#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS12	81792	genome.wustl.edu	37	5	33614429	33614429	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr5:33614429T>G	ENST00000504830.1	-	16	2776	c.2441A>C	c.(2440-2442)aAa>aCa	p.K814T	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.K729T|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	814	Spacer 1.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						AAGGCCATCTTTCTGGATTGT	0.483										HNSCC(64;0.19)																												dbGAP											0													215.0	156.0	176.0					5																	33614429		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2441A>C	5.37:g.33614429T>G	ENSP00000422554:p.Lys814Thr		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.K814T	ENST00000504830.1	37	c.2441	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	T	24.4	4.531690	0.85706	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.61392	0.14;0.11	5.73	5.73	0.89815	.	0.044570	0.85682	D	0.000000	T	0.74122	0.3675	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	1.0;0.991	D;P	0.81914	0.995;0.824	T	0.71471	-0.4583	10	0.14252	T	0.57	.	15.6829	0.77385	0.0:0.0:0.0:1.0	.	729;814	P58397-3;P58397	.;ATS12_HUMAN	T	814;729	ENSP00000422554:K814T;ENSP00000344847:K729T	ENSP00000344847:K729T	K	-	2	0	ADAMTS12	33650186	1.000000	0.71417	0.967000	0.41034	0.984000	0.73092	4.212000	0.58514	2.179000	0.69175	0.459000	0.35465	AAA	ADAMTS12	-	NULL	ENSG00000151388		0.483	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	152	0.00	0	T	NM_030955		33614429	33614429	-1	no_errors	ENST00000504830	ensembl	human	known	69_37n	missense	84	27.59	32	SNP	1.000	G
AGAP4	119016	genome.wustl.edu	37	10	46342649	46342649	+	Silent	SNP	T	T	C	rs202147206	byFrequency	TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr10:46342649T>C	ENST00000448048.2	-	1	272	c.147A>G	c.(145-147)gtA>gtG	p.V49V	AGAP4_ENST00000430779.2_5'UTR	NM_133446.2	NP_597703.2	Q96P64	AGAP4_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 4	49					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			central_nervous_system(1)|lung(1)|ovary(1)	3						CAGCAGGCTGTACAGCAGCAG	0.582																																						dbGAP											0													1.0	1.0	1.0					10																	46342649		14	59	73	-	-	-	SO:0001819	synonymous_variant	0			AF411132	CCDS7215.1	10q11.21	2014-06-19	2008-09-22	2008-09-22	ENSG00000188234	ENSG00000188234		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23459	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 1"", ""ArfGAP with GTPase domain, ankyrin repeat and PH domain 8"", ""centaurin, gamma-like family, member 5"""	CTGLF1, AGAP8, CTGLF5		12477932	Standard	XM_005271797		Approved	Em:AC012044.1, MRIP2	uc001jcx.4	Q96P64	OTTHUMG00000018088	ENST00000448048.2:c.147A>G	10.37:g.46342649T>C				Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.V49	ENST00000448048.2	37	c.147	CCDS7215.1	10																																																																																			AGAP4	-	NULL	ENSG00000188234		0.582	AGAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP4	HGNC	protein_coding	OTTHUMT00000047799.1	12	0.00	0	T	NM_133446		46342649	46342649	-1	no_errors	ENST00000448048	ensembl	human	known	69_37n	silent	5	37.50	3	SNP	0.177	C
C21orf91	54149	genome.wustl.edu	37	21	19169225	19169225	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr21:19169225G>A	ENST00000400558.3	-	3	428	c.338C>T	c.(337-339)tCt>tTt	p.S113F	C21orf91_ENST00000400559.3_Missense_Mutation_p.S113F|AL109761.5_ENST00000428689.1_RNA|C21orf91_ENST00000284881.4_Missense_Mutation_p.S113F|C21orf91_ENST00000493464.1_5'UTR	NM_001100421.1	NP_001093891.1			chromosome 21 open reading frame 91											endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		GGGGTTTTTAGAACATTCAGA	0.348																																						dbGAP											0													101.0	92.0	94.0					21																	19169225		1814	4089	5903	-	-	-	SO:0001583	missense	0			AF239726	CCDS42907.1, CCDS42908.1, CCDS42909.1	21q21.1	2011-12-12	2003-07-22		ENSG00000154642	ENSG00000154642			16459	protein-coding gene	gene with protein product	"""cold sore susceptibility gene 1"", ""early undifferentiated retina and lens"""		"""chromosome 21 open reading frame 38"""	C21orf38, C21orf14		22039568	Standard	NM_001100421		Approved	YG81, EURL, CSSG1	uc002yko.4	Q9NYK6	OTTHUMG00000074509	ENST00000400558.3:c.338C>T	21.37:g.19169225G>A	ENSP00000383403:p.Ser113Phe			Missense_Mutation	SNP	pfam_EURL_prot	p.S113F	ENST00000400558.3	37	c.338	CCDS42909.1	21	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830464	0.32329	.	.	ENSG00000154642	ENST00000284881;ENST00000400559;ENST00000400558;ENST00000405964	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.94	5.05	0.67936	.	0.416908	0.31233	N	0.008014	T	0.21427	0.0516	M	0.64997	1.995	0.80722	D	1	B;B	0.15930	0.012;0.015	B;B	0.18263	0.012;0.021	T	0.02484	-1.1152	9	.	.	.	-4.547	16.252	0.82491	0.0:0.1328:0.8672:0.0	.	113;113	Q9NYK6-3;Q9NYK6	.;EURL_HUMAN	F	113	ENSP00000284881:S113F;ENSP00000383404:S113F;ENSP00000383403:S113F;ENSP00000385566:S113F	.	S	-	2	0	C21orf91	18091096	1.000000	0.71417	0.997000	0.53966	0.088000	0.18126	4.749000	0.62155	1.505000	0.48720	-0.181000	0.13052	TCT	C21orf91	-	pfam_EURL_prot	ENSG00000154642		0.348	C21orf91-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	C21orf91	HGNC	protein_coding	OTTHUMT00000158214.1	56	0.00	0	G	NM_017447		19169225	19169225	-1	no_errors	ENST00000284881	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	0.998	A
C9orf43	257169	genome.wustl.edu	37	9	116187646	116187648	+	In_Frame_Del	DEL	GCA	GCA	-	rs374165893|rs371732185		TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr9:116187646_116187648delGCA	ENST00000288462.4	+	10	1334_1336	c.888_890delGCA	c.(886-891)cggcag>cgg	p.Q304del	C9orf43_ENST00000374165.1_In_Frame_Del_p.Q304del	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	304	Gln-rich.									breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						agcagcagcggcagcagcagcag	0.557																																						dbGAP											0										2,231,68,3961		0,0,0,2,0,0,231,2,64,1832						-2.8	0.0			63	18,338,431,7463		2,0,0,14,0,0,338,9,413,3349	no	codingComplex	C9orf43	NM_152786.1		2,0,0,16,0,0,569,11,477,5181	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		9.5394,7.0624,8.6957				20,569,499,11424				-	-	-	SO:0001651	inframe_deletion	0			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.888_890delGCA	9.37:g.116187655_116187657delGCA	ENSP00000288462:p.Gln304del			In_Frame_Del	DEL	NULL	p.Q300in_frame_del	ENST00000288462.4	37	c.888_890	CCDS6796.1	9																																																																																			C9orf43	-	NULL	ENSG00000157653		0.557	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C9orf43	HGNC	protein_coding	OTTHUMT00000053739.1	72	0.00	0	GCA	NM_152786		116187646	116187648	+1	no_errors	ENST00000288462	ensembl	human	known	69_37n	in_frame_del	32	11.11	4	DEL	0.211:0.207:0.211	-
CD248	57124	genome.wustl.edu	37	11	66083729	66083729	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr11:66083729C>T	ENST00000311330.3	-	1	786	c.770G>A	c.(769-771)cGc>cAc	p.R257H	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	257					anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CTCAGTGCAGCGGCAGGACAC	0.687																																						dbGAP											0													34.0	45.0	42.0					11																	66083729		2200	4290	6490	-	-	-	SO:0001583	missense	0			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.770G>A	11.37:g.66083729C>T	ENSP00000308117:p.Arg257His		Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_EGF-like_Ca-bd,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_C-type_lectin	p.R257H	ENST00000311330.3	37	c.770	CCDS8134.1	11	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861219	0.32884	.	.	ENSG00000174807	ENST00000311330	D	0.96491	-4.03	4.17	3.25	0.37280	Epidermal growth factor-like (1);	0.850116	0.10554	N	0.661116	D	0.91102	0.7199	L	0.27053	0.805	0.31489	N	0.666164	B	0.15473	0.013	B	0.08055	0.003	D	0.86393	0.1737	10	0.34782	T	0.22	-21.4467	4.9289	0.13907	0.2088:0.6809:0.0:0.1103	.	257	Q9HCU0	CD248_HUMAN	H	257	ENSP00000308117:R257H	ENSP00000308117:R257H	R	-	2	0	CD248	65840305	0.720000	0.27996	1.000000	0.80357	0.979000	0.70002	0.723000	0.25939	0.971000	0.38288	0.462000	0.41574	CGC	CD248	-	smart_EGF-like	ENSG00000174807		0.687	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD248	HGNC	protein_coding	OTTHUMT00000392922.2	37	0.00	0	C	NM_020404		66083729	66083729	-1	no_errors	ENST00000311330	ensembl	human	known	69_37n	missense	25	21.21	7	SNP	1.000	T
CEP44	80817	genome.wustl.edu	37	4	175224964	175224964	+	Silent	SNP	G	G	C			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr4:175224964G>C	ENST00000503780.1	+	5	762	c.348G>C	c.(346-348)gtG>gtC	p.V116V	CEP44_ENST00000457424.2_Silent_p.V116V|CEP44_ENST00000426172.1_Silent_p.V116V|CEP44_ENST00000296519.4_Silent_p.V116V	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	116						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)				endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						TGAATTGTGTGATGAAAAAGC	0.284																																						dbGAP											0													73.0	76.0	75.0					4																	175224964		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.348G>C	4.37:g.175224964G>C			A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Silent	SNP	NULL	p.V116	ENST00000503780.1	37	c.348	CCDS34106.1	4																																																																																			CEP44	-	NULL	ENSG00000164118		0.284	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP44	HGNC	protein_coding	OTTHUMT00000362109.2	101	0.00	0	G	NM_030633		175224964	175224964	+1	no_errors	ENST00000426172	ensembl	human	known	69_37n	silent	64	29.67	27	SNP	0.987	C
CNTN1	1272	genome.wustl.edu	37	12	41419093	41419093	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr12:41419093T>A	ENST00000551295.2	+	21	2782	c.2665T>A	c.(2665-2667)Tgt>Agt	p.C889S	CNTN1_ENST00000347616.1_Missense_Mutation_p.C889S|CNTN1_ENST00000348761.2_Missense_Mutation_p.C878S|CNTN1_ENST00000550305.1_3'UTR	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	889	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TAGTGCAGGGTGTGGACCTCC	0.478																																						dbGAP											0													174.0	188.0	183.0					12																	41419093		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2665T>A	12.37:g.41419093T>A	ENSP00000447006:p.Cys889Ser		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.C889S	ENST00000551295.2	37	c.2665	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	T	11.96	1.794580	0.31777	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.55760	0.5;0.5;0.5	4.88	4.88	0.63580	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.189815	0.47455	D	0.000222	T	0.20861	0.0502	N	0.00873	-1.125	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.14587	-1.0467	10	0.17832	T	0.49	.	11.2538	0.49041	0.0:0.0:0.1529:0.8471	.	878;889	Q12860-2;Q12860	.;CNTN1_HUMAN	S	889;889;878	ENSP00000447006:C889S;ENSP00000325660:C889S;ENSP00000261160:C878S	ENSP00000325660:C889S	C	+	1	0	CNTN1	39705360	1.000000	0.71417	0.987000	0.45799	0.955000	0.61496	4.452000	0.60054	2.127000	0.65507	0.533000	0.62120	TGT	CNTN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000018236		0.478	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	47	0.00	0	T	NM_001843		41419093	41419093	+1	no_errors	ENST00000347616	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.993	A
CSMD3	114788	genome.wustl.edu	37	8	113988224	113988224	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr8:113988224C>T	ENST00000297405.5	-	7	1428	c.1184G>A	c.(1183-1185)cGa>cAa	p.R395Q	CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000343508.3_Missense_Mutation_p.R355Q|CSMD3_ENST00000352409.3_Missense_Mutation_p.R395Q	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	395						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AACTTGCACTCGCTGTTCCTC	0.502										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													217.0	189.0	198.0					8																	113988224		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1184G>A	8.37:g.113988224C>T	ENSP00000297405:p.Arg395Gln		Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.R395Q	ENST00000297405.5	37	c.1184	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223892	0.58668	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000352409	T;T;T	0.19105	2.18;2.17;2.19	6.17	6.17	0.99709	.	0.301150	0.21846	N	0.068245	T	0.13372	0.0324	N	0.22421	0.69	0.28057	N	0.933112	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.21008	-1.0258	10	0.11794	T	0.64	.	11.3746	0.49719	0.0:0.8067:0.1264:0.0669	.	395;355	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	Q	355;395;395	ENSP00000345799:R355Q;ENSP00000297405:R395Q;ENSP00000343124:R395Q	ENSP00000297405:R395Q	R	-	2	0	CSMD3	114057400	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	1.094000	0.30951	2.941000	0.99782	0.655000	0.94253	CGA	CSMD3	-	NULL	ENSG00000164796		0.502	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	137	0.72	1	C	NM_052900		113988224	113988224	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	195	19.75	48	SNP	1.000	T
CYP2A13	1553	genome.wustl.edu	37	19	41596358	41596358	+	Silent	SNP	C	C	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr19:41596358C>A	ENST00000330436.3	+	4	543	c.543C>A	c.(541-543)gtC>gtA	p.V181V		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	181					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	TCTCCAATGTCATCAGCTCCA	0.552																																						dbGAP											0													136.0	125.0	129.0					19																	41596358		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.543C>A	19.37:g.41596358C>A			Q53YR8|Q6R569|Q6R570|Q9H2X2	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.V181	ENST00000330436.3	37	c.543	CCDS12571.1	19																																																																																			CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000197838		0.552	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	186	0.00	0	C	NM_000766		41596358	41596358	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	silent	162	22.49	47	SNP	1.000	A
DNM1P46	196968	genome.wustl.edu	37	15	100340174	100340175	+	RNA	INS	-	-	A	rs200691929	byFrequency	TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr15:100340174_100340175insA	ENST00000341853.1	-	0	751_752					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										CAGGAGTGTCTTCTCGTTCCCA	0.614																																						dbGAP											0																																										-	-	-			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340174_100340175insA			Q3ZCN3	RNA	INS	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.614	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	9	0.00	0	-	NR_003260		100340174	100340175	-1	no_errors	ENST00000341853	ensembl	human	known	69_37n	rna	5	28.57	2	INS	0.948:0.931	A
DSC2	1824	genome.wustl.edu	37	18	28667707	28667707	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr18:28667707C>T	ENST00000280904.6	-	6	1143	c.700G>A	c.(700-702)Gag>Aag	p.E234K	DSC2_ENST00000251081.6_Missense_Mutation_p.E234K	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	234	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TTTTCATCCTCTATTTTGATT	0.338																																						dbGAP											0													103.0	105.0	104.0					18																	28667707		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.700G>A	18.37:g.28667707C>T	ENSP00000280904:p.Glu234Lys			Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin,prints_Desmo_cadherin	p.E234K	ENST00000280904.6	37	c.700	CCDS11892.1	18	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449721	0.84101	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000399347	T;T	0.61158	0.13;0.13	5.03	5.03	0.67393	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.32819	N	0.005606	T	0.73140	0.3549	M	0.62088	1.915	0.58432	D	0.999999	D;D	0.76494	0.999;0.998	D;D	0.73708	0.981;0.976	T	0.72814	-0.4179	10	0.45353	T	0.12	.	17.2989	0.87176	0.0:1.0:0.0:0.0	.	234;234	Q02487;Q02487-2	DSC2_HUMAN;.	K	234;234;247	ENSP00000251081:E234K;ENSP00000280904:E234K	ENSP00000251081:E234K	E	-	1	0	DSC2	26921705	0.998000	0.40836	1.000000	0.80357	0.704000	0.40688	3.045000	0.49838	2.613000	0.88420	0.655000	0.94253	GAG	DSC2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000134755		0.338	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	HGNC	protein_coding	OTTHUMT00000254943.1	160	0.00	0	C	NM_004949		28667707	28667707	-1	no_errors	ENST00000280904	ensembl	human	known	69_37n	missense	71	29.00	29	SNP	1.000	T
ELOF1	84337	genome.wustl.edu	37	19	11664586	11664586	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr19:11664586T>A	ENST00000252445.3	-	4	290	c.227A>T	c.(226-228)gAc>gTc	p.D76V	ELOF1_ENST00000591912.1_3'UTR|ELOF1_ENST00000586683.1_Intron|ELOF1_ENST00000590700.1_Missense_Mutation_p.D76V|ELOF1_ENST00000586120.1_Missense_Mutation_p.D76V|ELOF1_ENST00000591674.1_Missense_Mutation_p.D83V|ELOF1_ENST00000589171.1_3'UTR|ELOF1_ENST00000587806.1_Missense_Mutation_p.D97V	NM_032377.3	NP_115753.1	P60002	ELOF1_HUMAN	elongation factor 1 homolog (S. cerevisiae)	76					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(3)|lung(2)	5						CTCGCAGGCGTCTATCCAATC	0.582																																						dbGAP											0													79.0	74.0	76.0					19																	11664586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001171	CCDS12264.1	19p13.2	2008-02-05	2006-02-13			ENSG00000130165			28691	protein-coding gene	gene with protein product			"""elongation factor 1 homolog (ELF1, S. cerevisiae)"""			12477932	Standard	NM_032377		Approved	MGC4549, ELF1	uc002mse.1	P60002		ENST00000252445.3:c.227A>T	19.37:g.11664586T>A	ENSP00000252445:p.Asp76Val		Q8R1J7|Q96II4	Missense_Mutation	SNP	pfam_DUF701_Zn-bd	p.D76V	ENST00000252445.3	37	c.227	CCDS12264.1	19	.	.	.	.	.	.	.	.	.	.	T	16.66	3.183699	0.57800	.	.	ENSG00000130165	ENST00000252445	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.78515	0.4295	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81462	-0.0922	8	0.87932	D	0	-22.9335	12.798	0.57569	0.0:0.0:0.0:1.0	.	76	P60002	ELOF1_HUMAN	V	76	.	ENSP00000252445:D76V	D	-	2	0	ELOF1	11525586	1.000000	0.71417	0.954000	0.39281	0.006000	0.05464	7.143000	0.77348	2.014000	0.59158	0.519000	0.50382	GAC	ELOF1	-	pfam_DUF701_Zn-bd	ENSG00000130165		0.582	ELOF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOF1	HGNC	protein_coding	OTTHUMT00000458868.1	35	0.00	0	T	NM_032377		11664586	11664586	-1	no_errors	ENST00000252445	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	A
EYS	346007	genome.wustl.edu	37	6	64487930	64487930	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr6:64487930C>T	ENST00000370621.3	-	40	8393	c.7867G>A	c.(7867-7869)Ggg>Agg	p.G2623R	EYS_ENST00000503581.1_Missense_Mutation_p.G2623R|PHF3_ENST00000420043.1_3'UTR|EYS_ENST00000370616.2_Missense_Mutation_p.G2623R			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2623	EGF-like 24. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ATGCATGTCCCACCATTGCCA	0.463																																						dbGAP											0													169.0	127.0	140.0					6																	64487930		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.7867G>A	6.37:g.64487930C>T	ENSP00000359655:p.Gly2623Arg		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G2623R	ENST00000370621.3	37	c.7867		6	.	.	.	.	.	.	.	.	.	.	C	17.70	3.455106	0.63401	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.96967	-4.19;-4.19;-4.19	4.02	4.02	0.46733	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.46758	U	0.000265	D	0.98504	0.9501	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;0.996	D;D	0.97110	1.0;0.946	D	0.99719	1.1009	10	0.87932	D	0	-5.3441	14.3434	0.66643	0.0:1.0:0.0:0.0	.	2623;2623	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	R	2623	ENSP00000424243:G2623R;ENSP00000359655:G2623R;ENSP00000359650:G2623R	ENSP00000359650:G2623R	G	-	1	0	EYS	64545889	0.991000	0.36638	0.153000	0.22517	0.003000	0.03518	4.826000	0.62715	1.798000	0.52647	0.655000	0.94253	GGG	EYS	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000188107		0.463	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	62	0.00	0	C	XM_294050		64487930	64487930	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	54	28.00	21	SNP	0.975	T
EPB41L2	2037	genome.wustl.edu	37	6	131184781	131184781	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr6:131184781G>C	ENST00000337057.3	-	18	3088	c.2907C>G	c.(2905-2907)gaC>gaG	p.D969E	EPB41L2_ENST00000527659.1_Missense_Mutation_p.D775E|EPB41L2_ENST00000524581.1_Missense_Mutation_p.D347E|EPB41L2_ENST00000530481.1_Missense_Mutation_p.D816E|EPB41L2_ENST00000528282.1_Missense_Mutation_p.D711E|EPB41L2_ENST00000525271.1_Missense_Mutation_p.D637E|EPB41L2_ENST00000445890.2_Missense_Mutation_p.D711E|EPB41L2_ENST00000368128.2_Missense_Mutation_p.D969E|EPB41L2_ENST00000527411.1_Missense_Mutation_p.D899E|EPB41L2_ENST00000530757.1_Missense_Mutation_p.D165E|EPB41L2_ENST00000525193.1_Missense_Mutation_p.D670E|EPB41L2_ENST00000529208.1_Missense_Mutation_p.D899E|EPB41L2_ENST00000392427.3_Missense_Mutation_p.D637E|EPB41L2_ENST00000531410.1_Missense_Mutation_p.D90E	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	969	C-terminal (CTD).				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TATTTACCTGGTCATGATCAA	0.373																																						dbGAP											0													167.0	137.0	147.0					6																	131184781		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.2907C>G	6.37:g.131184781G>C	ENSP00000338481:p.Asp969Glu		B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.D969E	ENST00000337057.3	37	c.2907	CCDS5141.1	6	.	.	.	.	.	.	.	.	.	.	G	18.73	3.685761	0.68157	.	.	ENSG00000079819	ENST00000531410;ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000530757;ENST00000392427;ENST00000368128;ENST00000527411;ENST00000524581;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208;ENST00000527017	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25	6.0	2.26	0.28386	Band 4.1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81273	0.4788	M	0.81614	2.55	0.38615	D	0.951007	P;P;D;D;D;D	0.89917	0.708;0.766;1.0;0.981;0.999;0.99	P;P;D;D;D;D	0.91635	0.809;0.81;0.999;0.966;0.994;0.946	T	0.80162	-0.1497	10	0.49607	T	0.09	.	8.448	0.32854	0.5308:0.0:0.4692:0.0	.	637;816;969;711;347;136	B4DHI8;E9PPD9;O43491;Q68DV2;Q6R5J7;Q9UG62	.;.;E41L2_HUMAN;.;.;.	E	90;711;816;711;969;165;637;969;899;347;637;670;775;899;233	ENSP00000434596:D90E;ENSP00000434308:D711E;ENSP00000434576:D816E;ENSP00000402041:D711E;ENSP00000338481:D969E;ENSP00000436349:D165E;ENSP00000376222:D637E;ENSP00000357110:D969E;ENSP00000436348:D899E;ENSP00000437207:D347E;ENSP00000432803:D637E;ENSP00000431988:D670E;ENSP00000431647:D775E;ENSP00000436641:D899E;ENSP00000432949:D233E	ENSP00000338481:D969E	D	-	3	2	EPB41L2	131226474	0.996000	0.38824	0.999000	0.59377	0.970000	0.65996	0.387000	0.20718	0.134000	0.18681	0.655000	0.94253	GAC	EPB41L2	-	pirsf_Band_41_protein,pfam_Band_4.1_C	ENSG00000079819		0.373	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3	133	0.00	0	G			131184781	131184781	-1	no_errors	ENST00000337057	ensembl	human	known	69_37n	missense	125	10.64	15	SNP	0.998	C
LOC101929008	101929008	genome.wustl.edu	37	16	90168694	90168695	+	lincRNA	INS	-	-	GCA	rs9922437|rs374192516|rs544421598	byFrequency	TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr16:90168694_90168695insGCA	ENST00000562203.1	-	0	832																											AACTGgcggcggcagcagcagc	0.564																																						dbGAP											0																																										-	-	-			0																															16.37:g.90168701_90168703dupGCA				RNA	INS	-	NULL	ENST00000562203.1	37	NULL		16																																																																																			FAM157C	-	-	ENSG00000260528		0.564	RP11-356C4.3-001	KNOWN	basic	lincRNA	FAM157C	HGNC	lincRNA	OTTHUMT00000420874.1	36	0.00	0	-			90168694	90168695	+1	no_errors	ENST00000563357	ensembl	human	known	69_37n	rna	70	10.26	8	INS	0.004:0.011	GCA
FLRT2	23768	genome.wustl.edu	37	14	86089456	86089456	+	Missense_Mutation	SNP	C	C	T	rs538772019		TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr14:86089456C>T	ENST00000330753.4	+	2	2365	c.1598C>T	c.(1597-1599)aCg>aTg	p.T533M	FLRT2_ENST00000554746.1_Missense_Mutation_p.T533M	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	533					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GAGCAGACGACGTCCCACAGC	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16281	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													98.0	98.0	98.0					14																	86089456		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1598C>T	14.37:g.86089456C>T	ENSP00000332879:p.Thr533Met		A0AV84|B7ZLP3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.T533M	ENST00000330753.4	37	c.1598	CCDS9877.1	14	.	.	.	.	.	.	.	.	.	.	C	12.32	1.903193	0.33628	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.56776	0.44;0.44	6.17	6.17	0.99709	.	0.048749	0.85682	D	0.000000	T	0.45895	0.1365	L	0.38175	1.15	0.45995	D	0.998807	B	0.31318	0.319	B	0.17979	0.02	T	0.34453	-0.9828	10	0.49607	T	0.09	-17.5458	20.8794	0.99867	0.0:1.0:0.0:0.0	.	533	O43155	FLRT2_HUMAN	M	533;533;186	ENSP00000332879:T533M;ENSP00000451050:T533M	ENSP00000332879:T533M	T	+	2	0	FLRT2	85159209	1.000000	0.71417	0.711000	0.30485	0.681000	0.39784	4.852000	0.62904	2.941000	0.99782	0.655000	0.94253	ACG	FLRT2	-	NULL	ENSG00000185070		0.582	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	36	0.00	0	C			86089456	86089456	+1	no_errors	ENST00000330753	ensembl	human	known	69_37n	missense	8	60.00	12	SNP	0.980	T
GALNT2	2590	genome.wustl.edu	37	1	230313974	230313974	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr1:230313974A>G	ENST00000366672.4	+	2	209	c.137A>G	c.(136-138)aAt>aGt	p.N46S	GALNT2_ENST00000543760.1_Missense_Mutation_p.N8S|GALNT2_ENST00000541865.1_Intron	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	46					cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GAGGACTGGAATGAAATTGAC	0.458																																						dbGAP											0													91.0	83.0	86.0					1																	230313974		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.137A>G	1.37:g.230313974A>G	ENSP00000355632:p.Asn46Ser		A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.N46S	ENST00000366672.4	37	c.137	CCDS1582.1	1	.	.	.	.	.	.	.	.	.	.	A	14.04	2.415423	0.42817	.	.	ENSG00000143641	ENST00000543760;ENST00000366672;ENST00000543291	T;T	0.54479	0.57;0.59	5.71	5.71	0.89125	.	0.898900	0.09985	N	0.730491	T	0.43411	0.1246	L	0.40543	1.245	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.18335	-1.0340	10	0.08381	T	0.77	.	12.3675	0.55236	1.0:0.0:0.0:0.0	.	46;8	Q10471;G3V1S6	GALT2_HUMAN;.	S	8;46;46	ENSP00000445017:N8S;ENSP00000355632:N46S	ENSP00000355632:N46S	N	+	2	0	GALNT2	228380597	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.310000	0.65780	2.175000	0.68902	0.482000	0.46254	AAT	GALNT2	-	NULL	ENSG00000143641		0.458	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT2	HGNC	protein_coding	OTTHUMT00000092158.1	78	0.00	0	A	NM_004481		230313974	230313974	+1	no_errors	ENST00000366672	ensembl	human	known	69_37n	missense	51	25.00	17	SNP	1.000	G
GLRA3	8001	genome.wustl.edu	37	4	175598272	175598272	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr4:175598272G>A	ENST00000274093.3	-	7	1386	c.884C>T	c.(883-885)aCg>aTg	p.T295M	GLRA3_ENST00000340217.5_Missense_Mutation_p.T295M	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	295					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.T295M(1)		endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	TGTAGTCATCGTTAGCACAGT	0.458																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											109.0	87.0	95.0					4																	175598272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.884C>T	4.37:g.175598272G>A	ENSP00000274093:p.Thr295Met		D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A3,prints_Glycine_rcpt_A,prints_Neur_channel,tigrfam_Neur_channel	p.T295M	ENST00000274093.3	37	c.884	CCDS3822.1	4	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281191	0.59758	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	D;D	0.87887	-2.31;-2.31	5.17	5.17	0.71159	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94493	0.8227	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.95283	0.8388	10	0.87932	D	0	.	18.7161	0.91677	0.0:0.0:1.0:0.0	.	295;295	O75311-2;O75311	.;GLRA3_HUMAN	M	295	ENSP00000274093:T295M;ENSP00000345284:T295M	ENSP00000274093:T295M	T	-	2	0	GLRA3	175834847	1.000000	0.71417	0.901000	0.35422	0.012000	0.07955	9.714000	0.98744	2.415000	0.81967	0.650000	0.86243	ACG	GLRA3	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000145451		0.458	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	GLRA3	HGNC	protein_coding	OTTHUMT00000313427.1	57	0.00	0	G			175598272	175598272	-1	no_errors	ENST00000274093	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	1.000	A
GUCY2C	2984	genome.wustl.edu	37	12	14798208	14798208	+	Silent	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr12:14798208G>A	ENST00000261170.3	-	16	1888	c.1752C>T	c.(1750-1752)ttC>ttT	p.F584F		NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	584	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CCCAATCCATGAATGTGCCAT	0.333																																						dbGAP											0													117.0	117.0	117.0					12																	14798208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1752C>T	12.37:g.14798208G>A			B2RMY6	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.F584	ENST00000261170.3	37	c.1752	CCDS8664.1	12																																																																																			GUCY2C	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000070019		0.333	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	HGNC	protein_coding	OTTHUMT00000400835.1	99	0.00	0	G			14798208	14798208	-1	no_errors	ENST00000261170	ensembl	human	known	69_37n	silent	49	28.99	20	SNP	1.000	A
HDGFRP3	50810	genome.wustl.edu	37	15	83826259	83826259	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr15:83826259C>T	ENST00000299633.4	-	4	970	c.367G>A	c.(367-369)Gag>Aag	p.E123K		NM_016073.3	NP_057157.1	Q9Y3E1	HDGR3_HUMAN		123					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						CCTTCTTCCTCACTGCTTGCA	0.363																																						dbGAP											0													137.0	115.0	123.0					15																	83826259		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000299633.4:c.367G>A	15.37:g.83826259C>T	ENSP00000299633:p.Glu123Lys			Missense_Mutation	SNP	pfam_PWWP,smart_PWWP,pfscan_PWWP	p.E123K	ENST00000299633.4	37	c.367	CCDS32314.1	15	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689623	0.88735	.	.	ENSG00000166503	ENST00000299633	T	0.72282	-0.64	5.35	5.35	0.76521	.	0.156989	0.56097	D	0.000036	T	0.63224	0.2493	L	0.38838	1.175	0.41351	D	0.987363	B	0.19331	0.035	B	0.12837	0.008	T	0.57236	-0.7846	10	0.23302	T	0.38	.	19.4352	0.94788	0.0:1.0:0.0:0.0	.	123	Q9Y3E1	HDGR3_HUMAN	K	123	ENSP00000299633:E123K	ENSP00000299633:E123K	E	-	1	0	AC024270.1	81617263	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.345000	0.65987	2.668000	0.90789	0.655000	0.94253	GAG	RP11-382A20.3	-	NULL	ENSG00000166503		0.363	HDGFRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDGFRP3	Clone_based_vega_gene	protein_coding	OTTHUMT00000419898.1	172	0.00	0	C			83826259	83826259	-1	no_errors	ENST00000299633	ensembl	human	known	69_37n	missense	136	29.17	56	SNP	1.000	T
HMOX1	3162	genome.wustl.edu	37	22	35789489	35789489	+	Silent	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr22:35789489G>A	ENST00000216117.8	+	5	1104	c.765G>A	c.(763-765)ggG>ggA	p.G255G		NM_002133.2	NP_002124.1	P09601	HMOX1_HUMAN	heme oxygenase (decycling) 1	255					angiogenesis (GO:0001525)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to cadmium ion (GO:0071276)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient (GO:0031670)|endothelial cell proliferation (GO:0001935)|erythrocyte homeostasis (GO:0034101)|excretion (GO:0007588)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|iron ion homeostasis (GO:0055072)|low-density lipoprotein particle clearance (GO:0034383)|negative regulation of DNA binding (GO:0043392)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|protein homooligomerization (GO:0051260)|regulation of angiogenesis (GO:0045765)|regulation of blood pressure (GO:0008217)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to estrogen (GO:0043627)|response to hydrogen peroxide (GO:0042542)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|smooth muscle hyperplasia (GO:0014806)|transmembrane transport (GO:0055085)|wound healing involved in inflammatory response (GO:0002246)	caveola (GO:0005901)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)|phospholipase D activity (GO:0004630)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16					Vitamin E(DB00163)	CTCCCAGAGGGAAGCCCCCAC	0.557																																						dbGAP											0													155.0	168.0	164.0					22																	35789489		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13914.1	22q12	2003-10-13			ENSG00000100292	ENSG00000100292	1.14.99.3		5013	protein-coding gene	gene with protein product		141250				10591208	Standard	NM_002133		Approved	bK286B10, HO-1	uc003ant.2	P09601	OTTHUMG00000150960	ENST00000216117.8:c.765G>A	22.37:g.35789489G>A				Silent	SNP	pfam_Haem_Oase-like,superfamily_Haem_Oase-like_multi-hlx,pirsf_Haem_Oase,prints_Haem_Oase	p.G255	ENST00000216117.8	37	c.765	CCDS13914.1	22																																																																																			HMOX1	-	superfamily_Haem_Oase-like_multi-hlx,pirsf_Haem_Oase	ENSG00000100292		0.557	HMOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMOX1	HGNC	protein_coding	OTTHUMT00000320657.1	81	0.00	0	G			35789489	35789489	+1	no_errors	ENST00000216117	ensembl	human	known	69_37n	silent	44	37.84	28	SNP	0.000	A
ITGAX	3687	genome.wustl.edu	37	16	31391361	31391361	+	Missense_Mutation	SNP	C	C	T	rs181404376	byFrequency	TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr16:31391361C>T	ENST00000268296.4	+	26	3156	c.3035C>T	c.(3034-3036)gCg>gTg	p.A1012V	ITGAX_ENST00000562522.1_Missense_Mutation_p.A1012V	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	1012			A -> V (in dbSNP:rs181404376). {ECO:0000269|PubMed:21763482}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						GACTTCCTGGCGCACATTCAG	0.552													C|||	5	0.000998403	0.0	0.0058	5008	,	,		18624	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													46.0	45.0	46.0					16																	31391361		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.3035C>T	16.37:g.31391361C>T	ENSP00000268296:p.Ala1012Val		Q8IVA6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.A1012V	ENST00000268296.4	37	c.3035	CCDS10711.1	16	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	9.567	1.119951	0.20877	.	.	ENSG00000140678	ENST00000268296	T	0.45276	0.9	4.3	2.27	0.28462	Integrin alpha-2 (1);	.	.	.	.	T	0.28599	0.0708	L	0.34521	1.04	0.09310	N	1	B;B	0.17465	0.022;0.022	B;B	0.06405	0.001;0.002	T	0.18304	-1.0341	9	0.36615	T	0.2	.	6.0046	0.19539	0.0:0.7026:0.1918:0.1056	.	1012;197	P20702;Q8TES5	ITAX_HUMAN;.	V	1012	ENSP00000268296:A1012V	ENSP00000268296:A1012V	A	+	2	0	ITGAX	31298862	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.185000	0.16958	0.522000	0.28464	-0.657000	0.03884	GCG	ITGAX	-	pfam_Integrin_alpha-2	ENSG00000140678		0.552	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	30	0.00	0	C	NM_000887		31391361	31391361	+1	no_errors	ENST00000268296	ensembl	human	known	69_37n	missense	26	32.50	13	SNP	0.002	T
KCNH1	3756	genome.wustl.edu	37	1	210948878	210948878	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr1:210948878C>T	ENST00000271751.4	-	10	1951	c.1924G>A	c.(1924-1926)Gac>Aac	p.D642N	KCNH1_ENST00000367007.4_Missense_Mutation_p.D615N			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	642					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CCAAACACGTCTCCTTTTCCT	0.527																																						dbGAP											0													123.0	96.0	105.0					1																	210948878		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1924G>A	1.37:g.210948878C>T	ENSP00000271751:p.Asp642Asn		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.D642N	ENST00000271751.4	37	c.1924	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643063	0.87859	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.97303	-4.33;-4.33	5.47	5.47	0.80525	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.043526	0.85682	D	0.000000	D	0.98485	0.9495	M	0.88031	2.925	0.80722	D	1	P;P	0.46512	0.879;0.879	P;P	0.57548	0.753;0.823	D	0.99429	1.0935	10	0.87932	D	0	.	19.3371	0.94324	0.0:1.0:0.0:0.0	.	615;642	Q14CL3;O95259	.;KCNH1_HUMAN	N	642;615	ENSP00000271751:D642N;ENSP00000355974:D615N	ENSP00000271751:D642N	D	-	1	0	KCNH1	209015501	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.743000	0.68655	2.567000	0.86603	0.561000	0.74099	GAC	KCNH1	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom	ENSG00000143473		0.527	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	59	0.00	0	C	NM_002238		210948878	210948878	-1	no_errors	ENST00000271751	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	1.000	T
KCNH5	27133	genome.wustl.edu	37	14	63174294	63174294	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr14:63174294A>G	ENST00000322893.7	-	11	3167	c.2899T>C	c.(2899-2901)Tgt>Cgt	p.C967R	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	967					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		ATATCCTGACATGGTATCTGG	0.378																																						dbGAP											0													106.0	121.0	116.0					14																	63174294		2203	4300	6503	-	-	-	SO:0001583	missense	0			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2899T>C	14.37:g.63174294A>G	ENSP00000321427:p.Cys967Arg		C9JP98	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.C967R	ENST00000322893.7	37	c.2899	CCDS9756.1	14	.	.	.	.	.	.	.	.	.	.	A	9.473	1.096241	0.20552	.	.	ENSG00000140015	ENST00000322893	D	0.98876	-5.2	5.4	4.26	0.50523	.	0.159072	0.64402	D	0.000019	D	0.94387	0.8195	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.91632	0.5319	10	0.14656	T	0.56	.	10.9481	0.47312	0.9265:0.0:0.0735:0.0	.	967	Q8NCM2	KCNH5_HUMAN	R	967	ENSP00000321427:C967R	ENSP00000321427:C967R	C	-	1	0	KCNH5	62244047	0.995000	0.38212	0.991000	0.47740	0.992000	0.81027	3.324000	0.52022	2.178000	0.69098	0.448000	0.29417	TGT	KCNH5	-	NULL	ENSG00000140015		0.378	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1	79	0.00	0	A	NM_139318		63174294	63174294	-1	no_errors	ENST00000322893	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	0.800	G
KCNK16	83795	genome.wustl.edu	37	6	39284658	39284658	+	Silent	SNP	T	T	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr6:39284658T>G	ENST00000373229.5	-	4	574	c.561A>C	c.(559-561)ccA>ccC	p.P187P	KCNK16_ENST00000425054.2_Silent_p.P187P|KCNK16_ENST00000507712.1_Silent_p.P122P|KCNK16_ENST00000437525.2_Silent_p.P187P|KCNK16_ENST00000373227.4_Silent_p.P187P|KCNK17_ENST00000373231.4_5'Flank|KCNK17_ENST00000453413.2_5'Flank	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	187					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						AGACCATGGGTGGGAAGATGA	0.562																																						dbGAP											0													112.0	111.0	112.0					6																	39284658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.561A>C	6.37:g.39284658T>G			B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Silent	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl	p.P187	ENST00000373229.5	37	c.561	CCDS4843.1	6																																																																																			KCNK16	-	pfam_Ion_trans_2	ENSG00000095981		0.562	KCNK16-001	KNOWN	basic|CCDS	protein_coding	KCNK16	HGNC	protein_coding	OTTHUMT00000040452.2	38	0.00	0	T	NM_032115		39284658	39284658	-1	no_errors	ENST00000425054	ensembl	human	known	69_37n	silent	38	13.33	6	SNP	0.495	G
KIAA1468	57614	genome.wustl.edu	37	18	59895751	59895751	+	Silent	SNP	A	A	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr18:59895751A>T	ENST00000398130.2	+	8	1600	c.1368A>T	c.(1366-1368)tcA>tcT	p.S456S	KIAA1468_ENST00000256858.6_Silent_p.S456S|KIAA1468_ENST00000592479.1_3'UTR	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	456										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				CCCCAAATTCATTCCCCAGGA	0.358																																						dbGAP											0													71.0	67.0	68.0					18																	59895751		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.1368A>T	18.37:g.59895751A>T				Silent	SNP	pfam_HEAT,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_HEAT_type_2,pfscan_LisH_dimerisation	p.S456	ENST00000398130.2	37	c.1368	CCDS11979.2	18																																																																																			KIAA1468	-	NULL	ENSG00000134444		0.358	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1468	HGNC	protein_coding	OTTHUMT00000256187.1	74	0.00	0	A	NM_020854		59895751	59895751	+1	no_errors	ENST00000256858	ensembl	human	known	69_37n	silent	57	26.92	21	SNP	0.533	T
LAS1L	81887	genome.wustl.edu	37	X	64754390	64754390	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chrX:64754390G>A	ENST00000374811.3	-	1	246	c.206C>T	c.(205-207)gCg>gTg	p.A69V	LAS1L_ENST00000312391.8_Missense_Mutation_p.A69V|LAS1L_ENST00000374804.5_Missense_Mutation_p.A69V|LAS1L_ENST00000374807.5_Missense_Mutation_p.A69V	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	69					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						GCGGTTAAGCGCGTACCGCTG	0.612																																						dbGAP											0													83.0	51.0	62.0					X																	64754390		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.206C>T	X.37:g.64754390G>A	ENSP00000363944:p.Ala69Val		A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Missense_Mutation	SNP	pfam_Las1	p.A69V	ENST00000374811.3	37	c.206	CCDS14381.1	X	.	.	.	.	.	.	.	.	.	.	g	31	5.090017	0.94149	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804;ENST00000312391	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.79741	0.4498	M	0.80616	2.505	0.42068	D	0.99119	D;D;P	0.89917	1.0;1.0;0.881	D;D;P	0.97110	0.998;1.0;0.819	T	0.83048	-0.0154	9	0.87932	D	0	.	14.7844	0.69790	0.0:0.0:1.0:0.0	.	69;69;69	Q9Y4W2-3;Q9Y4W2-2;Q9Y4W2	.;.;LAS1L_HUMAN	V	69	.	ENSP00000308649:A69V	A	-	2	0	LAS1L	64671115	1.000000	0.71417	0.966000	0.40874	0.935000	0.57460	6.451000	0.73481	2.370000	0.80446	0.597000	0.82753	GCG	LAS1L	-	pfam_Las1	ENSG00000001497		0.612	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAS1L	HGNC	protein_coding	OTTHUMT00000056974.1	32	0.00	0	G	NM_031206		64754390	64754390	-1	no_errors	ENST00000374811	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.998	A
GNB3	2784	genome.wustl.edu	37	12	6948564	6948564	+	5'Flank	SNP	G	G	A	rs376420128		TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr12:6948564G>A	ENST00000229264.3	+	0	0				GNB3_ENST00000435982.2_5'Flank|LEPREL2_ENST00000538102.1_RNA|LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA	NM_002075.2	NP_002066.1	P16520	GBB3_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 3						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|stomach(1)	20						CCCCCTAGCCGCAGGCACCAG	0.587																																						dbGAP											0													23.0	29.0	27.0					12																	6948564		1962	4042	6004	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS8564.1, CCDS73427.1	12p13	2013-01-10			ENSG00000111664	ENSG00000111664		"""WD repeat domain containing"""	4400	protein-coding gene	gene with protein product		139130				11770079, 16600389	Standard	XM_005253680		Approved		uc001qrd.3	P16520	OTTHUMG00000168517		12.37:g.6948564G>A	Exception_encountered		Q96B71|Q9BQC0	Missense_Mutation	SNP	smart_Pro_4_hyd_alph	p.R716H	ENST00000229264.3	37	c.2147	CCDS8564.1	12	.	.	.	.	.	.	.	.	.	.	g	3.856	-0.030870	0.07543	.	.	ENSG00000110811	ENST00000451242;ENST00000396725;ENST00000290510	T;T	0.35048	1.33;1.75	4.47	-8.94	0.00768	.	1.145380	0.06409	N	0.720228	T	0.15132	0.0365	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14615	-1.0466	9	0.23302	T	0.38	-30.178	3.5387	0.07803	0.5151:0.2397:0.1485:0.0967	.	717	Q8IVL6	P3H3_HUMAN	H	144;716;532	ENSP00000379951:R716H;ENSP00000290510:R532H	ENSP00000290510:R532H	R	+	2	0	LEPREL2	6818825	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.804000	0.04535	-1.769000	0.01297	-1.438000	0.01074	CGC	LEPREL2	-	NULL	ENSG00000110811		0.587	GNB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPREL2	HGNC	protein_coding	OTTHUMT00000400006.1	41	0.00	0	G	NM_002075		6948564	6948564	+1	no_errors	ENST00000396725	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	0.001	A
LZTS2	84445	genome.wustl.edu	37	10	102763412	102763412	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr10:102763412C>T	ENST00000370220.1	+	2	3620	c.557C>T	c.(556-558)cCt>cTt	p.P186L	LZTS2_ENST00000370223.3_Missense_Mutation_p.P186L					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TTTGGGGGCCCTGcctcctcc	0.657																																					Esophageal Squamous(8;38 437 13604 19902 37640)	dbGAP											0													83.0	96.0	91.0					10																	102763412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.557C>T	10.37:g.102763412C>T	ENSP00000359240:p.Pro186Leu			Missense_Mutation	SNP	pfam_Fez1	p.P186L	ENST00000370220.1	37	c.557	CCDS7507.1	10	.	.	.	.	.	.	.	.	.	.	C	17.56	3.421205	0.62622	.	.	ENSG00000107816	ENST00000426584;ENST00000370223;ENST00000429732;ENST00000315797;ENST00000370220;ENST00000454422	T;T	0.31247	1.5;1.5	5.27	5.27	0.74061	.	0.166280	0.53938	D	0.000048	T	0.25938	0.0632	L	0.34521	1.04	0.46185	D	0.998911	B	0.11235	0.004	B	0.06405	0.002	T	0.05869	-1.0859	10	0.16420	T	0.52	-4.7468	18.8452	0.92203	0.0:1.0:0.0:0.0	.	186	Q9BRK4	LZTS2_HUMAN	L	186	ENSP00000359243:P186L;ENSP00000359240:P186L	ENSP00000314437:P186L	P	+	2	0	LZTS2	102753402	0.982000	0.34865	1.000000	0.80357	0.969000	0.65631	2.639000	0.46570	2.619000	0.88677	0.561000	0.74099	CCT	LZTS2	-	NULL	ENSG00000107816		0.657	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LZTS2	HGNC	protein_coding	OTTHUMT00000049872.1	25	0.00	0	C	XM_046743		102763412	102763412	+1	no_errors	ENST00000370220	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	1.000	T
MCMDC2	157777	genome.wustl.edu	37	8	67796162	67796162	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr8:67796162C>G	ENST00000422365.2	+	9	1177	c.1006C>G	c.(1006-1008)Cgt>Ggt	p.R336G	MCMDC2_ENST00000492775.1_Missense_Mutation_p.R336G|MCMDC2_ENST00000313616.5_Missense_Mutation_p.R336G|MCMDC2_ENST00000396592.3_Missense_Mutation_p.R336G|MCMDC2_ENST00000541540.1_Missense_Mutation_p.R273G	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	336					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						GACAACTGACCGTAACAAGGA	0.353																																						dbGAP											0													70.0	67.0	68.0					8																	67796162		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.1006C>G	8.37:g.67796162C>G	ENSP00000413632:p.Arg336Gly		B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase	p.R336G	ENST00000422365.2	37	c.1006	CCDS6197.2	8	.	.	.	.	.	.	.	.	.	.	C	10.10	1.257390	0.22965	.	.	ENSG00000178460	ENST00000379356;ENST00000396592;ENST00000422365;ENST00000492775;ENST00000313616;ENST00000541540	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	5.57	-2.4	0.06583	.	0.908483	0.09739	N	0.762066	T	0.19604	0.0471	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.20368	0.044;0.026;0.026;0.044	B;B;B;B	0.23852	0.049;0.016;0.016;0.036	T	0.28427	-1.0044	10	0.51188	T	0.08	-0.0182	1.9374	0.03340	0.1618:0.2313:0.1187:0.4881	.	273;336;336;336	Q4G0Z9-4;Q4G0Z9;B4DXX4;G3XAN3	.;CH045_HUMAN;.;.	G	208;336;336;336;336;273	ENSP00000379837:R336G;ENSP00000413632:R336G;ENSP00000428037:R336G;ENSP00000317234:R336G;ENSP00000445629:R273G	ENSP00000317234:R336G	R	+	1	0	C8orf45	67958716	0.000000	0.05858	0.065000	0.19835	0.850000	0.48378	-0.095000	0.11077	-0.193000	0.10415	-0.136000	0.14681	CGT	MCMDC2	-	smart_MCM_DNA-dep_ATPase	ENSG00000178460		0.353	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCMDC2	HGNC	protein_coding	OTTHUMT00000347350.1	46	0.00	0	C	NM_173518		67796162	67796162	+1	no_errors	ENST00000422365	ensembl	human	known	69_37n	missense	37	28.85	15	SNP	0.000	G
MED12L	116931	genome.wustl.edu	37	3	151134206	151134206	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr3:151134206C>T	ENST00000474524.1	+	41	6337	c.6299C>T	c.(6298-6300)cCc>cTc	p.P2100L	MED12L_ENST00000273432.4_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2100	Gln-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCCCAGCAGCCCTTGGTAAGG	0.537																																						dbGAP											0													49.0	51.0	50.0					3																	151134206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6299C>T	3.37:g.151134206C>T	ENSP00000417235:p.Pro2100Leu		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.P2100L	ENST00000474524.1	37	c.6299	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912233	0.52439	.	.	ENSG00000144893	ENST00000474524	T	0.57752	0.38	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.36717	0.0977	N	0.14661	0.345	0.80722	D	1	B	0.27823	0.19	B	0.23018	0.043	T	0.21965	-1.0230	10	0.41790	T	0.15	-16.597	16.1582	0.81680	0.0:1.0:0.0:0.0	.	2100	Q86YW9	MD12L_HUMAN	L	2100	ENSP00000417235:P2100L	ENSP00000417235:P2100L	P	+	2	0	MED12L	152616896	0.999000	0.42202	1.000000	0.80357	0.854000	0.48673	4.423000	0.59861	2.563000	0.86464	0.591000	0.81541	CCC	MED12L	-	NULL	ENSG00000144893		0.537	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	39	0.00	0	C	NM_053002		151134206	151134206	+1	no_errors	ENST00000474524	ensembl	human	known	69_37n	missense	19	45.71	16	SNP	1.000	T
NOXO1	124056	genome.wustl.edu	37	16	2029885	2029885	+	Silent	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr16:2029885G>A	ENST00000397280.4	-	6	624	c.621C>T	c.(619-621)aaC>aaT	p.N207N	NOXO1_ENST00000566005.1_Silent_p.N206N|AC005606.1_ENST00000598236.1_5'Flank|NOXO1_ENST00000356120.4_Silent_p.N202N|TBL3_ENST00000568546.1_3'UTR|NOXO1_ENST00000354249.4_Silent_p.N201N			Q8NFA2	NOXO1_HUMAN	NADPH oxidase organizer 1	207	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				extracellular matrix disassembly (GO:0022617)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|superoxide metabolic process (GO:0006801)	NADPH oxidase complex (GO:0043020)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|phospholipid binding (GO:0005543)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			lung(2)	2					Ecabet(DB05265)	GCCGGTCTTCGTTCTCCACCA	0.672																																					Pancreas(104;2811 2841 4129)|Esophageal Squamous(25;910 1225 43728)	dbGAP											0													9.0	14.0	13.0					16																	2029885		2132	4260	6392	-	-	-	SO:0001819	synonymous_variant	0			AF532985	CCDS10454.1, CCDS10455.1, CCDS42101.1, CCDS58406.1	16p13.3	2008-02-05			ENSG00000196408	ENSG00000196408			19404	protein-coding gene	gene with protein product		611256					Standard	NM_144603		Approved	P41NOXA, P41NOXB, P41NOXC, SH3PXD5, SNX28	uc002cnx.4	Q8NFA2	OTTHUMG00000128707	ENST00000397280.4:c.621C>T	16.37:g.2029885G>A			Q86YM1|Q8NFA3|Q96B73	Silent	SNP	pfam_SH3_domain,pfam_Phox,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.N207	ENST00000397280.4	37	c.621	CCDS42101.1	16																																																																																			NOXO1	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000196408		0.672	NOXO1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOXO1	HGNC	protein_coding	OTTHUMT00000250612.1	16	0.00	0	G			2029885	2029885	-1	no_errors	ENST00000397280	ensembl	human	known	69_37n	silent	12	36.84	7	SNP	0.955	A
NR2C1	7181	genome.wustl.edu	37	12	95445620	95445620	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr12:95445620T>G	ENST00000333003.5	-	8	1213	c.883A>C	c.(883-885)Atg>Ctg	p.M295L	NR2C1_ENST00000330677.7_Missense_Mutation_p.M295L|NR2C1_ENST00000393101.3_Missense_Mutation_p.M295L|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	295					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						ATCATAGACATTTCATTACTA	0.348																																						dbGAP											0													105.0	96.0	99.0					12																	95445620		2203	4297	6500	-	-	-	SO:0001583	missense	0			M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.883A>C	12.37:g.95445620T>G	ENSP00000333275:p.Met295Leu		A8K5K4|Q15625|Q15626	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.M295L	ENST00000333003.5	37	c.883	CCDS9051.1	12	.	.	.	.	.	.	.	.	.	.	T	3.263	-0.150732	0.06585	.	.	ENSG00000120798	ENST00000333003;ENST00000393101;ENST00000330677	T;T;T	0.47869	0.83;0.83;0.83	5.45	-4.72	0.03269	Nuclear hormone receptor, ligand-binding (1);	0.331730	0.36893	N	0.002358	T	0.14013	0.0339	N	0.01410	-0.885	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.30707	-0.9969	10	0.19590	T	0.45	.	9.5632	0.39383	0.0:0.2533:0.5296:0.217	.	295;295;295;295	B6ZGT7;P13056-3;P13056-2;P13056	.;.;.;NR2C1_HUMAN	L	295	ENSP00000333275:M295L;ENSP00000376813:M295L;ENSP00000328843:M295L	ENSP00000328843:M295L	M	-	1	0	NR2C1	93969751	0.007000	0.16637	0.019000	0.16419	0.756000	0.42949	0.250000	0.18235	-0.650000	0.05423	0.533000	0.62120	ATG	NR2C1	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000120798		0.348	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	HGNC	protein_coding	OTTHUMT00000407565.2	87	0.00	0	T	NM_003297		95445620	95445620	-1	no_errors	ENST00000333003	ensembl	human	known	69_37n	missense	61	27.38	23	SNP	0.115	G
NUP210	23225	genome.wustl.edu	37	3	13364872	13364872	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr3:13364872A>C	ENST00000254508.5	-	34	4787	c.4705T>G	c.(4705-4707)Ttc>Gtc	p.F1569V		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1569					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GCCTCCTGGAAGCTGGTCTGG	0.582																																						dbGAP											0													123.0	122.0	122.0					3																	13364872		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4705T>G	3.37:g.13364872A>C	ENSP00000254508:p.Phe1569Val		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.F1569V	ENST00000254508.5	37	c.4705	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	A	1.702	-0.501372	0.04261	.	.	ENSG00000132182	ENST00000254508	T	0.04234	3.67	5.54	4.36	0.52297	.	0.608827	0.17788	N	0.161970	T	0.04092	0.0114	L	0.39898	1.24	0.21841	N	0.999516	B	0.06786	0.001	B	0.04013	0.001	T	0.46148	-0.9212	10	0.02654	T	1	-15.8184	9.6039	0.39622	0.8389:0.0:0.0:0.1611	.	1569	Q8TEM1	PO210_HUMAN	V	1569	ENSP00000254508:F1569V	ENSP00000254508:F1569V	F	-	1	0	NUP210	13339872	0.920000	0.31207	0.483000	0.27378	0.639000	0.38242	1.459000	0.35234	0.879000	0.35944	0.533000	0.62120	TTC	NUP210	-	NULL	ENSG00000132182		0.582	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	HGNC	protein_coding	OTTHUMT00000340085.1	63	0.00	0	A	NM_024923		13364872	13364872	-1	no_errors	ENST00000254508	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	0.609	C
OR11G2	390439	genome.wustl.edu	37	14	20666089	20666089	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr14:20666089G>A	ENST00000357366.3	+	1	595	c.595G>A	c.(595-597)Gtc>Atc	p.V199I		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V199I(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		GATTCCTATCGTCAACATCTC	0.458																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											117.0	100.0	106.0					14																	20666089		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.595G>A	14.37:g.20666089G>A	ENSP00000349930:p.Val199Ile		Q6IF09|Q96R33	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V199I	ENST00000357366.3	37	c.595	CCDS32032.1	14	.	.	.	.	.	.	.	.	.	.	g	0.001	-2.889112	0.00060	.	.	ENSG00000196832	ENST00000357366	T	0.37058	1.22	4.93	1.09	0.20402	GPCR, rhodopsin-like superfamily (1);	0.648115	0.13478	N	0.384946	T	0.15176	0.0366	N	0.13168	0.305	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.30909	-0.9962	10	0.07030	T	0.85	.	3.9912	0.09538	0.6032:0.0:0.2511:0.1457	.	199	Q8NGC1	O11G2_HUMAN	I	199	ENSP00000349930:V199I	ENSP00000349930:V199I	V	+	1	0	OR11G2	19735929	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.008000	0.03663	0.064000	0.16427	-0.300000	0.09419	GTC	OR11G2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196832		0.458	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR11G2	HGNC	protein_coding	OTTHUMT00000395722.1	121	0.00	0	G			20666089	20666089	+1	no_errors	ENST00000357366	ensembl	human	known	69_37n	missense	84	19.81	21	SNP	0.000	A
PKLR	5313	genome.wustl.edu	37	1	155261573	155261573	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr1:155261573C>T	ENST00000342741.4	-	10	1630	c.1592G>A	c.(1591-1593)cGc>cAc	p.R531H	PKLR_ENST00000392414.3_Missense_Mutation_p.R500H	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	531			R -> C (in PKRD).		ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TTGCACCCGGCGATCTACATC	0.572																																						dbGAP											0													93.0	94.0	93.0					1																	155261573		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.1592G>A	1.37:g.155261573C>T	ENSP00000339933:p.Arg531His		O75758|P11973	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.R531H	ENST00000342741.4	37	c.1592	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657577	0.47467	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99051	-5.37;-5.37	4.85	3.94	0.45596	Pyruvate kinase, C-terminal (2);Pyruvate kinase, alpha/beta (1);	0.224862	0.45126	D	0.000394	D	0.95705	0.8603	L	0.46567	1.45	0.37432	D	0.914053	B;B	0.15473	0.005;0.013	B;B	0.06405	0.002;0.002	D	0.94900	0.8055	10	0.46703	T	0.11	-13.6029	11.3713	0.49702	0.0:0.9112:0.0:0.0888	.	531;522	P30613;B1AVT1	KPYR_HUMAN;.	H	556;500;531;445	ENSP00000376214:R500H;ENSP00000339933:R531H	ENSP00000271946:R445H	R	-	2	0	PKLR	153528197	0.870000	0.30015	1.000000	0.80357	0.988000	0.76386	0.941000	0.29005	1.400000	0.46741	0.563000	0.77884	CGC	PKLR	-	pfam_Pyrv_Knase_C,superfamily_Pyrv_Knase_C,tigrfam_Pyr_Knase	ENSG00000143627		0.572	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	42	0.00	0	C	NM_000298		155261573	155261573	-1	no_errors	ENST00000342741	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	0.999	T
PRICKLE3	4007	genome.wustl.edu	37	X	49034759	49034759	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chrX:49034759G>T	ENST00000376317.3	-	6	724	c.630C>A	c.(628-630)tgC>tgA	p.C210*	PRICKLE3_ENST00000538114.1_Nonsense_Mutation_p.C197*|PRICKLE3_ENST00000540849.1_Nonsense_Mutation_p.C142*|PRICKLE3_ENST00000536904.1_Nonsense_Mutation_p.C129*	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	210	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						GTGGGTGCCAGCAGGCACCCA	0.572																																						dbGAP											0													70.0	50.0	57.0					X																	49034759		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.630C>A	X.37:g.49034759G>T	ENSP00000365494:p.Cys210*		B7Z8F2|O76007|Q53XR5	Nonsense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.C210*	ENST00000376317.3	37	c.630	CCDS14320.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.93|19.93	3.917605|3.917605	0.73098|0.73098	.|.	.|.	ENSG00000012211|ENSG00000012211	ENST00000376317;ENST00000536904;ENST00000540849;ENST00000538114|ENST00000453382;ENST00000432913	.|.	.|.	.|.	5.14|5.14	0.975|0.975	0.19721|0.19721	.|.	0.179412|.	0.27384|.	N|.	0.019614|.	.|T	.|0.43166	.|0.1235	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.51108	.|-0.8747	.|3	0.02654|.	T|.	1|.	-0.0242|-0.0242	8.8249|8.8249	0.35050|0.35050	0.4259:0.0:0.5741:0.0|0.4259:0.0:0.5741:0.0	.|.	.|.	.|.	.|.	X|M	210;129;142;197|223;221	.|.	ENSP00000365494:C210X|.	C|L	-|-	3|1	2|2	PRICKLE3|PRICKLE3	48921703|48921703	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.788000|0.788000	0.44548|0.44548	0.811000|0.811000	0.27198|0.27198	0.125000|0.125000	0.18397|0.18397	0.511000|0.511000	0.50034|0.50034	TGC|CTG	PRICKLE3	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000012211		0.572	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRICKLE3	HGNC	protein_coding	OTTHUMT00000060811.1	55	0.00	0	G	NM_006150		49034759	49034759	-1	no_errors	ENST00000376317	ensembl	human	known	69_37n	nonsense	39	31.03	18	SNP	1.000	T
PRKAR1A	5573	genome.wustl.edu	37	17	66511664	66511664	+	Nonsense_Mutation	SNP	C	C	T	rs281864782		TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr17:66511664C>T	ENST00000589228.1	+	2	252	c.124C>T	c.(124-126)Cga>Tga	p.R42*	PRKAR1A_ENST00000586397.1_Nonsense_Mutation_p.R42*|PRKAR1A_ENST00000358598.2_Nonsense_Mutation_p.R42*|PRKAR1A_ENST00000536854.2_Nonsense_Mutation_p.R42*|PRKAR1A_ENST00000588188.2_Nonsense_Mutation_p.R42*|PRKAR1A_ENST00000392711.1_Nonsense_Mutation_p.R42*	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	42	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					GTGCACTGCTCGACCTGAGAG	0.473			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												Ovarian(167;637 1670 33025 39608 46699 51856)	dbGAP	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	0			GRCh37	CM003047	PRKAR1A	M							76.0	64.0	68.0					17																	66511664		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.124C>T	17.37:g.66511664C>T	ENSP00000464977:p.Arg42*		K7ER48|Q567S7	Nonsense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cNMP-bd-like,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	p.R42*	ENST00000589228.1	37	c.124	CCDS11678.1	17	.	.	.	.	.	.	.	.	.	.	C	37	5.979786	0.97168	.	.	ENSG00000108946	ENST00000358598;ENST00000392711;ENST00000392710;ENST00000536854	.	.	.	5.11	4.11	0.48088	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-16.8484	12.7152	0.57111	0.427:0.573:0.0:0.0	.	.	.	.	X	42	.	ENSP00000351410:R42X	R	+	1	2	PRKAR1A	64023259	0.796000	0.28864	0.027000	0.17364	0.877000	0.50540	1.573000	0.36472	1.094000	0.41399	0.655000	0.94253	CGA	PRKAR1A	-	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,pirsf_cAMP_dep_PK_reg_su	ENSG00000108946		0.473	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAR1A	HGNC	protein_coding	OTTHUMT00000449884.1	63	0.00	0	C			66511664	66511664	+1	no_errors	ENST00000358598	ensembl	human	known	69_37n	nonsense	61	28.24	24	SNP	0.544	T
PRKCQ	5588	genome.wustl.edu	37	10	6520982	6520982	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr10:6520982G>A	ENST00000263125.5	-	12	1424	c.1325C>T	c.(1324-1326)aCg>aTg	p.T442M	PRKCQ_ENST00000397176.2_Missense_Mutation_p.T442M|PRKCQ_ENST00000539722.1_Missense_Mutation_p.T317M	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	442	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	AAACATGTGCGTCAGAAACGG	0.498																																					Ovarian(50;572 1126 10530 25349 30594)	dbGAP											0													229.0	192.0	205.0					10																	6520982		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1325C>T	10.37:g.6520982G>A	ENSP00000263125:p.Thr442Met		B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.T442M	ENST00000263125.5	37	c.1325	CCDS7079.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.54|15.54	2.864771|2.864771	0.51482|0.51482	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|T;T;T	.|0.65364	.|-0.15;-0.15;-0.15	4.76|4.76	3.86|3.86	0.44501|0.44501	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.047773	.|0.85682	.|D	.|0.000000	T|T	0.64757|0.64757	0.2627|0.2627	N|N	0.17248|0.17248	0.465|0.465	0.54753|0.54753	D|D	0.999985|0.999985	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.83275	.|0.996;0.994;0.996;0.985	T|T	0.69606|0.69606	-0.5100|-0.5100	5|10	.|0.87932	.|D	.|0	.|.	12.8711|12.8711	0.57965|0.57965	0.0804:0.0:0.9196:0.0|0.0804:0.0:0.9196:0.0	.|.	.|317;214;442;442	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	C|M	215|442;442;317	.|ENSP00000263125:T442M;ENSP00000380361:T442M;ENSP00000441752:T317M	.|ENSP00000263125:T442M	R|T	-|-	1|2	0|0	PRKCQ|PRKCQ	6560988|6560988	1.000000|1.000000	0.71417|0.71417	0.467000|0.467000	0.27180|0.27180	0.311000|0.311000	0.27955|0.27955	9.671000|9.671000	0.98627|0.98627	1.134000|1.134000	0.42165|0.42165	-0.229000|-0.229000	0.12294|0.12294	CGC|ACG	PRKCQ	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Prot_kin_PKC_delta,pfscan_Prot_kinase_cat_dom	ENSG00000065675		0.498	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	HGNC	protein_coding	OTTHUMT00000046665.1	129	0.77	1	G	NM_006257		6520982	6520982	-1	no_errors	ENST00000263125	ensembl	human	known	69_37n	missense	87	26.05	31	SNP	0.996	A
RBPJL	11317	genome.wustl.edu	37	20	43940867	43940867	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr20:43940867G>A	ENST00000343694.3	+	6	523	c.451G>A	c.(451-453)Ggc>Agc	p.G151S	RBPJL_ENST00000372741.3_Missense_Mutation_p.G151S|RBPJL_ENST00000372743.1_Missense_Mutation_p.G151S	NM_001281448.1|NM_001281449.1|NM_014276.2	NP_001268377.1|NP_001268378.1|NP_055091.2	Q9UBG7	RBPJL_HUMAN	recombination signal binding protein for immunoglobulin kappa J region-like	151					positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Myeloproliferative disorder(115;0.0122)				CTAGGAATTCGGCTGCGCCAA	0.637											OREG0025979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													54.0	56.0	55.0					20																	43940867		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024964	CCDS13349.1, CCDS63283.1, CCDS63284.1	20q13.12	2013-10-18	2007-02-26	2007-02-26	ENSG00000124232	ENSG00000124232			13761	protein-coding gene	gene with protein product			"""recombining binding protein suppressor of hairless (Drosophila)-like"""	RBPSUHL		9929984	Standard	NM_014276		Approved	RBP-L, SUH, SUHL	uc002xns.3	Q9UBG7	OTTHUMG00000033055	ENST00000343694.3:c.451G>A	20.37:g.43940867G>A	ENSP00000341243:p.Gly151Ser	920	O95723|Q5QPU9|Q5QPV0|Q9ULV9	Missense_Mutation	SNP	pfam_Beta-trefoil_DNA-bd_dom,pfam_LAG1_DNA-bd,superfamily_Beta-trefoil_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set	p.G151S	ENST00000343694.3	37	c.451	CCDS13349.1	20	.	.	.	.	.	.	.	.	.	.	G	8.476	0.858672	0.17178	.	.	ENSG00000124232	ENST00000372743;ENST00000372741;ENST00000343694	D;D;D	0.82344	-1.6;-1.6;-1.6	4.01	2.03	0.26663	LAG1, DNA binding (2);p53-like transcription factor, DNA-binding (1);	0.477387	0.22034	N	0.065557	T	0.67154	0.2863	L	0.34521	1.04	0.32467	N	0.543325	B;B	0.29862	0.259;0.018	B;B	0.21360	0.034;0.021	T	0.62062	-0.6933	10	0.28530	T	0.3	-9.333	4.3154	0.10991	0.2733:0.0:0.5676:0.1592	.	151;151	Q5QPV1;Q9UBG7	.;RBPJL_HUMAN	S	151	ENSP00000361828:G151S;ENSP00000361826:G151S;ENSP00000341243:G151S	ENSP00000341243:G151S	G	+	1	0	RBPJL	43374281	0.988000	0.35896	0.971000	0.41717	0.643000	0.38383	0.568000	0.23623	0.441000	0.26529	0.448000	0.29417	GGC	RBPJL	-	pfam_LAG1_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000124232		0.637	RBPJL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBPJL	HGNC	protein_coding	OTTHUMT00000080391.1	29	0.00	0	G	NM_014276		43940867	43940867	+1	no_errors	ENST00000343694	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	0.999	A
RINT1	60561	genome.wustl.edu	37	7	105205897	105205897	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr7:105205897A>G	ENST00000257700.2	+	13	2291	c.2060A>G	c.(2059-2061)tAc>tGc	p.Y687C	EFCAB10_ENST00000480514.1_Intron|EFCAB10_ENST00000490493.1_5'Flank|EFCAB10_ENST00000485614.1_3'UTR	NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	687	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GTATACATCTACCAAGAAGTA	0.338																																						dbGAP											0													82.0	85.0	84.0					7																	105205897		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.2060A>G	7.37:g.105205897A>G	ENSP00000257700:p.Tyr687Cys		Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	pfam_RINT1_TIP1	p.Y687C	ENST00000257700.2	37	c.2060	CCDS34726.1	7	.	.	.	.	.	.	.	.	.	.	A	17.64	3.440228	0.63067	.	.	ENSG00000135249	ENST00000257700	T	0.31769	1.48	5.48	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.51329	0.1668	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.50988	-0.8762	10	0.59425	D	0.04	-14.2082	11.6112	0.51059	0.9292:0.0:0.0707:0.0	.	687	Q6NUQ1	RINT1_HUMAN	C	687	ENSP00000257700:Y687C	ENSP00000257700:Y687C	Y	+	2	0	RINT1	104993133	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.417000	0.80156	0.874000	0.35823	0.528000	0.53228	TAC	RINT1	-	pfam_RINT1_TIP1	ENSG00000135249		0.338	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RINT1	HGNC	protein_coding	OTTHUMT00000348686.1	104	0.00	0	A	NM_021930		105205897	105205897	+1	no_errors	ENST00000257700	ensembl	human	known	69_37n	missense	58	22.67	17	SNP	1.000	G
RNF182	221687	genome.wustl.edu	37	6	13977576	13977576	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr6:13977576G>A	ENST00000488300.1	+	3	749	c.226G>A	c.(226-228)Gat>Aat	p.D76N	RNF182_ENST00000544682.1_Missense_Mutation_p.D76N|RNF182_ENST00000537663.1_Missense_Mutation_p.D76N|RNF182_ENST00000537388.1_Missense_Mutation_p.D76N	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	76					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			CCTGCCAGATGATGAAGTTAG	0.498																																						dbGAP											0													134.0	126.0	129.0					6																	13977576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.226G>A	6.37:g.13977576G>A	ENSP00000420465:p.Asp76Asn		B2RDG2|Q8NBG3	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D76N	ENST00000488300.1	37	c.226	CCDS4531.1	6	.	.	.	.	.	.	.	.	.	.	G	16.62	3.172894	0.57584	.	.	ENSG00000180537	ENST00000537663;ENST00000488300;ENST00000544682;ENST00000420478;ENST00000423553;ENST00000537388	D;D;D;D;D;D	0.93189	-2.19;-2.19;-2.19;-2.19;-3.18;-2.19	5.39	5.39	0.77823	.	0.704963	0.13990	N	0.348859	D	0.85500	0.5711	L	0.34521	1.04	0.49051	D	0.999743	B	0.20780	0.048	B	0.14578	0.011	T	0.78778	-0.2071	9	.	.	.	-10.4915	19.1467	0.93472	0.0:0.0:1.0:0.0	.	76	Q8N6D2	RN182_HUMAN	N	76	ENSP00000443228:D76N;ENSP00000420465:D76N;ENSP00000442021:D76N;ENSP00000419329:D76N;ENSP00000418717:D76N;ENSP00000441271:D76N	.	D	+	1	0	RNF182	14085555	1.000000	0.71417	0.921000	0.36526	0.904000	0.53231	7.310000	0.78947	2.541000	0.85698	0.563000	0.77884	GAT	RNF182	-	NULL	ENSG00000180537		0.498	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF182	HGNC	protein_coding	OTTHUMT00000039911.2	92	0.00	0	G	NM_152737		13977576	13977576	+1	no_errors	ENST00000488300	ensembl	human	known	69_37n	missense	54	38.64	34	SNP	0.995	A
SLC12A5	57468	genome.wustl.edu	37	20	44680441	44680441	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr20:44680441C>G	ENST00000454036.2	+	18	2427	c.2378C>G	c.(2377-2379)aCt>aGt	p.T793S	SLC12A5_ENST00000243964.3_Missense_Mutation_p.T770S	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	793					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CAGCACAACACTGTGCTTGTT	0.597																																						dbGAP											0													72.0	72.0	72.0					20																	44680441		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.2378C>G	20.37:g.44680441C>G	ENSP00000387694:p.Thr793Ser		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.T793S	ENST00000454036.2	37	c.2378	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930062	0.73327	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	D;D	0.93811	-3.29;-3.29	4.19	4.19	0.49359	.	0.180532	0.49305	D	0.000148	D	0.93370	0.7886	M	0.68593	2.085	0.80722	D	1	P;P	0.39748	0.686;0.577	P;B	0.44447	0.45;0.331	D	0.93744	0.7053	10	0.49607	T	0.09	.	16.0375	0.80640	0.0:1.0:0.0:0.0	.	793;770	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	S	793;770	ENSP00000387694:T793S;ENSP00000243964:T770S	ENSP00000243964:T770S	T	+	2	0	SLC12A5	44113848	1.000000	0.71417	0.940000	0.37924	0.957000	0.61999	7.609000	0.82925	2.302000	0.77476	0.462000	0.41574	ACT	SLC12A5	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.597	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	54	0.00	0	C			44680441	44680441	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	0.999	G
SPINK8	646424	genome.wustl.edu	37	3	48351420	48351420	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr3:48351420T>C	ENST00000434006.1	-	4	255	c.256A>G	c.(256-258)Ata>Gta	p.I86V		NM_001080525.1	NP_001073994.1	P0C7L1	ISK8_HUMAN	serine peptidase inhibitor, Kazal type 8 (putative)	86	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		AGTTTAGTTATGTTAAGCCCT	0.259																																						dbGAP											0													28.0	25.0	26.0					3																	48351420		1402	3271	4673	-	-	-	SO:0001583	missense	0				CCDS46822.1	3p21.31	2011-08-31			ENSG00000229453	ENSG00000229453		"""Serine peptidase inhibitors, Kazal type"""	33160	protein-coding gene	gene with protein product						16930550	Standard	NM_001080525		Approved		uc003csq.1	P0C7L1	OTTHUMG00000156832	ENST00000434006.1:c.256A>G	3.37:g.48351420T>C	ENSP00000407497:p.Ile86Val			Missense_Mutation	SNP	pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Prot_inh_Kazal	p.I86V	ENST00000434006.1	37	c.256	CCDS46822.1	3	.	.	.	.	.	.	.	.	.	.	T	0.707	-0.788521	0.02884	.	.	ENSG00000229453	ENST00000434006	T	0.78246	-1.16	3.79	-1.67	0.08238	Proteinase inhibitor I1, Kazal (2);	.	.	.	.	T	0.59155	0.2173	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.17098	0.017	T	0.41413	-0.9510	8	0.30854	T	0.27	.	4.0044	0.09595	0.0:0.3216:0.1872:0.4911	.	86	P0C7L1	ISK8_HUMAN	V	86	ENSP00000407497:I86V	ENSP00000407497:I86V	I	-	1	0	SPINK8	48326424	0.033000	0.19621	0.023000	0.16930	0.436000	0.31835	-0.292000	0.08332	-0.265000	0.09352	-0.256000	0.11100	ATA	SPINK8	-	pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Prot_inh_Kazal	ENSG00000229453		0.259	SPINK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPINK8	HGNC	protein_coding	OTTHUMT00000346123.1	80	0.00	0	T	NM_001080525		48351420	48351420	-1	no_errors	ENST00000434006	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	0.033	C
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	18	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	34	23.91	11	SNP	0.994	A
TCN1	6947	genome.wustl.edu	37	11	59626616	59626616	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr11:59626616C>G	ENST00000257264.3	-	5	785	c.681G>C	c.(679-681)aaG>aaC	p.K227N	TCN1_ENST00000532419.1_Intron	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	227	Globular N-terminal alpha domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)	p.K227N(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGACAGAATCTTTTCTACCA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											181.0	170.0	174.0					11																	59626616		2201	4295	6496	-	-	-	SO:0001583	missense	0			J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.681G>C	11.37:g.59626616C>G	ENSP00000257264:p.Lys227Asn		A8KAC5|Q8WV77	Missense_Mutation	SNP	pfam_Cbl-bd_transpt_euk	p.K227N	ENST00000257264.3	37	c.681	CCDS7978.1	11	.	.	.	.	.	.	.	.	.	.	C	8.721	0.914462	0.17907	.	.	ENSG00000134827	ENST00000257264	T	0.48201	0.82	4.92	1.95	0.26073	.	0.344222	0.24029	N	0.042202	T	0.52240	0.1722	L	0.41961	1.31	0.09310	N	1	D	0.76494	0.999	D	0.72982	0.979	T	0.38436	-0.9661	10	0.27082	T	0.32	-4.4093	6.7713	0.23594	0.0:0.6864:0.0:0.3136	.	227	P20061	TCO1_HUMAN	N	227	ENSP00000257264:K227N	ENSP00000257264:K227N	K	-	3	2	TCN1	59383192	0.173000	0.23056	0.006000	0.13384	0.033000	0.12548	-0.043000	0.12043	0.198000	0.20407	0.650000	0.86243	AAG	TCN1	-	pfam_Cbl-bd_transpt_euk	ENSG00000134827		0.408	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCN1	HGNC	protein_coding	OTTHUMT00000394503.1	157	0.00	0	C	NM_001062		59626616	59626616	-1	no_errors	ENST00000257264	ensembl	human	known	69_37n	missense	71	37.17	42	SNP	0.239	G
TFEB	7942	genome.wustl.edu	37	6	41658742	41658742	+	Silent	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr6:41658742C>T	ENST00000230323.4	-	3	511	c.210G>A	c.(208-210)ttG>ttA	p.L70L	TFEB_ENST00000403298.4_Silent_p.L70L|TFEB_ENST00000373033.1_Silent_p.L70L|TFEB_ENST00000420312.1_Silent_p.L70L|TFEB_ENST00000394283.1_Silent_p.L70L|TFEB_ENST00000358871.2_Silent_p.L84L	NM_001271945.1|NM_007162.2	NP_001258874.1|NP_009093.1	P19484	TFEB_HUMAN	transcription factor EB	70					autophagy (GO:0006914)|embryonic placenta development (GO:0001892)|humoral immune response (GO:0006959)|lysosome organization (GO:0007040)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	11	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GCCCTACCTTCAACACCTCCC	0.662			T	ALPHA	renal (childhood epithelioid)						OREG0004069	type=REGULATORY REGION|Gene=TFEB|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP		Dom	yes		6	6p21	7942	transcription factor EB		"""E,M"""	0													25.0	24.0	24.0					6																	41658742		2202	4294	6496	-	-	-	SO:0001819	synonymous_variant	0			M33782	CCDS4858.1, CCDS64424.1, CCDS64425.1	6p21	2013-05-21			ENSG00000112561	ENSG00000112561		"""Basic helix-loop-helix proteins"""	11753	protein-coding gene	gene with protein product		600744				2115126	Standard	NM_007162		Approved	TCFEB, bHLHe35	uc003oqu.2	P19484	OTTHUMG00000014684	ENST00000230323.4:c.210G>A	6.37:g.41658742C>T		902	Q709B3|Q7Z6P9|Q9BRJ5|Q9UJD8	Silent	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.L70	ENST00000230323.4	37	c.210	CCDS4858.1	6																																																																																			TFEB	-	NULL	ENSG00000112561		0.662	TFEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFEB	HGNC	protein_coding	OTTHUMT00000040522.3	34	0.00	0	C			41658742	41658742	-1	no_errors	ENST00000230323	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	0.968	T
THSD7B	80731	genome.wustl.edu	37	2	137928463	137928463	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr2:137928463G>C	ENST00000409968.1	+	7	1856	c.1678G>C	c.(1678-1680)Ggc>Cgc	p.G560R	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000485379.1_3'UTR|THSD7B_ENST00000413152.2_Missense_Mutation_p.G529R|THSD7B_ENST00000272643.3_Missense_Mutation_p.G560R			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	560						integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGGAAAATGTGGCCTGGGACA	0.502																																						dbGAP											0													111.0	102.0	105.0					2																	137928463		1999	4171	6170	-	-	-	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1678G>C	2.37:g.137928463G>C	ENSP00000387145:p.Gly560Arg			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G560R	ENST00000409968.1	37	c.1678		2	.	.	.	.	.	.	.	.	.	.	G	29.7	5.024376	0.93462	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.37058	1.86;1.62;1.22	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.71384	0.3333	M	0.94142	3.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78086	-0.2341	10	0.56958	D	0.05	.	17.2153	0.86941	0.0:0.0:1.0:0.0	.	560;529	Q9C0I4;C9JKN6	THS7B_HUMAN;.	R	560;560;529	ENSP00000387145:G560R;ENSP00000272643:G560R;ENSP00000413841:G529R	ENSP00000272643:G560R	G	+	1	0	THSD7B	137644933	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.704000	0.74639	2.793000	0.96121	0.655000	0.94253	GGC	THSD7B	-	NULL	ENSG00000144229		0.502	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	91	0.00	0	G	XM_046570.9		137928463	137928463	+1	no_errors	ENST00000272643	ensembl	human	known	69_37n	missense	57	20.83	15	SNP	1.000	C
TMEM168	64418	genome.wustl.edu	37	7	112424725	112424725	+	Silent	SNP	T	T	C			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr7:112424725T>C	ENST00000312814.6	-	2	716	c.156A>G	c.(154-156)ctA>ctG	p.L52L	TMEM168_ENST00000454074.1_Silent_p.L52L	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	52						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						ATCTTACGTATAGACCTAAGC	0.338																																						dbGAP											0													45.0	46.0	46.0					7																	112424725		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.156A>G	7.37:g.112424725T>C			A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Silent	SNP	superfamily_ConA-like_lec_gl	p.L52	ENST00000312814.6	37	c.156	CCDS5757.1	7																																																																																			TMEM168	-	NULL	ENSG00000146802		0.338	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM168	HGNC	protein_coding	OTTHUMT00000338696.4	33	0.00	0	T	NM_022484		112424725	112424725	-1	no_errors	ENST00000312814	ensembl	human	known	69_37n	silent	10	56.52	13	SNP	0.921	C
TMLHE	55217	genome.wustl.edu	37	X	154743676	154743676	+	Silent	SNP	C	C	T			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chrX:154743676C>T	ENST00000334398.3	-	4	754	c.609G>A	c.(607-609)gaG>gaA	p.E203E	TMLHE-AS1_ENST00000452506.1_RNA|TMLHE_ENST00000369439.4_Silent_p.E203E	NM_018196.3	NP_060666.1	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon	203					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|trimethyllysine dioxygenase activity (GO:0050353)			breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	CTGCCAACTTCTCTGTGTGCT	0.368																																						dbGAP											0													123.0	112.0	115.0					X																	154743676		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF373407, X97513	CCDS14768.1, CCDS55547.1	Xq28	2006-07-14			ENSG00000185973	ENSG00000185973			18308	protein-coding gene	gene with protein product	"""butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2"""	300777				8908511, 11431483	Standard	NM_018196		Approved	TMLH, FLJ10727, BBOX2, XAP130	uc004fnn.3	Q9NVH6	OTTHUMG00000022674	ENST00000334398.3:c.609G>A	X.37:g.154743676C>T			A8K6M9|B4E3R3|Q5TZB5|Q6IA90|Q8TBT0	Silent	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_Trimethyllysine_dOase	p.E203	ENST00000334398.3	37	c.609	CCDS14768.1	X																																																																																			TMLHE	-	pfam_Taurine_dOase,tigrfam_Trimethyllysine_dOase	ENSG00000185973		0.368	TMLHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMLHE	HGNC	protein_coding	OTTHUMT00000058817.1	105	0.00	0	C	NM_018196		154743676	154743676	-1	no_errors	ENST00000334398	ensembl	human	known	69_37n	silent	54	41.94	39	SNP	0.976	T
ZFAND4	93550	genome.wustl.edu	37	10	46121562	46121562	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr10:46121562A>G	ENST00000344646.5	-	7	1924	c.1709T>C	c.(1708-1710)cTt>cCt	p.L570P	ZFAND4_ENST00000374371.2_Intron|ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374366.3_Missense_Mutation_p.L496P	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	570							zinc ion binding (GO:0008270)										CAGTGAGGCAAGAAAACTGAT	0.468																																						dbGAP											0													98.0	99.0	99.0					10																	46121562		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.1709T>C	10.37:g.46121562A>G	ENSP00000339484:p.Leu570Pro		A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_Znf_AN1,smart_Ubiquitin,smart_Znf_AN1,prints_Ubiquitin_subgr,pfscan_Znf_AN1,pfscan_Ubiquitin_supergroup	p.L570P	ENST00000344646.5	37	c.1709	CCDS7214.1	10	.	.	.	.	.	.	.	.	.	.	A	16.77	3.215672	0.58452	.	.	ENSG00000172671	ENST00000344646;ENST00000374366;ENST00000374370	T;T	0.31247	1.5;1.51	5.73	5.73	0.89815	.	1.063210	0.07390	N	0.888985	T	0.56906	0.2017	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	T	0.38265	-0.9669	10	0.87932	D	0	-17.044	13.973	0.64252	1.0:0.0:0.0:0.0	.	570	Q86XD8	ANUB1_HUMAN	P	570;496;452	ENSP00000339484:L570P;ENSP00000363486:L496P	ENSP00000339484:L570P	L	-	2	0	ANUBL1	45441568	1.000000	0.71417	0.996000	0.52242	0.464000	0.32679	8.575000	0.90766	2.186000	0.69663	0.459000	0.35465	CTT	ZFAND4	-	NULL	ENSG00000172671		0.468	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND4	HGNC	protein_coding	OTTHUMT00000047790.1	46	0.00	0	A	NM_174890		46121562	46121562	-1	no_errors	ENST00000344646	ensembl	human	known	69_37n	missense	23	42.50	17	SNP	1.000	G
ZFHX4	79776	genome.wustl.edu	37	8	77765416	77765416	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr8:77765416C>A	ENST00000521891.2	+	10	6707	c.6259C>A	c.(6259-6261)Caa>Aaa	p.Q2087K	ZFHX4_ENST00000050961.6_Missense_Mutation_p.Q2042K|ZFHX4_ENST00000455469.2_Missense_Mutation_p.Q2042K|ZFHX4_ENST00000518282.1_Missense_Mutation_p.Q2061K	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2042					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCAACCTGTGCAACACCCTGC	0.597										HNSCC(33;0.089)																												dbGAP											0													22.0	23.0	23.0					8																	77765416		2033	4151	6184	-	-	-	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6259C>A	8.37:g.77765416C>A	ENSP00000430497:p.Gln2087Lys		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.Q2087K	ENST00000521891.2	37	c.6259	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	17.45	3.391598	0.62066	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50548	0.74;0.8;0.77;0.76	3.76	2.85	0.33270	.	0.165651	0.28036	N	0.016860	T	0.32071	0.0817	N	0.24115	0.695	0.54753	D	0.999984	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.07597	-1.0764	10	0.29301	T	0.29	.	12.2768	0.54739	0.1716:0.8284:0.0:0.0	.	2042;2042;2087	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	K	2087;2071;2042;2042;2061	ENSP00000430497:Q2087K;ENSP00000399605:Q2042K;ENSP00000050961:Q2042K;ENSP00000430848:Q2061K	ENSP00000050961:Q2042K	Q	+	1	0	ZFHX4	77927971	1.000000	0.71417	0.211000	0.23655	0.726000	0.41606	7.516000	0.81772	0.899000	0.36444	0.455000	0.32223	CAA	ZFHX4	-	NULL	ENSG00000091656		0.597	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	37	0.00	0	C	NM_024721		77765416	77765416	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	1.000	A
ZNF677	342926	genome.wustl.edu	37	19	53740447	53740447	+	Silent	SNP	T	T	A			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr19:53740447T>A	ENST00000598513.1	-	5	1683	c.1533A>T	c.(1531-1533)ggA>ggT	p.G511G	ZNF677_ENST00000333952.4_Silent_p.G511G	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		AAGGTTTCTCTCCAGTATGGA	0.363																																						dbGAP											0													106.0	102.0	104.0					19																	53740447		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1533A>T	19.37:g.53740447T>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G511	ENST00000598513.1	37	c.1533	CCDS12861.1	19																																																																																			ZNF677	-	pfscan_Znf_C2H2	ENSG00000197928		0.363	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	162	0.00	0	T	NM_182609		53740447	53740447	-1	no_errors	ENST00000333952	ensembl	human	known	69_37n	silent	145	13.69	23	SNP	0.987	A
ZNF71	58491	genome.wustl.edu	37	19	57132793	57132793	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr19:57132793G>C	ENST00000328070.6	+	3	372	c.138G>C	c.(136-138)gaG>gaC	p.E46D		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	46					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		GCTGGCCAGAGAGGCCGCGGG	0.622																																						dbGAP											0													34.0	35.0	35.0					19																	57132793		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.138G>C	19.37:g.57132793G>C	ENSP00000328245:p.Glu46Asp		Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E46D	ENST00000328070.6	37	c.138	CCDS12947.1	19	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645370	0.29246	.	.	ENSG00000197951	ENST00000328070	T	0.07216	3.21	3.01	1.95	0.26073	.	.	.	.	.	T	0.06050	0.0157	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	9	0.44086	T	0.13	.	8.0451	0.30545	0.0:0.2513:0.7487:0.0	.	46	Q9NQZ8	ZNF71_HUMAN	D	46	ENSP00000328245:E46D	ENSP00000328245:E46D	E	+	3	2	ZNF71	61824605	0.003000	0.15002	0.001000	0.08648	0.015000	0.08874	0.830000	0.27462	0.827000	0.34685	0.561000	0.74099	GAG	ZNF71	-	NULL	ENSG00000197951		0.622	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF71	HGNC	protein_coding	OTTHUMT00000459798.2	32	0.00	0	G	NM_021216		57132793	57132793	+1	no_errors	ENST00000328070	ensembl	human	known	69_37n	missense	33	34.00	17	SNP	0.004	C
ZNF773	374928	genome.wustl.edu	37	19	58017951	58017951	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22B-01A-11D-A159-09	TCGA-E9-A22B-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e46a5d19-2dd7-4c34-8fff-6276278c58b3	f948182a-f814-4e3c-83ee-82b78aa423c1	g.chr19:58017951T>C	ENST00000282292.4	+	4	628	c.488T>C	c.(487-489)cTc>cCc	p.L163P	ZNF773_ENST00000599847.1_Intron|ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.L162P	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	163					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		TCAGGTGTTCTCAAGCACCAG	0.502																																						dbGAP											0													55.0	56.0	56.0					19																	58017951		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.488T>C	19.37:g.58017951T>C	ENSP00000282292:p.Leu163Pro		Q96DL8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L163P	ENST00000282292.4	37	c.488	CCDS33134.1	19	.	.	.	.	.	.	.	.	.	.	T	5.045	0.193890	0.09599	.	.	ENSG00000152439	ENST00000282292	T	0.01234	5.13	1.25	-1.21	0.09524	.	.	.	.	.	T	0.01421	0.0046	L	0.43757	1.38	0.09310	N	0.999992	B;B	0.21452	0.056;0.001	B;B	0.23275	0.045;0.002	T	0.45963	-0.9225	9	0.46703	T	0.11	.	2.5424	0.04729	0.2161:0.3137:0.0:0.4702	.	162;163	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	P	163	ENSP00000282292:L163P	ENSP00000282292:L163P	L	+	2	0	ZNF773	62709763	0.000000	0.05858	0.001000	0.08648	0.067000	0.16453	-1.753000	0.01818	-0.519000	0.06444	0.260000	0.18958	CTC	ZNF773	-	NULL	ENSG00000152439		0.502	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	64	0.00	0	T	NM_198542		58017951	58017951	+1	no_errors	ENST00000282292	ensembl	human	known	69_37n	missense	41	29.31	17	SNP	0.022	C
