:g.2939779_2939782delCTCC			A2RRE3|B4DV61	RNA	DEL	-	NULL	ENST00000337508.4	37	NULL	CCDS8514.1	12																																																																																			ITFG2	-	-	ENSG00000111203		0.588	NRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG2	HGNC	protein_coding	OTTHUMT00000253090.4	61	0.00	0	CTCC	NM_031474		2939771	2939774	+1	no_errors	ENST00000552005	ensembl	human	known	69_37n	rna	28	12.50	4	DEL	0.000:0.000:0.006:0.004	-
ITPKB	3707	genome.wustl.edu	37	1	226924426	226924426	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr1:226924426C>T	ENST00000272117.3	-	1	733	c.734G>A	c.(733-735)gGa>gAa	p.G245E	ITPKB_ENST00000366784.1_Missense_Mutation_p.G245E|ITPKB_ENST00000429204.1_Missense_Mutation_p.G245E			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	245					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				AGCCTCTGATCCTGTAGGGGC	0.587																																					Colon(84;110 1851 5306 33547)	dbGAP											0													61.0	62.0	62.0					1																	226924426		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.734G>A	1.37:g.226924426C>T	ENSP00000272117:p.Gly245Glu		Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	pfam_IPK	p.G245E	ENST00000272117.3	37	c.734	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	C	7.244	0.601835	0.13939	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.23950	1.9;1.9;1.88	4.6	-1.07	0.09968	.	1.644920	0.03205	N	0.175368	T	0.13500	0.0327	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.13818	-1.0495	10	0.17369	T	0.5	.	0.9305	0.01334	0.162:0.2779:0.1582:0.4018	.	245	P27987	IP3KB_HUMAN	E	245	ENSP00000272117:G245E;ENSP00000411152:G245E;ENSP00000355748:G245E	ENSP00000272117:G245E	G	-	2	0	ITPKB	224991049	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-1.814000	0.01723	-0.058000	0.13177	-0.258000	0.10820	GGA	ITPKB	-	NULL	ENSG00000143772		0.587	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	123	0.00	0	C	NM_002221		226924426	226924426	-1	no_errors	ENST00000272117	ensembl	human	known	69_37n	missense	117	12.03	16	SNP	0.000	T
KCTD6	200845	genome.wustl.edu	37	3	58486742	58486742	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr3:58486742T>C	ENST00000355076.6	+	2	1080	c.97T>C	c.(97-99)Tac>Cac	p.Y33H	KCTD6_ENST00000479470.1_3'UTR|KCTD6_ENST00000404589.3_Missense_Mutation_p.Y33H|KCTD6_ENST00000490264.1_Missense_Mutation_p.Y33H	NM_153331.3	NP_699162.3	Q8NC69	KCTD6_HUMAN	potassium channel tetramerization domain containing 6	33	BTB.				protein homooligomerization (GO:0051260)		ankyrin binding (GO:0030506)			endometrium(1)|large_intestine(2)|lung(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(55;0.000177)|Kidney(10;0.00229)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.148)		ATTGACGCGTTACCCGGATTC	0.458																																						dbGAP											0													131.0	134.0	133.0					3																	58486742		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074934	CCDS2891.1	3p21.2	2013-06-20	2013-06-20		ENSG00000168301	ENSG00000168301			22235	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 6"""			21472142	Standard	NM_153331		Approved	MGC27385, KCASH3	uc003dkj.4	Q8NC69	OTTHUMG00000159161	ENST00000355076.6:c.97T>C	3.37:g.58486742T>C	ENSP00000347188:p.Tyr33His		B3KNI5|Q8NBS6|Q8TCA6	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.Y33H	ENST00000355076.6	37	c.97	CCDS2891.1	3	.	.	.	.	.	.	.	.	.	.	T	13.00	2.105164	0.37145	.	.	ENSG00000168301	ENST00000404589;ENST00000490264;ENST00000491093;ENST00000355076	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.75	4.58	0.56647	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	L	0.43646	1.37	0.80722	D	1	P	0.51240	0.943	P	0.56916	0.809	T	0.32771	-0.9894	10	0.27082	T	0.32	.	13.1284	0.59368	0.0:0.0:0.1337:0.8663	.	33	Q8NC69	KCTD6_HUMAN	H	33;33;24;33	ENSP00000384948:Y33H;ENSP00000417490:Y33H;ENSP00000442507:Y24H;ENSP00000347188:Y33H	ENSP00000347188:Y33H	Y	+	1	0	KCTD6	58461782	1.000000	0.71417	0.778000	0.31720	0.065000	0.16274	8.040000	0.89188	0.991000	0.38814	-0.313000	0.08912	TAC	KCTD6	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000168301		0.458	KCTD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD6	HGNC	protein_coding	OTTHUMT00000353591.1	90	0.00	0	T	NM_153331		58486742	58486742	+1	no_errors	ENST00000355076	ensembl	human	known	69_37n	missense	33	32.65	16	SNP	0.996	C
LY96	23643	genome.wustl.edu	37	8	74922237	74922237	+	Splice_Site	SNP	G	G	A			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr8:74922237G>A	ENST00000284818.2	+	3	295	c.204G>A	c.(202-204)agG>agA	p.R68R	LY96_ENST00000518893.1_Splice_Site_p.G38G	NM_015364.4	NP_056179	Q9Y6Y9	LY96_HUMAN	lymphocyte antigen 96	68					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endosome membrane (GO:0010008)|extracellular region (GO:0005576)|lipopolysaccharide receptor complex (GO:0046696)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|lipopolysaccharide receptor activity (GO:0001875)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			CTTTTAAAGGGAGAGATTTAA	0.328																																					GBM(131;1357 1748 34893 50149 52212)	dbGAP											0													61.0	63.0	62.0					8																	74922237		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB018549	CCDS6216.1, CCDS56540.1	8q13.3	2004-01-22			ENSG00000154589	ENSG00000154589			17156	protein-coding gene	gene with protein product		605243				10359581, 11466383	Standard	NM_015364		Approved	MD-2	uc003yad.3	Q9Y6Y9	OTTHUMG00000164504	ENST00000284818.2:c.203-1G>A	8.37:g.74922237G>A			B3Y6A5|E5RJJ7	Silent	SNP	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog	p.R68	ENST00000284818.2	37	c.204	CCDS6216.1	8																																																																																			LY96	-	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog	ENSG00000154589		0.328	LY96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY96	HGNC	protein_coding	OTTHUMT00000379032.2	68	0.00	0	G	NM_015364	Silent	74922237	74922237	+1	no_errors	ENST00000284818	ensembl	human	known	69_37n	silent	52	28.77	21	SNP	0.962	A
MYH7	4625	genome.wustl.edu	37	14	23894537	23894537	+	Nonsense_Mutation	SNP	G	G	A	rs140175704		TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr14:23894537G>A	ENST00000355349.3	-	21	2539	c.2377C>T	c.(2377-2379)Cga>Tga	p.R793*		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	793	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		AGCACACCTCGGGACTGGGCC	0.592																																						dbGAP											0													99.0	82.0	88.0					14																	23894537		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2377C>T	14.37:g.23894537G>A	ENSP00000347507:p.Arg793*		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R793*	ENST00000355349.3	37	c.2377	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	41	8.942275	0.99012	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	.	.	.	4.6	3.63	0.41609	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7174	0.62705	0.0:0.0:0.7331:0.2669	.	.	.	.	X	793	.	ENSP00000347507:R793X	R	-	1	2	MYH7	22964377	0.913000	0.31002	1.000000	0.80357	0.983000	0.72400	1.318000	0.33643	2.543000	0.85770	0.563000	0.77884	CGA	MYH7	-	smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000092054		0.592	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	45	0.00	0	G	NM_000257		23894537	23894537	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	nonsense	18	40.00	12	SNP	1.000	A
NEURL4	84461	genome.wustl.edu	37	17	7222464	7222464	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr17:7222464C>T	ENST00000399464.2	-	22	3604	c.3589G>A	c.(3589-3591)Gcg>Acg	p.A1197T	NEURL4_ENST00000570460.1_Missense_Mutation_p.A1173T|RP11-542C16.2_ENST00000575474.1_Silent_p.A10A|NEURL4_ENST00000315614.7_Missense_Mutation_p.A1195T|NEURL4_ENST00000574120.1_5'Flank	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	1197	NHR 6. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTCTCAGGCGCGCAGGTGATG	0.582																																						dbGAP											0													56.0	68.0	64.0					17																	7222464		2039	4192	6231	-	-	-	SO:0001583	missense	0				CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.3589G>A	17.37:g.7222464C>T	ENSP00000382390:p.Ala1197Thr		Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	pfam_Neu_Z,superfamily_ConA-like_lec_gl,smart_Neu_Z,pfscan_Neu_Z	p.A1197T	ENST00000399464.2	37	c.3589	CCDS42251.1	17	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437508	0.43224	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.30448	1.53;1.53	4.83	3.85	0.44370	NEUZ (3);	0.158614	0.44285	D	0.000470	T	0.21145	0.0509	L	0.43923	1.385	0.25796	N	0.984561	B;B	0.18166	0.021;0.026	B;B	0.17433	0.011;0.018	T	0.13818	-1.0495	9	.	.	.	-3.074	3.893	0.09127	0.0903:0.173:0.5737:0.163	.	1195;1197	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	T	1195;1197	ENSP00000319826:A1195T;ENSP00000382390:A1197T	.	A	-	1	0	NEURL4	7163188	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.428000	0.44749	1.137000	0.42214	-0.344000	0.07964	GCG	NEURL4	-	pfam_Neu_Z,smart_Neu_Z,pfscan_Neu_Z	ENSG00000215041		0.582	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEURL4	HGNC	protein_coding	OTTHUMT00000255434.2	116	0.00	0	C	NM_032442		7222464	7222464	-1	no_errors	ENST00000399464	ensembl	human	known	69_37n	missense	44	34.33	23	SNP	1.000	T
OR2T8	343172	genome.wustl.edu	37	1	248084909	248084909	+	Missense_Mutation	SNP	T	T	G	rs34508376	byFrequency	TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr1:248084909T>G	ENST00000319968.4	+	1	590	c.590T>G	c.(589-591)aTg>aGg	p.M197R		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	197			M -> R (in dbSNP:rs4474294).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAAAACGCCATGTACATCTGC	0.527													T|||	1511	0.301717	0.1029	0.4337	5008	,	,		14434	0.2778		0.4652	False		,,,				2504	0.3333					dbGAP											0													4.0	3.0	4.0					1																	248084909		1815	3480	5295	-	-	-	SO:0001583	missense	0				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.590T>G	1.37:g.248084909T>G	ENSP00000326225:p.Met197Arg			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M197R	ENST00000319968.4	37	c.590	CCDS31100.1	1	1010	0.4624542124542125	65	0.13211382113821138	233	0.643646408839779	209	0.36538461538461536	503	0.6635883905013192	T	14.19	2.460615	0.43736	.	.	ENSG00000177462	ENST00000319968	T	0.00130	8.69	3.56	1.06	0.20224	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	U	0.000672	T	0.00012	0.0000	L	0.54323	1.7	0.80722	P	0.0	D	0.57899	0.981	D	0.65987	0.94	T	0.13255	-1.0516	9	0.72032	D	0.01	.	4.6079	0.12387	0.1689:0.1007:0.0:0.7304	rs34508376	197	A6NH00	OR2T8_HUMAN	R	197	ENSP00000326225:M197R	ENSP00000326225:M197R	M	+	2	0	OR2T8	246151532	0.000000	0.05858	0.009000	0.14445	0.396000	0.30629	-0.130000	0.10498	0.012000	0.14892	0.332000	0.21555	ATG	OR2T8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000177462		0.527	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	43	0.00	0	T	NM_001005522		248084909	248084909	+1	no_errors	ENST00000319968	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	0.000	G
RGPD4	285190	genome.wustl.edu	37	2	108443541	108443541	+	Splice_Site	SNP	G	G	C			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr2:108443541G>C	ENST00000408999.3	+	1	149	c.72G>C	c.(70-72)aaG>aaC	p.K24N	AC096655.2_ENST00000457647.2_lincRNA|RGPD4_ENST00000354986.4_Splice_Site_p.K24N	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	24					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						CGCCTCGAAAGGTGAGTGGAT	0.716																																						dbGAP											0													42.0	57.0	52.0					2																	108443541		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.72+1G>C	2.37:g.108443541G>C			B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.K24N	ENST00000408999.3	37	c.72	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	5.810	0.333790	0.11013	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.38560	1.13;1.13	2.21	1.09	0.20402	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.28632	0.0709	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23726	-1.0180	9	0.52906	T	0.07	-5.3597	7.2473	0.26129	0.0:0.278:0.722:0.0	.	24	Q7Z3J3	RGPD4_HUMAN	N	24	ENSP00000347081:K24N;ENSP00000386810:K24N	ENSP00000347081:K24N	K	+	3	2	RGPD4	107809973	1.000000	0.71417	0.069000	0.20011	0.010000	0.07245	0.812000	0.27211	0.911000	0.36747	0.184000	0.17185	AAG	RGPD4	-	NULL	ENSG00000196862		0.716	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	122	0.00	0	G	XM_496581	Missense_Mutation	108443541	108443541	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	missense	62	33.68	32	SNP	0.261	C
RNU11	26824	genome.wustl.edu	37	1	28975152	28975152	+	lincRNA	SNP	C	C	G	rs75113560	byFrequency	TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr1:28975152C>G	ENST00000427804.1	+	0	1376				RNU11_ENST00000387069.1_lincRNA																							TAGGGCAACTCGATTGCTCTG	0.488																																						dbGAP											0													158.0	148.0	151.0					1																	28975152		692	1591	2283	-	-	-			0																															1.37:g.28975152C>G				RNA	SNP	-	NULL	ENST00000427804.1	37	NULL		1																																																																																			RNU11	-	-	ENSG00000209804		0.488	RP11-442N24__B.1-002	KNOWN	basic	lincRNA	RNU11	HGNC	lincRNA	OTTHUMT00000010342.1	82	0.00	0	C			28975152	28975152	+1	no_errors	ENST00000387069	ensembl	human	known	69_37n	rna	46	13.21	7	SNP	0.641	G
SHQ1	55164	genome.wustl.edu	37	3	72866534	72866534	+	Splice_Site	SNP	C	C	A			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr3:72866534C>A	ENST00000325599.8	-	7	868	c.729G>T	c.(727-729)gtG>gtT	p.V243V	SHQ1_ENST00000463369.1_Splice_Site_p.V215V	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	243					negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CAGAAAAAGACACTAGAAGAA	0.333																																						dbGAP											0													57.0	56.0	56.0					3																	72866534		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.728-1G>T	3.37:g.72866534C>A			B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Silent	SNP	pfam_SHQ1,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.V243	ENST00000325599.8	37	c.729	CCDS33788.1	3																																																																																			SHQ1	-	pfam_SHQ1	ENSG00000144736		0.333	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHQ1	HGNC	protein_coding	OTTHUMT00000352310.1	38	0.00	0	C	NM_018130	Silent	72866534	72866534	-1	no_errors	ENST00000325599	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	0.631	A
SPEN	23013	genome.wustl.edu	37	1	16254905	16254905	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr1:16254905C>T	ENST00000375759.3	+	11	2374	c.2170C>T	c.(2170-2172)Cga>Tga	p.R724*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	724	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GCCGATTGAACGAAGTCAAAG	0.502																																						dbGAP											0													94.0	94.0	94.0					1																	16254905		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2170C>T	1.37:g.16254905C>T	ENSP00000364912:p.Arg724*		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.R724*	ENST00000375759.3	37	c.2170	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.393381	0.97529	.	.	ENSG00000065526	ENST00000375759	.	.	.	4.84	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.5505	13.6305	0.62191	0.36:0.64:0.0:0.0	.	.	.	.	X	724	.	ENSP00000364912:R724X	R	+	1	2	SPEN	16127492	1.000000	0.71417	0.997000	0.53966	0.398000	0.30690	3.027000	0.49697	1.244000	0.43870	-0.311000	0.09066	CGA	SPEN	-	NULL	ENSG00000065526		0.502	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	36	0.00	0	C	NM_015001		16254905	16254905	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	nonsense	19	20.83	5	SNP	0.998	T
SSBP3	23648	genome.wustl.edu	37	1	54692427	54692427	+	3'UTR	SNP	A	A	C	rs548654307		TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr1:54692427A>C	ENST00000371320.3	-	0	1954				SSBP3_ENST00000326956.7_5'UTR|SSBP3_ENST00000371319.3_3'UTR|SSBP3_ENST00000417664.2_3'UTR	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3						head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						ATTTTCCCCCAAAAAACCCCC	0.348																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.*377T>G	1.37:g.54692427A>C			A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	RNA	SNP	-	NULL	ENST00000371320.3	37	NULL	CCDS591.1	1																																																																																			SSBP3	-	-	ENSG00000157216		0.348	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SSBP3	HGNC	protein_coding	OTTHUMT00000022721.1	65	0.00	0	A	NM_018070		54692427	54692427	-1	no_errors	ENST00000326956	ensembl	human	known	69_37n	rna	92	29.77	39	SNP	0.000	C
THADA	63892	genome.wustl.edu	37	2	43776496	43776497	+	Frame_Shift_Ins	INS	-	-	GCTT	rs370549487		TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr2:43776496_43776497insGCTT	ENST00000405006.4	-	20	3309_3310	c.2958_2959insAAGC	c.(2956-2961)agccgcfs	p.R987fs	THADA_ENST00000415080.2_Frame_Shift_Ins_p.R697fs|THADA_ENST00000330266.7_Frame_Shift_Ins_p.R697fs|THADA_ENST00000405975.2_Frame_Shift_Ins_p.R987fs	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	987										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				ATCTGTAAGCGGCTTGCTGACT	0.376																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.2955_2958dupAAGC	2.37:g.43776497_43776500dupGCTT	ENSP00000385995:p.Arg987fs		A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Frame_Shift_Ins	INS	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	p.R986fs	ENST00000405006.4	37	c.2959_2958	CCDS46268.1	2																																																																																			THADA	-	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	ENSG00000115970		0.376	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	HGNC	protein_coding	OTTHUMT00000326070.3	56	0.00	0	-	NM_022065		43776496	43776497	-1	no_errors	ENST00000405006	ensembl	human	known	69_37n	frame_shift_ins	40	20.00	10	INS	1.000:0.983	GCTT
TMEM57	55219	genome.wustl.edu	37	1	25810703	25810703	+	Silent	SNP	C	C	G	rs539330446		TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr1:25810703C>G	ENST00000374343.4	+	7	1430	c.1251C>G	c.(1249-1251)acC>acG	p.T417T	TMEM57_ENST00000399763.3_Silent_p.T59T|TMEM57_ENST00000399766.3_Silent_p.T190T	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	417					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)				breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		TTTCGAGCACCGAGCGAGGGA	0.557																																						dbGAP											0													72.0	74.0	73.0					1																	25810703		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.1251C>G	1.37:g.25810703C>G			B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Silent	SNP	pfam_Macoilin,superfamily_Prefoldin	p.T417	ENST00000374343.4	37	c.1251	CCDS30638.1	1																																																																																			TMEM57	-	pfam_Macoilin,superfamily_Prefoldin	ENSG00000204178		0.557	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM57	HGNC	protein_coding	OTTHUMT00000009659.2	26	0.00	0	C	NM_018202		25810703	25810703	+1	no_errors	ENST00000374343	ensembl	human	known	69_37n	silent	11	38.89	7	SNP	0.303	G
TUBAL3	79861	genome.wustl.edu	37	10	5436290	5436290	+	Silent	SNP	C	C	T	rs186242250	byFrequency	TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr10:5436290C>T	ENST00000380419.3	-	4	568	c.531G>A	c.(529-531)tcG>tcA	p.S177S	TUBAL3_ENST00000479328.1_Silent_p.S137S	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	177					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						CTGGGTAGACCGAGAACTCCA	0.522													C|||	4	0.000798722	0.0	0.0043	5008	,	,		19175	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													88.0	85.0	86.0					10																	5436290		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.531G>A	10.37:g.5436290C>T			B4DKL2|Q4QQJ5|Q9H6Z0	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.S177	ENST00000380419.3	37	c.531	CCDS7066.2	10																																																																																			TUBAL3	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Tubulin	ENSG00000178462		0.522	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBAL3	HGNC	protein_coding	OTTHUMT00000046548.2	46	0.00	0	C	NM_024803		5436290	5436290	-1	no_errors	ENST00000380419	ensembl	human	known	69_37n	silent	24	36.84	14	SNP	0.018	T
WDR13	64743	genome.wustl.edu	37	X	48462671	48462671	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chrX:48462671A>G	ENST00000218056.5	+	8	1671	c.1166A>G	c.(1165-1167)aAc>aGc	p.N389S	WDR13_ENST00000376729.5_Missense_Mutation_p.N389S	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	389						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						GTGGTAGACAACGAGGGGACC	0.607																																						dbGAP											0													76.0	55.0	62.0					X																	48462671		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.1166A>G	X.37:g.48462671A>G	ENSP00000218056:p.Asn389Ser		Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N389S	ENST00000218056.5	37	c.1166	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	A	9.309	1.055047	0.19907	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.71222	-0.55;-0.55	5.74	5.74	0.90152	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.043456	0.85682	D	0.000000	T	0.57286	0.2043	L	0.31207	0.915	0.58432	D	0.999998	B	0.20368	0.044	B	0.17098	0.017	T	0.53143	-0.8480	10	0.16420	T	0.52	0.5335	12.7506	0.57306	1.0:0.0:0.0:0.0	.	389	Q9H1Z4	WDR13_HUMAN	S	389	ENSP00000365919:N389S;ENSP00000218056:N389S	ENSP00000218056:N389S	N	+	2	0	WDR13	48347615	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	6.530000	0.73816	1.918000	0.55548	0.483000	0.47432	AAC	WDR13	-	superfamily_WD40_repeat_dom	ENSG00000101940		0.607	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	81	0.00	0	A			48462671	48462671	+1	no_errors	ENST00000218056	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	1.000	G
CFAP44	55779	genome.wustl.edu	37	3	113119414	113119414	+	Silent	SNP	G	G	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr3:113119414G>T	ENST00000295868.2	-	12	1614	c.1452C>A	c.(1450-1452)ctC>ctA	p.L484L	WDR52_ENST00000393845.2_Silent_p.L484L	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TTGTGGCCATGAGATAAGTGA	0.403																																						dbGAP											0													59.0	62.0	61.0					3																	113119414		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000295868.2:c.1452C>A	3.37:g.113119414G>T				Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L484	ENST00000295868.2	37	c.1452	CCDS2972.1	3																																																																																			WDR52	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000206530		0.403	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR52	HGNC	protein_coding	OTTHUMT00000354128.3	42	0.00	0	G			113119414	113119414	-1	no_errors	ENST00000393845	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	0.987	T
ZC3H11A	9877	genome.wustl.edu	37	1	203767807	203767807	+	Intron	SNP	C	C	T			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr1:203767807C>T	ENST00000332127.4	+	2	293				ZBED6_ENST00000550078.1_Missense_Mutation_p.A386V|ZC3H11A_ENST00000367214.1_Intron|ZC3H11A_ENST00000367212.3_Intron|ZC3H11A_ENST00000545588.1_5'Flank|ZC3H11A_ENST00000466470.1_Intron			O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A						poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATTCCCGTTGCAGAGCAAGGC	0.443																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000332127.4:c.-565+2183C>T	1.37:g.203767807C>T			Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	pfam_Znf_BED_prd,pfam_HATC,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.A386V	ENST00000332127.4	37	c.1157	CCDS30978.1	1	.	.	.	.	.	.	.	.	.	.	C	5.093	0.202803	0.09652	.	.	ENSG00000257315	ENST00000550078	.	.	.	4.46	-0.53	0.11898	.	.	.	.	.	T	0.23210	0.0561	L	0.36672	1.1	0.28409	N	0.918282	.	.	.	.	.	.	T	0.27502	-1.0072	6	0.25751	T	0.34	.	1.0195	0.01515	0.1565:0.3725:0.1541:0.3168	.	.	.	.	V	386	.	ENSP00000447879:A386V	A	+	2	0	ZBED6	202034430	0.000000	0.05858	0.712000	0.30502	0.573000	0.36030	0.209000	0.17435	-0.079000	0.12707	-0.136000	0.14681	GCA	ZBED6	-	NULL	ENSG00000257315		0.443	ZC3H11A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED6	HGNC	protein_coding	OTTHUMT00000087691.1	57	0.00	0	C	NM_014827		203767807	203767807	+1	no_errors	ENST00000550078	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	0.872	T
ZNF510	22869	genome.wustl.edu	37	9	99525348	99525348	+	Intron	SNP	T	T	C			TCGA-E2-A570-01A-11D-A29N-09	TCGA-E2-A570-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	0ebb7058-4311-40a6-ac47-6b5f0c38492f	714b82cd-b87d-4c9f-af14-386a442d1c74	g.chr9:99525348T>C	ENST00000375231.1	-	5	1003				ZNF510_ENST00000472201.1_5'UTR|ZNF510_ENST00000223428.4_Intron			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TAAAGTGACCTGGAGTCTAAC	0.403																																						dbGAP											0													68.0	63.0	65.0					9																	99525348		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.352+51A>G	9.37:g.99525348T>C			Q5SZP5	RNA	SNP	-	NULL	ENST00000375231.1	37	NULL	CCDS35074.1	9																																																																																			ZNF510	-	-	ENSG00000081386		0.403	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF510	HGNC	protein_coding	OTTHUMT00000053287.1	59	0.00	0	T	NM_014930		99525348	99525348	-1	no_errors	ENST00000472201	ensembl	human	known	69_37n	rna	34	30.61	15	SNP	0.001	C
