#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
SMIM14	201895	genome.wustl.edu	37	4	39553738	39553738	+	3'UTR	SNP	T	T	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr4:39553738T>A	ENST00000295958.5	-	0	694				UGDH-AS1_ENST00000504032.1_RNA|SMIM14_ENST00000510628.1_5'UTR|SMIM14_ENST00000511809.1_Nonstop_Mutation_p.*55C	NM_174921.1	NP_777581.1	Q96QK8	SIM14_HUMAN	small integral membrane protein 14							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											ACTTCCCATATCACAAAGTTA	0.348																																						dbGAP											0													108.0	97.0	101.0					4																	39553738		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC008502	CCDS3456.1	4p14	2014-02-10	2012-12-03	2012-12-03	ENSG00000163683	ENSG00000163683			27321	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 34"""	C4orf34		15231747, 24499674, 23759569	Standard	NM_174921		Approved	FLJ13289	uc003guo.3	Q96QK8	OTTHUMG00000128581	ENST00000295958.5:c.*8A>T	4.37:g.39553738T>A				Nonstop_Mutation	SNP	pfam_Uncharacterised_CD034/YQF4	p.*55C	ENST00000295958.5	37	c.165	CCDS3456.1	4	.	.	.	.	.	.	.	.	.	.	T	10.10	1.258244	0.23051	.	.	ENSG00000163683	ENST00000511809	.	.	.	5.45	1.63	0.23807	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.129	0.01741	0.2461:0.0998:0.1511:0.503	.	.	.	.	C	55	.	.	X	-	3	0	C4orf34	39230133	0.001000	0.12720	0.874000	0.34290	0.621000	0.37620	-0.455000	0.06762	1.021000	0.39600	0.482000	0.46254	TGA	C4orf34	-	NULL	ENSG00000163683		0.348	SMIM14-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C4orf34	HGNC	protein_coding	OTTHUMT00000250434.4	241	0.00	0	T	NM_174921		39553738	39553738	-1	no_errors	ENST00000511809	ensembl	human	novel	69_37n	nonstop	102	35.44	56	SNP	0.178	A
CALR3	125972	genome.wustl.edu	37	19	16593495	16593495	+	Silent	SNP	C	C	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr19:16593495C>T	ENST00000269881.3	-	6	842	c.780G>A	c.(778-780)ccG>ccA	p.P260P	CALR3_ENST00000602234.1_5'UTR|CTD-3222D19.2_ENST00000409035.1_3'UTR	NM_145046.4	NP_659483.2	Q96L12	CALR3_HUMAN	calreticulin 3	260	3 X approximate repeats.|P-domain.				cell differentiation (GO:0030154)|protein folding (GO:0006457)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|prostate(1)|skin(1)	15						ACACCTGGTACGGGGGCTTCT	0.592																																						dbGAP											0													49.0	50.0	50.0					19																	16593495		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK058084	CCDS12344.1	19p13.11	2014-09-17				ENSG00000269058			20407	protein-coding gene	gene with protein product	"""cancer/testis antigen 93"", ""calsperin"""	611414				12384296	Standard	NM_145046		Approved	CRT2, FLJ25355, MGC26577, CT93	uc002ned.3	Q96L12		ENST00000269881.3:c.780G>A	19.37:g.16593495C>T			D9N574|Q96LN3	Silent	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,superfamily_Calreticulin/calnexin_P,pirsf_Calreticulin,prints_Calret/calnex	p.P260	ENST00000269881.3	37	c.780	CCDS12344.1	19																																																																																			CALR3	-	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,superfamily_Calreticulin/calnexin_P,pirsf_Calreticulin	ENSG00000141979		0.592	CALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR3	HGNC	protein_coding	OTTHUMT00000461089.1	86	0.00	0	C	NM_145046		16593495	16593495	-1	no_errors	ENST00000269881	ensembl	human	known	69_37n	silent	43	31.75	20	SNP	0.010	T
CHAF1B	8208	genome.wustl.edu	37	21	37771831	37771831	+	Silent	SNP	A	A	G			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr21:37771831A>G	ENST00000314103.5	+	7	742	c.591A>G	c.(589-591)gtA>gtG	p.V197V		NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	197					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						TGCTGCGAGTATACAGTATAC	0.383																																						dbGAP											0													139.0	131.0	134.0					21																	37771831		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.591A>G	21.37:g.37771831A>G			Q99548	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B	p.V197	ENST00000314103.5	37	c.591	CCDS13644.1	21																																																																																			CHAF1B	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Gprotein_B	ENSG00000159259		0.383	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1B	HGNC	protein_coding	OTTHUMT00000194616.2	168	0.00	0	A	NM_005441		37771831	37771831	+1	no_errors	ENST00000314103	ensembl	human	known	69_37n	silent	84	32.26	40	SNP	0.210	G
DCAF8L1	139425	genome.wustl.edu	37	X	27999081	27999081	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chrX:27999081C>A	ENST00000441525.1	-	1	485	c.371G>T	c.(370-372)gGt>gTt	p.G124V		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	124										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						GTTGGTGCCACCGCATCGTGG	0.557																																						dbGAP											0													141.0	77.0	98.0					X																	27999081		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.371G>T	X.37:g.27999081C>A	ENSP00000405222:p.Gly124Val		B3KXX1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G124V	ENST00000441525.1	37	c.371	CCDS35222.1	X	.	.	.	.	.	.	.	.	.	.	C	4.659	0.122518	0.08931	.	.	ENSG00000226372	ENST00000441525	T	0.63744	-0.06	0.842	0.842	0.18927	.	0.989298	0.08207	N	0.981384	T	0.49372	0.1553	L	0.43152	1.355	0.19300	N	0.999977	B	0.29612	0.251	B	0.32393	0.145	T	0.41413	-0.9510	10	0.30078	T	0.28	-0.157	3.0536	0.06177	0.0:0.6655:0.0:0.3345	.	124	A6NGE4	DC8L1_HUMAN	V	124	ENSP00000405222:G124V	ENSP00000405222:G124V	G	-	2	0	DCAF8L1	27909002	0.679000	0.27596	0.002000	0.10522	0.021000	0.10359	0.698000	0.25571	0.691000	0.31592	0.284000	0.19432	GGT	DCAF8L1	-	NULL	ENSG00000226372		0.557	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	HGNC	protein_coding	OTTHUMT00000056150.2	112	0.00	0	C	XM_066690		27999081	27999081	-1	no_errors	ENST00000441525	ensembl	human	known	69_37n	missense	45	35.71	25	SNP	0.077	A
DHRS12	79758	genome.wustl.edu	37	13	52345423	52345423	+	Intron	SNP	G	G	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr13:52345423G>A	ENST00000444610.2	-	8	720				DHRS12_ENST00000280056.2_Silent_p.L256L|DHRS12_ENST00000218981.1_Intron|DHRS12_ENST00000490949.1_5'Flank	NM_001270424.1	NP_001257353.1	A0PJE2	DHR12_HUMAN	dehydrogenase/reductase (SDR family) member 12								oxidoreductase activity (GO:0016491)			cervix(1)|large_intestine(1)|lung(2)|skin(2)|urinary_tract(1)	7		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		gagcccaggtgagctgcctga	0.587																																						dbGAP											0													69.0	53.0	58.0					13																	52345423		2195	4293	6488	-	-	-	SO:0001627	intron_variant	0			AK023701	CCDS9430.1, CCDS31976.1, CCDS58292.1	13q14.3	2013-10-11			ENSG00000102796	ENSG00000102796		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	25832	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 40C, member 1"""					19027726	Standard	NM_001031719		Approved	FLJ13639, SDR40C1	uc001vfq.4	A0PJE2	OTTHUMG00000016952	ENST00000444610.2:c.706+533C>T	13.37:g.52345423G>A			Q96GB2|Q9H8H1	Silent	SNP	pfam_DH_sc/Rdtase_SDR	p.L256	ENST00000444610.2	37	c.768	CCDS58292.1	13																																																																																			DHRS12	-	NULL	ENSG00000102796		0.587	DHRS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS12	HGNC	protein_coding	OTTHUMT00000045036.3	101	0.00	0	G	NM_024705		52345423	52345423	-1	no_errors	ENST00000280056	ensembl	human	known	69_37n	silent	31	43.64	24	SNP	0.001	A
COL26A1	136227	genome.wustl.edu	37	7	101091052	101091052	+	RNA	SNP	G	G	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr7:101091052G>T	ENST00000397927.3	+	0	582				COL26A1_ENST00000528707.1_RNA|COL26A1_ENST00000313669.7_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)											GCTTCACCGGGAGCAACTGTG	0.607																																						dbGAP											0													36.0	38.0	37.0					7																	101091052		2070	4186	6256	-	-	-			0			AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101091052G>T			Q32M90	Silent	SNP	pfam_EMI_domain,pfam_Collagen,pfscan_EMI_domain	p.G123	ENST00000397927.3	37	c.369		7																																																																																			EMID2	-	pfam_EMI_domain,pfscan_EMI_domain	ENSG00000160963		0.607	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	EMID2	HGNC	polymorphic_pseudogene	OTTHUMT00000315898.2	58	0.00	0	G	NM_133457		101091052	101091052	+1	no_errors	ENST00000313669	ensembl	human	known	69_37n	silent	16	38.46	10	SNP	0.992	T
F8	2157	genome.wustl.edu	37	X	154159944	154159944	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chrX:154159944C>T	ENST00000360256.4	-	14	2321	c.2121G>A	c.(2119-2121)tgG>tgA	p.W707*		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	707	F5/8 type A 2.|Plastocyanin-like 4.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	ACCCCAGAATCCATAGACCTG	0.433																																						dbGAP											0			GRCh37	CM061759	F8	M							54.0	49.0	51.0					X																	154159944		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.2121G>A	X.37:g.154159944C>T	ENSP00000353393:p.Trp707*		Q14286|Q5HY69	Nonsense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.W707*	ENST00000360256.4	37	c.2121	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	C	39	7.512479	0.98329	.	.	ENSG00000185010	ENST00000360256	.	.	.	5.37	5.37	0.77165	.	0.056136	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.9769	14.7944	0.69868	0.0:1.0:0.0:0.0	.	.	.	.	X	707	.	ENSP00000353393:W707X	W	-	3	0	F8	153813138	1.000000	0.71417	0.997000	0.53966	0.421000	0.31385	3.996000	0.57009	2.240000	0.73641	0.422000	0.28245	TGG	F8	-	superfamily_Cupredoxin	ENSG00000185010		0.433	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	74	0.00	0	C			154159944	154159944	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	nonsense	36	23.40	11	SNP	1.000	T
FREM2	341640	genome.wustl.edu	37	13	39453040	39453040	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr13:39453040G>A	ENST00000280481.7	+	23	9148	c.8932G>A	c.(8932-8934)Gac>Aac	p.D2978N		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2978					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AGCAGTGGATGACCCTGAAGC	0.433																																						dbGAP											0													207.0	182.0	191.0					13																	39453040		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8932G>A	13.37:g.39453040G>A	ENSP00000280481:p.Asp2978Asn		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D2978N	ENST00000280481.7	37	c.8932	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	5.103	0.204685	0.09704	.	.	ENSG00000150893	ENST00000280481	T	0.62364	0.03	5.71	4.87	0.63330	.	0.099255	0.64402	D	0.000002	T	0.47783	0.1464	L	0.49126	1.545	0.50632	D	0.99988	B	0.32101	0.356	B	0.21546	0.035	T	0.41875	-0.9484	10	0.07030	T	0.85	.	11.0091	0.47652	0.0696:0.1295:0.8009:0.0	.	2978	Q5SZK8	FREM2_HUMAN	N	2978	ENSP00000280481:D2978N	ENSP00000280481:D2978N	D	+	1	0	FREM2	38351040	1.000000	0.71417	0.997000	0.53966	0.002000	0.02628	3.250000	0.51445	1.426000	0.47256	-0.253000	0.11424	GAC	FREM2	-	NULL	ENSG00000150893		0.433	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	192	0.00	0	G	NM_207361		39453040	39453040	+1	no_errors	ENST00000280481	ensembl	human	known	69_37n	missense	71	33.02	35	SNP	1.000	A
FXR1	8087	genome.wustl.edu	37	3	180680687	180680687	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr3:180680687G>C	ENST00000357559.4	+	12	1478	c.1094G>C	c.(1093-1095)aGa>aCa	p.R365T	FXR1_ENST00000445140.2_Missense_Mutation_p.R365T|FXR1_ENST00000480918.1_Missense_Mutation_p.R352T|FXR1_ENST00000491062.1_Missense_Mutation_p.R316T|FXR1_ENST00000468861.1_Missense_Mutation_p.R280T|FXR1_ENST00000305586.7_Missense_Mutation_p.R280T	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	365					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			GAACAGCTAAGAATGGAACGC	0.393																																						dbGAP											0													151.0	155.0	154.0					3																	180680687		2203	4300	6503	-	-	-	SO:0001583	missense	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1094G>C	3.37:g.180680687G>C	ENSP00000350170:p.Arg365Thr		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,superfamily_NA-bd_OB-fold-like,smart_KH_dom,pfscan_KH_dom_type_1	p.R365T	ENST00000357559.4	37	c.1094	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256386	0.80246	.	.	ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000480918	T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.67998	0.2953	M	0.78456	2.415	0.80722	D	1	D;D;D;D;D;P	0.71674	0.997;0.996;0.998;0.998;0.998;0.901	D;D;D;D;D;B	0.85130	0.956;0.971;0.971;0.997;0.984;0.432	T	0.71286	-0.4638	10	0.87932	D	0	-7.439	19.4941	0.95064	0.0:0.0:1.0:0.0	.	352;316;280;280;365;365	B4DXZ6;E9PFF5;E7EU85;E7ERF5;P51114-2;P51114	.;.;.;.;.;FXR1_HUMAN	T	365;280;316;280;365;352	ENSP00000350170:R365T;ENSP00000307633:R280T;ENSP00000420643:R316T;ENSP00000420515:R280T;ENSP00000388828:R365T;ENSP00000418097:R352T	ENSP00000307633:R280T	R	+	2	0	FXR1	182163381	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.212000	0.77941	2.682000	0.91365	0.591000	0.81541	AGA	FXR1	-	pfam_Frag_X_MRP_fam	ENSG00000114416		0.393	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	164	0.00	0	G			180680687	180680687	+1	no_errors	ENST00000357559	ensembl	human	known	69_37n	missense	71	34.26	37	SNP	1.000	C
ITGA8	8516	genome.wustl.edu	37	10	15614253	15614253	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr10:15614253A>G	ENST00000378076.3	-	25	2947	c.2594T>C	c.(2593-2595)cTg>cCg	p.L865P		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	865					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TTGGCACTGCAGAGGTCCCAG	0.418																																						dbGAP											0													84.0	87.0	86.0					10																	15614253		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2594T>C	10.37:g.15614253A>G	ENSP00000367316:p.Leu865Pro		B0YJ31|Q5VX94	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.L865P	ENST00000378076.3	37	c.2594	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	A	20.2	3.958162	0.73902	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.52526	0.66	5.79	5.79	0.91817	Integrin alpha-2 (1);	0.202344	0.44902	D	0.000405	T	0.66992	0.2846	M	0.75615	2.305	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.68483	0.929;0.958	T	0.66448	-0.5921	10	0.35671	T	0.21	.	15.1154	0.72397	1.0:0.0:0.0:0.0	.	850;865	F5H818;P53708	.;ITA8_HUMAN	P	865;850	ENSP00000367316:L865P	ENSP00000367316:L865P	L	-	2	0	ITGA8	15654259	1.000000	0.71417	0.916000	0.36221	0.894000	0.52154	7.360000	0.79487	2.208000	0.71279	0.533000	0.62120	CTG	ITGA8	-	pfam_Integrin_alpha-2	ENSG00000077943		0.418	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	85	0.00	0	A	NM_003638		15614253	15614253	-1	no_errors	ENST00000378076	ensembl	human	known	69_37n	missense	42	30.00	18	SNP	0.676	G
KCNA5	3741	genome.wustl.edu	37	12	5153951	5153951	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr12:5153951T>A	ENST00000252321.3	+	1	867	c.638T>A	c.(637-639)tTc>tAc	p.F213Y		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	213					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	ATGGAGCGCTTCCGCGAGGAT	0.632																																						dbGAP											0													49.0	55.0	53.0					12																	5153951		2203	4300	6503	-	-	-	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.638T>A	12.37:g.5153951T>A	ENSP00000252321:p.Phe213Tyr		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.F213Y	ENST00000252321.3	37	c.638	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	T	15.41	2.825307	0.50739	.	.	ENSG00000130037	ENST00000252321	T	0.76448	-1.02	4.77	4.77	0.60923	BTB/POZ-like (1);BTB/POZ fold (2);	0.000000	0.85682	U	0.000000	T	0.68449	0.3002	N	0.16478	0.41	0.58432	D	0.999994	B	0.24368	0.102	B	0.36378	0.223	T	0.66575	-0.5889	10	0.39692	T	0.17	.	13.6401	0.62246	0.0:0.0:0.0:1.0	.	213	P22460	KCNA5_HUMAN	Y	213	ENSP00000252321:F213Y	ENSP00000252321:F213Y	F	+	2	0	KCNA5	5024212	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.920000	0.70017	2.007000	0.58848	0.459000	0.35465	TTC	KCNA5	-	superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv1	ENSG00000130037		0.632	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	41	0.00	0	T	NM_002234		5153951	5153951	+1	no_errors	ENST00000252321	ensembl	human	known	69_37n	missense	15	63.41	26	SNP	1.000	A
KIF4A	24137	genome.wustl.edu	37	X	69510363	69510363	+	Silent	SNP	C	C	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chrX:69510363C>T	ENST00000374403.3	+	2	137	c.55C>T	c.(55-57)Ctg>Ttg	p.L19L	PDZD11_ENST00000473667.1_5'Flank|PDZD11_ENST00000239666.4_5'Flank|KIF4A_ENST00000485406.1_3'UTR|KIF4A_ENST00000374388.3_Silent_p.L19L|PDZD11_ENST00000374454.1_5'Flank	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	19	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TTGTCGCCCTCTGGTCCCCAA	0.577																																						dbGAP											0													75.0	62.0	67.0					X																	69510363		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.55C>T	X.37:g.69510363C>T			B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L19	ENST00000374403.3	37	c.55	CCDS14401.1	X																																																																																			KIF4A	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000090889		0.577	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	131	0.00	0	C	NM_012310		69510363	69510363	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	silent	57	26.92	21	SNP	0.999	T
KIR3DL1	3811	genome.wustl.edu	37	19	55325455	55325455	+	Intron	SNP	G	G	A	rs1051457	byFrequency	TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr19:55325455G>A	ENST00000538269.1	+	2	61				KIR3DL1_ENST00000326542.7_5'Flank|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000345540.5_Silent_p.L306L|KIR2DL4_ENST00000396293.1_Silent_p.L194L|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Silent_p.L361L|KIR2DL4_ENST00000346587.4_Silent_p.L211L|KIR2DL4_ENST00000357494.4_Silent_p.L289L|KIR3DL1_ENST00000391728.4_5'Flank|KIR3DL1_ENST00000358178.4_5'Flank|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000359085.4_3'UTR			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CCAGAGCGTTGTCTCCTGCCC	0.522													g|||	1141	0.227835	0.0197	0.3199	5008	,	,		10104	0.4712		0.1839	False		,,,				2504	0.2382					dbGAP											0													5.0	6.0	6.0					19																	55325455		1012	3024	4036	-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-3534G>A	19.37:g.55325455G>A			O43473|Q14946|Q16541	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.L361	ENST00000538269.1	37	c.1083		19																																																																																			KIR2DL4	-	NULL	ENSG00000189013		0.522	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL4	HGNC	protein_coding		22	0.00	0	G	NM_013289		55325455	55325455	+1	no_errors	ENST00000396284	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	0.001	A
LSM1	27257	genome.wustl.edu	37	8	38033806	38033806	+	Silent	SNP	G	G	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr8:38033806G>A	ENST00000311351.4	-	1	428	c.33C>T	c.(31-33)atC>atT	p.I11I	LSM1_ENST00000520755.1_Silent_p.I11I|BAG4_ENST00000287322.4_5'Flank|BAG4_ENST00000432471.2_5'Flank|LSM1_ENST00000522515.1_5'UTR	NM_014462.2	NP_055277.1	O15116	LSM1_HUMAN	LSM1, U6 small nuclear RNA associated	11					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(3)|lung(2)	7	Colorectal(12;0.000442)					CAATGTCCTCGATGAGGCTGG	0.562																																						dbGAP											0													53.0	50.0	51.0					8																	38033806		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF000177	CCDS6103.1	8p11.2	2014-02-14	2014-02-14		ENSG00000175324	ENSG00000175324			20472	protein-coding gene	gene with protein product		607281	"""LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)"""			12515382, 11953827	Standard	NM_014462		Approved	CASM, YJL124C	uc003xkw.3	O15116	OTTHUMG00000164051	ENST00000311351.4:c.33C>T	8.37:g.38033806G>A			B2R5E6	Silent	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.I11	ENST00000311351.4	37	c.33	CCDS6103.1	8																																																																																			LSM1	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	ENSG00000175324		0.562	LSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM1	HGNC	protein_coding	OTTHUMT00000376965.1	40	0.00	0	G	NM_014462		38033806	38033806	-1	no_errors	ENST00000311351	ensembl	human	known	69_37n	silent	17	37.04	10	SNP	1.000	A
MAP3K1	4214	genome.wustl.edu	37	5	56178577	56178577	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr5:56178577G>T	ENST00000399503.3	+	14	3550	c.3550G>T	c.(3550-3552)Gaa>Taa	p.E1184*		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1184	Poly-Glu.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GATGGAAGCTGAAGAAGAAGA	0.428																																						dbGAP											0													80.0	81.0	81.0					5																	56178577		2093	4240	6333	-	-	-	SO:0001587	stop_gained	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3550G>T	5.37:g.56178577G>T	ENSP00000382423:p.Glu1184*			Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.E1184*	ENST00000399503.3	37	c.3550	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	G	40	8.345508	0.98769	.	.	ENSG00000095015	ENST00000399503	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	1184	.	ENSP00000382423:E1184X	E	+	1	0	MAP3K1	56214334	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.158000	0.89649	2.941000	0.99782	0.655000	0.94253	GAA	MAP3K1	-	NULL	ENSG00000095015		0.428	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	111	0.00	0	G	XM_042066		56178577	56178577	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	nonsense	41	31.67	19	SNP	1.000	T
MAPKBP1	23005	genome.wustl.edu	37	15	42111445	42111445	+	Splice_Site	SNP	C	C	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr15:42111445C>T	ENST00000456763.2	+	22	2507	c.2311C>T	c.(2311-2313)Cac>Tac	p.H771Y	MAPKBP1_ENST00000260357.7_Splice_Site_p.H604Y|MAPKBP1_ENST00000514566.1_Splice_Site_p.H765Y|MAPKBP1_ENST00000221214.6_Splice_Site_p.H648Y|MAPKBP1_ENST00000457542.2_Splice_Site_p.H765Y	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	771										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CGGACTCAGGCACCAGGCCCC	0.572																																						dbGAP											0													81.0	81.0	81.0					15																	42111445		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.2310-1C>T	15.37:g.42111445C>T			A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H771Y	ENST00000456763.2	37	c.2311	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	c	9.500	1.102882	0.20632	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.41758	1.16;1.32;0.99;1.21;1.3	5.24	3.29	0.37713	.	0.906867	0.09710	N	0.765809	T	0.39489	0.1080	L	0.27053	0.805	0.33671	D	0.610904	P;B;P;P;P	0.41313	0.728;0.069;0.728;0.629;0.745	B;B;B;B;P	0.46172	0.24;0.06;0.271;0.228;0.506	T	0.49390	-0.8945	10	0.66056	D	0.02	-0.0071	10.6574	0.45684	0.0:0.839:0.0:0.161	.	604;648;765;771;765	F8WC21;O60336-3;O60336-2;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	Y	765;648;604;771;765	ENSP00000397570:H765Y;ENSP00000221214:H648Y;ENSP00000260357:H604Y;ENSP00000393099:H771Y;ENSP00000426154:H765Y	ENSP00000221214:H648Y	H	+	1	0	MAPKBP1	39898737	0.999000	0.42202	0.758000	0.31321	0.019000	0.09904	3.770000	0.55310	0.722000	0.32252	-0.299000	0.09455	CAC	MAPKBP1	-	NULL	ENSG00000137802		0.572	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	114	0.00	0	C	NM_014994	Missense_Mutation	42111445	42111445	+1	no_errors	ENST00000456763	ensembl	human	known	69_37n	missense	38	28.30	15	SNP	0.971	T
MDM4	4194	genome.wustl.edu	37	1	204507346	204507346	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr1:204507346G>A	ENST00000367182.3	+	7	583	c.421G>A	c.(421-423)Gag>Aag	p.E141K	MDM4_ENST00000391947.2_Missense_Mutation_p.R118K|MDM4_ENST00000463049.1_3'UTR|MDM4_ENST00000454264.2_Missense_Mutation_p.E141K|MDM4_ENST00000367183.3_Intron|MDM4_ENST00000507825.2_Intron	NM_001204171.1|NM_001278516.1|NM_001278517.1|NM_001278518.1|NM_001278519.1|NM_002393.4	NP_001191100.1|NP_001265445.1|NP_001265446.1|NP_001265447.1|NP_001265448.1|NP_002384.2	O15151	MDM4_HUMAN	MDM4, p53 regulator	141					cell proliferation (GO:0008283)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|G0 to G1 transition (GO:0045023)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)			GCAAAGTGCAGAGGAAAGTTC	0.448			A		"""GBM, bladder, retinoblastoma"""																																	dbGAP		Dom	yes		1	1q32	4194	Mdm4 p53 binding protein homolog		M	0													182.0	174.0	177.0					1																	204507346		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007111	CCDS1447.1, CCDS55674.1, CCDS55675.1, CCDS60396.1, CCDS73007.1, CCDS73008.1, CCDS73009.1	1q32	2014-03-03	2014-03-03		ENSG00000198625	ENSG00000198625			6974	protein-coding gene	gene with protein product		602704	"""mouse double minute 4, human homolog of; p53-binding protein"", ""Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)"", ""Mdm4 p53 binding protein homolog (mouse)"""			9226370, 14660608	Standard	NM_002393		Approved	MDMX, HDMX	uc001hba.3	O15151	OTTHUMG00000035877	ENST00000367182.3:c.421G>A	1.37:g.204507346G>A	ENSP00000356150:p.Glu141Lys		Q2M2Y2|Q32SL2|Q6GS18|Q8IV83	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,pirsf_p53_neg-reg_MDM_2/4,pfscan_Znf_RanBP2,pfscan_Znf_RING	p.E141K	ENST00000367182.3	37	c.421	CCDS1447.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.204|1.204	-0.631701|-0.631701	0.03584|0.03584	.|.	.|.	ENSG00000198625|ENSG00000198625	ENST00000367182;ENST00000454264|ENST00000543518;ENST00000391947	T;T|.	0.31510|.	1.49;1.52|.	5.76|5.76	3.84|3.84	0.44239|0.44239	.|.	0.708427|.	0.15092|.	N|.	0.281024|.	T|T	0.34658|0.34658	0.0905|0.0905	L|L	0.38838|0.38838	1.175|1.175	0.09310|0.09310	N|N	1|1	B;B|.	0.12013|.	0.004;0.005|.	B;B|.	0.08055|.	0.003;0.002|.	T|T	0.21075|0.21075	-1.0256|-1.0256	10|5	0.37606|.	T|.	0.19|.	-5.254|-5.254	6.6225|6.6225	0.22810|0.22810	0.1629:0.1498:0.6873:0.0|0.1629:0.1498:0.6873:0.0	.|.	141;141|.	O15151;Q2M2Y2|.	MDM4_HUMAN;.|.	K|K	141|131;118	ENSP00000356150:E141K;ENSP00000396840:E141K|.	ENSP00000356150:E141K|.	E|R	+|+	1|2	0|0	MDM4|MDM4	202773969|202773969	0.075000|0.075000	0.21258|0.21258	0.017000|0.017000	0.16124|0.16124	0.279000|0.279000	0.26890|0.26890	1.084000|1.084000	0.30828|0.30828	0.728000|0.728000	0.32382|0.32382	0.591000|0.591000	0.81541|0.81541	GAG|AGA	MDM4	-	pirsf_p53_neg-reg_MDM_2/4	ENSG00000198625		0.448	MDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDM4	HGNC	protein_coding	OTTHUMT00000087415.2	154	0.00	0	G	NM_002393		204507346	204507346	+1	no_errors	ENST00000367182	ensembl	human	known	69_37n	missense	52	35.80	29	SNP	0.105	A
MXRA5	25878	genome.wustl.edu	37	X	3235331	3235331	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chrX:3235331C>T	ENST00000217939.6	-	6	6545	c.6391G>A	c.(6391-6393)Gcg>Acg	p.A2131T		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2131	Ig-like C2-type 5.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GTCCTGCGCGCGGAGCCTACC	0.662																																						dbGAP											0													34.0	27.0	29.0					X																	3235331		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6391G>A	X.37:g.3235331C>T	ENSP00000217939:p.Ala2131Thr		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.A2131T	ENST00000217939.6	37	c.6391	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	c	13.67	2.306364	0.40795	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.68903	-0.36	3.48	2.55	0.30701	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.36628	U	0.002485	T	0.72195	0.3430	L	0.42632	1.34	0.26804	N	0.969145	D	0.89917	1.0	D	0.81914	0.995	T	0.62671	-0.6805	10	0.37606	T	0.19	.	11.6221	0.51124	0.1781:0.8219:0.0:0.0	.	2131	Q9NR99	MXRA5_HUMAN	T	2131	ENSP00000217939:A2131T	ENSP00000217939:A2131T	A	-	1	0	MXRA5	3245331	0.896000	0.30565	0.972000	0.41901	0.148000	0.21650	1.677000	0.37576	1.354000	0.45846	0.597000	0.82753	GCG	MXRA5	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000101825		0.662	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	34	0.00	0	C	NM_015419		3235331	3235331	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	missense	19	23.08	6	SNP	0.851	T
MED12	9968	genome.wustl.edu	37	X	70356252	70356252	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chrX:70356252G>A	ENST00000374080.3	+	37	5179	c.5147G>A	c.(5146-5148)cGa>cAa	p.R1716Q	MED12_ENST00000333646.6_Missense_Mutation_p.R1716Q|MED12_ENST00000374102.1_Missense_Mutation_p.R1716Q			Q93074	MED12_HUMAN	mediator complex subunit 12	1716	Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CGAGTGGCTCGAGGAGAGGAG	0.622			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													32.0	36.0	35.0					X																	70356252		1969	4158	6127	-	-	-	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.5147G>A	X.37:g.70356252G>A	ENSP00000363193:p.Arg1716Gln		O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.R1716Q	ENST00000374080.3	37	c.5147	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	-	15.37	2.814793	0.50527	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;1.47	4.17	4.17	0.49024	.	0.064020	0.64402	D	0.000011	T	0.35508	0.0934	L	0.27053	0.805	0.29769	N	0.834938	P;P;P;P	0.46706	0.883;0.811;0.883;0.814	B;B;B;B	0.35607	0.206;0.108;0.194;0.138	T	0.29882	-0.9997	10	0.18710	T	0.47	-8.472	16.2305	0.82341	0.0:0.0:1.0:0.0	.	1716;1563;1716;1716	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	Q	1716;1716;1716;1716;1684;461	ENSP00000333125:R1716Q;ENSP00000363215:R1716Q;ENSP00000363193:R1716Q;ENSP00000414203:R1684Q;ENSP00000408388:R461Q	ENSP00000333125:R1716Q	R	+	2	0	MED12	70272977	0.221000	0.23642	0.948000	0.38648	0.994000	0.84299	3.086000	0.50159	2.085000	0.62840	0.529000	0.55759	CGA	MED12	-	NULL	ENSG00000184634		0.622	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	36	0.00	0	G	NM_005120		70356252	70356252	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	missense	23	33.33	15	SNP	0.420	A
NASP	4678	genome.wustl.edu	37	1	46073697	46073697	+	Missense_Mutation	SNP	C	C	A	rs200497808	byFrequency	TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr1:46073697C>A	ENST00000350030.3	+	6	1201	c.1114C>A	c.(1114-1116)Cca>Aca	p.P372T	NASP_ENST00000402363.3_Missense_Mutation_p.P374T|NASP_ENST00000537798.1_Missense_Mutation_p.P308T|NASP_ENST00000351223.3_Intron|NASP_ENST00000372052.4_Intron	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	372	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)	p.P374T(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					GCAGGAGGCTCCAGTTCTCCC	0.507													C|||	5	0.000998403	0.0008	0.0014	5008	,	,		19634	0.001		0.0	False		,,,				2504	0.002					dbGAP											1	Substitution - Missense(1)	skin(1)											111.0	118.0	116.0					1																	46073697		2203	4300	6503	-	-	-	SO:0001583	missense	0			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.1114C>A	1.37:g.46073697C>A	ENSP00000255120:p.Pro372Thr		A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	SNP	pfam_Tetratricopeptide_SHNi-TPR_dom,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P374T	ENST00000350030.3	37	c.1120	CCDS524.1	1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.230947	0.00023	.	.	ENSG00000132780	ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030	D;D;D	0.94376	-3.41;-3.41;-3.41	5.27	3.01	0.34805	.	1.088120	0.06802	N	0.788899	T	0.79161	0.4399	N	0.01352	-0.895	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.70346	-0.4897	9	.	.	.	-0.0398	5.0466	0.14487	0.7192:0.1889:0.0919:0.0	.	308;372;272;372;374	F5H3J2;Q53H03;B4DS57;P49321;P49321-3	.;.;.;NASP_HUMAN;.	T	308;374;272;372	ENSP00000438871:P308T;ENSP00000384529:P374T;ENSP00000255120:P372T	.	P	+	1	0	NASP	45846284	0.000000	0.05858	0.001000	0.08648	0.171000	0.22731	-0.472000	0.06623	1.129000	0.42072	-0.265000	0.10407	CCA	NASP	-	NULL	ENSG00000132780		0.507	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NASP	HGNC	protein_coding	OTTHUMT00000021533.2	58	0.00	0	C	NM_002482		46073697	46073697	+1	no_errors	ENST00000402363	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.000	A
NCOA2	10499	genome.wustl.edu	37	8	71078828	71078828	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr8:71078828G>T	ENST00000452400.2	-	7	884	c.703C>A	c.(703-705)Cca>Aca	p.P235T		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	235					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			ATGGACTTTGGTTGAGAGACA	0.428			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																	dbGAP		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													209.0	203.0	205.0					8																	71078828		1908	4134	6042	-	-	-	SO:0001583	missense	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.703C>A	8.37:g.71078828G>T	ENSP00000399968:p.Pro235Thr		Q14CD2	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.P235T	ENST00000452400.2	37	c.703	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971371	0.92919	.	.	ENSG00000140396	ENST00000452400	T	0.02197	4.4	5.82	5.82	0.92795	.	0.048722	0.85682	D	0.000000	T	0.16257	0.0391	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00039	-1.2240	10	0.87932	D	0	.	20.0966	0.97849	0.0:0.0:1.0:0.0	.	235	Q15596	NCOA2_HUMAN	T	235	ENSP00000399968:P235T	ENSP00000399968:P235T	P	-	1	0	NCOA2	71241382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.788000	0.99064	2.751000	0.94390	0.650000	0.86243	CCA	NCOA2	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.428	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	118	0.00	0	G			71078828	71078828	-1	no_errors	ENST00000452400	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	1.000	T
PHLDA1	22822	genome.wustl.edu	37	12	76424952	76424952	+	Missense_Mutation	SNP	C	C	G	rs200070422		TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr12:76424952C>G	ENST00000266671.5	-	1	2760	c.570G>C	c.(568-570)caG>caC	p.Q190H	PHLDA1_ENST00000602540.1_Missense_Mutation_p.Q49H|RP11-290L1.2_ENST00000547721.1_RNA|RP11-290L1.3_ENST00000552367.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	190	PH.|Poly-Gln.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				gctgctgctgctggtgttgca	0.647																																						dbGAP											0													15.0	16.0	16.0					12																	76424952		2187	4269	6456	-	-	-	SO:0001583	missense	0			Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.570G>C	12.37:g.76424952C>G	ENSP00000266671:p.Gln190His		A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.Q190H	ENST00000266671.5	37	c.570	CCDS31861.1	12	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847435	0.32606	.	.	ENSG00000139289	ENST00000266671;ENST00000421361	T	0.25749	1.78	3.66	2.74	0.32292	Pleckstrin homology domain (1);	.	.	.	.	T	0.15478	0.0373	N	0.14661	0.345	0.26866	N	0.967856	B	0.06786	0.001	B	0.04013	0.001	T	0.19549	-1.0302	9	0.87932	D	0	.	8.7699	0.34726	0.0:0.767:0.233:0.0	.	190	Q8WV24	PHLA1_HUMAN	H	190;49	ENSP00000266671:Q190H	ENSP00000266671:Q190H	Q	-	3	2	PHLDA1	74711219	0.991000	0.36638	0.886000	0.34754	0.865000	0.49528	0.349000	0.20055	0.710000	0.31997	0.561000	0.74099	CAG	PHLDA1	-	smart_Pleckstrin_homology	ENSG00000139289		0.647	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHLDA1	HGNC	protein_coding	OTTHUMT00000405846.2	21	0.00	0	C	NM_007350		76424952	76424952	-1	no_errors	ENST00000266671	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.996	G
POU3F2	5454	genome.wustl.edu	37	6	99283256	99283256	+	Silent	SNP	G	G	C			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr6:99283256G>C	ENST00000328345.5	+	1	677	c.507G>C	c.(505-507)cgG>cgC	p.R169R		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	169					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GGGCATGGCGGAGCGCGGCGG	0.697																																						dbGAP											0													5.0	6.0	6.0					6																	99283256		2061	4130	6191	-	-	-	SO:0001819	synonymous_variant	0			Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.507G>C	6.37:g.99283256G>C			Q14960|Q86V54|Q9UJL0	Silent	SNP	pirsf_Transcription_factor_POU,pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.R169	ENST00000328345.5	37	c.507	CCDS5040.1	6																																																																																			POU3F2	-	pirsf_Transcription_factor_POU	ENSG00000184486		0.697	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F2	HGNC	protein_coding	OTTHUMT00000041586.2	19	0.00	0	G			99283256	99283256	+1	no_errors	ENST00000328345	ensembl	human	known	69_37n	silent	4	50.00	4	SNP	1.000	C
LINC01410	103352539	genome.wustl.edu	37	9	66458146	66458146	+	lincRNA	SNP	C	C	T	rs148666006		TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr9:66458146C>T	ENST00000424345.1	+	0	67				RNA5SP283_ENST00000365604.1_RNA																							AAGCCAaaagcctacggtacc	0.627																																						dbGAP											0																																										-	-	-			0																															9.37:g.66458146C>T				RNA	SNP	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			RNA5SP283	-	-	ENSG00000202474		0.627	RP11-262H14.1-001	KNOWN	basic	lincRNA	RNA5SP283	HGNC	lincRNA	OTTHUMT00000128851.1	11	0.00	0	C			66458146	66458146	-1	no_errors	ENST00000365604	ensembl	human	known	69_37n	rna	6	33.33	3	SNP	0.031	T
TMPO	7112	genome.wustl.edu	37	12	98926744	98926744	+	Intron	SNP	G	G	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr12:98926744G>A	ENST00000556029.1	+	3	921				TMPO_ENST00000343315.5_Intron|TMPO_ENST00000266732.4_Missense_Mutation_p.E237K|TMPO_ENST00000393053.2_Intron|TMPO_ENST00000261210.5_Intron	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGGCAGTACCGAACTACAGGC	0.478																																						dbGAP											0													76.0	82.0	80.0					12																	98926744		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.565+1128G>A	12.37:g.98926744G>A			A2T926|Q14861	Missense_Mutation	SNP	pfam_LAP2alpha,pfam_Thymopoietin_LEM,pfam_LEM,superfamily_LEM-like_dom,smart_LEM,pfscan_LEM,pfscan_Thymopoietin_LEM	p.E237K	ENST00000556029.1	37	c.709	CCDS31879.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226378	0.79576	.	.	ENSG00000120802	ENST00000266732	T	0.38560	1.13	5.11	5.11	0.69529	.	0.406531	0.28815	N	0.014046	T	0.33760	0.0874	N	0.24115	0.695	0.80722	D	1	D	0.56746	0.977	P	0.44394	0.448	T	0.17349	-1.0372	10	0.56958	D	0.05	-12.4948	14.3863	0.66947	0.0:0.0:1.0:0.0	.	237	P42166	LAP2A_HUMAN	K	237	ENSP00000266732:E237K	ENSP00000266732:E237K	E	+	1	0	TMPO	97450875	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.431000	0.59915	2.536000	0.85505	0.650000	0.86243	GAA	TMPO	-	NULL	ENSG00000120802		0.478	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPO	HGNC	protein_coding	OTTHUMT00000407973.2	61	0.00	0	G	NM_003276		98926744	98926744	+1	no_errors	ENST00000266732	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	A
TRIM64B	642446	genome.wustl.edu	37	11	89607385	89607385	+	Silent	SNP	G	G	C			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr11:89607385G>C	ENST00000329862.6	-	3	566	c.567C>G	c.(565-567)ctC>ctG	p.L189L		NM_001136486.1|NM_001164397.1	NP_001129958.1|NP_001157869.1	A6NI03	TR64B_HUMAN	tripartite motif containing 64B	189						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)	2						CCTCCTCATCGAGAAATATAG	0.408																																						dbGAP											0													8.0	7.0	7.0					11																	89607385		681	1553	2234	-	-	-	SO:0001819	synonymous_variant	0				CCDS53693.1	11q14.3	2014-04-02	2011-01-25		ENSG00000189253	ENSG00000189253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37147	protein-coding gene	gene with protein product			"""tripartite motif-containing 64B"""				Standard	NM_001164397		Approved		uc021qoo.1	A6NI03	OTTHUMG00000167638	ENST00000329862.6:c.567C>G	11.37:g.89607385G>C				Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.L189	ENST00000329862.6	37	c.567	CCDS53693.1	11																																																																																			TRIM64B	-	NULL	ENSG00000189253		0.408	TRIM64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM64B	HGNC	protein_coding	OTTHUMT00000395440.1	65	0.00	0	G			89607385	89607385	-1	no_errors	ENST00000329862	ensembl	human	known	69_37n	silent	38	13.64	6	SNP	0.002	C
TXNRD1	7296	genome.wustl.edu	37	12	104682625	104682625	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr12:104682625G>A	ENST00000378070.4	+	1	130	c.68G>A	c.(67-69)cGg>cAg	p.R23Q	TXNRD1_ENST00000540716.1_Intron|TXNRD1_ENST00000354940.6_Intron|TXNRD1_ENST00000525566.1_Intron|TXNRD1_ENST00000526390.1_Intron|TXNRD1_ENST00000524698.1_Intron|TXNRD1_ENST00000388854.3_Intron|TXNRD1_ENST00000542918.1_Intron|TXNRD1_ENST00000503506.2_Intron|TXNRD1_ENST00000429002.2_Intron|TXNRD1_ENST00000526691.1_Intron|TXNRD1_ENST00000397736.2_5'Flank|TXNRD1_ENST00000529546.1_Intron			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	0					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	GGGCCGGGACGGAAGCCCCGC	0.617																																					Ovarian(139;555 1836 9186 9946 10884)	dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000378070.4:c.68G>A	12.37:g.104682625G>A	ENSP00000367310:p.Arg23Gln		B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,superfamily_Thioredoxin-like_fold,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Thioredoxin/glutathione_Rdtase	p.R23Q	ENST00000378070.4	37	c.68		12	.	.	.	.	.	.	.	.	.	.	G	12.96	2.094603	0.36952	.	.	ENSG00000198431	ENST00000378070	T	0.69175	-0.38	2.82	0.869	0.19096	.	1.052530	0.07429	N	0.895338	T	0.56572	0.1994	.	.	.	0.33694	D	0.613701	.	.	.	.	.	.	T	0.59690	-0.7407	7	0.33940	T	0.23	.	3.4524	0.07503	0.1584:0.2769:0.5647:0.0	.	.	.	.	Q	23	ENSP00000367310:R23Q	ENSP00000367310:R23Q	R	+	2	0	TXNRD1	103206755	0.722000	0.28017	0.494000	0.27515	0.411000	0.31082	0.473000	0.22132	0.483000	0.27608	0.456000	0.33151	CGG	TXNRD1	-	NULL	ENSG00000198431		0.617	TXNRD1-202	KNOWN	basic	protein_coding	TXNRD1	HGNC	protein_coding		17	0.00	0	G	NM_003330		104682625	104682625	+1	no_errors	ENST00000378070	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.346	A
YWHAG	7532	genome.wustl.edu	37	7	75959501	75959501	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr7:75959501G>C	ENST00000307630.3	-	2	359	c.137C>G	c.(136-138)tCt>tGt	p.S46C		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	46					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						GTAGGCCACAGACAGAAGGTT	0.517																																						dbGAP											0													96.0	76.0	83.0					7																	75959501		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.137C>G	7.37:g.75959501G>C	ENSP00000306330:p.Ser46Cys		O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Missense_Mutation	SNP	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.S46C	ENST00000307630.3	37	c.137	CCDS5584.1	7	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951801	0.73787	.	.	ENSG00000170027	ENST00000307630;ENST00000536755;ENST00000453207	T	0.54675	0.56	5.8	5.8	0.92144	14-3-3 protein, conserved site (1);14-3-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.82426	0.5034	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87452	0.2402	10	0.87932	D	0	.	19.0459	0.93019	0.0:0.0:1.0:0.0	.	46	P61981	1433G_HUMAN	C	46;24;46	ENSP00000306330:S46C	ENSP00000306330:S46C	S	-	2	0	YWHAG	75797437	1.000000	0.71417	0.210000	0.23637	0.902000	0.53008	9.823000	0.99369	2.741000	0.93983	0.655000	0.94253	TCT	YWHAG	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	ENSG00000170027		0.517	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAG	HGNC	protein_coding	OTTHUMT00000253002.1	75	0.00	0	G	NM_012479		75959501	75959501	-1	no_errors	ENST00000307630	ensembl	human	known	69_37n	missense	30	26.19	11	SNP	0.998	C
ZNF35	7584	genome.wustl.edu	37	3	44701222	44701222	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1N4-01A-11D-A14K-09	TCGA-E9-A1N4-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a3784a48-47a7-4587-91dd-5b8873a24ca9	a7a3cf1b-eb9b-468a-b613-55bb99265df8	g.chr3:44701222C>T	ENST00000396056.2	+	4	1602	c.1367C>T	c.(1366-1368)aCa>aTa	p.T456I	ZNF35_ENST00000542250.1_Missense_Mutation_p.T296I|RP11-944L7.4_ENST00000457331.1_RNA|ZNF35_ENST00000296092.3_3'UTR	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	456					cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		AAGGCCTTCACATGTAGCTCA	0.448																																						dbGAP											0													80.0	78.0	79.0					3																	44701222		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.1367C>T	3.37:g.44701222C>T	ENSP00000379368:p.Thr456Ile		B2RBU6|Q53Y54|Q96D01	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T456I	ENST00000396056.2	37	c.1367	CCDS2718.2	3	.	.	.	.	.	.	.	.	.	.	C	14.46	2.540549	0.45176	.	.	ENSG00000169981	ENST00000396056;ENST00000542250	T;T	0.19806	2.12;2.12	5.27	4.36	0.52297	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.48286	D	0.000200	T	0.35828	0.0945	L	0.45352	1.415	0.29967	N	0.818873	D	0.76494	0.999	D	0.75020	0.985	T	0.04825	-1.0924	10	0.27785	T	0.31	-14.7857	15.0807	0.72113	0.0:0.8584:0.1416:0.0	.	456	P13682	ZNF35_HUMAN	I	456;296	ENSP00000379368:T456I;ENSP00000443714:T296I	ENSP00000379368:T456I	T	+	2	0	ZNF35	44676226	0.000000	0.05858	0.968000	0.41197	0.986000	0.74619	-1.636000	0.02016	2.748000	0.94277	0.655000	0.94253	ACA	ZNF35	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000169981		0.448	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF35	HGNC	protein_coding	OTTHUMT00000256749.4	79	0.00	0	C	NM_003420		44701222	44701222	+1	no_errors	ENST00000396056	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.798	T
