#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AADACL4	343066	genome.wustl.edu	37	1	12704575	12704575	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr1:12704575C>T	ENST00000376221.1	+	1	10	c.10C>T	c.(10-12)Ccc>Tcc	p.P4S		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	4						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CATGGCTGTCCCCTGGCTAGT	0.562																																						dbGAP											0													140.0	123.0	129.0					1																	12704575		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.10C>T	1.37:g.12704575C>T	ENSP00000365395:p.Pro4Ser			Missense_Mutation	SNP	pfam_AB_hydrolase_3,pirsf_Arylacetamide_deacetylase	p.P4S	ENST00000376221.1	37	c.10	CCDS30590.1	1	.	.	.	.	.	.	.	.	.	.	C	9.900	1.206546	0.22205	.	.	ENSG00000204518	ENST00000376221	T	0.03982	3.74	3.99	2.1	0.27182	.	1.506570	0.04724	N	0.419851	T	0.05593	0.0147	L	0.40543	1.245	0.09310	N	1	B	0.31655	0.334	B	0.29176	0.099	T	0.38265	-0.9669	10	0.52906	T	0.07	0.736	5.8046	0.18432	0.0:0.7595:0.0:0.2405	.	4	Q5VUY2	ADCL4_HUMAN	S	4	ENSP00000365395:P4S	ENSP00000365395:P4S	P	+	1	0	AADACL4	12627162	0.011000	0.17503	0.002000	0.10522	0.003000	0.03518	1.514000	0.35834	1.018000	0.39521	0.561000	0.74099	CCC	AADACL4	-	pirsf_Arylacetamide_deacetylase	ENSG00000204518		0.562	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AADACL4	HGNC	protein_coding	OTTHUMT00000005328.1	97	0.00	0	C	NM_001013630		12704575	12704575	+1	no_errors	ENST00000376221	ensembl	human	known	69_37n	missense	24	71.08	59	SNP	0.001	T
ADAL	161823	genome.wustl.edu	37	15	43644127	43644127	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr15:43644127G>C	ENST00000562188.1	+	10	1068	c.1052G>C	c.(1051-1053)aGa>aCa	p.R351T	ADAL_ENST00000422466.2_Missense_Mutation_p.R351T|ADAL_ENST00000428046.3_Missense_Mutation_p.R324T			Q6DHV7	ADAL_HUMAN	adenosine deaminase-like	351					adenosine catabolic process (GO:0006154)|drug metabolic process (GO:0017144)|inosine biosynthetic process (GO:0046103)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	adenosine deaminase activity (GO:0004000)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)	7		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		CTGAAGCCCAGAGTGTTACAT	0.418																																						dbGAP											0													115.0	96.0	102.0					15																	43644127		690	1590	2280	-	-	-	SO:0001583	missense	0				CCDS32214.1, CCDS53936.1	15q15.3	2014-08-08			ENSG00000168803	ENSG00000168803			31853	protein-coding gene	gene with protein product							Standard	NM_001012969		Approved		uc010udo.2	Q6DHV7	OTTHUMG00000176646	ENST00000562188.1:c.1052G>C	15.37:g.43644127G>C	ENSP00000456242:p.Arg351Thr		A6NHZ3|B4DQM8	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom	p.R351T	ENST00000562188.1	37	c.1052		15	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187518	0.38609	.	.	ENSG00000168803	ENST00000422466;ENST00000428046	D;D	0.95171	-3.63;-3.32	5.01	0.205	0.15204	.	.	.	.	.	D	0.84884	0.5571	N	0.08118	0	0.21445	N	0.999686	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.71649	-0.4529	9	0.24483	T	0.36	-0.0162	8.1194	0.30963	0.6417:0.0:0.3583:0.0	.	324;351	B4DQM8;Q6DHV7	.;ADAL_HUMAN	T	351;324	ENSP00000398744:R351T;ENSP00000413074:R324T	ENSP00000398744:R351T	R	+	2	0	ADAL	41431419	0.303000	0.24463	0.914000	0.36105	0.885000	0.51271	0.123000	0.15708	-0.127000	0.11661	-0.302000	0.09304	AGA	ADAL	-	NULL	ENSG00000168803		0.418	ADAL-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ADAL	HGNC	protein_coding	OTTHUMT00000432960.1	45	0.00	0	G	XM_091156		43644127	43644127	+1	no_errors	ENST00000422466	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	0.991	C
ADCY7	113	genome.wustl.edu	37	16	50328657	50328657	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr16:50328657G>A	ENST00000394697.2	+	7	1283	c.943G>A	c.(943-945)Gcc>Acc	p.A315T	ADCY7_ENST00000538642.1_Missense_Mutation_p.A315T|ADCY7_ENST00000566433.2_Missense_Mutation_p.A315T|ADCY7_ENST00000564044.1_3'UTR|ADCY7_ENST00000537579.1_Missense_Mutation_p.A315T|ADCY7_ENST00000254235.3_Missense_Mutation_p.A315T			P51828	ADCY7_HUMAN	adenylate cyclase 7	315	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		CGACCAGATCGCCAAGGTGAG	0.607																																						dbGAP											0													66.0	48.0	54.0					16																	50328657		2198	4300	6498	-	-	-	SO:0001583	missense	0			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.943G>A	16.37:g.50328657G>A	ENSP00000378187:p.Ala315Thr		A0AVA6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.A315T	ENST00000394697.2	37	c.943	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.624338	0.96660	.	.	ENSG00000121281	ENST00000538642;ENST00000394697;ENST00000537579;ENST00000254235	D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93	5.33	5.33	0.75918	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.41001	U	0.000974	D	0.90665	0.7072	L	0.49455	1.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.991	D	0.91452	0.5182	10	0.87932	D	0	.	19.0226	0.92921	0.0:0.0:1.0:0.0	.	315;315	P51828;F5H4D1	ADCY7_HUMAN;.	T	315	ENSP00000445046:A315T;ENSP00000378187:A315T;ENSP00000437788:A315T;ENSP00000254235:A315T	ENSP00000254235:A315T	A	+	1	0	ADCY7	48886158	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.792000	0.99085	2.494000	0.84150	0.655000	0.94253	GCC	ADCY7	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000121281		0.607	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	HGNC	protein_coding	OTTHUMT00000256877.3	33	0.00	0	G			50328657	50328657	+1	no_errors	ENST00000254235	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	1.000	A
AGAP2	116986	genome.wustl.edu	37	12	58128453	58128453	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr12:58128453C>T	ENST00000547588.1	-	3	1236	c.1237G>A	c.(1237-1239)Ggc>Agc	p.G413S	AGAP2_ENST00000257897.3_Missense_Mutation_p.G77S	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	413	G domain.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						CTGGCATCGCCCAGCACACCC	0.527																																						dbGAP											0													131.0	129.0	129.0					12																	58128453		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.1237G>A	12.37:g.58128453C>T	ENSP00000449241:p.Gly413Ser		A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.G413S	ENST00000547588.1	37	c.1237	CCDS44932.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.074025|5.074025	0.94000|0.94000	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000328568|ENST00000257897;ENST00000547588	.|D;D	.|0.89939	.|-2.59;-2.59	5.35|5.35	5.35|5.35	0.76521|0.76521	.|Mitochondrial Rho-like (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.96734|0.96734	0.8934|0.8934	H|H	0.97783|0.97783	4.075|4.075	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.97964|0.97964	1.0339|1.0339	6|10	.|0.87932	.|D	.|0	.|.	16.3575|16.3575	0.83241|0.83241	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|77;413;413	.|Q99490-2;F8VVT9;Q99490	.|.;.;AGAP2_HUMAN	E|S	276|77;413	.|ENSP00000257897:G77S;ENSP00000449241:G413S	.|ENSP00000257897:G77S	G|G	-|-	2|1	0|0	AGAP2|AGAP2	56414720|56414720	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.319000|6.319000	0.72871|0.72871	2.676000|2.676000	0.91093|0.91093	0.655000|0.655000	0.94253|0.94253	GGG|GGC	AGAP2	-	pfam_MIRO-like,pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase	ENSG00000135439		0.527	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	HGNC	protein_coding	OTTHUMT00000408367.1	38	0.00	0	C	NM_014770		58128453	58128453	-1	no_errors	ENST00000547588	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	1.000	T
AKT2	208	genome.wustl.edu	37	19	40741973	40741973	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr19:40741973C>T	ENST00000392038.2	-	11	1297	c.999G>A	c.(997-999)tgG>tgA	p.W333*	AKT2_ENST00000424901.1_Nonsense_Mutation_p.W333*|AKT2_ENST00000579047.1_Nonsense_Mutation_p.W271*|AKT2_ENST00000311278.6_Nonsense_Mutation_p.W290*	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	333	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CCAGCCCCCACCAGTCCACGG	0.622			A		"""ovarian, pancreatic """																																	dbGAP		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	0													94.0	74.0	81.0					19																	40741973		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.999G>A	19.37:g.40741973C>T	ENSP00000375892:p.Trp333*		B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom	p.W333*	ENST00000392038.2	37	c.999	CCDS12552.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.804286	0.96967	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278;ENST00000391845	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4906	0.90846	0.0:1.0:0.0:0.0	.	.	.	.	X	333;234;333;290;153	.	ENSP00000309428:W290X	W	-	3	0	AKT2	45433813	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.765000	0.85310	2.670000	0.90874	0.555000	0.69702	TGG	AKT2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000105221		0.622	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT2	HGNC	protein_coding	OTTHUMT00000268029.1	51	0.00	0	C	NM_001626		40741973	40741973	-1	no_errors	ENST00000392038	ensembl	human	known	69_37n	nonsense	36	33.33	18	SNP	1.000	T
ASAP1	50807	genome.wustl.edu	37	8	131226804	131226804	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr8:131226804G>C	ENST00000518721.1	-	5	630	c.403C>G	c.(403-405)Ctg>Gtg	p.L135V	ASAP1_ENST00000357668.1_Missense_Mutation_p.L135V	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	135					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TGTCTTACCAGATTTTTCAGC	0.388																																						dbGAP											0													74.0	77.0	76.0					8																	131226804		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.403C>G	8.37:g.131226804G>C	ENSP00000429900:p.Leu135Val		B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,prints_ArfGAP,prints_p67phox,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP	p.L135V	ENST00000518721.1	37	c.403	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087237	0.55968	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721;ENST00000524367	T;T;T	0.07114	3.22;3.22;3.22	5.28	4.39	0.52855	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.64402	D	0.000004	T	0.12518	0.0304	M	0.79011	2.435	0.80722	D	1	B;B	0.33212	0.402;0.402	B;B	0.29267	0.1;0.1	T	0.01626	-1.1309	10	0.52906	T	0.07	.	12.7535	0.57321	0.0794:0.0:0.9206:0.0	.	135;135	B2RNV3;Q9ULH1	.;ASAP1_HUMAN	V	135;135;135;105	ENSP00000350297:L135V;ENSP00000429900:L135V;ENSP00000430588:L105V	ENSP00000344591:L135V	L	-	1	2	ASAP1	131295986	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	6.343000	0.72986	2.637000	0.89404	0.585000	0.79938	CTG	ASAP1	-	NULL	ENSG00000153317		0.388	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1	78	0.00	0	G	NM_018482		131226804	131226804	-1	no_errors	ENST00000357668	ensembl	human	known	69_37n	missense	88	20.00	22	SNP	1.000	C
C4orf47	441054	genome.wustl.edu	37	4	186370764	186370764	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr4:186370764A>G	ENST00000378850.4	+	7	918	c.896A>G	c.(895-897)aAg>aGg	p.K299R	CCDC110_ENST00000307588.3_Intron|CCDC110_ENST00000393540.3_Intron	NM_001114357.1	NP_001107829.1	A7E2U8	CD047_HUMAN	chromosome 4 open reading frame 47	299										breast(2)|endometrium(1)	3						CTAAATTCAAAGAACTACAAG	0.318																																						dbGAP											0													116.0	105.0	108.0					4																	186370764		692	1591	2283	-	-	-	SO:0001583	missense	0			AY947525, BC127739, BC141967	CCDS47169.1	4q35.1	2008-07-18			ENSG00000205129	ENSG00000205129			34346	protein-coding gene	gene with protein product						12477932	Standard	NM_001114357		Approved	LOC441054	uc003ixt.2	A7E2U8	OTTHUMG00000160458	ENST00000378850.4:c.896A>G	4.37:g.186370764A>G	ENSP00000368127:p.Lys299Arg		Q5BLP7	Missense_Mutation	SNP	NULL	p.K299R	ENST00000378850.4	37	c.896	CCDS47169.1	4	.	.	.	.	.	.	.	.	.	.	A	11.06	1.528672	0.27387	.	.	ENSG00000205129	ENST00000378850	.	.	.	5.83	4.58	0.56647	.	.	.	.	.	T	0.48660	0.1512	L	0.57536	1.79	0.80722	D	1	B	0.17465	0.022	B	0.18263	0.021	T	0.41716	-0.9493	8	0.21014	T	0.42	-6.8239	7.2782	0.26296	0.709:0.1484:0.0:0.1426	.	299	A7E2U8	CD047_HUMAN	R	299	.	ENSP00000368127:K299R	K	+	2	0	C4orf47	186607758	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	1.225000	0.32551	2.226000	0.72624	0.533000	0.62120	AAG	C4orf47	-	NULL	ENSG00000205129		0.318	C4orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf47	HGNC	protein_coding	OTTHUMT00000360667.1	74	0.00	0	A	NM_001114357		186370764	186370764	+1	no_errors	ENST00000378850	ensembl	human	known	69_37n	missense	67	32.32	32	SNP	0.999	G
EPHA3	2042	genome.wustl.edu	37	3	89521635	89521635	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr3:89521635C>G	ENST00000336596.2	+	16	2937	c.2712C>G	c.(2710-2712)gaC>gaG	p.D904E	EPHA3_ENST00000494014.1_Missense_Mutation_p.D904E	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	904					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TTCTTCTGGACCAAAGCAATG	0.463										TSP Lung(6;0.00050)																												dbGAP											0													184.0	178.0	180.0					3																	89521635		2203	4300	6503	-	-	-	SO:0001583	missense	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2712C>G	3.37:g.89521635C>G	ENSP00000337451:p.Asp904Glu		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.D904E	ENST00000336596.2	37	c.2712	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	C	15.25	2.776829	0.49786	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.61859	0.07;0.07	5.73	5.73	0.89815	Sterile alpha motif/pointed domain (1);	0.000000	0.85682	D	0.000000	T	0.59878	0.2226	L	0.40543	1.245	0.58432	D	0.999999	P	0.42620	0.785	P	0.51806	0.68	T	0.55218	-0.8175	9	.	.	.	.	13.1385	0.59423	0.0:0.9271:0.0:0.0728	.	904	P29320	EPHA3_HUMAN	E	904	ENSP00000337451:D904E;ENSP00000419190:D904E	.	D	+	3	2	EPHA3	89604325	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.958000	0.49145	2.700000	0.92200	0.655000	0.94253	GAC	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000044524		0.463	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	50	0.00	0	C	NM_005233		89521635	89521635	+1	no_errors	ENST00000336596	ensembl	human	known	69_37n	missense	39	31.58	18	SNP	1.000	G
EXOSC9	5393	genome.wustl.edu	37	4	122737590	122737590	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr4:122737590C>G	ENST00000243498.5	+	11	1331	c.1223C>G	c.(1222-1224)cCa>cGa	p.P408R	EXOSC9_ENST00000512454.1_Missense_Mutation_p.P392R|EXOSC9_ENST00000379663.3_Missense_Mutation_p.P425R	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	408					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						GACAAGAATCCAAAGAAAATA	0.289																																						dbGAP											0													63.0	74.0	70.0					4																	122737590		2197	4291	6488	-	-	-	SO:0001583	missense	0			M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.1223C>G	4.37:g.122737590C>G	ENSP00000243498:p.Pro408Arg		Q12883|Q4W5P5|Q86Y41|Q86Y48	Missense_Mutation	SNP	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2	p.P425R	ENST00000243498.5	37	c.1274	CCDS3722.2	4	.	.	.	.	.	.	.	.	.	.	C	12.59	1.982551	0.34942	.	.	ENSG00000123737	ENST00000243498;ENST00000379663;ENST00000512454	T;T;T	0.28454	1.88;1.61;1.88	6.08	3.47	0.39725	.	0.610404	0.18010	N	0.154596	T	0.26376	0.0644	L	0.46157	1.445	0.09310	N	1	B;B;P	0.38440	0.087;0.01;0.631	B;B;B	0.36766	0.068;0.019;0.232	T	0.06881	-1.0802	10	0.45353	T	0.12	-18.5418	9.8602	0.41109	0.0:0.7914:0.0:0.2086	.	392;408;425	D6RIY6;Q06265;Q06265-2	.;EXOS9_HUMAN;.	R	408;425;392	ENSP00000243498:P408R;ENSP00000368984:P425R;ENSP00000425782:P392R	ENSP00000243498:P408R	P	+	2	0	EXOSC9	122957040	0.237000	0.23815	0.388000	0.26195	0.977000	0.68977	1.651000	0.37302	0.476000	0.27440	-0.140000	0.14226	CCA	EXOSC9	-	NULL	ENSG00000123737		0.289	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC9	HGNC	protein_coding	OTTHUMT00000250708.2	55	0.00	0	C	NM_005033		122737590	122737590	+1	no_errors	ENST00000379663	ensembl	human	known	69_37n	missense	34	38.18	21	SNP	0.043	G
FAM47B	170062	genome.wustl.edu	37	X	34961414	34961414	+	Nonsense_Mutation	SNP	G	G	T	rs368902203		TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chrX:34961414G>T	ENST00000329357.5	+	1	502	c.466G>T	c.(466-468)Gag>Tag	p.E156*		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	156										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						GCTGGATCCCGAGAGGAAGCT	0.567																																						dbGAP											0													54.0	48.0	50.0					X																	34961414		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.466G>T	X.37:g.34961414G>T	ENSP00000328307:p.Glu156*		Q5JQN5|Q6PIG3	Nonsense_Mutation	SNP	NULL	p.E156*	ENST00000329357.5	37	c.466	CCDS14236.1	X	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056133	0.36277	.	.	ENSG00000189132	ENST00000329357	.	.	.	0.843	0.843	0.18935	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	3.0451	0.06151	0.3323:0.0:0.6677:0.0	.	.	.	.	X	156	.	ENSP00000328307:E156X	E	+	1	0	FAM47B	34871335	0.018000	0.18449	0.003000	0.11579	0.006000	0.05464	0.363000	0.20301	0.695000	0.31675	0.292000	0.19580	GAG	FAM47B	-	NULL	ENSG00000189132		0.567	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	HGNC	protein_coding	OTTHUMT00000056211.1	53	0.00	0	G	NM_152631		34961414	34961414	+1	no_errors	ENST00000329357	ensembl	human	known	69_37n	nonsense	34	32.00	16	SNP	0.116	T
SPATA31A6	389730	genome.wustl.edu	37	9	43625257	43625257	+	Missense_Mutation	SNP	C	C	T	rs532278354	byFrequency	TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr9:43625257C>T	ENST00000332857.6	-	4	3458	c.3430G>A	c.(3430-3432)Gtc>Atc	p.V1144I	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	1144					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGTAGCTGGACGCCTTCATCC	0.418													C|||	2	0.000399361	0.0	0.0	5008	,	,		13911	0.0		0.002	False		,,,				2504	0.0					dbGAP											0													10.0	29.0	24.0					9																	43625257		510	1379	1889	-	-	-	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.3430G>A	9.37:g.43625257C>T	ENSP00000329825:p.Val1144Ile			Missense_Mutation	SNP	NULL	p.V1144I	ENST00000332857.6	37	c.3430	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	C	0.888	-0.726539	0.03158	.	.	ENSG00000185775	ENST00000332857	T	0.03772	3.81	2.44	-4.88	0.03113	.	2.346610	0.02153	N	0.058215	T	0.02727	0.0082	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40924	-0.9537	10	0.17832	T	0.49	13.5942	0.1538	0.00096	0.2508:0.1661:0.2586:0.3246	.	1144	Q5VVP1	F75A6_HUMAN	I	1144	ENSP00000329825:V1144I	ENSP00000329825:V1144I	V	-	1	0	FAM75A6	43565253	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.345000	0.01097	-1.777000	0.01283	-0.932000	0.02703	GTC	FAM75A6	-	NULL	ENSG00000185775		0.418	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	HGNC	protein_coding	OTTHUMT00000036987.1	226	0.00	0	C	NM_001145196		43625257	43625257	-1	no_errors	ENST00000332857	ensembl	human	known	69_37n	missense	90	42.31	66	SNP	0.000	T
RP11-383M4.6	0	genome.wustl.edu	37	9	84562337	84562337	+	lincRNA	SNP	G	G	C	rs201734550	byFrequency	TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr9:84562337G>C	ENST00000585776.1	-	0	942				SPATA31D3_ENST00000334208.4_RNA																							CTGTGTCAGAGAGCATTCATG	0.488													G|||	175	0.0349441	0.0825	0.0187	5008	,	,		19498	0.0		0.0417	False		,,,				2504	0.0112					dbGAP											0													1.0	1.0	1.0					9																	84562337		377	789	1166	-	-	-			0																															9.37:g.84562337G>C				RNA	SNP	-	NULL	ENST00000585776.1	37	NULL		9																																																																																			FAM75D3	-	-	ENSG00000186788		0.488	RP11-383M4.6-001	KNOWN	basic	lincRNA	FAM75D3	HGNC	lincRNA	OTTHUMT00000453562.1	22	0.00	0	G			84562337	84562337	+1	no_errors	ENST00000334208	ensembl	human	known	69_37n	rna	9	47.06	8	SNP	0.000	C
FBN1	2200	genome.wustl.edu	37	15	48766788	48766788	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr15:48766788T>C	ENST00000316623.5	-	33	4479	c.4024A>G	c.(4024-4026)Aca>Gca	p.T1342A		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1342	EGF-like 22; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CTTCCTGCTGTATTGGTACAT	0.438																																						dbGAP											0													128.0	112.0	118.0					15																	48766788		2198	4296	6494	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4024A>G	15.37:g.48766788T>C	ENSP00000325527:p.Thr1342Ala		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.T1342A	ENST00000316623.5	37	c.4024	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	T	15.42	2.828292	0.50845	.	.	ENSG00000166147	ENST00000316623;ENST00000544030	D	0.92858	-3.12	4.87	4.87	0.63330	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.147481	0.64402	D	0.000012	D	0.91751	0.7391	M	0.84156	2.68	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	D	0.89291	0.3619	10	0.34782	T	0.22	.	14.2927	0.66289	0.0:0.0:0.0:1.0	.	1342	P35555	FBN1_HUMAN	A	1342;232	ENSP00000325527:T1342A	ENSP00000325527:T1342A	T	-	1	0	FBN1	46554080	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.269000	0.51592	2.059000	0.61396	0.533000	0.62120	ACA	FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000166147		0.438	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	91	0.00	0	T			48766788	48766788	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	56	37.78	34	SNP	1.000	C
FBXL17	64839	genome.wustl.edu	37	5	107216824	107216824	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr5:107216824A>G	ENST00000542267.1	-	8	2285	c.1879T>C	c.(1879-1881)Tgt>Cgt	p.C627R	FBXL17_ENST00000496714.1_Missense_Mutation_p.C229R|FBXL17_ENST00000359660.5_Missense_Mutation_p.C229R	NM_001163315.2	NP_001156787.2	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17	627										endometrium(1)|large_intestine(4)|lung(1)	6		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		ATTTCTTTACACCATCCGACA	0.453																																						dbGAP											0													189.0	168.0	175.0					5																	107216824		2202	4300	6502	-	-	-	SO:0001583	missense	0			AL133602	CCDS54886.1	5q21.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000145743	ENSG00000145743		"""F-boxes / Leucine-rich repeats"""	13615	protein-coding gene	gene with protein product		609083	"""F-box only protein 13"""	FBXO13			Standard	NM_001163315		Approved	DKFZP434C1715, Fbx13, Fbl17	uc011cvc.2	Q9UF56	OTTHUMG00000159785	ENST00000542267.1:c.1879T>C	5.37:g.107216824A>G	ENSP00000437464:p.Cys627Arg		A1A4E3	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.C627R	ENST00000542267.1	37	c.1879	CCDS54886.1	5	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198748	0.79015	.	.	ENSG00000145743	ENST00000359660;ENST00000542267;ENST00000496714	T;T;T	0.18657	2.2;2.2;2.2	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.61481	-0.7054	10	0.87932	D	0	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	627;229	Q9UF56;Q9UF56-2	FXL17_HUMAN;.	R	229;627;229	ENSP00000352683:C229R;ENSP00000437464:C627R;ENSP00000418111:C229R	ENSP00000352683:C229R	C	-	1	0	FBXL17	107244723	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	8.927000	0.92846	2.279000	0.76181	0.533000	0.62120	TGT	FBXL17	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000145743		0.453	FBXL17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL17	HGNC	protein_coding		68	0.00	0	A			107216824	107216824	-1	no_errors	ENST00000542267	ensembl	human	known	69_37n	missense	29	44.44	24	SNP	1.000	G
GFPT2	9945	genome.wustl.edu	37	5	179745913	179745913	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr5:179745913C>T	ENST00000253778.8	-	10	1007	c.838G>A	c.(838-840)Gat>Aat	p.D280N	GFPT2_ENST00000520165.1_5'UTR	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	280	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	GCGATGTCATCGTCCTCCAGG	0.587																																						dbGAP											0													60.0	64.0	62.0					5																	179745913		2093	4228	6321	-	-	-	SO:0001583	missense	0			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.838G>A	5.37:g.179745913C>T	ENSP00000253778:p.Asp280Asn		Q53XM2|Q9BWS4	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.D280N	ENST00000253778.8	37	c.838	CCDS43411.1	5	.	.	.	.	.	.	.	.	.	.	C	13.76	2.333179	0.41297	.	.	ENSG00000131459	ENST00000253778;ENST00000518906	T;T	0.76060	-0.99;-0.99	5.24	5.24	0.73138	Glutamine amidotransferase, type II (1);	0.045148	0.85682	D	0.000000	T	0.66297	0.2775	L	0.48935	1.535	0.80722	D	1	P	0.36633	0.562	B	0.26969	0.075	T	0.66176	-0.5989	9	.	.	.	-20.0531	18.829	0.92130	0.0:1.0:0.0:0.0	.	280	O94808	GFPT2_HUMAN	N	280;182	ENSP00000253778:D280N;ENSP00000431125:D182N	.	D	-	1	0	GFPT2	179678519	1.000000	0.71417	0.413000	0.26509	0.302000	0.27658	5.978000	0.70501	2.465000	0.83290	0.555000	0.69702	GAT	GFPT2	-	tigrfam_GlmS_trans	ENSG00000131459		0.587	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFPT2	HGNC	protein_coding	OTTHUMT00000373444.4	26	0.00	0	C	NM_005110		179745913	179745913	-1	no_errors	ENST00000253778	ensembl	human	known	69_37n	missense	8	66.67	16	SNP	1.000	T
GLDC	2731	genome.wustl.edu	37	9	6605176	6605176	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr9:6605176C>G	ENST00000321612.6	-	6	966	c.816G>C	c.(814-816)aaG>aaC	p.K272N		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	272					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	AGTCTTCCACCTTCCCCTCCG	0.512																																						dbGAP											0													155.0	116.0	129.0					9																	6605176		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.816G>C	9.37:g.6605176C>G	ENSP00000370737:p.Lys272Asn		Q2M2F8	Missense_Mutation	SNP	pfam_GDC-P_N,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_GDC_P_homo	p.K272N	ENST00000321612.6	37	c.816	CCDS34987.1	9	.	.	.	.	.	.	.	.	.	.	C	11.65	1.702779	0.30232	.	.	ENSG00000178445	ENST00000321612	D	0.95377	-3.69	5.45	3.5	0.40072	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Glycine cleavage system P-protein, N-terminal (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.140700	0.64402	D	0.000007	T	0.80999	0.4732	N	0.00602	-1.34	0.41409	D	0.987724	B	0.02656	0.0	B	0.08055	0.003	T	0.74731	-0.3566	10	0.40728	T	0.16	-26.039	4.1936	0.10433	0.1295:0.6025:0.1257:0.1423	.	272	P23378	GCSP_HUMAN	N	272	ENSP00000370737:K272N	ENSP00000370737:K272N	K	-	3	2	GLDC	6595176	0.952000	0.32445	1.000000	0.80357	0.971000	0.66376	0.103000	0.15292	1.445000	0.47624	0.655000	0.94253	AAG	GLDC	-	pfam_GDC-P_N,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_GDC_P_homo	ENSG00000178445		0.512	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDC	HGNC	protein_coding	OTTHUMT00000051674.2	67	0.00	0	C	NM_000170		6605176	6605176	-1	no_errors	ENST00000321612	ensembl	human	known	69_37n	missense	20	45.95	17	SNP	1.000	G
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29974791	29974791	+	RNA	SNP	G	G	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr6:29974791G>C	ENST00000376797.3	-	0	1346				ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		CCCAGGCACAGACTGACCGAG	0.672																																						dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29974791G>C				RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.672	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1	46	0.00	0	G	NR_026751		29974791	29974791	+1	no_errors	ENST00000462773	ensembl	human	known	69_37n	rna	36	20.00	9	SNP	0.020	C
INSRR	3645	genome.wustl.edu	37	1	156812803	156812803	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr1:156812803T>A	ENST00000368195.3	-	17	3515	c.3119A>T	c.(3118-3120)cAc>cTc	p.H1040L	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1040	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TACCACATGGTGACACTTGAA	0.507																																						dbGAP											0													74.0	69.0	71.0					1																	156812803		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3119A>T	1.37:g.156812803T>A	ENSP00000357178:p.His1040Leu		O60724|Q5VZS3	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H1040L	ENST00000368195.3	37	c.3119	CCDS1160.1	1	.	.	.	.	.	.	.	.	.	.	T	19.85	3.903940	0.72754	.	.	ENSG00000027644	ENST00000368195	D	0.88741	-2.42	5.04	5.04	0.67666	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000101	D	0.93245	0.7848	.	.	.	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.94260	0.7501	9	0.87932	D	0	.	13.7381	0.62831	0.0:0.0:0.0:1.0	.	1040	P14616	INSRR_HUMAN	L	1040	ENSP00000357178:H1040L	ENSP00000357178:H1040L	H	-	2	0	INSRR	155079427	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.832000	0.86757	2.118000	0.64928	0.533000	0.62120	CAC	INSRR	-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000027644		0.507	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	32	0.00	0	T	NM_014215		156812803	156812803	-1	no_errors	ENST00000368195	ensembl	human	known	69_37n	missense	27	24.32	9	SNP	1.000	A
ITGA1	3672	genome.wustl.edu	37	5	52240786	52240786	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr5:52240786G>C	ENST00000282588.6	+	27	3757	c.3299G>C	c.(3298-3300)aGc>aCc	p.S1100T	CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	1100					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TATTTTTCCAGCTTAAATCTT	0.333																																						dbGAP											0													96.0	107.0	103.0					5																	52240786		2203	4299	6502	-	-	-	SO:0001583	missense	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.3299G>C	5.37:g.52240786G>C	ENSP00000282588:p.Ser1100Thr		B2RNU0	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.S1100T	ENST00000282588.6	37	c.3299	CCDS3955.1	5	.	.	.	.	.	.	.	.	.	.	G	5.987	0.366062	0.11352	.	.	ENSG00000213949	ENST00000282588	T	0.47177	0.85	5.63	5.63	0.86233	.	0.121096	0.85682	D	0.000000	T	0.32406	0.0828	N	0.13198	0.31	0.41364	D	0.987441	B	0.06786	0.001	B	0.08055	0.003	T	0.09729	-1.0661	10	0.20046	T	0.44	.	16.9486	0.86237	0.0:0.0:1.0:0.0	.	1100	P56199	ITA1_HUMAN	T	1100	ENSP00000282588:S1100T	ENSP00000282588:S1100T	S	+	2	0	ITGA1	52276543	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.935000	0.56560	2.797000	0.96272	0.655000	0.94253	AGC	ITGA1	-	NULL	ENSG00000213949		0.333	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3	79	0.00	0	G	NM_181501		52240786	52240786	+1	no_errors	ENST00000282588	ensembl	human	known	69_37n	missense	35	30.00	15	SNP	1.000	C
ITIH5	80760	genome.wustl.edu	37	10	7605192	7605192	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr10:7605192T>A	ENST00000256861.6	-	14	2761	c.2683A>T	c.(2683-2685)Att>Ttt	p.I895F	ITIH5_ENST00000298441.6_Missense_Mutation_p.I681F|ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000446830.2_Missense_Mutation_p.I677F	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	895					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CCGTTGTAAATCTTCCTTTGC	0.537																																						dbGAP											0													161.0	125.0	137.0					10																	7605192		2203	4300	6503	-	-	-	SO:0001583	missense	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2683A>T	10.37:g.7605192T>A	ENSP00000256861:p.Ile895Phe		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.I895F	ENST00000256861.6	37	c.2683		10	.	.	.	.	.	.	.	.	.	.	T	15.62	2.888543	0.52014	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.12361	2.69;2.69;2.69	5.79	5.79	0.91817	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.048245	0.85682	D	0.000000	T	0.38983	0.1061	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.984	T	0.16247	-1.0409	9	0.59425	D	0.04	-34.267	16.1204	0.81351	0.0:0.0:0.0:1.0	.	895;681	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	F	895;681;677	ENSP00000256861:I895F;ENSP00000298441:I681F;ENSP00000387969:I677F	ENSP00000256861:I895F	I	-	1	0	ITIH5	7645198	1.000000	0.71417	0.974000	0.42286	0.034000	0.12701	5.794000	0.69067	2.209000	0.71365	0.528000	0.53228	ATT	ITIH5	-	pfam_ITI_HC_C	ENSG00000123243		0.537	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	70	0.00	0	T	NM_030569		7605192	7605192	-1	no_errors	ENST00000256861	ensembl	human	known	69_37n	missense	53	29.33	22	SNP	1.000	A
KCNA6	3742	genome.wustl.edu	37	12	4920003	4920003	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr12:4920003G>T	ENST00000280684.3	+	1	1662	c.796G>T	c.(796-798)Gtg>Ttg	p.V266L	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.V266L			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	266					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	CTTCTTTCTGGTGGAGACGCT	0.557										HNSCC(72;0.22)																												dbGAP											0													84.0	86.0	85.0					12																	4920003		2203	4300	6503	-	-	-	SO:0001583	missense	0			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.796G>T	12.37:g.4920003G>T	ENSP00000280684:p.Val266Leu			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.6,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.V266L	ENST00000280684.3	37	c.796	CCDS8534.1	12	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638212	0.29157	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.98207	-4.79;-4.79	5.12	4.23	0.50019	Ion transport (1);	0.195152	0.44483	D	0.000455	D	0.94518	0.8235	N	0.25485	0.75	0.35195	D	0.773758	B	0.17667	0.023	B	0.26969	0.075	D	0.92460	0.5977	10	0.32370	T	0.25	.	6.3019	0.21117	0.2765:0.0:0.7235:0.0	.	266	P17658	KCNA6_HUMAN	L	266	ENSP00000408321:V266L;ENSP00000280684:V266L	ENSP00000280684:V266L	V	+	1	0	KCNA6	4790264	0.981000	0.34729	1.000000	0.80357	0.992000	0.81027	0.869000	0.27996	1.398000	0.46701	0.655000	0.94253	GTG	KCNA6	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000151079		0.557	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA6	HGNC	protein_coding	OTTHUMT00000398909.1	20	0.00	0	G	NM_002235		4920003	4920003	+1	no_errors	ENST00000280684	ensembl	human	known	69_37n	missense	21	44.74	17	SNP	1.000	T
KIAA1107	23285	genome.wustl.edu	37	1	92647600	92647600	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr1:92647600G>C	ENST00000370378.4	+	8	3144	c.3046G>C	c.(3046-3048)Gaa>Caa	p.E1016Q	KIAA1107_ENST00000409154.4_Missense_Mutation_p.E1071Q	NM_015237.2	NP_056052.2	Q9UPP5	K1107_HUMAN	KIAA1107	1071				F -> L (in Ref. 4; AAH37317). {ECO:0000305}.						breast(4)|central_nervous_system(1)|endometrium(3)|kidney(2)|prostate(1)|skin(3)	14						AGATGAAGGAGAAGTCCATAC	0.383																																						dbGAP											0													94.0	87.0	89.0					1																	92647600		692	1591	2283	-	-	-	SO:0001583	missense	0			AB029030	CCDS44172.1	1p22.1	2008-02-05			ENSG00000069712	ENSG00000069712			29192	protein-coding gene	gene with protein product						10470851	Standard	NM_015237		Approved		uc010otd.2	Q9UPP5	OTTHUMG00000010292	ENST00000370378.4:c.3046G>C	1.37:g.92647600G>C	ENSP00000359404:p.Glu1016Gln		O14767|Q8N3X7	Missense_Mutation	SNP	NULL	p.E1071Q	ENST00000370378.4	37	c.3211	CCDS44172.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064872	0.76187	.	.	ENSG00000069712	ENST00000409154;ENST00000370378	T;T	0.07908	3.16;3.15	5.79	5.79	0.91817	.	0.240918	0.41823	D	0.000817	T	0.18882	0.0453	L	0.59436	1.845	0.43835	D	0.996416	D	0.71674	0.998	D	0.66351	0.943	T	0.00253	-1.1875	10	0.51188	T	0.08	.	20.04	0.97581	0.0:0.0:1.0:0.0	.	1016	E9PEZ5	.	Q	1071;1016	ENSP00000386957:E1071Q;ENSP00000359404:E1016Q	ENSP00000359404:E1016Q	E	+	1	0	KIAA1107	92420188	1.000000	0.71417	0.990000	0.47175	0.951000	0.60555	8.898000	0.92538	2.733000	0.93635	0.655000	0.94253	GAA	KIAA1107	-	NULL	ENSG00000069712		0.383	KIAA1107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1107	HGNC	protein_coding	OTTHUMT00000028375.3	69	0.00	0	G	XM_034086		92647600	92647600	+1	no_errors	ENST00000409154	ensembl	human	known	69_37n	missense	21	43.24	16	SNP	0.998	C
KIFAP3	22920	genome.wustl.edu	37	1	170007569	170007569	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr1:170007569C>T	ENST00000361580.2	-	5	606	c.379G>A	c.(379-381)Gat>Aat	p.D127N	KIFAP3_ENST00000367765.1_Missense_Mutation_p.D87N|KIFAP3_ENST00000538366.1_Missense_Mutation_p.D49N|KIFAP3_ENST00000490550.1_5'UTR|KIFAP3_ENST00000367767.1_Missense_Mutation_p.D83N	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	127					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCAACTTCATCAATCTGAAAC	0.353																																						dbGAP											0													95.0	105.0	101.0					1																	170007569		2203	4300	6503	-	-	-	SO:0001583	missense	0			U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.379G>A	1.37:g.170007569C>T	ENSP00000354560:p.Asp127Asn		B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.D127N	ENST00000361580.2	37	c.379	CCDS1288.1	1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.926186	0.52759	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767;ENST00000538366	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.74	5.74	0.90152	Armadillo-like helical (1);	0.043545	0.85682	D	0.000000	T	0.24122	0.0584	N	0.25647	0.755	0.80722	D	1	B;B;B	0.24426	0.103;0.014;0.006	B;B;B	0.22152	0.038;0.015;0.01	T	0.05632	-1.0873	9	.	.	.	-28.1139	19.8931	0.96937	0.0:1.0:0.0:0.0	.	49;83;127	B7Z8A3;B1AKU5;Q92845	.;.;KIFA3_HUMAN	N	127;87;83;49	ENSP00000354560:D127N;ENSP00000356739:D87N;ENSP00000356741:D83N;ENSP00000444622:D49N	.	D	-	1	0	KIFAP3	168274193	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.298000	0.59067	2.873000	0.98535	0.563000	0.77884	GAT	KIFAP3	-	NULL	ENSG00000075945		0.353	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFAP3	HGNC	protein_coding	OTTHUMT00000087568.1	54	0.00	0	C	NM_014970		170007569	170007569	-1	no_errors	ENST00000361580	ensembl	human	known	69_37n	missense	36	28.00	14	SNP	1.000	T
LCN2	3934	genome.wustl.edu	37	9	130913971	130913971	+	Silent	SNP	C	C	G	rs371653139		TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr9:130913971C>G	ENST00000373017.1	+	4	567	c.330C>G	c.(328-330)ggC>ggG	p.G110G	LCN2_ENST00000470902.1_3'UTR|LCN2_ENST00000372998.1_Silent_p.G112G|LCN2_ENST00000277480.2_Silent_p.G110G|LCN2_ENST00000540948.1_Silent_p.G110G|LCN2_ENST00000373013.2_Silent_p.G112G			P80188	NGAL_HUMAN	lipocalin 2	110					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|small molecule binding (GO:0036094)|transporter activity (GO:0005215)			central_nervous_system(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	8						GCCAGCCCGGCGAGTTCACGC	0.587																																						dbGAP											0													61.0	53.0	56.0					9																	130913971		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6892.1	9q34	2011-10-24	2007-12-18		ENSG00000148346	ENSG00000148346		"""Lipocalins"""	6526	protein-coding gene	gene with protein product	"""oncogene 24p3"", ""neutrophil gelatinase-associated lipocalin"", ""siderocalin"""	600181	"""lipocalin 2 (oncogene 24p3)"""			7683678	Standard	NM_005564		Approved	NGAL, 24p3	uc004bto.1	P80188	OTTHUMG00000020734	ENST00000373017.1:c.330C>G	9.37:g.130913971C>G			A6NII8|B4DWV4|B7ZAA2|P30150|Q5SYV9|Q5SYW0|Q6FGL5|Q92683	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_N_gelatinase,prints_PstgldnD_synth,prints_Lipocalin,prints_A1-microglobln	p.G112	ENST00000373017.1	37	c.336	CCDS6892.1	9																																																																																			LCN2	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_N_gelatinase	ENSG00000148346		0.587	LCN2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LCN2	HGNC	protein_coding	OTTHUMT00000054375.1	35	0.00	0	C	NM_005564		130913971	130913971	+1	no_errors	ENST00000372998	ensembl	human	known	69_37n	silent	22	24.14	7	SNP	1.000	G
MED16	10025	genome.wustl.edu	37	19	875294	875295	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr19:875294_875295delTT	ENST00000589119.1	-	9	1719_1720	c.1720_1721delAA	c.(1720-1722)aagfs	p.K574fs	MED16_ENST00000269814.4_Frame_Shift_Del_p.K574fs|MED16_ENST00000312090.6_Frame_Shift_Del_p.K574fs|MED16_ENST00000606828.1_5'UTR|MED16_ENST00000395808.3_Frame_Shift_Del_p.K574fs|MED16_ENST00000325464.1_Frame_Shift_Del_p.K574fs			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	574					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCGGGGCTCTTGTCAGGCGTG	0.604																																						dbGAP											0										1,4263		0,1,2131						0.9	1.0			69	0,8248		0,0,4124	no	frameshift	MED16	NM_005481.2		0,1,6255	A1A1,A1R,RR		0.0,0.0235,0.0080				1,12511				-	-	-	SO:0001589	frameshift_variant	0			AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1720_1721delAA	19.37:g.875294_875295delTT	ENSP00000464810:p.Lys574fs		Q6PJT2|Q96AD4|Q96I35|Q9Y652	Frame_Shift_Del	DEL	pfam_Mediator_Med16,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K574fs	ENST00000589119.1	37	c.1721_1720	CCDS12047.1	19																																																																																			MED16	-	pfam_Mediator_Med16	ENSG00000175221		0.604	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MED16	HGNC	protein_coding	OTTHUMT00000457902.3	34	0.00	0	TT	NM_005481		875294	875295	-1	no_errors	ENST00000325464	ensembl	human	known	69_37n	frame_shift_del	8	47.37	9	DEL	1.000:1.000	-
MPND	84954	genome.wustl.edu	37	19	4354359	4354359	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr19:4354359C>A	ENST00000262966.8	+	6	855	c.788C>A	c.(787-789)gCc>gAc	p.A263D	AC007292.3_ENST00000593524.1_RNA|AC007292.4_ENST00000594776.1_RNA|MPND_ENST00000359935.4_Missense_Mutation_p.A263D|MPND_ENST00000599840.1_Missense_Mutation_p.A263D	NM_032868.4	NP_116257.2	Q8N594	MPND_HUMAN	MPN domain containing	263							peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCTTTGCAGCCATCAACAAG	0.612																																						dbGAP											0													62.0	65.0	64.0					19																	4354359		2048	4172	6220	-	-	-	SO:0001583	missense	0				CCDS42470.1, CCDS54200.1, CCDS74261.1	19p13.3	2014-08-12			ENSG00000008382				25934	protein-coding gene	gene with protein product							Standard	XM_005259663		Approved	FLJ14981	uc002mae.3	Q8N594	OTTHUMG00000181914	ENST00000262966.8:c.788C>A	19.37:g.4354359C>A	ENSP00000262966:p.Ala263Asp		Q96SJ0|Q9Y2P1|Q9Y2P2	Missense_Mutation	SNP	pfam_JAB1_Mov34_MPN_PAD1	p.A263D	ENST00000262966.8	37	c.788	CCDS42470.1	19	.	.	.	.	.	.	.	.	.	.	c	21.2	4.114000	0.77210	.	.	ENSG00000008382	ENST00000262966;ENST00000359935	D;D	0.85013	-1.93;-1.93	5.03	5.03	0.67393	.	0.111321	0.64402	D	0.000012	D	0.85053	0.5609	L	0.36672	1.1	0.58432	D	0.999999	D;D;D	0.61080	0.962;0.975;0.989	P;P;P	0.57009	0.744;0.698;0.811	T	0.81745	-0.0792	10	0.21014	T	0.42	-26.433	14.1996	0.65693	0.0:1.0:0.0:0.0	.	263;263;263	Q8N594-2;A6NI36;Q8N594	.;.;MPND_HUMAN	D	263	ENSP00000262966:A263D;ENSP00000353015:A263D	ENSP00000262966:A263D	A	+	2	0	MPND	4305359	1.000000	0.71417	0.974000	0.42286	0.847000	0.48162	6.304000	0.72800	2.505000	0.84491	0.550000	0.68814	GCC	MPND	-	NULL	ENSG00000008382		0.612	MPND-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MPND	HGNC	protein_coding	OTTHUMT00000458292.1	48	0.00	0	C	NM_032868		4354359	4354359	+1	no_errors	ENST00000262966	ensembl	human	known	69_37n	missense	34	35.85	19	SNP	1.000	A
MUC12	10071	genome.wustl.edu	37	7	100637073	100637073	+	Missense_Mutation	SNP	C	C	T	rs199836803	byFrequency	TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr7:100637073C>T	ENST00000379442.3	+	5	3658	c.3658C>T	c.(3658-3660)Cgc>Tgc	p.R1220C	MUC12_ENST00000536621.1_Missense_Mutation_p.R1077C			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1220	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TACAACCTCACGCATCAGTCC	0.512																																						dbGAP											0													8.0	8.0	8.0					7																	100637073		556	1231	1787	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.3658C>T	7.37:g.100637073C>T	ENSP00000368755:p.Arg1220Cys		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.R1220C	ENST00000379442.3	37	c.3658		7	.	.	.	.	.	.	.	.	.	.	c	0.783	-0.761743	0.02996	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.13901	2.55;2.55	0.713	-1.02	0.10135	.	.	.	.	.	T	0.06050	0.0157	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.34700	-0.9818	7	0.56958	D	0.05	.	2.7243	0.05209	0.3079:0.3837:0.3084:0.0	.	.	.	.	C	1220;1077	ENSP00000368755:R1220C;ENSP00000441929:R1077C	ENSP00000368755:R1220C	R	+	1	0	MUC12	100423793	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	1.331000	0.33793	-0.288000	0.09051	0.184000	0.17185	CGC	MUC12	-	NULL	ENSG00000205277		0.512	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	37	0.00	0	C	XM_379904		100637073	100637073	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.000	T
MXRA5	25878	genome.wustl.edu	37	X	3239601	3239601	+	Silent	SNP	T	T	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chrX:3239601T>C	ENST00000217939.6	-	5	4279	c.4125A>G	c.(4123-4125)ccA>ccG	p.P1375P		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1375						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTGGAGTTCCTGGAAAGCCTA	0.502																																						dbGAP											0													39.0	38.0	38.0					X																	3239601		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.4125A>G	X.37:g.3239601T>C			Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P1375	ENST00000217939.6	37	c.4125	CCDS14124.1	X																																																																																			MXRA5	-	NULL	ENSG00000101825		0.502	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	36	0.00	0	T	NM_015419		3239601	3239601	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	0.001	C
NBPF11	200030	genome.wustl.edu	37	1	146055349	146055349	+	Missense_Mutation	SNP	G	G	A	rs200002878	byFrequency	TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr1:146055349G>A	ENST00000604938.1	-	7	1572	c.274C>T	c.(274-276)Ctc>Ttc	p.L92F	NBPF11_ENST00000604894.1_Intron|NBPF11_ENST00000369323.3_Intron|NBPF11_ENST00000605317.1_Missense_Mutation_p.L146F|NBPF11_ENST00000401009.2_5'Flank|NBPF11_ENST00000479926.2_Intron|NBPF11_ENST00000339388.5_Missense_Mutation_p.L92F			Q86T75	NBPFB_HUMAN	neuroblastoma breakpoint family, member 11	92						cytoplasm (GO:0005737)						all_hematologic(923;0.0276)					CCTCACCTGAGCTCCTCAGCT	0.527																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					1q21.1	2014-01-16			ENSG00000152042	ENSG00000263956		"""neuroblastoma breakpoint family"""	31993	protein-coding gene	gene with protein product		614001	"""neuroblastoma breakpoint family, member 24"""	NBPF24		16079250	Standard	XM_006711197		Approved			Q86T75	OTTHUMG00000013880	ENST00000604938.1:c.274C>T	1.37:g.146055349G>A	ENSP00000474107:p.Leu92Phe		B1AKG1|B7Z7R4	Missense_Mutation	SNP	pfam_NBPF_dom,superfamily_Secretoglobin	p.L92F	ENST00000604938.1	37	c.274		1	.	.	.	.	.	.	.	.	.	.	g	8.397	0.841041	0.16891	.	.	ENSG00000152042	ENST00000339388;ENST00000479926	T	0.03553	3.89	0.804	0.804	0.18697	.	.	.	.	.	T	0.04952	0.0133	M	0.66378	2.025	0.09310	N	0.999998	D;B	0.76494	0.999;0.137	D;B	0.71656	0.974;0.01	T	0.35748	-0.9776	9	0.39692	T	0.17	.	5.0805	0.14653	0.0:0.0:1.0:0.0	.	92;92	B7WNR1;Q86T75	.;NBPFB_HUMAN	F	92	ENSP00000345181:L92F	ENSP00000345181:L92F	L	-	1	0	NBPF11	144766706	0.001000	0.12720	0.053000	0.19242	0.075000	0.17131	-0.341000	0.07811	0.772000	0.33382	0.398000	0.26397	CTC	NBPF11	-	NULL	ENSG00000152042		0.527	NBPF11-001	KNOWN	basic|appris_candidate	protein_coding	NBPF11	HGNC	protein_coding	OTTHUMT00000351193.2	11	0.00	0	G	NM_183372		146055349	146055349	-1	no_errors	ENST00000339388	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.060	A
NEB	4703	genome.wustl.edu	37	2	152580858	152580858	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr2:152580858C>T	ENST00000172853.10	-	8	675	c.528G>A	c.(526-528)tgG>tgA	p.W176*	NEB_ENST00000397345.3_Nonsense_Mutation_p.W176*|NEB_ENST00000409198.1_Nonsense_Mutation_p.W176*|NEB_ENST00000603639.1_Nonsense_Mutation_p.W176*|NEB_ENST00000604864.1_Nonsense_Mutation_p.W176*|NEB_ENST00000427231.2_Nonsense_Mutation_p.W176*			P20929	NEBU_HUMAN	nebulin	176					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGTGTCTTCCCAGTTCTGCT	0.493																																						dbGAP											0													112.0	119.0	117.0					2																	152580858		1994	4163	6157	-	-	-	SO:0001587	stop_gained	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.528G>A	2.37:g.152580858C>T	ENSP00000172853:p.Trp176*		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Nonsense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.W176*	ENST00000172853.10	37	c.528		2	.	.	.	.	.	.	.	.	.	.	C	39	7.630034	0.98399	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000439291	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	20.1519	0.98089	0.0:1.0:0.0:0.0	.	.	.	.	X	176	.	ENSP00000172853:W176X	W	-	3	0	NEB	152289104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.183000	0.77697	2.861000	0.98227	0.655000	0.94253	TGG	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.493	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		89	0.00	0	C	NM_004543		152580858	152580858	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	nonsense	63	28.41	25	SNP	1.000	T
PCDHGA7	56108	genome.wustl.edu	37	5	140764619	140764619	+	Missense_Mutation	SNP	G	G	A	rs559398944		TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr5:140764619G>A	ENST00000518325.1	+	1	2153	c.2153G>A	c.(2152-2154)cGc>cAc	p.R718H	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_5'Flank|PCDHGB3_ENST00000576222.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	718					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R718H(1)		NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCTGCGGCGCTGGCACAAG	0.622																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											53.0	59.0	57.0					5																	140764619		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.2153G>A	5.37:g.140764619G>A	ENSP00000430024:p.Arg718His		B2RN87|Q9Y5D0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R718H	ENST00000518325.1	37	c.2153	CCDS54927.1	5	.	.	.	.	.	.	.	.	.	.	.	14.03	2.413500	0.42817	.	.	ENSG00000253537	ENST00000518325	T	0.56444	0.46	4.73	3.86	0.44501	.	.	.	.	.	T	0.45538	0.1347	L	0.58428	1.81	0.23685	N	0.997119	B;B	0.31040	0.111;0.305	B;B	0.25614	0.035;0.062	T	0.33752	-0.9856	9	0.38643	T	0.18	.	8.7327	0.34510	0.1744:0.0:0.8256:0.0	.	718;718	Q9Y5G6;Q9Y5G6-2	PCDG7_HUMAN;.	H	718	ENSP00000430024:R718H	ENSP00000430024:R718H	R	+	2	0	PCDHGA7	140744803	0.000000	0.05858	0.892000	0.35008	0.579000	0.36224	-0.038000	0.12144	1.115000	0.41800	0.563000	0.77884	CGC	PCDHGA7	-	NULL	ENSG00000253537		0.622	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA7	HGNC	protein_coding	OTTHUMT00000374744.1	34	0.00	0	G	NM_018920		140764619	140764619	+1	no_errors	ENST00000518325	ensembl	human	known	69_37n	missense	32	34.69	17	SNP	0.979	A
PRX	57716	genome.wustl.edu	37	19	40902282	40902282	+	Silent	SNP	G	G	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr19:40902282G>T	ENST00000324001.7	-	7	2247	c.1977C>A	c.(1975-1977)ctC>ctA	p.L659L	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	659	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGACTTTCGGGAGCTGCACTT	0.562																																						dbGAP											0													88.0	99.0	95.0					19																	40902282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1977C>A	19.37:g.40902282G>T			Q9BXL9|Q9HCF2	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L659	ENST00000324001.7	37	c.1977	CCDS33028.1	19																																																																																			PRX	-	NULL	ENSG00000105227		0.562	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	61	0.00	0	G	NM_020956		40902282	40902282	-1	no_errors	ENST00000324001	ensembl	human	known	69_37n	silent	31	27.91	12	SNP	0.024	T
PSMD2	5708	genome.wustl.edu	37	3	184018176	184018176	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr3:184018176C>G	ENST00000310118.4	+	3	859	c.301C>G	c.(301-303)Cca>Gca	p.P101A	PSMD2_ENST00000439383.1_5'Flank|PSMD2_ENST00000435761.1_5'Flank|EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000459910.1_3'UTR	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	101					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	ATTTCTGCGTCCACACTATGG	0.473																																					Colon(24;313 636 6917 9932 15554)	dbGAP											0													91.0	87.0	89.0					3																	184018176		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.301C>G	3.37:g.184018176C>G	ENSP00000310129:p.Pro101Ala		B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Missense_Mutation	SNP	pfam_APC_proteasome,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn1	p.P101A	ENST00000310118.4	37	c.301	CCDS3258.1	3	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029205	0.93518	.	.	ENSG00000175166	ENST00000310118;ENST00000417952;ENST00000538096	T;T	0.25414	1.8;1.8	5.71	5.71	0.89125	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.57080	0.2029	M	0.83774	2.66	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.60337	-0.7283	10	0.66056	D	0.02	-10.8041	19.8633	0.96793	0.0:1.0:0.0:0.0	.	101	Q13200	PSMD2_HUMAN	A	101;101;93	ENSP00000310129:P101A;ENSP00000414061:P101A	ENSP00000310129:P101A	P	+	1	0	PSMD2	185500870	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.786000	0.85741	2.697000	0.92050	0.591000	0.81541	CCA	PSMD2	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn1	ENSG00000175166		0.473	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD2	HGNC	protein_coding	OTTHUMT00000345843.1	35	0.00	0	C	NM_002808		184018176	184018176	+1	no_errors	ENST00000310118	ensembl	human	known	69_37n	missense	31	31.11	14	SNP	1.000	G
PTRF	284119	genome.wustl.edu	37	17	40557214	40557214	+	Nonsense_Mutation	SNP	T	T	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr17:40557214T>A	ENST00000357037.5	-	2	1083	c.664A>T	c.(664-666)Aag>Tag	p.K222*		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CCGCTGCGCTTGATACGCTCT	0.642																																						dbGAP											0													100.0	102.0	102.0					17																	40557214		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.664A>T	17.37:g.40557214T>A	ENSP00000349541:p.Lys222*			Nonsense_Mutation	SNP	NULL	p.K222*	ENST00000357037.5	37	c.664	CCDS11425.1	17	.	.	.	.	.	.	.	.	.	.	T	32	5.158791	0.94686	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	.	.	.	5.35	4.25	0.50352	.	0.153557	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.678	12.2722	0.54712	0.0:0.0:0.1421:0.8579	.	.	.	.	X	222;177	.	ENSP00000349541:K222X	K	-	1	0	PTRF	37810740	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	4.283000	0.58977	0.840000	0.34995	0.366000	0.22137	AAG	PTRF	-	NULL	ENSG00000177469		0.642	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRF	HGNC	protein_coding	OTTHUMT00000449938.1	32	0.00	0	T	NM_012232		40557214	40557214	-1	no_errors	ENST00000357037	ensembl	human	known	69_37n	nonsense	38	36.67	22	SNP	1.000	A
RBM3	5935	genome.wustl.edu	37	X	48434030	48434030	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chrX:48434030T>A	ENST00000376759.3	+	3	248	c.185T>A	c.(184-186)gTt>gAt	p.V62D	RBM3_ENST00000354480.2_5'Flank|AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000376755.1_Missense_Mutation_p.V62D|RBM3_ENST00000466764.1_3'UTR|RBM3_ENST00000430348.2_5'UTR	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3	62	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						CATGCTTCAGTTGCCATGAGA	0.542																																						dbGAP											0													68.0	58.0	61.0					X																	48434030		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.185T>A	X.37:g.48434030T>A	ENSP00000365950:p.Val62Asp			Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V62D	ENST00000376759.3	37	c.185	CCDS14301.1	X	.	.	.	.	.	.	.	.	.	.	T	2.094	-0.407680	0.04832	.	.	ENSG00000102317	ENST00000376759;ENST00000376755	T;T	0.15139	2.45;2.45	4.82	3.64	0.41730	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.079789	0.47852	N	0.000219	T	0.06234	0.0161	N	0.02708	-0.52	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29640	-1.0005	9	.	.	.	-7.6854	8.3302	0.32182	0.8138:0.0:0.0:0.1862	.	62	P98179	RBM3_HUMAN	D	62	ENSP00000365950:V62D;ENSP00000365946:V62D	.	V	+	2	0	RBM3	48318974	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.358000	0.59442	0.606000	0.29965	-0.657000	0.03884	GTT	RBM3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000102317		0.542	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM3	HGNC	protein_coding	OTTHUMT00000060755.1	51	0.00	0	T	NM_006743		48434030	48434030	+1	no_errors	ENST00000376755	ensembl	human	known	69_37n	missense	38	39.68	25	SNP	1.000	A
RPTN	126638	genome.wustl.edu	37	1	152128042	152128042	+	Silent	SNP	A	A	G	rs267598026		TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr1:152128042A>G	ENST00000316073.3	-	3	1597	c.1533T>C	c.(1531-1533)taT>taC	p.Y511Y		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	511	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						CTGTCTGACCATAGTGGGAAC	0.498																																						dbGAP											0													827.0	718.0	751.0					1																	152128042		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1533T>C	1.37:g.152128042A>G			B7ZBZ3	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.Y511	ENST00000316073.3	37	c.1533	CCDS41397.1	1																																																																																			RPTN	-	NULL	ENSG00000215853		0.498	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	312	0.00	0	A	XM_371312		152128042	152128042	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	silent	209	54.66	252	SNP	0.023	G
SBSPON	157869	genome.wustl.edu	37	8	73982160	73982160	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr8:73982160C>T	ENST00000297354.6	-	4	761	c.557G>A	c.(556-558)tGg>tAg	p.W186*	SBSPON_ENST00000519697.1_5'UTR	NM_153225.3	NP_694957.3	Q8IVN8	SBSPO_HUMAN	somatomedin B and thrombospondin, type 1 domain containing	186			W -> R (in dbSNP:rs2291219). {ECO:0000269|PubMed:12107410, ECO:0000269|PubMed:14702039}.		immune response (GO:0006955)	proteinaceous extracellular matrix (GO:0005578)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)										AGTCAAGGGCCAGTTTTCCAG	0.468																																						dbGAP											0													106.0	105.0	105.0					8																	73982160		2000	4181	6181	-	-	-	SO:0001587	stop_gained	0				CCDS43747.2	8q21.11	2013-08-07	2012-05-15	2012-05-15	ENSG00000164764	ENSG00000164764			30362	protein-coding gene	gene with protein product	"""RPE spondin"", ""rpe-spondin"""		"""chromosome 8 open reading frame 84"""	C8orf84		12107410	Standard	NM_153225		Approved	RPESP	uc003xzf.3	Q8IVN8	OTTHUMG00000157144	ENST00000297354.6:c.557G>A	8.37:g.73982160C>T	ENSP00000297354:p.Trp186*		A8KAA5|Q96J64	Nonsense_Mutation	SNP	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Somatomedin_B_dom,pfscan_Thrombospondin_1_rpt	p.W186*	ENST00000297354.6	37	c.557	CCDS43747.2	8	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048193	0.75846	.	.	ENSG00000164764	ENST00000297354	.	.	.	6.06	6.06	0.98353	.	0.146153	0.47093	D	0.000247	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-23.6019	20.2159	0.98296	0.0:1.0:0.0:0.0	.	.	.	.	X	186	.	ENSP00000297354:W186X	W	-	2	0	C8orf84	74144714	0.953000	0.32496	0.668000	0.29813	0.033000	0.12548	2.155000	0.42301	2.882000	0.98803	0.655000	0.94253	TGG	SBSPON	-	NULL	ENSG00000164764		0.468	SBSPON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SBSPON	HGNC	protein_coding	OTTHUMT00000347584.2	61	0.00	0	C	NM_153225		73982160	73982160	-1	no_errors	ENST00000297354	ensembl	human	known	69_37n	nonsense	71	29.00	29	SNP	0.994	T
SCN2B	6327	genome.wustl.edu	37	11	118038933	118038933	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr11:118038933delG	ENST00000278947.5	-	3	556	c.315delC	c.(313-315)cccfs	p.P105fs		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	105	Ig-like C2-type.				cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	CGTACTTGCTGGGGTTCCCTG	0.567																																						dbGAP											0													117.0	88.0	98.0					11																	118038933		2200	4296	6496	-	-	-	SO:0001589	frameshift_variant	0			AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.315delC	11.37:g.118038933delG	ENSP00000278947:p.Pro105fs		O75302|Q9UNN3	Frame_Shift_Del	DEL	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like,prints_Myelin_P0	p.S106fs	ENST00000278947.5	37	c.315	CCDS8390.1	11																																																																																			SCN2B	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like,prints_Myelin_P0	ENSG00000149575		0.567	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN2B	HGNC	protein_coding	OTTHUMT00000109748.2	45	0.00	0	G	NM_004588		118038933	118038933	-1	no_errors	ENST00000278947	ensembl	human	known	69_37n	frame_shift_del	12	42.86	9	DEL	1.000	-
SH3GLB2	56904	genome.wustl.edu	37	9	131772130	131772130	+	Silent	SNP	G	G	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr9:131772130G>T	ENST00000372564.3	-	9	904	c.759C>A	c.(757-759)ctC>ctA	p.L253L	SH3GLB2_ENST00000416629.1_Silent_p.L232L|SH3GLB2_ENST00000417224.1_Silent_p.L253L|SH3GLB2_ENST00000372554.4_Silent_p.L257L|SH3GLB2_ENST00000372559.1_Silent_p.L253L	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	253	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)				NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						CGAACTCGTGGAGGCAGCGCA	0.602																																						dbGAP											0													65.0	58.0	61.0					9																	131772130		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.759C>A	9.37:g.131772130G>T			A6NC47|A8MPS4|Q8WY61|Q96JH9	Silent	SNP	pfam_BAR_dom,pfam_BAR_dom-cont,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain	p.L257	ENST00000372564.3	37	c.771	CCDS6916.1	9																																																																																			SH3GLB2	-	pfam_BAR_dom,pfam_BAR_dom-cont,smart_BAR_dom,pfscan_BAR_dom	ENSG00000148341		0.602	SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GLB2	HGNC	protein_coding	OTTHUMT00000054535.2	29	0.00	0	G			131772130	131772130	-1	no_errors	ENST00000372554	ensembl	human	known	69_37n	silent	27	34.15	14	SNP	0.982	T
SLC5A5	6528	genome.wustl.edu	37	19	17988649	17988649	+	Silent	SNP	C	C	T	rs121909175		TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr19:17988649C>T	ENST00000222248.3	+	6	1163	c.816C>T	c.(814-816)tgC>tgT	p.C272C		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	272					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						ACGTGGCTTGCCGCACAGAGA	0.607																																					Melanoma(65;1008 1708 7910 46650)	dbGAP											0			GRCh37	CM971392	SLC5A5	M	rs121909175						123.0	105.0	111.0					19																	17988649		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.816C>T	19.37:g.17988649C>T			O43702|Q2M335|Q9NYB6	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.C272	ENST00000222248.3	37	c.816	CCDS12368.1	19																																																																																			SLC5A5	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000105641		0.607	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A5	HGNC	protein_coding	OTTHUMT00000466690.1	50	0.00	0	C			17988649	17988649	+1	no_errors	ENST00000222248	ensembl	human	known	69_37n	silent	45	34.78	24	SNP	0.730	T
SLC5A6	8884	genome.wustl.edu	37	2	27425725	27425725	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr2:27425725G>C	ENST00000310574.3	-	12	1704	c.1231C>G	c.(1231-1233)Cta>Gta	p.L411V	SLC5A6_ENST00000461319.1_5'UTR|SLC5A6_ENST00000408041.1_Missense_Mutation_p.L411V	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	411					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	GCCATTCCTAGACAAAGCAGC	0.473																																						dbGAP											0													113.0	122.0	119.0					2																	27425725		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.1231C>G	2.37:g.27425725G>C	ENSP00000310208:p.Leu411Val		B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L411V	ENST00000310574.3	37	c.1231	CCDS1740.1	2	.	.	.	.	.	.	.	.	.	.	G	16.51	3.142899	0.57044	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.88664	-2.41;-2.41	5.47	3.66	0.41972	.	0.000000	0.64402	D	0.000001	T	0.81019	0.4736	N	0.17800	0.525	0.58432	D	0.999992	P	0.41597	0.756	P	0.44647	0.456	T	0.73585	-0.3936	10	0.18276	T	0.48	.	8.4733	0.32999	0.081:0.0:0.7653:0.1537	.	411	Q9Y289	SC5A6_HUMAN	V	411	ENSP00000310208:L411V;ENSP00000384853:L411V	ENSP00000310208:L411V	L	-	1	2	SLC5A6	27279229	1.000000	0.71417	0.995000	0.50966	0.772000	0.43724	4.551000	0.60740	0.684000	0.31448	0.563000	0.77884	CTA	SLC5A6	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000138074		0.473	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	HGNC	protein_coding	OTTHUMT00000214194.1	49	0.00	0	G	NM_021095		27425725	27425725	-1	no_errors	ENST00000310574	ensembl	human	known	69_37n	missense	27	34.15	14	SNP	1.000	C
SPAST	6683	genome.wustl.edu	37	2	32361954	32361954	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr2:32361954G>T	ENST00000315285.3	+	11	1455	c.1330G>T	c.(1330-1332)Gat>Tat	p.D444Y	SPAST_ENST00000345662.1_Missense_Mutation_p.D412Y	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGATGAAGTTGATAGCCTTTT	0.333																																						dbGAP											0													101.0	108.0	105.0					2																	32361954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.1330G>T	2.37:g.32361954G>T	ENSP00000320885:p.Asp444Tyr			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_MIT,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_MIT,smart_AAA+_ATPase,pirsf_Spastin	p.D444Y	ENST00000315285.3	37	c.1330	CCDS1778.1	2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569649	0.86439	.	.	ENSG00000021574	ENST00000345662;ENST00000315285	D;D	0.95918	-3.85;-3.85	5.63	5.63	0.86233	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.98629	0.9541	H	0.96489	3.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99250	1.0887	10	0.87932	D	0	-30.1059	19.6351	0.95728	0.0:0.0:1.0:0.0	.	412;444	E5KRP6;Q9UBP0	.;SPAST_HUMAN	Y	412;444	ENSP00000340817:D412Y;ENSP00000320885:D444Y	ENSP00000320885:D444Y	D	+	1	0	SPAST	32215458	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.987000	0.93497	2.805000	0.96524	0.655000	0.94253	GAT	SPAST	-	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,pirsf_Spastin	ENSG00000021574		0.333	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAST	HGNC	protein_coding	OTTHUMT00000250253.1	96	0.00	0	G	NM_199436		32361954	32361954	+1	no_errors	ENST00000315285	ensembl	human	known	69_37n	missense	72	23.40	22	SNP	1.000	T
SSTR4	6754	genome.wustl.edu	37	20	23016840	23016840	+	Silent	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr20:23016840C>T	ENST00000255008.3	+	1	784	c.720C>T	c.(718-720)gcC>gcT	p.A240A	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	240					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					AGATGCGCGCCGTGGCCCTGC	0.637																																					Esophageal Squamous(15;850 1104 16640)	dbGAP											0													73.0	83.0	80.0					20																	23016840		2157	4277	6434	-	-	-	SO:0001819	synonymous_variant	0				CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.720C>T	20.37:g.23016840C>T			Q17RM1|Q17RM3|Q9UIY1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Somatstn_rcpt_4,prints_7TM_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_Neuropept_W_rcpt,prints_NPY_rcpt,prints_Somatstn_rcpt_1	p.A240	ENST00000255008.3	37	c.720	CCDS42856.1	20																																																																																			SSTR4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_supfam,prints_Somatstn_rcpt,prints_Neuropept_W_rcpt	ENSG00000132671		0.637	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR4	HGNC	protein_coding	OTTHUMT00000078308.1	56	0.00	0	C			23016840	23016840	+1	no_errors	ENST00000255008	ensembl	human	known	69_37n	silent	32	40.74	22	SNP	0.682	T
STON2	85439	genome.wustl.edu	37	14	81743745	81743747	+	In_Frame_Del	DEL	GTG	GTG	-			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	GTG	GTG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr14:81743745_81743747delGTG	ENST00000267540.2	-	4	2108_2110	c.1908_1910delCAC	c.(1906-1911)accaca>aca	p.636_637TT>T	STON2_ENST00000556280.1_5'Flank|STON2_ENST00000555447.1_In_Frame_Del_p.636_637TT>T	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	636	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		GATCCACTTTGTGGTGGTGGTGG	0.527																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.1908_1910delCAC	14.37:g.81743754_81743756delGTG	ENSP00000267540:p.Thr637del		G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	In_Frame_Del	DEL	pfam_Stonin2_N,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C,pfscan_SHD	p.T637in_frame_del	ENST00000267540.2	37	c.1910_1908	CCDS9875.1	14																																																																																			STON2	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C	ENSG00000140022		0.527	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STON2	HGNC	protein_coding	OTTHUMT00000413317.1	52	0.00	0	GTG	NM_033104		81743745	81743747	-1	no_errors	ENST00000267540	ensembl	human	known	69_37n	in_frame_del	16	11.11	2	DEL	0.994:0.996:0.998	-
TFG	10342	genome.wustl.edu	37	3	100467337	100467337	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr3:100467337G>T	ENST00000240851.4	+	8	1505	c.1165G>T	c.(1165-1167)Ggt>Tgt	p.G389C	TFG_ENST00000476228.1_Missense_Mutation_p.G385C|TFG_ENST00000481203.1_3'UTR|TFG_ENST00000490574.1_Missense_Mutation_p.G389C|TFG_ENST00000418917.2_Missense_Mutation_p.G385C	NM_001195478.1|NM_001195479.1|NM_006070.5	NP_001182407.1|NP_001182408.1|NP_006061.2	Q92734	TFG_HUMAN	TRK-fused gene	389					cell death (GO:0008219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	signal transducer activity (GO:0004871)		TFG/NR4A3(2)|TFG/NTRK1_ENST00000392302(5)|TFG/ALK(9)	large_intestine(4)|lung(2)|prostate(1)|stomach(1)	8						TCCTCCCTTTGGTCAGGGCTA	0.507			T	"""NTRK1, ALK"""	"""papillary thyroid, ALCL, NSCLC"""																																	dbGAP		Dom	yes		3	3q11-q12	10342	TRK-fused gene		"""E, L"""	0													76.0	71.0	73.0					3																	100467337		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC009241	CCDS2939.1, CCDS56266.1	3q12.2	2013-03-13	2001-12-04		ENSG00000114354	ENSG00000114354			11758	protein-coding gene	gene with protein product		602498				9169129, 23479643	Standard	NM_001007565		Approved	TF6, FLJ36137, SPG57	uc003dui.3	Q92734	OTTHUMG00000159085	ENST00000240851.4:c.1165G>T	3.37:g.100467337G>T	ENSP00000240851:p.Gly389Cys		D3DN49|G5E9V1|Q15656|Q969I2	Missense_Mutation	SNP	pfam_OPR_PB1,smart_OPR_PB1	p.G389C	ENST00000240851.4	37	c.1165	CCDS2939.1	3	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783337	0.49891	.	.	ENSG00000114354	ENST00000418917;ENST00000490574;ENST00000240851;ENST00000476228	T;T;T;T	0.48836	0.8;0.81;0.81;0.8	5.75	2.58	0.30949	.	0.744519	0.13391	N	0.391434	T	0.45074	0.1324	L	0.29908	0.895	0.45777	D	0.998666	P;P	0.47409	0.895;0.577	P;B	0.49301	0.606;0.334	T	0.42068	-0.9473	10	0.66056	D	0.02	-8.346	11.878	0.52558	0.2204:0.0:0.7796:0.0	.	385;389	G5E9V1;Q92734	.;TFG_HUMAN	C	385;389;389;385	ENSP00000397182:G385C;ENSP00000419960:G389C;ENSP00000240851:G389C;ENSP00000417952:G385C	ENSP00000240851:G389C	G	+	1	0	TFG	101950027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.254000	0.43214	0.777000	0.33496	0.650000	0.86243	GGT	TFG	-	NULL	ENSG00000114354		0.507	TFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFG	HGNC	protein_coding	OTTHUMT00000353242.1	30	0.00	0	G	NM_006070		100467337	100467337	+1	no_errors	ENST00000240851	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	1.000	T
TLR4	7099	genome.wustl.edu	37	9	120475050	120475050	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr9:120475050T>C	ENST00000355622.6	+	3	745	c.644T>C	c.(643-645)aTg>aCg	p.M215T	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.M175T	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	215					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	CTGAACCCTATGAACTTTATC	0.348																																						dbGAP											0													56.0	62.0	60.0					9																	120475050		2192	4296	6488	-	-	-	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.644T>C	9.37:g.120475050T>C	ENSP00000363089:p.Met215Thr		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.M215T	ENST00000355622.6	37	c.644	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	T	9.246	1.039506	0.19669	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.37235	1.49;1.21	5.59	5.59	0.84812	.	0.264243	0.31797	N	0.007048	T	0.23532	0.0569	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.11329	0.006	T	0.28138	-1.0053	10	0.87932	D	0	.	15.771	0.78167	0.0:0.0:0.0:1.0	.	215	O00206	TLR4_HUMAN	T	175;215	ENSP00000377997:M175T;ENSP00000363089:M215T	ENSP00000363089:M215T	M	+	2	0	TLR4	119514871	0.929000	0.31497	0.065000	0.19835	0.182000	0.23217	5.693000	0.68264	2.123000	0.65237	0.533000	0.62120	ATG	TLR4	-	pirsf_Toll-like_receptor,smart_Leu-rich_rpt_typical-subtyp	ENSG00000136869		0.348	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	42	0.00	0	T	NM_138554		120475050	120475050	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	missense	25	39.02	16	SNP	0.345	C
TLR4	7099	genome.wustl.edu	37	9	120475844	120475844	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr9:120475844G>T	ENST00000355622.6	+	3	1539	c.1438G>T	c.(1438-1440)Ggc>Tgc	p.G480C	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.G440C	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	480					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GAAAATGGCTGGCAATTCTTT	0.448																																						dbGAP											0													87.0	88.0	88.0					9																	120475844		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1438G>T	9.37:g.120475844G>T	ENSP00000363089:p.Gly480Cys		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.G480C	ENST00000355622.6	37	c.1438	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	G	15.87	2.960067	0.53400	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.59502	0.26;0.26	5.72	5.72	0.89469	.	0.080653	0.53938	D	0.000055	T	0.76579	0.4007	M	0.79011	2.435	0.44275	D	0.997137	D	0.89917	1.0	D	0.91635	0.999	T	0.78940	-0.2006	10	0.87932	D	0	.	15.3728	0.74581	0.0:0.1388:0.8612:0.0	.	480	O00206	TLR4_HUMAN	C	440;480	ENSP00000377997:G440C;ENSP00000363089:G480C	ENSP00000363089:G480C	G	+	1	0	TLR4	119515665	1.000000	0.71417	1.000000	0.80357	0.550000	0.35303	2.721000	0.47260	2.704000	0.92352	0.650000	0.86243	GGC	TLR4	-	pirsf_Toll-like_receptor,smart_Leu-rich_rpt_typical-subtyp	ENSG00000136869		0.448	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	28	0.00	0	G	NM_138554		120475844	120475844	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	missense	21	36.36	12	SNP	1.000	T
TNFRSF8	943	genome.wustl.edu	37	1	12175747	12175747	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr1:12175747T>A	ENST00000263932.2	+	8	1129	c.907T>A	c.(907-909)Tac>Aac	p.Y303N	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.Y192N	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	303					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	CTGTGTCCCCTACCCAATCTG	0.622																																						dbGAP											0													124.0	92.0	103.0					1																	12175747		2203	4300	6503	-	-	-	SO:0001583	missense	0			M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.907T>A	1.37:g.12175747T>A	ENSP00000263932:p.Tyr303Asn		B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_8	p.Y303N	ENST00000263932.2	37	c.907	CCDS144.1	1	.	.	.	.	.	.	.	.	.	.	T	11.02	1.517208	0.27123	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	T;T	0.72835	-0.69;-0.69	3.72	-6.48	0.01896	.	.	.	.	.	T	0.41534	0.1163	N	0.22421	0.69	0.09310	N	1	P;B	0.34462	0.454;0.329	B;B	0.26517	0.053;0.07	T	0.27806	-1.0063	9	0.35671	T	0.21	-0.6933	0.0481	0.00011	0.327:0.1791:0.1949:0.2989	.	192;303	D3YTD8;P28908	.;TNR8_HUMAN	N	303;192	ENSP00000263932:Y303N;ENSP00000390650:Y192N	ENSP00000263932:Y303N	Y	+	1	0	TNFRSF8	12098334	0.000000	0.05858	0.000000	0.03702	0.222000	0.24845	-0.313000	0.08103	-1.684000	0.01443	-0.479000	0.04858	TAC	TNFRSF8	-	NULL	ENSG00000120949		0.622	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF8	HGNC	protein_coding	OTTHUMT00000005130.1	44	0.00	0	T			12175747	12175747	+1	no_errors	ENST00000263932	ensembl	human	known	69_37n	missense	29	35.56	16	SNP	0.000	A
TXNRD1	7296	genome.wustl.edu	37	12	104713335	104713335	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr12:104713335C>T	ENST00000529546.1	+	6	622	c.397C>T	c.(397-399)Cct>Tct	p.P133S	TXNRD1_ENST00000388854.3_Missense_Mutation_p.P223S|TXNRD1_ENST00000542918.1_Missense_Mutation_p.P221S|TXNRD1_ENST00000429002.2_Missense_Mutation_p.P321S|TXNRD1_ENST00000354940.6_Missense_Mutation_p.P171S|TXNRD1_ENST00000503506.2_Missense_Mutation_p.P171S|TXNRD1_ENST00000427956.1_Missense_Mutation_p.P286S|TXNRD1_ENST00000397736.2_Missense_Mutation_p.P215S|TXNRD1_ENST00000526390.1_Missense_Mutation_p.P215S|TXNRD1_ENST00000526950.1_Missense_Mutation_p.P240S|TXNRD1_ENST00000378070.4_Missense_Mutation_p.P270S|TXNRD1_ENST00000540716.1_Missense_Mutation_p.P133S|TXNRD1_ENST00000526691.1_Missense_Mutation_p.P223S|TXNRD1_ENST00000524698.1_Missense_Mutation_p.P171S|TXNRD1_ENST00000525566.1_Missense_Mutation_p.P321S			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	321	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	CTTGGGCATCCCTGGTGACAA	0.398																																					Ovarian(139;555 1836 9186 9946 10884)	dbGAP											0													33.0	31.0	32.0					12																	104713335		1838	4079	5917	-	-	-	SO:0001583	missense	0				CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.397C>T	12.37:g.104713335C>T	ENSP00000434919:p.Pro133Ser		B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_Glutaredoxin,superfamily_FAD/NAD-linked_Rdtase_dimer,superfamily_Thioredoxin-like_fold,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Thioredoxin/glutathione_Rdtase	p.P321S	ENST00000529546.1	37	c.961	CCDS58274.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.193245	0.94960	.	.	ENSG00000198431	ENST00000525566;ENST00000429002;ENST00000503506;ENST00000526691;ENST00000388854;ENST00000354940;ENST00000526390;ENST00000529546;ENST00000540716;ENST00000524698;ENST00000542918;ENST00000378070;ENST00000527335;ENST00000397736;ENST00000427956;ENST00000526950	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49;0.49	5.16	5.16	0.70880	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.103049	0.64402	D	0.000002	T	0.81254	0.4784	H	0.95816	3.725	0.80722	D	1	D;P;D;P;P;D;P	0.63880	0.98;0.896;0.993;0.874;0.896;0.961;0.933	D;P;D;P;P;P;P	0.70935	0.932;0.706;0.971;0.676;0.783;0.9;0.761	D	0.87323	0.2319	10	0.87932	D	0	-15.4621	18.7163	0.91677	0.0:1.0:0.0:0.0	.	221;215;321;223;171;321;286	B7Z2S5;E2QRB9;B7Z904;Q16881-4;B2R5P6;Q16881;E7EW10	.;.;.;.;.;TRXR1_HUMAN;.	S	321;321;171;223;223;171;215;133;133;171;221;270;171;215;286;240	ENSP00000434516:P321S;ENSP00000412045:P321S;ENSP00000421934:P171S;ENSP00000435929:P223S;ENSP00000373506:P223S;ENSP00000347020:P171S;ENSP00000435123:P215S;ENSP00000434919:P133S;ENSP00000442709:P133S;ENSP00000433425:P171S;ENSP00000440978:P221S;ENSP00000367310:P270S;ENSP00000433599:P171S;ENSP00000380844:P215S;ENSP00000393328:P286S;ENSP00000432812:P240S	ENSP00000347020:P171S	P	+	1	0	TXNRD1	103237465	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.840000	0.69402	2.425000	0.82216	0.638000	0.83543	CCT	TXNRD1	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,tigrfam_Thioredoxin/glutathione_Rdtase	ENSG00000198431		0.398	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	TXNRD1	HGNC	protein_coding	OTTHUMT00000389969.1	38	0.00	0	C	NM_003330		104713335	104713335	+1	no_errors	ENST00000429002	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	1.000	T
VPS11	55823	genome.wustl.edu	37	11	118948974	118948974	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr11:118948974C>T	ENST00000300793.6	+	12	1892	c.1850C>T	c.(1849-1851)tCa>tTa	p.S617L	VPS11_ENST00000527798.1_3'UTR	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	618					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		CAGCCAGACTCACCCCAGGGG	0.567																																						dbGAP											0													138.0	137.0	137.0					11																	118948974		2000	4175	6175	-	-	-	SO:0001583	missense	0			AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.1850C>T	11.37:g.118948974C>T	ENSP00000475301:p.Ser617Leu		Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	RNA	SNP	-	NULL	ENST00000300793.6	37	NULL		11																																																																																			VPS11	-	-	ENSG00000160695		0.567	VPS11-201	KNOWN	basic|appris_principal	protein_coding	VPS11	HGNC	protein_coding		30	0.00	0	C	NM_021729		118948974	118948974	+1	no_errors	ENST00000300793	ensembl	human	known	69_37n	rna	20	39.39	13	SNP	0.999	T
VWDE	221806	genome.wustl.edu	37	7	12391277	12391277	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr7:12391277T>C	ENST00000275358.3	-	19	3996	c.3808A>G	c.(3808-3810)Agt>Ggt	p.S1270G		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1270						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TTATTTACACTTTTATCAGAT	0.338																																						dbGAP											0													206.0	183.0	190.0					7																	12391277		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.3808A>G	7.37:g.12391277T>C	ENSP00000275358:p.Ser1270Gly		B7ZM77|Q96SQ3	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EGF-like,pfscan_EG-like_dom	p.S1270G	ENST00000275358.3	37	c.3808	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	T	8.312	0.822407	0.16678	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	T	0.72282	-0.64	3.06	3.06	0.35304	.	1.074000	0.07077	N	0.836301	T	0.59088	0.2168	L	0.28649	0.875	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48843	-0.8999	10	0.48119	T	0.1	.	7.9048	0.29755	0.0:0.0:0.0:1.0	.	1270	Q8N2E2	VWDE_HUMAN	G	1270;724	ENSP00000275358:S1270G	ENSP00000275358:S1270G	S	-	1	0	VWDE	12357802	0.001000	0.12720	0.009000	0.14445	0.072000	0.16883	0.676000	0.25247	1.660000	0.50760	0.459000	0.35465	AGT	VWDE	-	NULL	ENSG00000146530		0.338	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	117	0.00	0	T	XM_371878		12391277	12391277	-1	no_errors	ENST00000275358	ensembl	human	novel	69_37n	missense	73	34.23	38	SNP	0.010	C
ZNF560	147741	genome.wustl.edu	37	19	9577765	9577765	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr19:9577765G>A	ENST00000301480.4	-	10	2071	c.1858C>T	c.(1858-1860)Cga>Tga	p.R620*		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	620					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						GTGTGTCTTCGTAAATGTTTA	0.398																																						dbGAP											0													146.0	134.0	138.0					19																	9577765		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1858C>T	19.37:g.9577765G>A	ENSP00000301480:p.Arg620*		Q495S9|Q495T1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R620*	ENST00000301480.4	37	c.1858	CCDS12214.1	19	.	.	.	.	.	.	.	.	.	.	G	38	6.944800	0.97952	.	.	ENSG00000198028	ENST00000301480	.	.	.	2.02	-2.31	0.06765	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.7655	0.13130	0.0:0.138:0.4393:0.4226	.	.	.	.	X	620	.	ENSP00000301480:R620X	R	-	1	2	ZNF560	9438765	0.000000	0.05858	0.000000	0.03702	0.956000	0.61745	-2.173000	0.01265	-0.643000	0.05473	0.462000	0.41574	CGA	ZNF560	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198028		0.398	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF560	HGNC	protein_coding	OTTHUMT00000449901.1	79	0.00	0	G	NM_152476		9577765	9577765	-1	no_errors	ENST00000301480	ensembl	human	known	69_37n	nonsense	59	27.16	22	SNP	0.000	A
ZNF799	90576	genome.wustl.edu	37	19	12501549	12501550	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr19:12501549_12501550delTG	ENST00000430385.3	-	4	1862_1863	c.1662_1663delCA	c.(1660-1665)cacatgfs	p.M555fs	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Frame_Shift_Del_p.M523fs	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	555					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TTCTCTCTCATGTGAATTCTTT	0.411																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1662_1663delCA	19.37:g.12501551_12501552delTG	ENSP00000411084:p.Met555fs			Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M555fs	ENST00000430385.3	37	c.1663_1662	CCDS45989.1	19																																																																																			ZNF799	-	pfscan_Znf_C2H2	ENSG00000196466		0.411	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	HGNC	protein_coding	OTTHUMT00000344099.2	117	0.00	0	TG	NM_001080821		12501549	12501550	-1	no_errors	ENST00000430385	ensembl	human	known	69_37n	frame_shift_del	84	13.40	13	DEL	0.984:0.994	-
WIZ	58525	genome.wustl.edu	37	19	15536452	15536452	+	Silent	SNP	G	G	C			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr19:15536452G>C	ENST00000389282.4	-	7	3993	c.3780C>G	c.(3778-3780)gtC>gtG	p.V1260V	WIZ_ENST00000545156.1_Silent_p.V574V|WIZ_ENST00000599686.3_Silent_p.V444V|WIZ_ENST00000263381.7_Silent_p.V403V|WIZ_ENST00000599910.2_Silent_p.V577V			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1260					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						GCGAACCATTGACGGACCACT	0.622																																						dbGAP											0													48.0	47.0	48.0					19																	15536452		2072	4207	6279	-	-	-	SO:0001819	synonymous_variant	0			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3780C>G	19.37:g.15536452G>C			B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V1260	ENST00000389282.4	37	c.3780		19																																																																																			WIZ	-	NULL	ENSG00000011451		0.622	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		19	0.00	0	G	NM_021241		15536452	15536452	-1	no_errors	ENST00000389282	ensembl	human	known	69_37n	silent	16	23.81	5	SNP	0.997	C
ZYG11B	79699	genome.wustl.edu	37	1	53267568	53267568	+	Silent	SNP	T	T	A			TCGA-E9-A1R2-01A-11D-A14G-09	TCGA-E9-A1R2-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b321a2d9-5345-4891-b450-bfd696c6cfb0	bedecc9f-4e3f-4853-b683-2c901c6d3743	g.chr1:53267568T>A	ENST00000294353.6	+	9	1708	c.1563T>A	c.(1561-1563)ctT>ctA	p.L521L	ZYG11B_ENST00000545132.1_Silent_p.L521L|ZYG11B_ENST00000443756.2_Intron	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	521										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						TGAGTGCACTTTGGAACCTCA	0.348																																						dbGAP											0													63.0	61.0	62.0					1																	53267568		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.1563T>A	1.37:g.53267568T>A			Q8N2X3|Q9H8L8	Silent	SNP	superfamily_ARM-type_fold	p.L521	ENST00000294353.6	37	c.1563	CCDS30717.1	1																																																																																			ZYG11B	-	superfamily_ARM-type_fold	ENSG00000162378		0.348	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11B	HGNC	protein_coding	OTTHUMT00000024749.1	85	0.00	0	T	NM_024646		53267568	53267568	+1	no_errors	ENST00000294353	ensembl	human	known	69_37n	silent	34	41.38	24	SNP	0.996	A
