#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AASDHPPT	60496	genome.wustl.edu	37	11	105962133	105962133	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr11:105962133G>C	ENST00000278618.4	+	4	844	c.622G>C	c.(622-624)Gat>Cat	p.D208H	RP11-677I18.3_ENST00000532422.1_RNA	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	208					macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		ATTAAACTTGGATATAGGCCA	0.353																																						dbGAP											0													101.0	109.0	106.0					11																	105962133		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.622G>C	11.37:g.105962133G>C	ENSP00000278618:p.Asp208His		B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	pfam_4-PPantetheinyl_Trfase,superfamily_4-PPantetheinyl_Trfase	p.D208H	ENST00000278618.4	37	c.622	CCDS31664.1	11	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887180	0.52014	.	.	ENSG00000149313	ENST00000533423;ENST00000524411;ENST00000278618	.	.	.	5.77	5.77	0.91146	4&apos (2);-phosphopantetheinyl transferase (2);	0.481754	0.24879	N	0.034879	T	0.55986	0.1955	L	0.33339	1.005	0.43317	D	0.995339	B	0.02656	0.0	B	0.08055	0.003	T	0.48139	-0.9061	9	0.45353	T	0.12	.	19.981	0.97324	0.0:0.0:1.0:0.0	.	208	Q9NRN7	ADPPT_HUMAN	H	143;143;208	.	ENSP00000278618:D208H	D	+	1	0	AASDHPPT	105467343	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.623000	0.54224	2.729000	0.93468	0.585000	0.79938	GAT	AASDHPPT	-	superfamily_4-PPantetheinyl_Trfase	ENSG00000149313		0.353	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDHPPT	HGNC	protein_coding	OTTHUMT00000388734.1	79	0.00	0	G	NM_015423		105962133	105962133	+1	no_errors	ENST00000278618	ensembl	human	known	69_37n	missense	52	16.13	10	SNP	1.000	C
ADCY10	55811	genome.wustl.edu	37	1	167787330	167787330	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:167787330T>A	ENST00000367851.4	-	31	4646	c.4462A>T	c.(4462-4464)Agt>Tgt	p.S1488C	ADCY10_ENST00000367848.1_Missense_Mutation_p.S1396C|ADCY10_ENST00000545172.1_Missense_Mutation_p.S1335C|RP1-313L4.3_ENST00000451545.1_RNA	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1488					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TCCTCCCCACTGGCTTGGGCA	0.418																																						dbGAP											0													97.0	89.0	92.0					1																	167787330		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4462A>T	1.37:g.167787330T>A	ENSP00000356825:p.Ser1488Cys		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.S1488C	ENST00000367851.4	37	c.4462	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	T	10.76	1.440949	0.25900	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.33216	1.42;1.42;1.42	5.63	0.472	0.16758	.	1.061000	0.07325	N	0.878273	T	0.15869	0.0382	L	0.51422	1.61	0.31805	N	0.6279239999999999	D;P	0.56287	0.975;0.923	P;B	0.50378	0.639;0.436	T	0.07673	-1.0760	9	0.54805	T	0.06	-0.0639	1.7107	0.02891	0.2869:0.0796:0.1493:0.4842	.	1396;1488	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	C	1335;1488;1396	ENSP00000441992:S1335C;ENSP00000356825:S1488C;ENSP00000356822:S1396C	ENSP00000356822:S1396C	S	-	1	0	ADCY10	166053954	0.006000	0.16342	0.022000	0.16811	0.001000	0.01503	0.353000	0.20130	-0.168000	0.10853	0.533000	0.62120	AGT	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.418	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	65	0.00	0	T	NM_018417		167787330	167787330	-1	no_errors	ENST00000367851	ensembl	human	known	69_37n	missense	117	16.43	23	SNP	0.098	A
AIFM1	9131	genome.wustl.edu	37	X	129263589	129263589	+	Silent	SNP	A	A	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chrX:129263589A>T	ENST00000287295.3	-	16	2015	c.1785T>A	c.(1783-1785)ggT>ggA	p.G595G	AIFM1_ENST00000346424.2_Silent_p.G308G|AIFM1_ENST00000460436.2_Silent_p.G256G|AIFM1_ENST00000440263.1_Silent_p.G243G|AIFM1_ENST00000319908.3_Silent_p.G591G|AIFM1_ENST00000535724.1_3'UTR	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	595					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	CATGCTGCTCACCGTCCTTAA	0.502																																						dbGAP											0													193.0	158.0	170.0					X																	129263589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1785T>A	X.37:g.129263589A>T			A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Silent	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase	p.G595	ENST00000287295.3	37	c.1785	CCDS14618.1	X																																																																																			AIFM1	-	superfamily_FAD/NAD-linked_Rdtase_dimer	ENSG00000156709		0.502	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM1	HGNC	protein_coding	OTTHUMT00000058247.2	79	0.00	0	A			129263589	129263589	-1	no_errors	ENST00000287295	ensembl	human	known	69_37n	silent	106	19.08	25	SNP	0.994	T
ANK3	288	genome.wustl.edu	37	10	61822913	61822913	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr10:61822913C>A	ENST00000280772.2	-	40	12742	c.12551G>T	c.(12550-12552)aGa>aTa	p.R4184I	ANK3_ENST00000373827.2_Missense_Mutation_p.R1565I|ANK3_ENST00000355288.2_Missense_Mutation_p.R705I|RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000503366.1_Missense_Mutation_p.R1572I	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4184					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R4184K(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TGCAAAACTTCTGGTGCCTGA	0.328																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											87.0	81.0	83.0					10																	61822913		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12551G>T	10.37:g.61822913C>A	ENSP00000280772:p.Arg4184Ile		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Nonsense_Mutation	SNP	pfam_Death,superfamily_DEATH-like,smart_Death,pfscan_Death	p.E78*	ENST00000280772.2	37	c.232	CCDS7258.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.1|29.1	4.974537|4.974537	0.92919|0.92919	.|.	.|.	ENSG00000151150|ENSG00000151150	ENST00000514197;ENST00000511043|ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817	.|D;T;T;T;T	.|0.93811	.|-3.29;0.51;0.51;0.51;0.51	5.38|5.38	5.38|5.38	0.77491|0.77491	.|DEATH-like (2);	.|0.000000	.|0.44483	.|D	.|0.000458	.|D	.|0.94735	.|0.8301	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|P;D;P;P;D;D;D	.|0.89917	.|0.791;0.999;0.793;0.94;0.999;0.996;1.0	.|B;D;B;P;D;D;D	.|0.91635	.|0.373;0.996;0.36;0.835;0.983;0.974;0.999	.|D	.|0.95575	.|0.8641	.|10	.|0.87932	.|D	.|0	.|.	19.1293|19.1293	0.93399|0.93399	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1572;705;1565;4184;806;705;104	.|E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.|.;.;.;ANK3_HUMAN;.;.;.	X|I	78;131|4184;1565;163;705;705;1572;1551;806	.|ENSP00000280772:R4184I;ENSP00000362933:R1565I;ENSP00000362926:R163I;ENSP00000347436:R705I;ENSP00000425236:R1572I	.|ENSP00000280772:R4184I	E|R	-|-	1|2	0|0	ANK3|ANK3	61492919|61492919	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.487000|7.487000	0.81328|0.81328	2.532000|2.532000	0.85374|0.85374	0.467000|0.467000	0.42956|0.42956	GAA|AGA	ANK3	-	superfamily_DEATH-like	ENSG00000151150		0.328	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	66	0.00	0	C	NM_020987		61822913	61822913	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000514197	ensembl	human	novel	69_37n	nonsense	39	30.36	17	SNP	1.000	A
ANKK1	255239	genome.wustl.edu	37	11	113264435	113264435	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr11:113264435C>G	ENST00000303941.3	+	2	512	c.418C>G	c.(418-420)Cct>Gct	p.P140A		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		CATTAAGCCGCCTCTGCTCCA	0.567																																						dbGAP											0													54.0	56.0	56.0					11																	113264435		2159	4276	6435	-	-	-	SO:0001583	missense	0			AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.418C>G	11.37:g.113264435C>G	ENSP00000306678:p.Pro140Ala			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P140A	ENST00000303941.3	37	c.418	CCDS44734.1	11	.	.	.	.	.	.	.	.	.	.	C	9.658	1.143250	0.21205	.	.	ENSG00000170209	ENST00000303941	T	0.34667	1.35	4.66	3.74	0.42951	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000053	T	0.46560	0.1399	L	0.47190	1.495	0.38280	D	0.942407	D	0.54047	0.964	P	0.59595	0.86	T	0.47573	-0.9107	10	0.40728	T	0.16	-4.9059	12.1685	0.54144	0.0:0.916:0.0:0.084	.	140	Q8NFD2	ANKK1_HUMAN	A	140	ENSP00000306678:P140A	ENSP00000306678:P140A	P	+	1	0	ANKK1	112769645	0.927000	0.31430	0.049000	0.19019	0.056000	0.15407	2.942000	0.49018	1.155000	0.42497	0.407000	0.27541	CCT	ANKK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000170209		0.567	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKK1	HGNC	protein_coding	OTTHUMT00000395830.1	29	0.00	0	C	NM_178510		113264435	113264435	+1	no_errors	ENST00000303941	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	0.715	G
APBA1	320	genome.wustl.edu	37	9	72130950	72130950	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr9:72130950C>A	ENST00000265381.4	-	2	1399	c.1177G>T	c.(1177-1179)Gac>Tac	p.D393Y		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	393	LIN-2/CASK binding.|Pro-rich.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.D393N(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GGCCTCTGGTCGTCACAGTCC	0.637																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											121.0	105.0	111.0					9																	72130950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1177G>T	9.37:g.72130950C>A	ENSP00000265381:p.Asp393Tyr		O14914|O60570|Q5VYR8	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.D393Y	ENST00000265381.4	37	c.1177	CCDS6630.1	9	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113260	0.77210	.	.	ENSG00000107282	ENST00000265381	T	0.04551	3.6	5.95	5.95	0.96441	.	0.133496	0.52532	D	0.000071	T	0.12603	0.0306	N	0.24115	0.695	0.58432	D	0.999995	D	0.71674	0.998	D	0.64042	0.921	T	0.02743	-1.1116	10	0.62326	D	0.03	-26.3813	20.3932	0.98965	0.0:1.0:0.0:0.0	.	393	Q02410	APBA1_HUMAN	Y	393	ENSP00000265381:D393Y	ENSP00000265381:D393Y	D	-	1	0	APBA1	71320770	1.000000	0.71417	0.959000	0.39883	0.980000	0.70556	3.990000	0.56965	2.824000	0.97209	0.655000	0.94253	GAC	APBA1	-	NULL	ENSG00000107282		0.637	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	HGNC	protein_coding	OTTHUMT00000052589.2	19	0.00	0	C	NM_001163		72130950	72130950	-1	no_errors	ENST00000265381	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	1.000	A
ARL17B	100506084	genome.wustl.edu	37	17	44430254	44430254	+	Missense_Mutation	SNP	G	G	C	rs35595570	byFrequency	TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr17:44430254G>C	ENST00000450673.3	-	3	296	c.191C>G	c.(190-192)gCt>gGt	p.A64G	ARL17B_ENST00000575698.1_Missense_Mutation_p.A64G|ARL17B_ENST00000570618.1_Missense_Mutation_p.A64G|ARL17B_ENST00000571246.1_Missense_Mutation_p.A64G|ARL17B_ENST00000575960.1_Missense_Mutation_p.A64G|ARL17B_ENST00000434041.2_Missense_Mutation_p.A64G	NM_001039083.3	NP_001034172.3	Q8IVW1	ARL17_HUMAN	ADP-ribosylation factor-like 17B	64					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)	GTP binding (GO:0005525)	p.A64G(1)		pancreas(1)	1						ATCCCAGACAGCGAAGGTGTT	0.378																																						dbGAP											1	Substitution - Missense(1)	pancreas(1)											3.0	3.0	3.0					17																	44430254		1275	3002	4277	-	-	-	SO:0001583	missense	0			AF493886	CCDS54137.1, CCDS58557.1	17q21.31	2014-05-09	2009-11-17	2009-11-17	ENSG00000228696	ENSG00000228696		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	32387	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 17"""	ARL17			Standard	NM_001039083		Approved			Q8IVW1	OTTHUMG00000178031	ENST00000450673.3:c.191C>G	17.37:g.44430254G>C	ENSP00000404247:p.Ala64Gly		B0AZR6|Q59FW5|Q8N6E2|Q8TD73|Q8WW54|Q9NZD5|Q9P158	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR	p.A64G	ENST00000450673.3	37	c.191	CCDS58557.1	17	.	.	.	.	.	.	.	.	.	.	g	4.858	0.159467	0.09236	.	.	ENSG00000228696	ENST00000434041;ENST00000450673	T;T	0.63744	-0.06;-0.06	2.89	2.89	0.33648	.	.	.	.	.	T	0.51736	0.1692	.	.	.	0.29739	N	0.837233	B;B;B	0.31817	0.164;0.054;0.341	B;B;B	0.31686	0.134;0.038;0.08	T	0.55768	-0.8089	8	0.52906	T	0.07	.	11.9465	0.52930	0.0:0.0:1.0:0.0	.	64;64;64	Q8IVW1;Q8IVW1-2;F8VZA5	ARL17_HUMAN;.;.	G	64	ENSP00000391751:A64G;ENSP00000404247:A64G	ENSP00000391751:A64G	A	-	2	0	ARL17B	41786010	1.000000	0.71417	0.999000	0.59377	0.006000	0.05464	8.736000	0.91554	1.898000	0.54952	0.393000	0.25936	GCT	ARL17B	-	pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR	ENSG00000228696		0.378	ARL17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARL17B	HGNC	protein_coding	OTTHUMT00000440297.1	9	0.00	0	G	NM_001039083		44430254	44430254	-1	no_errors	ENST00000450673	ensembl	human	known	69_37n	missense	2	66.67	4	SNP	1.000	C
ASB9	140462	genome.wustl.edu	37	X	15262744	15262744	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chrX:15262744A>G	ENST00000380488.4	-	7	1042	c.769T>C	c.(769-771)Tct>Cct	p.S257P	ASB9_ENST00000380485.3_3'UTR|ASB9_ENST00000473862.1_5'UTR|ASB9_ENST00000546332.1_3'UTR|ASB9_ENST00000380483.3_3'UTR	NM_001031739.2	NP_001026909.1	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box containing 9	257	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|positive regulation of protein catabolic process (GO:0045732)|protein ubiquitination (GO:0016567)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(10)	15	Hepatocellular(33;0.183)					TGCATCAAAGAAGGGGGCCCT	0.393																																						dbGAP											0													96.0	86.0	90.0					X																	15262744		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000643	CCDS14163.1, CCDS35208.1, CCDS55372.1	Xp22.2	2013-01-10	2011-01-25		ENSG00000102048	ENSG00000102048		"""Ankyrin repeat domain containing"""	17184	protein-coding gene	gene with protein product		300890	"""ankyrin repeat and SOCS box-containing 9"""			12076535	Standard	NM_001031739		Approved	DKFZP564L0862, MGC4954, FLJ20636	uc004cwl.3	Q96DX5	OTTHUMG00000021172	ENST00000380488.4:c.769T>C	X.37:g.15262744A>G	ENSP00000369855:p.Ser257Pro		A8K8A5|Q9BVF5|Q9NWS5|Q9Y4T3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.S257P	ENST00000380488.4	37	c.769	CCDS35208.1	X	.	.	.	.	.	.	.	.	.	.	A	14.59	2.580062	0.46006	.	.	ENSG00000102048	ENST00000380488	T	0.61040	0.14	5.92	4.76	0.60689	SOCS protein, C-terminal (3);	0.270585	0.44097	N	0.000495	T	0.48786	0.1519	L	0.49256	1.55	0.80722	D	1	B	0.23806	0.091	B	0.25759	0.063	T	0.47959	-0.9076	10	0.66056	D	0.02	-17.3095	5.5951	0.17323	0.7667:0.0:0.0804:0.1528	.	257	Q96DX5	ASB9_HUMAN	P	257	ENSP00000369855:S257P	ENSP00000369855:S257P	S	-	1	0	ASB9	15172665	0.990000	0.36364	0.583000	0.28640	0.994000	0.84299	3.003000	0.49505	0.852000	0.35287	0.486000	0.48141	TCT	ASB9	-	pfam_SOCS_C,smart_SOCS_C,pfscan_SOCS_C	ENSG00000102048		0.393	ASB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB9	HGNC	protein_coding	OTTHUMT00000055844.1	53	0.00	0	A			15262744	15262744	-1	no_errors	ENST00000380488	ensembl	human	known	69_37n	missense	69	18.82	16	SNP	0.834	G
ATF4P4	100127952	genome.wustl.edu	37	11	113660393	113660394	+	RNA	DEL	TT	TT	-			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr11:113660393_113660394delTT	ENST00000393544.2	+	0	441_442									activating transcription factor 4 pseudogene 4																		CAAGCAGAACTTCATTGACCTC	0.554																																						dbGAP											0																																										-	-	-			0					11q23.2	2011-09-02	2010-12-16	2010-12-16	ENSG00000256167	ENSG00000256167			787	pseudogene	pseudogene			"""activating transcription factor 4B"""	ATF4B		10610718	Standard	NG_021835		Approved				OTTHUMG00000168194		11.37:g.113660393_113660394delTT				RNA	DEL	-	NULL	ENST00000393544.2	37	NULL		11																																																																																			ATF4P4	-	-	ENSG00000256167		0.554	ATF4P4-002	KNOWN	basic	processed_transcript	ATF4P4	HGNC	pseudogene	OTTHUMT00000398707.1	25	0.00	0	TT	NG_021835		113660393	113660394	+1	no_errors	ENST00000393544	ensembl	human	known	69_37n	rna	8	45.00	9	DEL	1.000:1.000	-
AXL	558	genome.wustl.edu	37	19	41736883	41736883	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr19:41736883A>G	ENST00000301178.4	+	5	788	c.598A>G	c.(598-600)Aca>Gca	p.T200A	AXL_ENST00000359092.3_Missense_Mutation_p.T200A|AXL_ENST00000593513.1_5'UTR	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	200	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						GCTGAACAAGACATCCTCTTT	0.617																																						dbGAP											0													138.0	127.0	130.0					19																	41736883		2203	4300	6503	-	-	-	SO:0001583	missense	0			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.598A>G	19.37:g.41736883A>G	ENSP00000301178:p.Thr200Ala		Q8N5L2|Q9UD27	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T200A	ENST00000301178.4	37	c.598	CCDS12575.1	19	.	.	.	.	.	.	.	.	.	.	a	13.42	2.233349	0.39498	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.09817	2.94;2.94	4.91	4.91	0.64330	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.070853	0.56097	U	0.000040	T	0.07728	0.0194	N	0.20357	0.565	0.35111	D	0.766114	B;B	0.26258	0.12;0.145	B;B	0.26094	0.039;0.066	T	0.27806	-1.0063	10	0.32370	T	0.25	-10.0576	10.9336	0.47233	1.0:0.0:0.0:0.0	.	200;200	P30530-2;P30530	.;UFO_HUMAN	A	200	ENSP00000301178:T200A;ENSP00000351995:T200A	ENSP00000301178:T200A	T	+	1	0	AXL	46428723	1.000000	0.71417	0.972000	0.41901	0.861000	0.49209	5.850000	0.69473	1.838000	0.53458	0.240000	0.17902	ACA	AXL	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000167601		0.617	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	HGNC	protein_coding	OTTHUMT00000463323.2	11	0.00	0	A			41736883	41736883	+1	no_errors	ENST00000301178	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	G
BIN2	51411	genome.wustl.edu	37	12	51693051	51693051	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr12:51693051C>A	ENST00000267012.4	-	7	599	c.538G>T	c.(538-540)Gcc>Tcc	p.A180S	BIN2_ENST00000452142.2_Missense_Mutation_p.A148S|BIN2_ENST00000544402.1_Missense_Mutation_p.A154S|BIN2_ENST00000604560.1_Missense_Mutation_p.A153S	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	180	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						ACAGTCTGGGCTTTGTTGAAC	0.428																																						dbGAP											0													129.0	116.0	121.0					12																	51693051		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.538G>T	12.37:g.51693051C>A	ENSP00000267012:p.Ala180Ser		Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom,prints_Amphiphysin	p.A180S	ENST00000267012.4	37	c.538	CCDS8811.1	12	.	.	.	.	.	.	.	.	.	.	C	28.6	4.936893	0.92458	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	D;D;D	0.83673	-1.75;-1.75;-1.75	4.46	4.46	0.54185	BAR (3);	0.066485	0.64402	D	0.000020	D	0.90079	0.6901	M	0.70842	2.15	0.58432	D	0.999998	D;D;D	0.76494	0.998;0.999;0.994	D;D;D	0.74023	0.969;0.974;0.982	D	0.90625	0.4562	10	0.62326	D	0.03	-10.4155	17.0881	0.86616	0.0:1.0:0.0:0.0	.	154;148;180	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	S	148;180;154	ENSP00000410217:A148S;ENSP00000267012:A180S;ENSP00000445874:A154S	ENSP00000267012:A180S	A	-	1	0	BIN2	49979318	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.259000	0.78381	2.760000	0.94817	0.655000	0.94253	GCC	BIN2	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom,prints_Amphiphysin	ENSG00000110934		0.428	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIN2	HGNC	protein_coding	OTTHUMT00000469800.1	55	0.00	0	C			51693051	51693051	-1	no_errors	ENST00000267012	ensembl	human	known	69_37n	missense	82	11.70	11	SNP	1.000	A
BPI	671	genome.wustl.edu	37	20	36935973	36935973	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr20:36935973C>A	ENST00000262865.4	+	2	236	c.147C>A	c.(145-147)agC>agA	p.S49R	CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	49					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				CTTCAGCCAGCCAGCAGGGGA	0.592																																						dbGAP											0													68.0	70.0	69.0					20																	36935973		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.147C>A	20.37:g.36935973C>A	ENSP00000262865:p.Ser49Arg		B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.S49R	ENST00000262865.4	37	c.147	CCDS13303.1	20	.	.	.	.	.	.	.	.	.	.	C	9.362	1.068240	0.20067	.	.	ENSG00000101425	ENST00000262865	T	0.04758	3.56	4.21	3.27	0.37495	Lipid-binding serum glycoprotein, conserved site (1);Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	1.001270	0.08054	N	0.997093	T	0.03011	0.0089	N	0.05078	-0.115	0.26439	N	0.975808	B	0.22983	0.078	B	0.26864	0.074	T	0.45041	-0.9288	10	0.22109	T	0.4	-9.9869	8.1272	0.31005	0.0:0.8926:0.0:0.1074	.	49	P17213	BPI_HUMAN	R	49	ENSP00000262865:S49R	ENSP00000262865:S49R	S	+	3	2	BPI	36369387	0.887000	0.30362	0.979000	0.43373	0.050000	0.14768	0.853000	0.27777	1.368000	0.46115	0.655000	0.94253	AGC	BPI	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N	ENSG00000101425		0.592	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BPI	HGNC	protein_coding	OTTHUMT00000079157.2	17	0.00	0	C	NM_001725		36935973	36935973	+1	no_errors	ENST00000262865	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	0.983	A
C12orf75	387882	genome.wustl.edu	37	12	105760448	105760448	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr12:105760448C>G	ENST00000443585.1	+	4	417	c.161C>G	c.(160-162)tCc>tGc	p.S54C	C12orf75_ENST00000549893.1_Intron|C12orf75_ENST00000548458.2_3'UTR|C12orf75_ENST00000552457.1_Missense_Mutation_p.P34A	NM_001145199.1	NP_001138671.1	Q8TAD7	OCC1_HUMAN	chromosome 12 open reading frame 75	54																	AATATGGTGTCCAGTCAAACA	0.308																																						dbGAP											0													198.0	174.0	182.0					12																	105760448		692	1591	2283	-	-	-	SO:0001583	missense	0			AK056999	CCDS55879.1	12q23.3	2013-07-03			ENSG00000235162	ENSG00000235162			35164	protein-coding gene	gene with protein product	"""adipogenesis down-regulated 3"", ""overexpressed in colon carcinoma 1"""					19531736	Standard	NM_001145199		Approved	OCC-1, OCC1, AGD3	uc001tlh.4	Q8TAD7	OTTHUMG00000150129	ENST00000443585.1:c.161C>G	12.37:g.105760448C>G	ENSP00000448536:p.Ser54Cys			Missense_Mutation	SNP	NULL	p.S54C	ENST00000443585.1	37	c.161	CCDS55879.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.71|11.71	1.719678|1.719678	0.30503|0.30503	.|.	.|.	ENSG00000235162|ENSG00000235162	ENST00000552457|ENST00000443585;ENST00000549934	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|.	.|.	.|.	.|.	T|T	0.59595|0.59595	0.2205|0.2205	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.54964	.|0.969	.|P	.|0.46758	.|0.526	T|T	0.60801|0.60801	-0.7191|-0.7191	5|7	0.87932|0.46703	D|T	0|0.11	.|.	15.5511|15.5511	0.76152|0.76152	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|54	.|Q8TAD7	.|OCC1_HUMAN	A|C	34|54	.|.	ENSP00000447440:P34A|ENSP00000448536:S54C	P|S	+|+	1|2	0|0	C12orf75|C12orf75	104284578|104284578	0.619000|0.619000	0.27059|0.27059	0.077000|0.077000	0.20336|0.20336	0.821000|0.821000	0.46438|0.46438	3.930000|3.930000	0.56522|0.56522	2.740000|2.740000	0.93945|0.93945	0.650000|0.650000	0.86243|0.86243	CCA|TCC	C12orf75	-	NULL	ENSG00000235162		0.308	C12orf75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf75	HGNC	protein_coding	OTTHUMT00000316459.3	67	0.00	0	C	NM_001145199		105760448	105760448	+1	no_errors	ENST00000443585	ensembl	human	known	69_37n	missense	52	40.91	36	SNP	0.707	G
ERICH3	127254	genome.wustl.edu	37	1	75037611	75037611	+	Missense_Mutation	SNP	T	T	A	rs147270498	byFrequency	TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:75037611T>A	ENST00000326665.5	-	14	4001	c.3783A>T	c.(3781-3783)caA>caT	p.Q1261H	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1261	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCACTCCTCCTTGCCCTTCAG	0.597																																						dbGAP											0													133.0	117.0	122.0					1																	75037611		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000326665.5:c.3783A>T	1.37:g.75037611T>A	ENSP00000322609:p.Gln1261His		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.Q1261H	ENST00000326665.5	37	c.3783	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413613	0.42817	.	.	ENSG00000178965	ENST00000326665	T	0.15603	2.41	4.16	0.338	0.15974	.	.	.	.	.	T	0.02929	0.0087	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.43782	-0.9370	9	0.49607	T	0.09	3.0117	3.519	0.07735	0.166:0.1983:0.0:0.6357	.	1261	Q5RHP9	CA173_HUMAN	H	1261	ENSP00000322609:Q1261H	ENSP00000322609:Q1261H	Q	-	3	2	C1orf173	74810199	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.496000	0.22499	-0.241000	0.09681	0.459000	0.35465	CAA	C1orf173	-	NULL	ENSG00000178965		0.597	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	51	0.00	0	T			75037611	75037611	-1	no_errors	ENST00000326665	ensembl	human	known	69_37n	missense	83	12.63	12	SNP	0.000	A
CARD9	64170	genome.wustl.edu	37	9	139261697	139261697	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr9:139261697C>T	ENST00000371732.5	-	9	1447	c.1282G>A	c.(1282-1284)Gaa>Aaa	p.E428K	CARD9_ENST00000460290.1_5'UTR|CARD9_ENST00000371734.3_Missense_Mutation_p.E428K	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	428					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		GAGCCATCTTCCAGGTCGGAG	0.662																																						dbGAP											0													56.0	57.0	56.0					9																	139261697		2196	4297	6493	-	-	-	SO:0001583	missense	0			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.1282G>A	9.37:g.139261697C>T	ENSP00000360797:p.Glu428Lys		Q5SXM5|Q5SXM6|Q9H854	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.E428K	ENST00000371732.5	37	c.1282	CCDS6997.1	9	.	.	.	.	.	.	.	.	.	.	C	13.10	2.137141	0.37728	.	.	ENSG00000187796	ENST00000371734;ENST00000371732	T;T	0.59772	0.24;0.24	3.66	3.66	0.41972	.	0.687251	0.11217	U	0.587124	T	0.48660	0.1512	L	0.47716	1.5	0.80722	D	1	B;B	0.31318	0.275;0.319	B;B	0.28232	0.087;0.063	T	0.35871	-0.9771	10	0.16896	T	0.51	-17.7271	13.0447	0.58920	0.0:1.0:0.0:0.0	.	428;428	Q9H257-2;Q9H257	.;CARD9_HUMAN	K	428	ENSP00000360799:E428K;ENSP00000360797:E428K	ENSP00000360797:E428K	E	-	1	0	CARD9	138381518	0.997000	0.39634	0.999000	0.59377	0.768000	0.43524	5.080000	0.64437	2.045000	0.60652	0.655000	0.94253	GAA	CARD9	-	NULL	ENSG00000187796		0.662	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD9	HGNC	protein_coding	OTTHUMT00000055053.1	30	0.00	0	C	NM_052813		139261697	139261697	-1	no_errors	ENST00000371732	ensembl	human	known	69_37n	missense	65	19.75	16	SNP	1.000	T
CCDC142	84865	genome.wustl.edu	37	2	74708475	74708475	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr2:74708475G>C	ENST00000393965.3	-	3	1529	c.1133C>G	c.(1132-1134)gCt>gGt	p.A378G	CCDC142_ENST00000471713.1_5'UTR|TTC31_ENST00000442235.2_5'Flank|CCDC142_ENST00000290418.4_Missense_Mutation_p.A378G|TTC31_ENST00000410003.1_5'Flank|TTC31_ENST00000233623.5_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	378										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						ACCCCCAAGAGCTGATCCCAA	0.562																																						dbGAP											0													108.0	125.0	119.0					2																	74708475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.1133C>G	2.37:g.74708475G>C	ENSP00000377537:p.Ala378Gly		B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	NULL	p.A378G	ENST00000393965.3	37	c.1133		2	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900475	0.33535	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.47177	0.85;0.85	4.65	3.77	0.43336	.	0.331962	0.21682	N	0.070708	T	0.41858	0.1177	L	0.57536	1.79	0.23657	N	0.997185	B;B;B	0.23937	0.094;0.094;0.094	B;B;B	0.24848	0.034;0.034;0.056	T	0.31641	-0.9936	10	0.36615	T	0.2	-0.104	8.3202	0.32124	0.1073:0.0:0.8927:0.0	.	378;378;378	Q17RM4;Q17RM4-2;Q17RM4-3	CC142_HUMAN;.;.	G	378	ENSP00000377537:A378G;ENSP00000290418:A378G	ENSP00000290418:A378G	A	-	2	0	CCDC142	74561983	0.116000	0.22171	0.233000	0.24025	0.987000	0.75469	1.638000	0.37165	1.167000	0.42706	0.563000	0.77884	GCT	CCDC142	-	NULL	ENSG00000135637		0.562	CCDC142-003	KNOWN	basic	protein_coding	CCDC142	HGNC	protein_coding	OTTHUMT00000328391.1	63	0.00	0	G	NM_032779		74708475	74708475	-1	no_errors	ENST00000393965	ensembl	human	known	69_37n	missense	113	16.30	22	SNP	0.603	C
CCT6P3	643180	genome.wustl.edu	37	7	64533818	64533818	+	RNA	DEL	G	G	-			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr7:64533818delG	ENST00000426828.1	+	0	1228				SNORA15_ENST00000384334.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		TTGCCTTTTAGGTGAGCCCGT	0.408																																						dbGAP											0																																										-	-	-			0					7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64533818delG				Splice_Site	DEL	-	NULL	ENST00000426828.1	37	c.NULL		7																																																																																			CCT6P3	-	-	ENSG00000234585		0.408	CCT6P3-004	KNOWN	basic	processed_transcript	CCT6P3	HGNC	pseudogene	OTTHUMT00000344862.1	12	0.00	0	G			64533818	64533818	+1	no_errors	ENST00000426828	ensembl	human	known	69_37n	splice_site_del	4	33.33	2	DEL	0.998	-
CDA	978	genome.wustl.edu	37	1	20944945	20944945	+	Splice_Site	SNP	T	T	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:20944945T>G	ENST00000375071.3	+	4	507	c.325T>G	c.(325-327)Ttt>Gtt	p.F109V	CDA_ENST00000461985.1_3'UTR	NM_001785.2	NP_001776.1	P32320	CDD_HUMAN	cytidine deaminase	109	CMP/dCMP deaminase zinc-binding.				cell surface receptor signaling pathway (GO:0007166)|cytidine deamination (GO:0009972)|cytosine metabolic process (GO:0019858)|negative regulation of cell growth (GO:0030308)|negative regulation of nucleotide metabolic process (GO:0045980)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine-containing compound salvage (GO:0008655)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	cytidine deaminase activity (GO:0004126)|nucleoside binding (GO:0001882)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	7		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	tctttTCCAGTTTGGCACCAA	0.572																																					Pancreas(74;49 1356 2772 27818 40529)	dbGAP											0													70.0	56.0	61.0					1																	20944945		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC054036	CCDS210.1	1p36.2-p35	2008-02-05			ENSG00000158825	ENSG00000158825	3.5.4.5		1712	protein-coding gene	gene with protein product		123920				8422236, 9878810	Standard	NM_001785		Approved	CDD	uc001bdk.3	P32320	OTTHUMG00000002845	ENST00000375071.3:c.325-1T>G	1.37:g.20944945T>G				Missense_Mutation	SNP	pfam_CMP_dCMP_Zn-bd,pfam_Cyd/dCyd_deaminase_Zn-bd,superfamily_Cytidine_deaminase-like,tigrfam_Cyt_deam_tetra	p.F109V	ENST00000375071.3	37	c.325	CCDS210.1	1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.557756	0.86231	.	.	ENSG00000158825	ENST00000375071	T	0.47528	0.84	5.72	5.72	0.89469	Cytidine deaminase-like (1);CMP/dCMP deaminase, zinc-binding (1);	0.000000	0.85682	D	0.000000	T	0.74680	0.3748	M	0.92459	3.31	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.80977	-0.1141	9	.	.	.	.	12.3817	0.55311	0.0:0.0:0.0:1.0	.	109	P32320	CDD_HUMAN	V	109	ENSP00000364212:F109V	.	F	+	1	0	CDA	20817532	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.378000	0.66190	2.182000	0.69389	0.402000	0.26972	TTT	CDA	-	pfam_CMP_dCMP_Zn-bd,superfamily_Cytidine_deaminase-like,tigrfam_Cyt_deam_tetra	ENSG00000158825		0.572	CDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDA	HGNC	protein_coding	OTTHUMT00000007965.1	17	0.00	0	T	NM_001785	Missense_Mutation	20944945	20944945	+1	no_errors	ENST00000375071	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	G
CKMT1B	1159	genome.wustl.edu	37	15	43890514	43890514	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr15:43890514C>G	ENST00000441322.1	+	7	1360	c.1000C>G	c.(1000-1002)Ctg>Gtg	p.L334V	CKMT1B_ENST00000300283.6_Missense_Mutation_p.L334V			P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1B	334	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			large_intestine(1)|lung(3)|skin(1)	5		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	CAAACTGCCCCTGCTAAGCAA	0.537																																						dbGAP											0													56.0	61.0	60.0					15																	43890514		2148	4276	6424	-	-	-	SO:0001583	missense	0			AK094322, J04469	CCDS10097.1	15q15	2005-04-15		2005-04-15	ENSG00000237289	ENSG00000237289	2.7.3.2		1995	protein-coding gene	gene with protein product		123290	"""creatine kinase, mitochondrial 1 (ubiquitous)"""	CKMT, CKMT1			Standard	XM_005254150		Approved	UMTCK	uc001zsc.3	P12532	OTTHUMG00000059900	ENST00000441322.1:c.1000C>G	15.37:g.43890514C>G	ENSP00000413255:p.Leu334Val		B4DIT8|B7ZA09|Q0VAM3|Q32NF6|Q53FC4	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.L334V	ENST00000441322.1	37	c.1000	CCDS10097.1	15	.	.	.	.	.	.	.	.	.	.	C	6.994	0.553474	0.13374	.	.	ENSG00000237289	ENST00000300283;ENST00000441322	T;T	0.11495	2.77;2.77	4.43	2.44	0.29823	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.068181	0.64402	D	0.000014	T	0.14787	0.0357	M	0.82823	2.61	0.80722	D	1	P;B	0.38788	0.647;0.026	B;B	0.36378	0.223;0.11	T	0.02320	-1.1177	10	0.48119	T	0.1	0.0461	8.8804	0.35372	0.0:0.8064:0.0:0.1936	.	365;334	P12532-2;P12532	.;KCRU_HUMAN	V	334	ENSP00000300283:L334V;ENSP00000413255:L334V	ENSP00000300283:L334V	L	+	1	2	CKMT1B	41677806	0.450000	0.25697	1.000000	0.80357	0.997000	0.91878	1.301000	0.33447	0.527000	0.28560	0.491000	0.48974	CTG	CKMT1B	-	pfam_ATP-guanido_PTrfase_cat	ENSG00000237289		0.537	CKMT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKMT1B	HGNC	protein_coding	OTTHUMT00000133147.2	50	0.00	0	C	NM_020990		43890514	43890514	+1	no_errors	ENST00000300283	ensembl	human	known	69_37n	missense	80	20.59	21	SNP	1.000	G
COL14A1	7373	genome.wustl.edu	37	8	121239591	121239591	+	Splice_Site	SNP	C	C	A	rs146557532	byFrequency	TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr8:121239591C>A	ENST00000297848.3	+	17	2407	c.2137C>A	c.(2137-2139)Ctt>Att	p.L713I	COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000247781.3_Splice_Site_p.L618I|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Splice_Site_p.L713I	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CGGGACCACACGTAAGTCTTG	0.502																																						dbGAP											0													161.0	130.0	141.0					8																	121239591		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2137+1C>A	8.37:g.121239591C>A				Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.L713I	ENST00000297848.3	37	c.2137	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951156	0.53186	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	D;D;D;T	0.87491	-2.16;-2.19;-2.26;0.6	6.03	6.03	0.97812	Fibronectin, type III (1);	0.281504	0.36555	N	0.002531	T	0.74015	0.3661	N	0.08118	0	0.80722	D	1	B;B	0.18863	0.031;0.015	B;B	0.20184	0.028;0.009	T	0.68565	-0.5375	10	0.18276	T	0.48	.	12.6298	0.56651	0.0:0.9239:0.0:0.0761	.	713;713	Q05707-2;Q05707	.;COEA1_HUMAN	I	713;713;618;526	ENSP00000311809:L713I;ENSP00000297848:L713I;ENSP00000247781:L618I;ENSP00000409461:L526I	ENSP00000247781:L618I	L	+	1	0	COL14A1	121308772	0.998000	0.40836	0.998000	0.56505	0.786000	0.44442	1.408000	0.34668	2.868000	0.98415	0.555000	0.69702	CTT	COL14A1	-	superfamily_Fibronectin_type3	ENSG00000187955		0.502	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	40	0.00	0	C	NM_021110	Missense_Mutation	121239591	121239591	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	missense	81	12.90	12	SNP	1.000	A
CROCC	9696	genome.wustl.edu	37	1	17264148	17264148	+	Silent	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:17264148G>C	ENST00000375541.5	+	10	1275	c.1206G>C	c.(1204-1206)ctG>ctC	p.L402L	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGACAGAGCTGGGCCTGGCAG	0.557																																						dbGAP											0													42.0	34.0	37.0					1																	17264148		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1206G>C	1.37:g.17264148G>C				Silent	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.L402	ENST00000375541.5	37	c.1206	CCDS30616.1	1																																																																																			CROCC	-	NULL	ENSG00000058453		0.557	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	46	0.00	0	G	NM_014675		17264148	17264148	+1	no_errors	ENST00000375541	ensembl	human	known	69_37n	silent	46	23.33	14	SNP	0.952	C
CRYM	1428	genome.wustl.edu	37	16	21288827	21288827	+	Silent	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr16:21288827G>A	ENST00000219599.3	-	4	514	c.249C>T	c.(247-249)cgC>cgT	p.R83R	CRYM_ENST00000415987.2_Silent_p.R41R|CRYM_ENST00000543948.1_Silent_p.R83R|CRYM_ENST00000574787.1_5'Flank|CRYM_ENST00000396023.2_Silent_p.R83R	NM_001888.3	NP_001879.1	Q14894	CRYM_HUMAN	crystallin, mu	83					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sensory perception of sound (GO:0007605)|thyroid hormone metabolic process (GO:0042403)|thyroid hormone transport (GO:0070327)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|thiomorpholine-carboxylate dehydrogenase activity (GO:0047127)|thyroid hormone binding (GO:0070324)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(3)	4				GBM - Glioblastoma multiforme(48;0.0573)		AGGTGATGCCGCGGTCCTCGT	0.617																																						dbGAP											0													86.0	65.0	72.0					16																	21288827		2199	4300	6499	-	-	-	SO:0001819	synonymous_variant	0				CCDS10597.1	16p12.2	2013-02-14			ENSG00000103316	ENSG00000103316	1.5.1.25		2418	protein-coding gene	gene with protein product	"""thiomorpholine-carboxylate dehydrogenase"""	123740				1478656, 21332720	Standard	NM_001014444		Approved	DFNA40	uc002dim.3	Q14894	OTTHUMG00000090707	ENST00000219599.3:c.249C>T	16.37:g.21288827G>A			D5MNX0|Q5HYB7	Silent	SNP	pfam_ODC_Mu_crystall,pfam_Shikm_DH/Glu-tRNA_Rdtase,pfam_6PGDH_NADP-bd,pfam_NADP_OxRdtase_F420	p.R83	ENST00000219599.3	37	c.249	CCDS10597.1	16																																																																																			CRYM	-	pfam_ODC_Mu_crystall	ENSG00000103316		0.617	CRYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYM	HGNC	protein_coding	OTTHUMT00000207398.1	19	0.00	0	G			21288827	21288827	-1	no_errors	ENST00000219599	ensembl	human	known	69_37n	silent	14	48.15	13	SNP	0.968	A
CT47B1	643311	genome.wustl.edu	37	X	120009232	120009234	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chrX:120009232_120009234delTCC	ENST00000371311.3	-	1	545_547	c.291_293delGGA	c.(289-294)gaggaa>gaa	p.97_98EE>E		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	97	Poly-Glu.									breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						gttcccctcttcctcctcctcct	0.69														11	0.00291391	0.0	0.0	3775	,	,		12235	0.0		0.0099	False		,,,				2504	0.001					dbGAP											0										33,3157		4,18,7,1330,479						0.2	0.0			60	187,5428		14,105,54,1882,1559	no	coding	CT47B1	NM_001145718.1		18,123,61,3212,2038	A1A1,A1R,A1,RR,R		3.3304,1.0345,2.4986				220,8585				-	-	-	SO:0001651	inframe_deletion	0				CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.291_293delGGA	X.37:g.120009241_120009243delTCC	ENSP00000360360:p.Glu99del		A6NM97	In_Frame_Del	DEL	NULL	p.E99in_frame_del	ENST00000371311.3	37	c.293_291	CCDS48161.1	X																																																																																			CT47B1	-	NULL	ENSG00000236446		0.690	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CT47B1	HGNC	protein_coding	OTTHUMT00000058121.1	11	0.00	0	TCC	NM_001145718		120009232	120009234	-1	no_errors	ENST00000371311	ensembl	human	known	69_37n	in_frame_del	13	40.91	9	DEL	0.000:0.000:0.000	-
DCLK2	166614	genome.wustl.edu	37	4	151153843	151153843	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr4:151153843C>G	ENST00000296550.7	+	10	2183	c.1429C>G	c.(1429-1431)Ctc>Gtc	p.L477V	DCLK2_ENST00000302176.8_Missense_Mutation_p.L494V|DCLK2_ENST00000506325.1_Missense_Mutation_p.L476V	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	477	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L494I(1)|p.L477I(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					GGGTGGAGATCTCTTTGATGC	0.438																																					GBM(195;186 2215 13375 16801 37459)	dbGAP											2	Substitution - Missense(2)	large_intestine(2)											219.0	194.0	202.0					4																	151153843		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1429C>G	4.37:g.151153843C>G	ENSP00000296550:p.Leu477Val		C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_cat_dom	p.L494V	ENST00000296550.7	37	c.1480	CCDS34076.1	4	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185755	0.78789	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	T;T;T	0.72725	-0.68;-0.68;-0.68	6.02	6.02	0.97574	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85128	0.5626	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	0.996;0.99;1.0	D	0.86607	0.1870	10	0.87932	D	0	.	13.7	0.62602	0.0:0.93:0.0:0.07	.	494;476;477	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	V	477;476;494	ENSP00000296550:L477V;ENSP00000427235:L476V;ENSP00000303887:L494V	ENSP00000296550:L477V	L	+	1	0	DCLK2	151373293	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.601000	0.54059	2.865000	0.98341	0.655000	0.94253	CTC	DCLK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000170390		0.438	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	HGNC	protein_coding	OTTHUMT00000364952.1	51	0.00	0	C	NM_001040260		151153843	151153843	+1	no_errors	ENST00000302176	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	1.000	G
DNAH9	1770	genome.wustl.edu	37	17	11597316	11597316	+	Splice_Site	SNP	G	G	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr17:11597316G>T	ENST00000262442.4	+	21	4813		c.e21+1		DNAH9_ENST00000454412.2_Splice_Site	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9						cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTCAGGGCAGGTGAGGGTCCG	0.483																																						dbGAP											0													92.0	91.0	91.0					17																	11597316		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4745+1G>T	17.37:g.11597316G>T			A2VCQ8|O15064|O95494|Q9NQ28	Splice_Site	SNP	-	e21+1	ENST00000262442.4	37	c.4745+1	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241178	0.58995	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8424	0.88719	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH9	11538041	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	9.028000	0.93712	2.627000	0.88993	0.655000	0.94253	.	DNAH9	-	-	ENSG00000007174		0.483	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	43	0.00	0	G	NM_001372	Intron	11597316	11597316	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	splice_site	20	50.00	20	SNP	1.000	T
DNAI1	27019	genome.wustl.edu	37	9	34514510	34514510	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr9:34514510G>A	ENST00000242317.4	+	17	1859	c.1688G>A	c.(1687-1689)tGg>tAg	p.W563*		NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	563					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		AGCTCCGACTGGACAGTGAAG	0.587									Kartagener syndrome																													dbGAP											0													125.0	117.0	119.0					9																	34514510		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.1688G>A	9.37:g.34514510G>A	ENSP00000242317:p.Trp563*		B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W563*	ENST00000242317.4	37	c.1688	CCDS6557.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.457562|4.457562	0.84317|0.84317	.|.	.|.	ENSG00000122735|ENSG00000122735	ENST00000442556|ENST00000379040;ENST00000242317	.|.	.|.	.|.	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.45337|.	0.1337|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34477|.	-0.9827|.	4|.	.|0.02654	.|T	.|1	.|.	17.0407|17.0407	0.86488|0.86488	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	R|X	67|119;563	.|.	.|ENSP00000242317:W563X	G|W	+|+	1|2	0|0	DNAI1|DNAI1	34504510|34504510	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	6.425000|6.425000	0.73370|0.73370	2.619000|2.619000	0.88677|0.88677	0.561000|0.561000	0.74099|0.74099	GGA|TGG	DNAI1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000122735		0.587	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAI1	HGNC	protein_coding	OTTHUMT00000052192.1	27	0.00	0	G			34514510	34514510	+1	no_errors	ENST00000242317	ensembl	human	known	69_37n	nonsense	27	42.55	20	SNP	1.000	A
DSPP	1834	genome.wustl.edu	37	4	88537096	88537096	+	Silent	SNP	T	T	C	rs200276196		TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr4:88537096T>C	ENST00000282478.7	+	4	3315	c.3282T>C	c.(3280-3282)agT>agC	p.S1094S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1094S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1094	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcaatagcagtgacagcagcg	0.547																																						dbGAP											0													17.0	25.0	22.0					4																	88537096		895	1802	2697	-	-	-	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3282T>C	4.37:g.88537096T>C			A8MUI0|O95815	Silent	SNP	NULL	p.S1094	ENST00000282478.7	37	c.3282	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	12	0.00	0	T	NM_014208		88537096	88537096	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	silent	19	29.63	8	SNP	0.001	C
TRIM59	286827	genome.wustl.edu	37	3	160156484	160156484	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr3:160156484A>C	ENST00000309784.4	-	3	673	c.488T>G	c.(487-489)cTt>cGt	p.L163R	RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.L163R|TRIM59_ENST00000543469.1_Missense_Mutation_p.L163R	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	163					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CTTTTCAATAAGATGGGTAAG	0.373																																						dbGAP											0													141.0	139.0	139.0					3																	160156484		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.488T>G	3.37:g.160156484A>C	ENSP00000311219:p.Leu163Arg		A8K5G9|D3DNL9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L163R	ENST00000309784.4	37	c.488	CCDS3190.1	3	.	.	.	.	.	.	.	.	.	.	A	10.68	1.418263	0.25552	.	.	ENSG00000213186	ENST00000543469;ENST00000309784;ENST00000479460	T;T;T	0.26810	1.9;1.71;1.96	5.77	5.77	0.91146	.	0.274138	0.36482	N	0.002561	T	0.28830	0.0715	M	0.62723	1.935	0.27023	N	0.964416	B	0.23735	0.09	B	0.27170	0.077	T	0.15065	-1.0450	9	.	.	.	-17.458	12.9032	0.58137	0.7942:0.2058:0.0:0.0	.	163	Q8IWR1	TRI59_HUMAN	R	163	ENSP00000444313:L163R;ENSP00000311219:L163R;ENSP00000417081:L163R	.	L	-	2	0	TRIM59	161639178	0.989000	0.36119	0.922000	0.36590	0.587000	0.36485	4.177000	0.58276	2.200000	0.70718	0.459000	0.35465	CTT	RP11-432B6.3	-	NULL	ENSG00000248710		0.373	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000248710	Clone_based_vega_gene	protein_coding	OTTHUMT00000352963.1	62	0.00	0	A	NM_173084		160156484	160156484	-1	no_errors	ENST00000483754	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	0.443	C
ERMP1	79956	genome.wustl.edu	37	9	5805055	5805055	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr9:5805055C>A	ENST00000339450.5	-	10	1975	c.1886G>T	c.(1885-1887)gGc>gTc	p.G629V	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000543230.1_Missense_Mutation_p.G207V|ERMP1_ENST00000381506.3_Intron	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	629						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		CATTGTACAGCCAGCCAAAAT	0.373																																						dbGAP											0													84.0	77.0	79.0					9																	5805055		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.1886G>T	9.37:g.5805055C>A	ENSP00000340427:p.Gly629Val		B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.G629V	ENST00000339450.5	37	c.1886	CCDS34983.1	9	.	.	.	.	.	.	.	.	.	.	C	0.873	-0.731373	0.03135	.	.	ENSG00000099219	ENST00000339450;ENST00000543230	T;T	0.20881	2.04;2.04	5.7	0.904	0.19302	.	0.564531	0.19489	N	0.113031	T	0.07908	0.0198	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38845	-0.9642	10	0.14252	T	0.57	-2.6371	10.3043	0.43672	0.3848:0.4464:0.1688:0.0	.	629	Q7Z2K6	ERMP1_HUMAN	V	629;207	ENSP00000340427:G629V;ENSP00000439368:G207V	ENSP00000340427:G629V	G	-	2	0	ERMP1	5795055	0.004000	0.15560	0.383000	0.26132	0.857000	0.48899	0.386000	0.20702	0.258000	0.21686	0.591000	0.81541	GGC	ERMP1	-	NULL	ENSG00000099219		0.373	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMP1	HGNC	protein_coding	OTTHUMT00000354877.1	52	0.00	0	C	NM_024896		5805055	5805055	-1	no_errors	ENST00000339450	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.001	A
ESF1	51575	genome.wustl.edu	37	20	13699616	13699616	+	Missense_Mutation	SNP	G	G	C	rs552139164	byFrequency	TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr20:13699616G>C	ENST00000202816.1	-	12	2161	c.2054C>G	c.(2053-2055)tCg>tGg	p.S685W		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	685	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						AGATTTTACCGATTTTTTATT	0.308																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.2054C>G	20.37:g.13699616G>C	ENSP00000202816:p.Ser685Trp		Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	pfam_NUC153	p.S685W	ENST00000202816.1	37	c.2054	CCDS13117.1	20	.	.	.	.	.	.	.	.	.	.	G	18.14	3.557584	0.65425	.	.	ENSG00000089048	ENST00000202816	T	0.25912	1.77	5.4	5.4	0.78164	.	0.460555	0.20673	N	0.087795	T	0.51719	0.1691	M	0.72894	2.215	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.51419	-0.8708	10	0.72032	D	0.01	1.3943	16.2668	0.82588	0.0:0.0:1.0:0.0	.	685	Q9H501	ESF1_HUMAN	W	685	ENSP00000202816:S685W	ENSP00000202816:S685W	S	-	2	0	ESF1	13647616	0.999000	0.42202	0.994000	0.49952	0.858000	0.48976	3.580000	0.53907	2.686000	0.91538	0.591000	0.81541	TCG	ESF1	-	NULL	ENSG00000089048		0.308	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESF1	HGNC	protein_coding	OTTHUMT00000078049.1	77	0.00	0	G	NM_016649		13699616	13699616	-1	no_errors	ENST00000202816	ensembl	human	known	69_37n	missense	108	27.52	41	SNP	0.997	C
FAM105A	54491	genome.wustl.edu	37	5	14609028	14609028	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr5:14609028C>G	ENST00000274217.3	+	7	919	c.799C>G	c.(799-801)Ctt>Gtt	p.L267V		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	267	OTU.									large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					CATTCCCAGTCTTTTTAGACT	0.388																																						dbGAP											0													110.0	113.0	112.0					5																	14609028		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.799C>G	5.37:g.14609028C>G	ENSP00000274217:p.Leu267Val		Q53H50|Q9H037	Missense_Mutation	SNP	prints_FAM105,prints_FAM105A	p.L267V	ENST00000274217.3	37	c.799	CCDS3884.1	5	.	.	.	.	.	.	.	.	.	.	C	11.97	1.798910	0.31777	.	.	ENSG00000145569	ENST00000274217	T	0.19669	2.13	4.89	4.02	0.46733	.	0.319686	0.26836	N	0.022260	T	0.18257	0.0438	L	0.44542	1.39	0.09310	N	1	P	0.46142	0.873	B	0.41510	0.359	T	0.10660	-1.0620	10	0.62326	D	0.03	-7.649	8.0371	0.30499	0.0:0.7527:0.0:0.2473	.	267	Q9NUU6	F105A_HUMAN	V	267	ENSP00000274217:L267V	ENSP00000274217:L267V	L	+	1	0	FAM105A	14662028	0.958000	0.32768	0.062000	0.19696	0.995000	0.86356	2.584000	0.46102	1.044000	0.40200	0.585000	0.79938	CTT	FAM105A	-	prints_FAM105	ENSG00000145569		0.388	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM105A	HGNC	protein_coding	OTTHUMT00000253710.1	54	0.00	0	C	NM_019018		14609028	14609028	+1	no_errors	ENST00000274217	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	0.026	G
FAM13B	51306	genome.wustl.edu	37	5	137292177	137292177	+	Intron	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr5:137292177C>G	ENST00000033079.3	-	14	1893				FAM13B_ENST00000420893.2_Intron|FAM13B_ENST00000425075.2_Missense_Mutation_p.R381T	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						CTCCCCATCTCTCTGCAGATG	0.378																																						dbGAP											0													76.0	68.0	70.0					5																	137292177		1871	4094	5965	-	-	-	SO:0001627	intron_variant	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1442-2112G>C	5.37:g.137292177C>G			D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,pfscan_RhoGAP_dom	p.R381T	ENST00000033079.3	37	c.1142	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101395	0.56183	.	.	ENSG00000031003	ENST00000425075	T	0.21932	1.98	6.16	6.16	0.99307	.	.	.	.	.	T	0.25938	0.0632	N	0.08118	0	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	T	0.11348	-1.0591	9	0.09338	T	0.73	.	19.0404	0.92997	0.0:1.0:0.0:0.0	.	381	G3V0H9	.	T	381	ENSP00000394669:R381T	ENSP00000394669:R381T	R	-	2	0	FAM13B	137320076	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.579000	0.53900	2.937000	0.99478	0.650000	0.86243	AGA	FAM13B	-	NULL	ENSG00000031003		0.378	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	68	0.00	0	C			137292177	137292177	-1	no_errors	ENST00000425075	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	1.000	G
FAM184A	79632	genome.wustl.edu	37	6	119337997	119337997	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr6:119337997G>C	ENST00000338891.7	-	5	1888	c.1445C>G	c.(1444-1446)aCt>aGt	p.T482S	FAM184A_ENST00000368475.4_Missense_Mutation_p.T362S|FAM184A_ENST00000522284.1_Missense_Mutation_p.T362S|FAM184A_ENST00000521531.1_Missense_Mutation_p.T482S|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000352896.5_Missense_Mutation_p.T362S	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	482						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TTCTTCCAAAGTCTTAGAATG	0.373																																						dbGAP											0													135.0	129.0	131.0					6																	119337997		1827	4084	5911	-	-	-	SO:0001583	missense	0			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1445C>G	6.37:g.119337997G>C	ENSP00000342604:p.Thr482Ser		B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	superfamily_Prefoldin	p.T482S	ENST00000338891.7	37	c.1445	CCDS43499.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.118999|4.118999	0.77323|0.77323	.|.	.|.	ENSG00000111879|ENSG00000111879	ENST00000448815|ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284	.|T;T;T;T;T	.|0.00358	.|7.88;7.88;7.88;7.88;7.88	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	.|0.100284	.|0.64402	.|D	.|0.000002	T|T	0.00241|0.00241	0.0007|0.0007	L|L	0.45581|0.45581	1.43|1.43	0.51767|0.51767	D|D	0.999938|0.999938	.|D;P;D	.|0.61080	.|0.986;0.933;0.989	.|P;B;P	.|0.54544	.|0.689;0.437;0.755	D|D	0.93529|0.93529	0.6868|0.6868	5|10	.|0.15066	.|T	.|0.55	-9.7793|-9.7793	18.6868|18.6868	0.91567|0.91567	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|482;362;482	.|Q8NB25-2;F8W8D6;Q8NB25	.|.;.;F184A_HUMAN	V|S	68|482;362;362;482;362	.|ENSP00000342604:T482S;ENSP00000326608:T362S;ENSP00000357460:T362S;ENSP00000430442:T482S;ENSP00000429826:T362S	.|ENSP00000342604:T482S	L|T	-|-	1|2	0|0	FAM184A|FAM184A	119379696|119379696	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	7.190000|7.190000	0.77755|0.77755	2.433000|2.433000	0.82419|0.82419	0.491000|0.491000	0.48974|0.48974	CTT|ACT	FAM184A	-	NULL	ENSG00000111879		0.373	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184A	HGNC	protein_coding	OTTHUMT00000042009.3	87	0.00	0	G	NM_024581		119337997	119337997	-1	no_errors	ENST00000338891	ensembl	human	known	69_37n	missense	90	20.35	23	SNP	1.000	C
FAM65C	140876	genome.wustl.edu	37	20	49232576	49232576	+	Missense_Mutation	SNP	G	G	A	rs373108831		TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr20:49232576G>A	ENST00000327979.2	-	4	710	c.299C>T	c.(298-300)tCt>tTt	p.S100F	FAM65C_ENST00000535356.1_Missense_Mutation_p.S104F|FAM65C_ENST00000045083.2_Missense_Mutation_p.S100F|MIR1302-5_ENST00000408164.1_RNA			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	100										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GTGGCGTCCAGACAGGTGGTC	0.537																																						dbGAP											0													102.0	88.0	93.0					20																	49232576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.299C>T	20.37:g.49232576G>A	ENSP00000332663:p.Ser100Phe		Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.S104F	ENST00000327979.2	37	c.311	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901322	0.52227	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02236	4.38;4.38;4.38	5.07	3.04	0.35103	.	0.415293	0.26863	N	0.022107	T	0.05731	0.0150	L	0.59436	1.845	0.09310	N	1	P;P	0.43633	0.809;0.813	P;P	0.51385	0.575;0.668	T	0.10497	-1.0627	10	0.66056	D	0.02	-2.0122	8.7243	0.34460	0.0858:0.2978:0.6165:0.0	.	104;100	F5H0X2;Q96MK2	.;FA65C_HUMAN	F	100;100;104	ENSP00000332663:S100F;ENSP00000045083:S100F;ENSP00000439802:S104F	ENSP00000045083:S100F	S	-	2	0	FAM65C	48665983	0.069000	0.21087	0.649000	0.29536	0.794000	0.44872	1.498000	0.35660	0.486000	0.27676	0.555000	0.69702	TCT	FAM65C	-	NULL	ENSG00000042062		0.537	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	55	0.00	0	G			49232576	49232576	-1	no_errors	ENST00000535356	ensembl	human	known	69_37n	missense	97	11.82	13	SNP	0.119	A
FBXW7	55294	genome.wustl.edu	37	4	153250888	153250888	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr4:153250888C>T	ENST00000281708.4	-	8	2401	c.1172G>A	c.(1171-1173)gGt>gAt	p.G391D	FBXW7_ENST00000393956.3_Missense_Mutation_p.G215D|FBXW7_ENST00000603841.1_Missense_Mutation_p.G391D|FBXW7_ENST00000296555.5_Missense_Mutation_p.G273D|FBXW7_ENST00000603548.1_Missense_Mutation_p.G391D|FBXW7_ENST00000263981.5_Missense_Mutation_p.G311D	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	391					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TATTCGGTTACCACAAAACTG	0.343			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											119.0	108.0	112.0					4																	153250888		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1172G>A	4.37:g.153250888C>T	ENSP00000281708:p.Gly391Asp		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G391D	ENST00000281708.4	37	c.1172	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347696	0.61183	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.99	5.99	0.97316	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66645	0.2810	M	0.70903	2.155	0.80722	D	1	P;P;P;P	0.48350	0.909;0.849;0.889;0.818	P;P;B;B	0.49252	0.531;0.604;0.396;0.396	T	0.60255	-0.7299	10	0.17369	T	0.5	-19.7539	20.5373	0.99239	0.0:1.0:0.0:0.0	.	215;391;273;311	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	D	391;273;311;215	ENSP00000281708:G391D;ENSP00000296555:G273D;ENSP00000263981:G311D;ENSP00000377528:G215D	ENSP00000263981:G311D	G	-	2	0	FBXW7	153470338	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.768000	0.85345	2.857000	0.98124	0.650000	0.86243	GGT	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.343	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	42	0.00	0	C			153250888	153250888	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	missense	19	54.76	23	SNP	1.000	T
FCRL3	115352	genome.wustl.edu	37	1	157648560	157648560	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:157648560T>A	ENST00000368184.3	-	15	2436	c.2145A>T	c.(2143-2145)gaA>gaT	p.E715D	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Missense_Mutation_p.E715D	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	715						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CATCATCTTCTTCATGGGCCC	0.502																																						dbGAP											0													156.0	134.0	141.0					1																	157648560		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.2145A>T	1.37:g.157648560T>A	ENSP00000357167:p.Glu715Asp		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E715D	ENST00000368184.3	37	c.2145	CCDS1167.1	1	.	.	.	.	.	.	.	.	.	.	T	10.05	1.245067	0.22796	.	.	ENSG00000160856	ENST00000368186;ENST00000368184	T;T	0.51325	0.73;0.71	3.55	1.21	0.21127	.	.	.	.	.	T	0.32376	0.0827	L	0.57536	1.79	0.09310	N	1	D;P;D	0.60160	0.978;0.941;0.987	P;B;P	0.56916	0.649;0.303;0.809	T	0.10989	-1.0606	9	0.18710	T	0.47	.	5.2964	0.15754	0.0:0.2428:0.0:0.7572	.	715;620;715	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	D	715	ENSP00000357169:E715D;ENSP00000357167:E715D	ENSP00000357167:E715D	E	-	3	2	FCRL3	155915184	0.190000	0.23276	0.002000	0.10522	0.004000	0.04260	1.432000	0.34936	0.227000	0.20999	0.533000	0.62120	GAA	FCRL3	-	NULL	ENSG00000160856		0.502	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	70	0.00	0	T	NM_052939		157648560	157648560	-1	no_errors	ENST00000368186	ensembl	human	known	69_37n	missense	133	13.07	20	SNP	0.002	A
GAB3	139716	genome.wustl.edu	37	X	153908516	153908516	+	Silent	SNP	G	G	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chrX:153908516G>T	ENST00000369575.3	-	9	1568	c.1537C>A	c.(1537-1539)Cga>Aga	p.R513R	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Silent_p.R514R	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	513					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTGGCTGTTCGGTGCTCCTCC	0.512																																						dbGAP											0													126.0	116.0	119.0					X																	153908516		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1537C>A	X.37:g.153908516G>T			A6NHF8|E9PB44	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R514	ENST00000369575.3	37	c.1540	CCDS14760.1	X																																																																																			GAB3	-	NULL	ENSG00000160219		0.512	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	34	0.00	0	G	NM_001081573		153908516	153908516	-1	no_errors	ENST00000424127	ensembl	human	known	69_37n	silent	29	21.05	8	SNP	0.004	T
GBP4	115361	genome.wustl.edu	37	1	89660995	89660995	+	Silent	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:89660995C>G	ENST00000355754.6	-	3	445	c.348G>C	c.(346-348)ctG>ctC	p.L116L		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	116	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		CTACATCGCCCAGGCCCTCGG	0.507																																						dbGAP											0													112.0	106.0	108.0					1																	89660995		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.348G>C	1.37:g.89660995C>G			B2R630|Q05D63|Q6NSL0|Q86T99	Silent	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C	p.L116	ENST00000355754.6	37	c.348	CCDS721.1	1																																																																																			GBP4	-	pfam_Guanylate-bd_N	ENSG00000162654		0.507	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	50	0.00	0	C	NM_052941		89660995	89660995	-1	no_errors	ENST00000355754	ensembl	human	known	69_37n	silent	51	17.74	11	SNP	0.993	G
PAXBP1	94104	genome.wustl.edu	37	21	34117167	34117167	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr21:34117167C>G	ENST00000331923.4	-	13	2315	c.2126G>C	c.(2125-2127)gGa>gCa	p.G709A	PAXBP1_ENST00000290178.4_Missense_Mutation_p.G709A|PAXBP1-AS1_ENST00000440052.1_RNA	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	709				Missing (in Ref. 5; AAD34617). {ECO:0000305}.	muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TAGTGTAATTCCCACCATTCT	0.313																																						dbGAP											0													109.0	120.0	116.0					21																	34117167		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.2126G>C	21.37:g.34117167C>G	ENSP00000328992:p.Gly709Ala		D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	pfam_GCFC_dom	p.G709A	ENST00000331923.4	37	c.2126	CCDS13619.1	21	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786621	0.31593	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.39406	1.08;1.08	6.17	6.17	0.99709	GC-rich sequence DNA-binding factor domain (1);	0.153604	0.52532	D	0.000063	T	0.19644	0.0472	N	0.03608	-0.345	0.39738	D	0.971718	B;B;B	0.14012	0.009;0.0;0.0	B;B;B	0.16722	0.016;0.001;0.001	T	0.15321	-1.0441	10	0.02654	T	1	-25.6861	14.9231	0.70856	0.0:0.7554:0.2446:0.0	.	709;709;218	Q9Y5B6-2;Q9Y5B6;B3KSC0	.;GCFC1_HUMAN;.	A	709	ENSP00000328992:G709A;ENSP00000290178:G709A	ENSP00000290178:G709A	G	-	2	0	GCFC1	33039038	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.737000	0.38197	2.941000	0.99782	0.655000	0.94253	GGA	GCFC1	-	pfam_GCFC_dom	ENSG00000159086		0.313	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCFC1	HGNC	protein_coding	OTTHUMT00000139563.1	74	0.00	0	C	NM_013329		34117167	34117167	-1	no_errors	ENST00000331923	ensembl	human	known	69_37n	missense	60	11.76	8	SNP	0.998	G
GPR149	344758	genome.wustl.edu	37	3	154147332	154147332	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr3:154147332G>T	ENST00000389740.2	-	1	172	c.73C>A	c.(73-75)Ctt>Att	p.L25I		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	25					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GGATTTAAAAGGTCCGTAGAA	0.373																																						dbGAP											0													79.0	78.0	78.0					3																	154147332		1834	4085	5919	-	-	-	SO:0001583	missense	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.73C>A	3.37:g.154147332G>T	ENSP00000374390:p.Leu25Ile			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L25I	ENST00000389740.2	37	c.73	CCDS43162.1	3	.	.	.	.	.	.	.	.	.	.	G	11.70	1.718034	0.30503	.	.	ENSG00000174948	ENST00000389740	T	0.37584	1.19	5.06	2.19	0.27852	.	0.540943	0.19419	N	0.114741	T	0.19604	0.0471	N	0.19112	0.55	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.09907	-1.0653	10	0.46703	T	0.11	-2.1974	4.6101	0.12399	0.1818:0.0:0.4514:0.3668	.	25	Q86SP6	GP149_HUMAN	I	25	ENSP00000374390:L25I	ENSP00000374390:L25I	L	-	1	0	GPR149	155630026	0.192000	0.23301	0.701000	0.30321	0.967000	0.64934	0.937000	0.28951	1.362000	0.46000	0.655000	0.94253	CTT	GPR149	-	NULL	ENSG00000174948		0.373	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	35	0.00	0	G	XM_293580		154147332	154147332	-1	no_errors	ENST00000389740	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	0.019	T
GPR98	84059	genome.wustl.edu	37	5	90049486	90049486	+	Silent	SNP	C	C	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr5:90049486C>A	ENST00000405460.2	+	54	11313	c.11217C>A	c.(11215-11217)ctC>ctA	p.L3739L		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3739	Calx-beta 24. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTGTAACCCTCACCCGTATCA	0.408																																						dbGAP											0													101.0	98.0	99.0					5																	90049486		1877	4123	6000	-	-	-	SO:0001819	synonymous_variant	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11217C>A	5.37:g.90049486C>A			O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR	p.S1305*	ENST00000405460.2	37	c.3914	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	C	0.040	-1.287333	0.01387	.	.	ENSG00000164199	ENST00000509621	.	.	.	5.53	0.224	0.15297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.7377	0.02945	0.2322:0.4326:0.1139:0.2213	.	.	.	.	X	1305	.	.	S	+	2	0	GPR98	90085242	0.000000	0.05858	0.280000	0.24747	0.061000	0.15899	-0.669000	0.05262	0.267000	0.21916	0.557000	0.71058	TCA	GPR98	-	NULL	ENSG00000164199		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	66	0.00	0	C	NM_032119		90049486	90049486	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000509621	ensembl	human	putative	69_37n	nonsense	19	47.22	17	SNP	0.121	A
HOXB3	3213	genome.wustl.edu	37	17	46629656	46629656	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr17:46629656C>T	ENST00000470495.1	-	1	1628	c.181G>A	c.(181-183)Gcc>Acc	p.A61T	HOXB3_ENST00000311626.4_Missense_Mutation_p.A61T|HOXB3_ENST00000485909.2_Intron|HOXB-AS1_ENST00000435312.1_RNA|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000472863.1_5'UTR|HOXB3_ENST00000476342.1_Missense_Mutation_p.A61T|HOXB-AS1_ENST00000508688.1_RNA|HOXB3_ENST00000498678.1_Missense_Mutation_p.A61T|HOXB3_ENST00000460160.1_Intron|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000490677.1_Intron|HOXB3_ENST00000489475.1_5'UTR			P14651	HXB3_HUMAN	homeobox B3	61					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						GCATGTGGGGCAGCGTTGCCC	0.706																																						dbGAP											0													27.0	33.0	31.0					17																	46629656		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.181G>A	17.37:g.46629656C>T	ENSP00000417207:p.Ala61Thr		A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.A61T	ENST00000470495.1	37	c.181	CCDS11528.1	17	.	.	.	.	.	.	.	.	.	.	C	5.093	0.202737	0.09652	.	.	ENSG00000120093	ENST00000470495;ENST00000311626;ENST00000498678;ENST00000476342	D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84	4.05	3.03	0.35002	.	0.628839	0.15361	N	0.266410	D	0.84620	0.5512	L	0.39397	1.21	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.78386	-0.2224	10	0.38643	T	0.18	.	8.2967	0.31990	0.0:0.7781:0.0:0.2219	.	61	P14651	HXB3_HUMAN	T	61	ENSP00000417207:A61T;ENSP00000308252:A61T;ENSP00000420595:A61T;ENSP00000418892:A61T	ENSP00000308252:A61T	A	-	1	0	HOXB3	43984655	0.614000	0.27017	0.995000	0.50966	0.006000	0.05464	-0.003000	0.12901	0.946000	0.37632	0.561000	0.74099	GCC	HOXB3	-	NULL	ENSG00000120093		0.706	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB3	HGNC	protein_coding	OTTHUMT00000358261.1	13	0.00	0	C			46629656	46629656	-1	no_errors	ENST00000311626	ensembl	human	known	69_37n	missense	9	64.00	16	SNP	0.974	T
HRNR	388697	genome.wustl.edu	37	1	152186041	152186042	+	Frame_Shift_Ins	INS	-	-	GG	rs12751022|rs555234935	byFrequency	TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:152186041_152186042insGG	ENST00000368801.2	-	3	8138_8139	c.8063_8064insCC	c.(8062-8064)ttgfs	p.L2688fs	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2688				L -> S (in Ref. 1; BAC57496). {ECO:0000305}.	establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L2688S(1)|p.L2688F(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGAGTGACCCAAGCGAGACTC	0.584																																						dbGAP											2	Substitution - Missense(2)	prostate(1)|lung(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8063_8064insCC	1.37:g.152186041_152186042insGG	ENSP00000357791:p.Leu2688fs		Q5DT20|Q5U1F4	Frame_Shift_Ins	INS	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.L2688fs	ENST00000368801.2	37	c.8064_8063	CCDS30859.1	1																																																																																			HRNR	-	NULL	ENSG00000197915		0.584	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	8	0.00	0	-	XM_373868		152186041	152186042	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.000:0.000	GG
HYDIN	54768	genome.wustl.edu	37	16	71101180	71101180	+	Intron	SNP	T	T	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr16:71101180T>C	ENST00000393567.2	-	15	2226				HYDIN_ENST00000541601.1_Intron|HYDIN_ENST00000288168.10_Silent_p.P713P|HYDIN_ENST00000448089.2_Intron|HYDIN_ENST00000393550.2_Intron|HYDIN_ENST00000321489.5_Intron|HYDIN_ENST00000448691.1_Intron|HYDIN_ENST00000543639.1_5'Flank|HYDIN_ENST00000538248.1_Intron	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein						cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AAGAGCAAGCTGGGGAGCAAT	0.587																																						dbGAP											0													42.0	36.0	38.0					16																	71101180		2197	4298	6495	-	-	-	SO:0001627	intron_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2075+12A>G	16.37:g.71101180T>C			A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like	p.P713	ENST00000393567.2	37	c.2139	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.587	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	13	0.00	0	T			71101180	71101180	-1	no_errors	ENST00000288168	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	0.016	C
IFT20	90410	genome.wustl.edu	37	17	26658938	26658938	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr17:26658938T>A	ENST00000585313.1	-	3	211	c.74A>T	c.(73-75)gAg>gTg	p.E25V	IFT20_ENST00000579419.1_Missense_Mutation_p.E25V|IFT20_ENST00000585089.1_Missense_Mutation_p.E51V|IFT20_ENST00000578985.1_Missense_Mutation_p.E51V|IFT20_ENST00000357896.3_Missense_Mutation_p.E25V|IFT20_ENST00000395418.3_Missense_Mutation_p.E25V|IFT20_ENST00000578122.1_Missense_Mutation_p.E51V	NM_001267775.1	NP_001254704.1	Q8IY31	IFT20_HUMAN	intraflagellar transport 20	25					cardiac muscle cell differentiation (GO:0055007)|centrosome localization (GO:0051642)|cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|kidney development (GO:0001822)|neural precursor cell proliferation (GO:0061351)|opsin transport (GO:0036372)|photoreceptor cell outer segment organization (GO:0035845)|protein localization to cilium (GO:0061512)|protein localization to Golgi apparatus (GO:0034067)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cilium assembly (GO:1902017)|smoothened signaling pathway (GO:0007224)|visual learning (GO:0008542)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				lung(2)	2	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		CTGGGTAACCTCTGGGTCCAA	0.502																																						dbGAP											0													282.0	217.0	239.0					17																	26658938		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070643	CCDS32593.1, CCDS58533.1, CCDS58534.1, CCDS58535.1, CCDS74017.1	17q11.2	2014-07-03	2014-07-03			ENSG00000109083		"""Intraflagellar transport homologs"""	30989	protein-coding gene	gene with protein product		614394	"""intraflagellar transport 20 homolog (Chlamydomonas)"""				Standard	NM_001267774		Approved		uc002hau.2	Q8IY31		ENST00000585313.1:c.74A>T	17.37:g.26658938T>A	ENSP00000463138:p.Glu25Val		J3QL09|Q5GLZ2|Q9BUG5	Missense_Mutation	SNP	NULL	p.E51V	ENST00000585313.1	37	c.152	CCDS58534.1	17	.	.	.	.	.	.	.	.	.	.	T	19.10	3.761499	0.69763	.	.	ENSG00000109083	ENST00000357896;ENST00000395418;ENST00000322326	T	0.27104	1.69	5.75	5.75	0.90469	.	0.092907	0.64402	D	0.000001	T	0.52208	0.1720	.	.	.	0.54753	D	0.999989	D;P;D;D	0.76494	0.999;0.937;0.991;0.98	D;P;D;P	0.71656	0.974;0.448;0.914;0.731	T	0.55976	-0.8055	9	0.62326	D	0.03	.	15.2475	0.73517	0.0:0.0:0.0:1.0	.	51;25;51;25	B7Z4S6;Q8IY31;Q8IY31-2;Q8IY31-3	.;IFT20_HUMAN;.;.	V	25;25;51	ENSP00000350570:E25V	ENSP00000318136:E51V	E	-	2	0	IFT20	23683065	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.544000	0.67231	2.201000	0.70794	0.533000	0.62120	GAG	IFT20	-	NULL	ENSG00000109083		0.502	IFT20-008	NOVEL	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	IFT20	HGNC	protein_coding	OTTHUMT00000446153.2	85	0.00	0	T	NM_174887		26658938	26658938	-1	no_errors	ENST00000585089	ensembl	human	known	69_37n	missense	70	42.74	53	SNP	1.000	A
INTS12	57117	genome.wustl.edu	37	4	106614625	106614625	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr4:106614625C>T	ENST00000451321.2	-	4	807	c.328G>A	c.(328-330)Gaa>Aaa	p.E110K	INTS12_ENST00000340139.5_Missense_Mutation_p.E110K|INTS12_ENST00000394735.1_Missense_Mutation_p.E110K	NM_001142471.1	NP_001135943.1	Q96CB8	INT12_HUMAN	integrator complex subunit 12	110					snRNA processing (GO:0016180)	integrator complex (GO:0032039)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		TCAACTCCTTCAGTGATGTCT	0.378																																						dbGAP											0													169.0	174.0	172.0					4																	106614625		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3671.1	4q24	2013-01-28	2006-03-15	2006-03-15	ENSG00000138785	ENSG00000138785		"""Zinc fingers, PHD-type"""	25067	protein-coding gene	gene with protein product	"""hypothetical nuclear factor SBBI22"""	611355	"""PHD finger protein 22"""	PHF22		16239144	Standard	NM_020395		Approved	SBBI22, INT12	uc010ilr.3	Q96CB8	OTTHUMG00000131215	ENST00000451321.2:c.328G>A	4.37:g.106614625C>T	ENSP00000415433:p.Glu110Lys		B2RC48|Q3B6Z3|Q9HD71	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E110K	ENST00000451321.2	37	c.328	CCDS3671.1	4	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764142	0.89932	.	.	ENSG00000138785	ENST00000394735;ENST00000340139;ENST00000451321;ENST00000503746;ENST00000420368	T;T;T	0.52526	0.66;0.66;0.66	5.93	5.1	0.69264	.	0.198569	0.52532	D	0.000080	T	0.41971	0.1182	L	0.50333	1.59	0.58432	D	0.999996	B	0.06786	0.001	B	0.10450	0.005	T	0.28073	-1.0055	10	0.14252	T	0.57	-30.3456	14.9807	0.71309	0.0:0.932:0.0:0.068	.	110	Q96CB8	INT12_HUMAN	K	110	ENSP00000378221:E110K;ENSP00000340737:E110K;ENSP00000415433:E110K	ENSP00000340737:E110K	E	-	1	0	INTS12	106834074	1.000000	0.71417	0.903000	0.35520	0.889000	0.51656	6.240000	0.72363	1.524000	0.49035	0.591000	0.81541	GAA	INTS12	-	NULL	ENSG00000138785		0.378	INTS12-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	INTS12	HGNC	protein_coding	OTTHUMT00000318624.1	72	0.00	0	C	NM_020395		106614625	106614625	-1	no_errors	ENST00000340139	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	0.998	T
IREB2	3658	genome.wustl.edu	37	15	78790455	78790455	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr15:78790455A>C	ENST00000258886.8	+	22	3011	c.2862A>C	c.(2860-2862)ttA>ttC	p.L954F		NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	954					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		ATGGAGGATTATTAAACTTTG	0.373																																					NSCLC(200;764 2208 35157 49871 50830)	dbGAP											0													136.0	126.0	129.0					15																	78790455		2196	4293	6489	-	-	-	SO:0001583	missense	0			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.2862A>C	15.37:g.78790455A>C	ENSP00000258886:p.Leu954Phe		A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.L954F	ENST00000258886.8	37	c.2862	CCDS10302.1	15	.	.	.	.	.	.	.	.	.	.	A	14.53	2.564027	0.45694	.	.	ENSG00000136381	ENST00000258886	T	0.18657	2.2	5.98	2.36	0.29203	Aconitase/3-isopropylmalate dehydratase, swivel (2);	0.534208	0.17666	N	0.166158	T	0.15955	0.0384	L	0.52364	1.645	0.80722	D	1	B	0.32245	0.361	B	0.24006	0.05	T	0.05194	-1.0900	10	0.87932	D	0	.	5.4761	0.16695	0.6543:0.0:0.2044:0.1413	.	954	P48200	IREB2_HUMAN	F	954	ENSP00000258886:L954F	ENSP00000258886:L954F	L	+	3	2	IREB2	76577510	0.998000	0.40836	0.997000	0.53966	0.988000	0.76386	0.541000	0.23207	0.139000	0.18822	-0.346000	0.07831	TTA	IREB2	-	superfamily_Aconitase/3IPM_dehydase_swvl,tigrfam_Aconitase/Fe_reg_prot_2	ENSG00000136381		0.373	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IREB2	HGNC	protein_coding	OTTHUMT00000290109.3	78	0.00	0	A	NM_004136		78790455	78790455	+1	no_errors	ENST00000258886	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	0.997	C
KIF1A	547	genome.wustl.edu	37	2	241700197	241700197	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr2:241700197G>A	ENST00000320389.7	-	24	2460	c.2302C>T	c.(2302-2304)Ccc>Tcc	p.P768S	KIF1A_ENST00000498729.2_Missense_Mutation_p.P777S	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	768					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GCCTCTGGGGGCAGCAGGTCG	0.627																																						dbGAP											0													38.0	44.0	42.0					2																	241700197		1952	4124	6076	-	-	-	SO:0001583	missense	0			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2302C>T	2.37:g.241700197G>A	ENSP00000322791:p.Pro768Ser		B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,prints_Kinesin_motor_dom,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom	p.P777S	ENST00000320389.7	37	c.2329	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362553	0.61403	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.80824	-1.42;-1.42;-1.42	4.94	4.94	0.65067	.	0.061993	0.64402	U	0.000003	T	0.78717	0.4327	M	0.65975	2.015	0.80722	D	1	B;B;B	0.11235	0.004;0.001;0.0	B;B;B	0.16289	0.015;0.004;0.001	T	0.74247	-0.3727	10	0.15952	T	0.53	.	17.7415	0.88408	0.0:0.0:1.0:0.0	.	777;777;768	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	S	768;777;777;777	ENSP00000322791:P768S;ENSP00000438388:P777S;ENSP00000384231:P777S	ENSP00000322791:P768S	P	-	1	0	KIF1A	241348870	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.201000	0.77847	2.302000	0.77476	0.543000	0.68304	CCC	KIF1A	-	NULL	ENSG00000130294		0.627	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	21	0.00	0	G	NM_138483		241700197	241700197	-1	no_errors	ENST00000498729	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	A
KLHL1	57626	genome.wustl.edu	37	13	70535549	70535549	+	Silent	SNP	A	A	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr13:70535549A>G	ENST00000377844.4	-	3	1467	c.708T>C	c.(706-708)taT>taC	p.Y236Y	KLHL1_ENST00000545028.1_Silent_p.Y43Y	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	236	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TGGCCGCAAAATAGTCGGAGA	0.443																																						dbGAP											0													125.0	109.0	114.0					13																	70535549		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.708T>C	13.37:g.70535549A>G			A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.Y236	ENST00000377844.4	37	c.708	CCDS9445.1	13																																																																																			KLHL1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000150361		0.443	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	57	0.00	0	A	NM_020866		70535549	70535549	-1	no_errors	ENST00000377844	ensembl	human	known	69_37n	silent	48	14.29	8	SNP	1.000	G
KRIT1	889	genome.wustl.edu	37	7	91864817	91864817	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr7:91864817T>C	ENST00000340022.2	-	8	1647	c.629A>G	c.(628-630)tAt>tGt	p.Y210C	KRIT1_ENST00000412043.2_Missense_Mutation_p.Y210C|KRIT1_ENST00000394505.2_Missense_Mutation_p.Y210C|KRIT1_ENST00000394503.2_Missense_Mutation_p.Y210C|KRIT1_ENST00000394507.1_Missense_Mutation_p.Y210C	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	210					angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TAGTGCACTATAGCCCATATG	0.378																																						dbGAP											0													201.0	199.0	200.0					7																	91864817		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.629A>G	7.37:g.91864817T>C	ENSP00000344668:p.Tyr210Cys		A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Missense_Mutation	SNP	pfam_FERM_central,superfamily_Ankyrin_rpt-contain_dom,superfamily_FERM_central,smart_Ankyrin_rpt,smart_Band_41_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_FERM_domain	p.Y210C	ENST00000340022.2	37	c.629	CCDS5624.1	7	.	.	.	.	.	.	.	.	.	.	T	22.6	4.313926	0.81358	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503;ENST00000415227;ENST00000458177	T;T;T;T;T;D	0.87029	0.95;0.95;0.95;0.95;-0.63;-2.2	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.90878	0.7134	L	0.47716	1.5	0.80722	D	1	D;D;D	0.76494	0.999;0.99;0.999	D;P;D	0.79784	0.993;0.785;0.993	D	0.91262	0.5037	10	0.52906	T	0.07	5.0078	15.0956	0.72232	0.0:0.0:0.0:1.0	.	210;210;210	A4D1F7;A6NNU0;O00522	.;.;KRIT1_HUMAN	C	210	ENSP00000378015:Y210C;ENSP00000344668:Y210C;ENSP00000410909:Y210C;ENSP00000378013:Y210C;ENSP00000378011:Y210C;ENSP00000391675:Y210C	ENSP00000344668:Y210C	Y	-	2	0	KRIT1	91702753	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.698000	0.84413	1.957000	0.56846	0.377000	0.23210	TAT	KRIT1	-	NULL	ENSG00000001631		0.378	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRIT1	HGNC	protein_coding	OTTHUMT00000253910.1	80	0.00	0	T			91864817	91864817	-1	no_errors	ENST00000340022	ensembl	human	known	69_37n	missense	118	12.59	17	SNP	1.000	C
LRRC16A	55604	genome.wustl.edu	37	6	25600824	25600824	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr6:25600824G>T	ENST00000329474.6	+	33	3770	c.3402G>T	c.(3400-3402)gaG>gaT	p.E1134D		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1134					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						CCTTTGAAGAGAGTCAAGGGG	0.557																																						dbGAP											0													55.0	58.0	57.0					6																	25600824		1974	4155	6129	-	-	-	SO:0001583	missense	0			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3402G>T	6.37:g.25600824G>T	ENSP00000331983:p.Glu1134Asp		B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E1134D	ENST00000329474.6	37	c.3402	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921637	0.33908	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.18502	2.21	5.06	-4.12	0.03916	.	0.580895	0.18085	N	0.152195	T	0.03011	0.0089	L	0.40543	1.245	0.80722	D	1	B;B;B	0.16166	0.007;0.003;0.016	B;B;B	0.19148	0.009;0.007;0.024	T	0.38802	-0.9644	10	0.12103	T	0.63	-10.6986	5.3056	0.15801	0.1455:0.1877:0.5613:0.1055	.	1134;1134;1134	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	D	1134	ENSP00000331983:E1134D	ENSP00000331983:E1134D	E	+	3	2	LRRC16A	25708803	0.946000	0.32159	0.007000	0.13788	0.945000	0.59286	1.478000	0.35442	-0.592000	0.05851	-0.502000	0.04539	GAG	LRRC16A	-	NULL	ENSG00000079691		0.557	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	30	0.00	0	G	NM_017640		25600824	25600824	+1	no_errors	ENST00000329474	ensembl	human	novel	69_37n	missense	19	17.39	4	SNP	0.075	T
LURAP1L	286343	genome.wustl.edu	37	9	12775717	12775717	+	Start_Codon_Del	DEL	G	G	-			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr9:12775717delG	ENST00000319264.3	+	0	698				LURAP1L_ENST00000489107.1_3'UTR|RP11-3L8.3_ENST00000417638.1_RNA	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like																		GAAAAGTCATGGAAGACAGCC	0.582																																						dbGAP											0													23.0	26.0	25.0					9																	12775717		2202	4297	6499	-	-	-	SO:0001582	initiator_codon_variant	0			AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557		9.37:g.12775717delG			Q5VZX7|Q8N923|Q8NCG2	Frame_Shift_Del	DEL	NULL	p.E2fs	ENST00000319264.3	37	c.3	CCDS6473.1	9																																																																																			LURAP1L	-	NULL	ENSG00000153714		0.582	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LURAP1L	HGNC	protein_coding	OTTHUMT00000051730.1	8	0.00	0	G	NM_203403		12775717	12775717	+1	no_errors	ENST00000319264	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
MBTD1	54799	genome.wustl.edu	37	17	49270117	49270117	+	Intron	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr17:49270117G>C	ENST00000586178.1	-	15	2034				MBTD1_ENST00000415868.1_Intron|MBTD1_ENST00000376381.2_Intron	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1						chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			TTTACAAAAGGACACCTTTTC	0.428																																						dbGAP											0													132.0	128.0	130.0					17																	49270117		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.1690+25C>G	17.37:g.49270117G>C			Q6ZVU7|Q9NXU1	Silent	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt	p.V87	ENST00000586178.1	37	c.261	CCDS11581.2	17																																																																																			MBTD1	-	NULL	ENSG00000011258		0.428	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTD1	HGNC	protein_coding	OTTHUMT00000318124.1	49	0.00	0	G			49270117	49270117	-1	no_start_codon	ENST00000586898	ensembl	human	known	69_37n	silent	65	19.75	16	SNP	0.998	C
MEF2C	4208	genome.wustl.edu	37	5	88100452	88100452	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr5:88100452T>A	ENST00000437473.2	-	3	638	c.221A>T	c.(220-222)gAg>gTg	p.E74V	MEF2C_ENST00000510942.1_Missense_Mutation_p.E74V|MEF2C_ENST00000504921.2_Missense_Mutation_p.E74V|MEF2C_ENST00000514015.1_Missense_Mutation_p.E74V|MEF2C_ENST00000340208.5_Missense_Mutation_p.E74V|MEF2C_ENST00000514028.1_Missense_Mutation_p.E74V|MEF2C_ENST00000539796.1_Missense_Mutation_p.E74V|MEF2C_ENST00000424173.2_Missense_Mutation_p.E74V|MEF2C_ENST00000508569.1_Missense_Mutation_p.E74V|MEF2C_ENST00000506554.1_Missense_Mutation_p.E74V	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	74					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		CTCATGCGGCTCGTTGTACTC	0.557										HNSCC(66;0.2)																												dbGAP											0													140.0	129.0	132.0					5																	88100452		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.221A>T	5.37:g.88100452T>A	ENSP00000396219:p.Glu74Val		C9JMZ0|D7F7N5|F8W7V7	Missense_Mutation	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,prints_TF_MADSbox,pfscan_TF_MADSbox	p.E74V	ENST00000437473.2	37	c.221	CCDS47245.1	5	.	.	.	.	.	.	.	.	.	.	T	34	5.295278	0.95574	.	.	ENSG00000081189	ENST00000340208;ENST00000424173;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000506554;ENST00000508569;ENST00000514015;ENST00000539796;ENST00000513252;ENST00000506716;ENST00000507984;ENST00000502983;ENST00000508610;ENST00000502831;ENST00000503075	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64;-1.64	5.5	5.5	0.81552	Transcription factor, MADS-box (1);	0.000000	0.85682	D	0.000000	D	0.89746	0.6804	M	0.61703	1.905	0.80722	D	1	P;D;D;D	0.89917	0.944;1.0;0.995;0.999	P;D;D;D	0.83275	0.647;0.996;0.989;0.979	D	0.90836	0.4720	10	0.87932	D	0	-7.8872	15.6133	0.76744	0.0:0.0:0.0:1.0	.	74;74;74;74	C9JMZ0;F8W7V7;Q06413;Q06413-2	.;.;MEF2C_HUMAN;.	V	74	ENSP00000340874:E74V;ENSP00000389610:E74V;ENSP00000421925:E74V;ENSP00000426665:E74V;ENSP00000396219:E74V;ENSP00000422390:E74V;ENSP00000425636:E74V;ENSP00000423597:E74V;ENSP00000424606:E74V;ENSP00000441153:E74V;ENSP00000423826:E74V;ENSP00000423656:E74V;ENSP00000424331:E74V;ENSP00000427163:E74V;ENSP00000426442:E74V;ENSP00000427286:E74V;ENSP00000426465:E74V	ENSP00000340874:E74V	E	-	2	0	MEF2C	88136208	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	2.085000	0.62840	0.533000	0.62120	GAG	MEF2C	-	superfamily_TF_MADSbox	ENSG00000081189		0.557	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	59	0.00	0	T	NM_002397		88100452	88100452	-1	no_errors	ENST00000437473	ensembl	human	known	69_37n	missense	85	16.67	17	SNP	1.000	A
MUC21	394263	genome.wustl.edu	37	6	30954438	30954438	+	Silent	SNP	C	C	T	rs41288646	byFrequency	TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr6:30954438C>T	ENST00000376296.3	+	2	727	c.486C>T	c.(484-486)gcC>gcT	p.A162A	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	162	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAGTGAGGCCAGCACAGCCA	0.617													C|||	26	0.00519169	0.0038	0.0086	5008	,	,		24561	0.002		0.007	False		,,,				2504	0.0061					dbGAP											0													145.0	136.0	139.0					6																	30954438		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.486C>T	6.37:g.30954438C>T			B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	NULL	p.A162	ENST00000376296.3	37	c.486	CCDS34388.1	6																																																																																			MUC21	-	NULL	ENSG00000204544		0.617	MUC21-001	KNOWN	basic|CCDS	protein_coding	MUC21	HGNC	protein_coding	OTTHUMT00000128579.3	30	0.00	0	C	NM_001010909		30954438	30954438	+1	no_errors	ENST00000376296	ensembl	human	known	69_37n	silent	44	16.98	9	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195505807	195505807	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr3:195505807G>T	ENST00000463781.3	-	2	13103	c.12644C>A	c.(12643-12645)tCc>tAc	p.S4215Y	MUC4_ENST00000475231.1_Missense_Mutation_p.S4215Y|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAGTGTCGGT	0.587																																						dbGAP											0													30.0	26.0	27.0					3																	195505807		692	1580	2272	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12644C>A	3.37:g.195505807G>T	ENSP00000417498:p.Ser4215Tyr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S4215Y	ENST00000463781.3	37	c.12644	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	3.930	-0.016431	0.07681	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38077	1.16;1.22	0.93	-0.0353	0.13893	.	.	.	.	.	T	0.23846	0.0577	N	0.14661	0.345	0.09310	N	1	D	0.54964	0.969	P	0.50490	0.642	T	0.09997	-1.0649	8	.	.	.	.	3.3312	0.07085	0.3094:0.0:0.6906:0.0	.	4087	E7ESK3	.	Y	4215	ENSP00000417498:S4215Y;ENSP00000420243:S4215Y	.	S	-	2	0	MUC4	196990586	.	.	0.000000	0.03702	0.001000	0.01503	.	.	-0.005000	0.14395	-0.379000	0.06801	TCC	MUC4	-	NULL	ENSG00000145113		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	109	0.00	0	G	NM_018406		195505807	195505807	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	216	10.37	25	SNP	0.002	T
NLRP9	338321	genome.wustl.edu	37	19	56244393	56244393	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr19:56244393T>A	ENST00000332836.2	-	2	831	c.804A>T	c.(802-804)gaA>gaT	p.E268D		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	268	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		GGAGAGAGGATTCTGGAAGCA	0.408																																						dbGAP											0													62.0	62.0	62.0					19																	56244393		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.804A>T	19.37:g.56244393T>A	ENSP00000331857:p.Glu268Asp		B2RN12|Q86W27	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E268D	ENST00000332836.2	37	c.804	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	T	7.565	0.665561	0.14710	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.63580	-0.05	2.46	-4.92	0.03075	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.54127	0.1839	L	0.54965	1.715	0.09310	N	1	B	0.30664	0.289	B	0.40940	0.344	T	0.55879	-0.8071	9	0.54805	T	0.06	.	1.8739	0.03214	0.1276:0.1659:0.3736:0.3329	.	268	Q7RTR0	NALP9_HUMAN	D	268	ENSP00000331857:E268D	ENSP00000331857:E268D	E	-	3	2	NLRP9	60936205	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.294000	0.02767	-1.588000	0.01627	-2.080000	0.00379	GAA	NLRP9	-	pfscan_NACHT_NTPase	ENSG00000185792		0.408	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1	54	0.00	0	T	NM_176820		56244393	56244393	-1	no_errors	ENST00000332836	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	0.000	A
NPHP4	261734	genome.wustl.edu	37	1	5923388	5923388	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:5923388G>C	ENST00000378156.4	-	30	4483	c.4218C>G	c.(4216-4218)atC>atG	p.I1406M	MIR4689_ENST00000582517.1_RNA|NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	1406					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CATTGATGTAGATCAGGATCT	0.537																																						dbGAP											0													201.0	214.0	210.0					1																	5923388		2117	4220	6337	-	-	-	SO:0001583	missense	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.4218C>G	1.37:g.5923388G>C	ENSP00000367398:p.Ile1406Met		Q8IWC0	Missense_Mutation	SNP	NULL	p.I1406M	ENST00000378156.4	37	c.4218	CCDS44052.1	1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124564	0.56613	.	.	ENSG00000131697	ENST00000378156	D	0.90444	-2.67	5.26	-0.285	0.12866	.	0.071551	0.56097	D	0.000033	D	0.93158	0.7821	M	0.68317	2.08	0.44221	D	0.997053	D	0.89917	1.0	D	0.91635	0.999	D	0.91086	0.4903	10	0.87932	D	0	.	10.9121	0.47114	0.4756:0.0:0.5244:0.0	.	1406	O75161	NPHP4_HUMAN	M	1406	ENSP00000367398:I1406M	ENSP00000367398:I1406M	I	-	3	3	NPHP4	5845975	0.992000	0.36948	0.993000	0.49108	0.782000	0.44232	0.311000	0.19380	-0.362000	0.08113	-0.312000	0.09012	ATC	NPHP4	-	NULL	ENSG00000131697		0.537	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	57	0.00	0	G			5923388	5923388	-1	no_errors	ENST00000378156	ensembl	human	known	69_37n	missense	90	10.89	11	SNP	0.999	C
NUDT9	53343	genome.wustl.edu	37	4	88363019	88363019	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr4:88363019T>G	ENST00000302174.4	+	4	806	c.482T>G	c.(481-483)cTt>cGt	p.L161R	NUDT9_ENST00000473942.1_Missense_Mutation_p.L111R	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	161					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		GGCCGGGGGCTTTTGGGGCGA	0.418																																						dbGAP											0													38.0	42.0	41.0					4																	88363019		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.482T>G	4.37:g.88363019T>G	ENSP00000303575:p.Leu161Arg		Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.L161R	ENST00000302174.4	37	c.482	CCDS3620.1	4	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901545	0.72754	.	.	ENSG00000170502	ENST00000302174;ENST00000512216;ENST00000473942;ENST00000440591	T;T;T;T	0.76839	-1.05;-1.05;-1.05;2.43	5.51	5.51	0.81932	NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	D	0.85986	0.5825	M	0.70595	2.14	0.80722	D	1	P;D	0.71674	0.916;0.998	B;D	0.66351	0.231;0.943	D	0.87559	0.2470	10	0.87932	D	0	-18.9902	13.6541	0.62328	0.0:0.0:0.0:1.0	.	161;161	Q96KB3;Q9BW91	.;NUDT9_HUMAN	R	161;111;111;129	ENSP00000303575:L161R;ENSP00000424702:L111R;ENSP00000421811:L111R;ENSP00000410270:L129R	ENSP00000303575:L161R	L	+	2	0	NUDT9	88582043	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.868000	0.75516	2.226000	0.72624	0.482000	0.46254	CTT	NUDT9	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000170502		0.418	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT9	HGNC	protein_coding	OTTHUMT00000253035.2	33	0.00	0	T			88363019	88363019	+1	no_errors	ENST00000302174	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	1.000	G
AKAP2	11217	genome.wustl.edu	37	9	112898669	112898669	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr9:112898669G>C	ENST00000259318.7	+	2	359	c.152G>C	c.(151-153)aGa>aCa	p.R51T	AKAP2_ENST00000510514.5_Missense_Mutation_p.R282T|AKAP2_ENST00000374525.1_Missense_Mutation_p.R140T|AKAP2_ENST00000434623.2_Missense_Mutation_p.R140T|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.R282T|AKAP2_ENST00000555236.1_Missense_Mutation_p.R282T|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.R282T	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	51										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						GATGTTGCCAGAGAGATCCGC	0.527																																						dbGAP											0													178.0	149.0	159.0					9																	112898669		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.152G>C	9.37:g.112898669G>C	ENSP00000259318:p.Arg51Thr		B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.R282T	ENST00000259318.7	37	c.845	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442762	0.63067	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.51817	2.03;2.03;2.03;2.03;1.27;0.69;0.69;1.31	6.17	5.27	0.74061	.	0.159048	0.53938	D	0.000041	T	0.40815	0.1132	L	0.60455	1.87	0.31908	N	0.6151	B;P;B;P;B;P;P;B	0.35872	0.059;0.525;0.085;0.525;0.391;0.465;0.465;0.22	B;B;B;B;B;B;B;B	0.34242	0.022;0.115;0.026;0.115;0.053;0.178;0.178;0.086	T	0.57242	-0.7845	10	0.72032	D	0.01	-24.9981	6.7813	0.23648	0.2117:0.0:0.7883:0.0	.	51;140;134;140;141;282;282;100	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	T	282;282;282;282;140;140;100;51	ENSP00000363654:R282T;ENSP00000305861:R282T;ENSP00000451476:R282T;ENSP00000421522:R282T;ENSP00000404782:R140T;ENSP00000363649:R140T;ENSP00000419268:R100T;ENSP00000259318:R51T	ENSP00000259318:R51T	R	+	2	0	PALM2-AKAP2;AKAP2	111938490	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.818000	0.62657	2.941000	0.99782	0.655000	0.94253	AGA	PALM2-AKAP2	-	NULL	ENSG00000157654		0.527	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	46	0.00	0	G	NM_001004065		112898669	112898669	+1	no_errors	ENST00000374530	ensembl	human	known	69_37n	missense	46	25.81	16	SNP	1.000	C
PALM3	342979	genome.wustl.edu	37	19	14165323	14165323	+	Silent	SNP	T	T	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr19:14165323T>A	ENST00000340790.4	-	6	1115	c.1116A>T	c.(1114-1116)ggA>ggT	p.G372G		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	372	Glu-rich.				negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						GGCTTTCATCTCCTCTCTCCC	0.612																																						dbGAP											0													113.0	94.0	100.0					19																	14165323		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.1116A>T	19.37:g.14165323T>A				Silent	SNP	NULL	p.G372	ENST00000340790.4	37	c.1116	CCDS46001.1	19																																																																																			PALM3	-	NULL	ENSG00000187867		0.612	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALM3	HGNC	protein_coding	OTTHUMT00000458540.1	56	0.00	0	T	NM_001145028		14165323	14165323	-1	no_errors	ENST00000340790	ensembl	human	known	69_37n	silent	74	16.67	15	SNP	0.000	A
PCK2	5106	genome.wustl.edu	37	14	24572061	24572061	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr14:24572061C>A	ENST00000216780.4	+	8	1602	c.1334C>A	c.(1333-1335)cCc>cAc	p.P445H	PCK2_ENST00000561286.1_Missense_Mutation_p.P311H|PCK2_ENST00000545054.2_Missense_Mutation_p.P311H|NRL_ENST00000561028.1_Intron|PCK2_ENST00000559250.1_Missense_Mutation_p.P457H|PCK2_ENST00000558096.1_Missense_Mutation_p.P311H	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	445					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		GAGGGTGTCCCCATTGACGCC	0.567																																						dbGAP											0													93.0	96.0	95.0					14																	24572061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.1334C>A	14.37:g.24572061C>A	ENSP00000216780:p.Pro445His		O43253|Q86U01|Q9BV62	Missense_Mutation	SNP	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	p.P445H	ENST00000216780.4	37	c.1334	CCDS9609.1	14	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628916	0.87560	.	.	ENSG00000100889	ENST00000216780;ENST00000545054	T;T	0.13089	2.62;2.62	5.69	4.8	0.61643	Phosphoenolpyruvate carboxykinase, C-terminal (1);	0.051361	0.85682	D	0.000000	T	0.51449	0.1675	H	0.97415	4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	T	0.67465	-0.5664	10	0.87932	D	0	-9.9232	12.0172	0.53321	0.0:0.917:0.0:0.083	.	311;445;445	B4DW73;Q16822;Q6IB91	.;PCKGM_HUMAN;.	H	445;311	ENSP00000216780:P445H;ENSP00000441826:P311H	ENSP00000216780:P445H	P	+	2	0	PCK2	23641901	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.399000	0.79935	1.416000	0.47057	0.655000	0.94253	CCC	PCK2	-	pfam_PEP_carboxykinase_GTP,pirsf_PEP_carboxykinase_GTP	ENSG00000100889		0.567	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK2	HGNC	protein_coding	OTTHUMT00000071900.3	37	0.00	0	C	NM_001018073		24572061	24572061	+1	no_errors	ENST00000216780	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	1.000	A
POFUT2	23275	genome.wustl.edu	37	21	46703436	46703436	+	Missense_Mutation	SNP	C	C	G	rs184052047		TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr21:46703436C>G	ENST00000349485.5	-	3	415	c.389G>C	c.(388-390)gGt>gCt	p.G130A	POFUT2_ENST00000471540.1_5'Flank|POFUT2_ENST00000331343.7_Missense_Mutation_p.G130A	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2	130					fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		AAAGGGCCCACCAGATTCTGA	0.522																																						dbGAP											0													179.0	162.0	167.0					21																	46703436		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.389G>C	21.37:g.46703436C>G	ENSP00000339613:p.Gly130Ala		Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	Missense_Mutation	SNP	pfam_GDP-Fuc_O-FucTrfase,superfamily_DUF749	p.G130A	ENST00000349485.5	37	c.389	CCDS13719.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.06|15.06	2.720231|2.720231	0.48728|0.48728	.|.	.|.	ENSG00000186866|ENSG00000186866	ENST00000331343;ENST00000349485|ENST00000451615	.|.	.|.	.|.	4.44|4.44	4.44|4.44	0.53790|0.53790	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74045|0.74045	0.3665|0.3665	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.997|.	D;D|.	0.66716|.	0.935;0.946|.	T|T	0.75625|0.75625	-0.3253|-0.3253	8|5	.|.	.|.	.|.	-8.2323|-8.2323	14.9363|14.9363	0.70957|0.70957	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	130;130|.	Q9Y2G5-1;Q9Y2G5|.	.;OFUT2_HUMAN|.	A|C	130|7	.|.	.|.	G|W	-|-	2|3	0|0	POFUT2|POFUT2	45527864|45527864	1.000000|1.000000	0.71417|0.71417	0.960000|0.960000	0.40013|0.40013	0.121000|0.121000	0.20230|0.20230	7.228000|7.228000	0.78079|0.78079	2.184000|2.184000	0.69523|0.69523	0.591000|0.591000	0.81541|0.81541	GGT|TGG	POFUT2	-	pfam_GDP-Fuc_O-FucTrfase	ENSG00000186866		0.522	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	POFUT2	HGNC	protein_coding	OTTHUMT00000192573.2	61	0.00	0	C	NM_015227		46703436	46703436	-1	no_errors	ENST00000349485	ensembl	human	known	69_37n	missense	73	22.34	21	SNP	1.000	G
PPDPF	79144	genome.wustl.edu	37	20	62152940	62152940	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr20:62152940C>T	ENST00000370179.3	+	3	327	c.131C>T	c.(130-132)cCa>cTa	p.P44L	PPDPF_ENST00000473620.1_3'UTR|PPDPF_ENST00000370177.1_Missense_Mutation_p.P44L	NM_024299.2	NP_077275.1	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and proliferation factor	44					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)					kidney(1)|lung(2)|ovary(1)	4						CCCCACCCCCCAGGTGAGTGC	0.657																																						dbGAP											0													46.0	51.0	49.0					20																	62152940		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL121829	CCDS13523.1	20q13.33	2013-07-23	2013-07-23	2009-06-04	ENSG00000125534	ENSG00000125534			16142	protein-coding gene	gene with protein product	"""exocrine differentiation and proliferation factor"""		"""chromosome 20 open reading frame 149"", ""pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)"""	C20orf149			Standard	NM_024299		Approved	dJ697K14.9, exdpf	uc002yff.3	Q9H3Y8	OTTHUMG00000032978	ENST00000370179.3:c.131C>T	20.37:g.62152940C>T	ENSP00000359198:p.Pro44Leu		E1P5J2|Q4VXP1|Q9H3Y7	Missense_Mutation	SNP	NULL	p.P44L	ENST00000370179.3	37	c.131	CCDS13523.1	20	.	.	.	.	.	.	.	.	.	.	.	21.8	4.203787	0.79127	.	.	ENSG00000125534	ENST00000370179;ENST00000370178;ENST00000370177	.	.	.	4.46	3.5	0.40072	.	0.000000	0.85682	D	0.000000	T	0.63745	0.2537	M	0.83483	2.645	0.80722	D	1	P	0.45634	0.863	P	0.44647	0.456	T	0.72909	-0.4149	9	0.87932	D	0	-14.5797	12.4289	0.55563	0.0:0.9145:0.0:0.0854	.	44	Q9H3Y8	PPDPF_HUMAN	L	44	.	ENSP00000359196:P44L	P	+	2	0	PPDPF	61623384	1.000000	0.71417	0.890000	0.34922	0.920000	0.55202	5.170000	0.64990	2.021000	0.59480	0.650000	0.86243	CCA	PPDPF	-	NULL	ENSG00000125534		0.657	PPDPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPDPF	HGNC	protein_coding	OTTHUMT00000080149.1	19	0.00	0	C			62152940	62152940	+1	no_errors	ENST00000370177	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	1.000	T
PTGER2	5732	genome.wustl.edu	37	14	52793971	52793971	+	Silent	SNP	A	A	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr14:52793971A>C	ENST00000245457.5	+	2	1030	c.876A>C	c.(874-876)cgA>cgC	p.R292R	PTGER2_ENST00000557436.1_Silent_p.R37R	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	292					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CCTCTTCCCGAAAGGAAAAAT	0.388																																						dbGAP											0													69.0	72.0	71.0					14																	52793971		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.876A>C	14.37:g.52793971A>C			D3DSC0|Q52LG8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP2_rcpt,prints_Prostanoid_rcpt,prints_7TM_GPCR_Rhodpsn	p.R292	ENST00000245457.5	37	c.876	CCDS9708.1	14																																																																																			PTGER2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP2_rcpt	ENSG00000125384		0.388	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGER2	HGNC	protein_coding	OTTHUMT00000276890.1	69	0.00	0	A			52793971	52793971	+1	no_errors	ENST00000245457	ensembl	human	known	69_37n	silent	63	34.38	33	SNP	0.003	C
PTPRG	5793	genome.wustl.edu	37	3	62204610	62204610	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr3:62204610G>C	ENST00000474889.1	+	13	2618	c.2241G>C	c.(2239-2241)ttG>ttC	p.L747F	PTPRG_ENST00000295874.10_Missense_Mutation_p.L747F	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	747					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TATCAGCCTTGACCTTCGTGT	0.537																																						dbGAP											0													320.0	250.0	274.0					3																	62204610		2203	4300	6503	-	-	-	SO:0001583	missense	0			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.2241G>C	3.37:g.62204610G>C	ENSP00000418112:p.Leu747Phe		B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.L747F	ENST00000474889.1	37	c.2241	CCDS2895.1	3	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067027	0.55539	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.61859	0.07;0.41	5.37	5.37	0.77165	.	0.066050	0.64402	D	0.000008	T	0.71779	0.3380	M	0.61703	1.905	0.58432	D	0.999995	P;D;D	0.76494	0.745;0.999;0.999	B;D;D	0.75484	0.145;0.96;0.986	T	0.73238	-0.4046	10	0.72032	D	0.01	.	12.5997	0.56491	0.0751:0.0:0.9249:0.0	.	22;747;747	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	F	747	ENSP00000418112:L747F;ENSP00000295874:L747F	ENSP00000295874:L747F	L	+	3	2	PTPRG	62179650	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.678000	0.54627	2.793000	0.96121	0.563000	0.77884	TTG	PTPRG	-	NULL	ENSG00000144724		0.537	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRG	HGNC	protein_coding	OTTHUMT00000351674.1	63	0.00	0	G	NM_002841		62204610	62204610	+1	no_errors	ENST00000474889	ensembl	human	known	69_37n	missense	98	13.27	15	SNP	1.000	C
RAB11FIP4	84440	genome.wustl.edu	37	17	29758839	29758839	+	Silent	SNP	A	A	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr17:29758839A>G	ENST00000325874.8	+	2	397	c.168A>G	c.(166-168)aaA>aaG	p.K56K		NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	56	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)	p.?(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				AGGTGGAAAAACTTGTGAAAT	0.567																																						dbGAP											1	Unknown(1)	autonomic_ganglia(1)											66.0	69.0	68.0					17																	29758839		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.168A>G	17.37:g.29758839A>G			Q52LI1|Q8N829|Q8NDT7|Q969D8	Silent	SNP	pfam_Rab-bd_FIP-RBD,pfscan_EF_HAND_2	p.K56	ENST00000325874.8	37	c.168	CCDS11267.1	17																																																																																			RAB11FIP4	-	pfscan_EF_HAND_2	ENSG00000131242		0.567	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP4	HGNC	protein_coding	OTTHUMT00000256195.2	18	0.00	0	A	NM_032932		29758839	29758839	+1	no_errors	ENST00000325874	ensembl	human	known	69_37n	silent	23	20.69	6	SNP	1.000	G
RET	5979	genome.wustl.edu	37	10	43607665	43607665	+	Silent	SNP	T	T	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr10:43607665T>C	ENST00000355710.3	+	8	1873	c.1641T>C	c.(1639-1641)gaT>gaC	p.D547D	RET_ENST00000340058.5_Silent_p.D547D	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	547					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GGCAAGGAGATGGCAAAGGTA	0.672		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	dbGAP	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0													70.0	72.0	72.0					10																	43607665		2167	4248	6415	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1641T>C	10.37:g.43607665T>C			A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Cadherin	p.D547	ENST00000355710.3	37	c.1641	CCDS7200.1	10																																																																																			RET	-	pirsf_Tyr_kinase_Ret_rcpt	ENSG00000165731		0.672	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	29	0.00	0	T	NM_020975		43607665	43607665	+1	no_errors	ENST00000355710	ensembl	human	known	69_37n	silent	29	45.28	24	SNP	0.582	C
RTN3	10313	genome.wustl.edu	37	11	63523641	63523644	+	Splice_Site	DEL	AAGT	AAGT	-	rs111505981		TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	AAGT	AAGT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr11:63523641_63523644delAAGT	ENST00000377819.5	+	8	3206_3207	c.3052_3053delAAGT	c.(3052-3054)aag>g	p.K1018fs	RTN3_ENST00000356000.3_Splice_Site_p.K241fs|RTN3_ENST00000354497.4_Splice_Site_p.S138fs|RTN3_ENST00000540798.1_Splice_Site_p.K906fs|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000339997.4_Splice_Site_p.K999fs|RTN3_ENST00000537981.1_Splice_Site_p.K222fs	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	1018	Interaction with FADD.|Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						AATTGTTGAAAAGTAAGTACATTT	0.387																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.3053+1AAGT>-	11.37:g.63523645_63523648delAAGT			B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Frame_Shift_Del	DEL	pfam_Reticulon,pfscan_Reticulon	p.K1018fs	ENST00000377819.5	37	c.3052_3053	CCDS58141.1	11																																																																																			RTN3	-	pfscan_Reticulon	ENSG00000133318		0.387	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	HGNC	protein_coding	OTTHUMT00000397846.1	69	0.00	0	AAGT	NM_006054	Frame_Shift_Del	63523641	63523644	+1	no_errors	ENST00000377819	ensembl	human	known	69_37n	frame_shift_del	55	32.10	26	DEL	1.000:1.000	-
RYR3	6263	genome.wustl.edu	37	15	33928672	33928672	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr15:33928672G>T	ENST00000389232.4	+	27	3547	c.3477G>T	c.(3475-3477)atG>atT	p.M1159I	RYR3_ENST00000415757.3_Missense_Mutation_p.M1159I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1159	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.M1159I(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATGCTTCAATGATCTTCACAC	0.502																																						dbGAP											1	Substitution - Missense(1)	prostate(1)											187.0	190.0	189.0					15																	33928672		2137	4256	6393	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3477G>T	15.37:g.33928672G>T	ENSP00000373884:p.Met1159Ile		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.M1159I	ENST00000389232.4	37	c.3477	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	3.157	-0.172943	0.06421	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.70869	-0.52;-0.52	5.19	5.19	0.71726	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.045105	0.85682	D	0.000000	T	0.32941	0.0846	N	0.01668	-0.77	0.47407	D	0.999419	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.49093	-0.8975	10	0.02654	T	1	.	4.0731	0.09891	0.0781:0.1373:0.5146:0.27	.	1159;1159	Q15413-2;Q15413	.;RYR3_HUMAN	I	1159	ENSP00000373884:M1159I;ENSP00000399610:M1159I	ENSP00000354735:M1159I	M	+	3	0	RYR3	31715964	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.475000	0.53136	2.859000	0.98148	0.591000	0.81541	ATG	RYR3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000198838		0.502	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	68	0.00	0	G			33928672	33928672	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	1.000	T
SEMA3A	10371	genome.wustl.edu	37	7	83689801	83689801	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr7:83689801A>T	ENST00000265362.4	-	5	841	c.527T>A	c.(526-528)cTg>cAg	p.L176Q	SEMA3A_ENST00000436949.1_Missense_Mutation_p.L176Q	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	176	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						GGATGCTGTCAGCAGCTTAGG	0.348																																						dbGAP											0													115.0	120.0	118.0					7																	83689801		2203	4300	6503	-	-	-	SO:0001583	missense	0			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.527T>A	7.37:g.83689801A>T	ENSP00000265362:p.Leu176Gln			Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.L176Q	ENST00000265362.4	37	c.527	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	A	9.411	1.080424	0.20309	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.21543	2.0;2.0	5.65	4.47	0.54385	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.211451	0.41396	N	0.000898	T	0.11793	0.0287	N	0.12746	0.255	0.51482	D	0.999929	B	0.17667	0.023	B	0.17722	0.019	T	0.11251	-1.0595	10	0.17369	T	0.5	.	12.1337	0.53957	0.8714:0.0:0.0:0.1286	.	176	Q14563	SEM3A_HUMAN	Q	176	ENSP00000265362:L176Q;ENSP00000415260:L176Q	ENSP00000265362:L176Q	L	-	2	0	SEMA3A	83527737	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	2.029000	0.41098	1.011000	0.39340	0.528000	0.53228	CTG	SEMA3A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000075213		0.348	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	63	0.00	0	A	NM_006080		83689801	83689801	-1	no_errors	ENST00000265362	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	T
SLC12A5	57468	genome.wustl.edu	37	20	44685909	44685909	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr20:44685909G>A	ENST00000454036.2	+	25	3344	c.3295G>A	c.(3295-3297)Ggg>Agg	p.G1099R	SLC12A5_ENST00000243964.3_Missense_Mutation_p.G1076R	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1099					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CAACATGCCTGGGCCTCCCCG	0.572																																						dbGAP											0													97.0	101.0	99.0					20																	44685909		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3295G>A	20.37:g.44685909G>A	ENSP00000387694:p.Gly1099Arg		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.G1099R	ENST00000454036.2	37	c.3295	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496432	0.85069	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	T;T	0.54866	0.55;0.55	4.57	4.57	0.56435	.	0.132321	0.51477	D	0.000099	T	0.70055	0.3180	M	0.77313	2.365	0.80722	D	1	D;D	0.64830	0.97;0.994	P;D	0.66497	0.77;0.944	T	0.68062	-0.5508	10	0.22706	T	0.39	.	16.5361	0.84373	0.0:0.0:1.0:0.0	.	1099;1076	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	R	1099;1076	ENSP00000387694:G1099R;ENSP00000243964:G1076R	ENSP00000243964:G1076R	G	+	1	0	SLC12A5	44119316	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.252000	0.78309	2.359000	0.80004	0.555000	0.69702	GGG	SLC12A5	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.572	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	39	0.00	0	G			44685909	44685909	+1	no_errors	ENST00000454036	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	A
SOD2	6648	genome.wustl.edu	37	6	160109177	160109177	+	Silent	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr6:160109177G>A	ENST00000546087.1	-	5	2013	c.186C>T	c.(184-186)aaC>aaT	p.N62N	SOD2_ENST00000538183.2_Silent_p.N108N|SOD2_ENST00000444946.2_Silent_p.N108N|SOD2_ENST00000367055.4_Silent_p.N108N|SOD2_ENST00000367054.2_Intron|SOD2_ENST00000337404.4_Intron			P04179	SODM_HUMAN	superoxide dismutase 2, mitochondrial	108					age-dependent response to reactive oxygen species (GO:0001315)|cellular response to ethanol (GO:0071361)|detection of oxygen (GO:0003032)|erythrophore differentiation (GO:0048773)|glutathione metabolic process (GO:0006749)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|hydrogen peroxide biosynthetic process (GO:0050665)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|iron ion homeostasis (GO:0055072)|liver development (GO:0001889)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|oxygen homeostasis (GO:0032364)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to lipopolysaccharide (GO:0032496)|response to manganese ion (GO:0010042)|response to selenium ion (GO:0010269)|response to silicon dioxide (GO:0034021)|response to superoxide (GO:0000303)|response to zinc ion (GO:0010043)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure (GO:0003069)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|manganese ion binding (GO:0030145)|oxygen binding (GO:0019825)|superoxide dismutase activity (GO:0004784)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(3)|skin(1)	14		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)		CTCCACCACCGTTAGGGCTGA	0.433																																						dbGAP											0													207.0	183.0	191.0					6																	160109177		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M36693	CCDS5265.1, CCDS34564.1	6q25	2008-02-05			ENSG00000112096	ENSG00000112096	1.15.1.1		11180	protein-coding gene	gene with protein product		147460					Standard	NM_000636		Approved		uc003qsg.3	P04179	OTTHUMG00000015940	ENST00000546087.1:c.186C>T	6.37:g.160109177G>A			B2R7R1|B3KUK2|B4DL20|B4E3K9|E1P5A9|P78434|Q16792|Q5TCM1|Q96EE6|Q9P2Z3	Silent	SNP	pfam_Mn/Fe_SOD_C,pfam_Mn/Fe_SOD_N,superfamily_Mn/Fe_SOD_C,superfamily_Mn/Fe_SOD_N,pirsf_Mn/Fe_SOD,prints_Mn/Fe_SOD	p.N108	ENST00000546087.1	37	c.324		6																																																																																			SOD2	-	superfamily_Mn/Fe_SOD_C,pirsf_Mn/Fe_SOD	ENSG00000112096		0.433	SOD2-004	PUTATIVE	basic|exp_conf	protein_coding	SOD2	HGNC	protein_coding	OTTHUMT00000399943.1	57	0.00	0	G	NM_000636		160109177	160109177	-1	no_errors	ENST00000367055	ensembl	human	known	69_37n	silent	54	10.00	6	SNP	0.986	A
STARD9	57519	genome.wustl.edu	37	15	42977487	42977487	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr15:42977487C>G	ENST00000290607.7	+	23	3768	c.3711C>G	c.(3709-3711)caC>caG	p.H1237Q		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1237					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CTTTTTGGCACCTGGAGGACT	0.517																																						dbGAP											0													62.0	56.0	58.0					15																	42977487		692	1590	2282	-	-	-	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.3711C>G	15.37:g.42977487C>G	ENSP00000290607:p.His1237Gln		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.H1237Q	ENST00000290607.7	37	c.3711	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	C	5.820	0.335568	0.11013	.	.	ENSG00000159433	ENST00000290607	T	0.65178	-0.14	5.91	0.574	0.17368	.	.	.	.	.	T	0.54447	0.1859	L	0.52573	1.65	0.09310	N	1	.	.	.	.	.	.	T	0.53194	-0.8473	7	0.72032	D	0.01	-0.236	1.446	0.02365	0.1597:0.4007:0.178:0.2616	.	.	.	.	Q	1237	ENSP00000290607:H1237Q	ENSP00000290607:H1237Q	H	+	3	2	STARD9	40764779	0.929000	0.31497	0.322000	0.25334	0.187000	0.23431	0.458000	0.21892	0.199000	0.20427	0.650000	0.86243	CAC	STARD9	-	NULL	ENSG00000159433		0.517	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	34	0.00	0	C			42977487	42977487	+1	no_errors	ENST00000290607	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	0.009	G
GTF2A1L	11036	genome.wustl.edu	37	2	48873664	48873664	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr2:48873664C>T	ENST00000403751.3	+	6	498	c.461C>T	c.(460-462)cCa>cTa	p.P154L	GTF2A1L_ENST00000430487.2_Missense_Mutation_p.P120L|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.P858L|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.P858L|LHCGR_ENST00000420913.3_5'UTR|GTF2A1L_ENST00000468326.1_3'UTR|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.P858L|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.P811L|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.P858L	NM_006872.3	NP_006863.2	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like	154					cognition (GO:0050890)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			lung(7)	7		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTTCAGCATCCAATTCAGCAA	0.378																																						dbGAP											0													99.0	98.0	98.0					2																	48873664		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106857	CCDS46281.1, CCDS54359.1	2p16.3	2007-08-02			ENSG00000242441	ENSG00000242441			30727	protein-coding gene	gene with protein product	"""TFIIA alpha/beta like factor"""	605358				10364255, 11889132, 16525715	Standard	NM_006872		Approved	ALF		Q9UNN4	OTTHUMG00000152038	ENST00000403751.3:c.461C>T	2.37:g.48873664C>T	ENSP00000384597:p.Pro154Leu		B4DY14|Q53FD9|Q5D050	Missense_Mutation	SNP	pfam_TFIIA_asu/bsu,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pfscan_Clathrin_mu_C,pfscan_SHD	p.P858L	ENST00000403751.3	37	c.2573	CCDS46281.1	2	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415820	0.62511	.	.	ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000242441;ENSG00000242441;ENSG00000242441;ENSG00000242441	ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751;ENST00000394749;ENST00000448460;ENST00000437125;ENST00000430487;ENST00000403751	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.82	4.89	0.63831	.	0.241030	0.34959	N	0.003549	T	0.69477	0.3115	M	0.83603	2.65	0.80722	D	1	P;D;D;D;D	0.89917	0.928;0.999;1.0;0.978;1.0	P;D;D;D;D	0.83275	0.647;0.986;0.996;0.913;0.996	T	0.73110	-0.4086	10	0.72032	D	0.01	.	12.7842	0.57496	0.1635:0.8365:0.0:0.0	.	120;811;858;154;858	Q9UNN4-2;A8MXJ1;B5MCF5;Q9UNN4;Q53S48	.;.;.;TF2AY_HUMAN;.	L	858;858;858;858;811;153;120;163;120;154	ENSP00000385499:P858L;ENSP00000385701:P858L;ENSP00000378236:P858L;ENSP00000311493:P858L;ENSP00000378234:P811L;ENSP00000412645:P120L;ENSP00000396702:P163L;ENSP00000387896:P120L;ENSP00000384597:P154L	ENSP00000384597:P154L	P	+	2	0	STON1-GTF2A1L;GTF2A1L	48727168	0.987000	0.35691	0.962000	0.40283	0.471000	0.32888	2.955000	0.49121	2.755000	0.94549	0.591000	0.81541	CCA	STON1-GTF2A1L	-	pfam_TFIIA_asu/bsu	ENSG00000068781		0.378	GTF2A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000323852.4	42	0.00	0	C	NM_006872		48873664	48873664	+1	no_errors	ENST00000309827	ensembl	human	known	69_37n	missense	39	33.90	20	SNP	0.962	T
SWI5	375757	genome.wustl.edu	37	9	131038582	131038582	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr9:131038582G>A	ENST00000320188.5	+	1	158	c.158G>A	c.(157-159)gGc>gAc	p.G53D	SWI5_ENST00000608796.1_5'UTR|SWI5_ENST00000495313.1_Intron|GOLGA2_ENST00000609374.1_5'Flank|GOLGA2_ENST00000490628.1_5'Flank|SWI5_ENST00000418976.1_5'UTR|SWI5_ENST00000419867.2_5'UTR|GOLGA2_ENST00000421699.2_5'Flank	NM_001040011.1	NP_001035100.1	Q1ZZU3	SWI5_HUMAN	SWI5 recombination repair homolog (yeast)	53					cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											AGAGTTCCTGGCCCGGTGCAC	0.706																																						dbGAP											0													12.0	16.0	15.0					9																	131038582		1898	4094	5992	-	-	-	SO:0001583	missense	0			BC029911	CCDS43883.1	9q34.13	2011-07-29	2011-07-29	2011-07-29	ENSG00000175854	ENSG00000175854			31412	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 119"""	C9orf119		21252223, 20976249	Standard	NM_001040011		Approved	bA395P17.9	uc004bup.3	Q1ZZU3	OTTHUMG00000020729	ENST00000320188.5:c.158G>A	9.37:g.131038582G>A	ENSP00000316609:p.Gly53Asp		Q5SYX7|Q5SYX8|Q8N2W6	Nonsense_Mutation	SNP	pfam_DNA-repair_Swi5	p.W20*	ENST00000320188.5	37	c.60	CCDS43883.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.226|0.226	-1.024709|-1.024709	0.02061|0.02061	.|.	.|.	ENSG00000175854|ENSG00000175854	ENST00000320188|ENST00000418976	.|.	.|.	.|.	1.98|1.98	-3.31|-3.31	0.04988|0.04988	.|.	2.171520|.	0.02635|.	N|.	0.104790|.	T|.	0.18964|.	0.0455|.	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.26018|.	-1.0115|.	9|.	0.45353|.	T|.	0.12|.	.|.	3.0713|3.0713	0.06231|0.06231	0.4293:0.2372:0.3335:0.0|0.4293:0.2372:0.3335:0.0	.|.	53|.	Q1ZZU3|.	SWI5_HUMAN|.	D|X	53|20	.|.	ENSP00000316609:G53D|.	G|W	+|+	2|3	0|0	SWI5|SWI5	130078403|130078403	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.324000|-0.324000	0.07986|0.07986	-0.687000|-0.687000	0.05162|0.05162	-0.507000|-0.507000	0.04495|0.04495	GGC|TGG	SWI5	-	NULL	ENSG00000175854		0.706	SWI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SWI5	HGNC	protein_coding		8	0.00	0	G	NM_001040011		131038582	131038582	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418976	ensembl	human	novel	69_37n	nonsense	2	75.00	6	SNP	0.000	A
TCEB3	6924	genome.wustl.edu	37	1	24075528	24075528	+	Silent	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:24075528G>A	ENST00000418390.2	+	2	442	c.171G>A	c.(169-171)aaG>aaA	p.K57K	TCEB3_ENST00000609199.1_Silent_p.K31K|TCEB3_ENST00000487554.1_3'UTR	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	57	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		AATATTTGAAGAAACTCTCCA	0.333																																						dbGAP											0													89.0	90.0	90.0					1																	24075528		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.171G>A	1.37:g.24075528G>A			B2R7Q8|Q8IXH1	Silent	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pfscan_F-box_dom_cyclin-like	p.K57	ENST00000418390.2	37	c.171	CCDS239.2	1																																																																																			TCEB3	-	pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	ENSG00000011007		0.333	TCEB3-001	KNOWN	basic|CCDS	protein_coding	TCEB3	HGNC	protein_coding	OTTHUMT00000008230.2	74	0.00	0	G	NM_003198		24075528	24075528	+1	no_errors	ENST00000418390	ensembl	human	known	69_37n	silent	62	13.89	10	SNP	1.000	A
TMEM18	129787	genome.wustl.edu	37	2	669836	669836	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr2:669836T>C	ENST00000281017.3	-	4	341	c.248A>G	c.(247-249)tAc>tGc	p.Y83C	TMEM18_ENST00000405941.3_Missense_Mutation_p.Y86C|TMEM18_ENST00000355654.2_Missense_Mutation_p.Y70C	NM_152834.2	NP_690047.2	Q96B42	TMM18_HUMAN	transmembrane protein 18	83					cell migration (GO:0016477)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(7)|ovary(1)	10	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)		GAAATACTGGTATTTCGAAAA	0.363																																						dbGAP											0													53.0	54.0	54.0					2																	669836		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137269	CCDS33141.1	2p25.3	2008-02-05			ENSG00000151353	ENSG00000151353			25257	protein-coding gene	gene with protein product		613220				12477932	Standard	NM_152834		Approved	DKFZp434C1714	uc002qwl.3	Q96B42	OTTHUMG00000151381	ENST00000281017.3:c.248A>G	2.37:g.669836T>C	ENSP00000281017:p.Tyr83Cys		D6W4X9|Q8N5H2|Q9NTH3	Missense_Mutation	SNP	NULL	p.Y83C	ENST00000281017.3	37	c.248	CCDS33141.1	2	.	.	.	.	.	.	.	.	.	.	T	13.11	2.140063	0.37728	.	.	ENSG00000151353	ENST00000281017;ENST00000355654;ENST00000405941	.	.	.	5.7	5.7	0.88788	.	0.326358	0.38005	N	0.001848	T	0.70046	0.3179	M	0.72118	2.19	0.43503	D	0.995758	D	0.69078	0.997	P	0.60236	0.871	T	0.70726	-0.4793	9	0.40728	T	0.16	-16.8412	12.4143	0.55483	0.0:0.0:0.0:1.0	.	83	Q96B42	TMM18_HUMAN	C	83;70;86	.	ENSP00000281017:Y83C	Y	-	2	0	TMEM18	659836	1.000000	0.71417	0.968000	0.41197	0.291000	0.27294	4.997000	0.63921	2.185000	0.69588	0.449000	0.29647	TAC	TMEM18	-	NULL	ENSG00000151353		0.363	TMEM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM18	HGNC	protein_coding	OTTHUMT00000322427.1	36	0.00	0	T	NM_152834		669836	669836	-1	no_errors	ENST00000281017	ensembl	human	known	69_37n	missense	15	44.44	12	SNP	1.000	C
TRAPPC8	22878	genome.wustl.edu	37	18	29487548	29487548	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr18:29487548G>A	ENST00000283351.4	-	9	1599	c.1264C>T	c.(1264-1266)Caa>Taa	p.Q422*	TRAPPC8_ENST00000582513.1_Nonsense_Mutation_p.Q422*|TRAPPC8_ENST00000582539.1_Nonsense_Mutation_p.Q368*	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	422					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TTCCTGATTTGAAGTTCTGGT	0.323																																						dbGAP											0													66.0	66.0	66.0					18																	29487548		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1264C>T	18.37:g.29487548G>A	ENSP00000283351:p.Gln422*		A0JP15|B3KME5|Q9H0L2	Nonsense_Mutation	SNP	NULL	p.Q422*	ENST00000283351.4	37	c.1264	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	G	38	6.794357	0.97845	.	.	ENSG00000153339	ENST00000283351	.	.	.	5.13	5.13	0.70059	.	0.119918	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	16.7543	0.85495	0.0:0.0:1.0:0.0	.	.	.	.	X	422	.	ENSP00000283351:Q422X	Q	-	1	0	TRAPPC8	27741546	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.397000	0.97276	2.386000	0.81285	0.655000	0.94253	CAA	TRAPPC8	-	NULL	ENSG00000153339		0.323	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1	38	0.00	0	G	NM_014939		29487548	29487548	-1	no_errors	ENST00000283351	ensembl	human	known	69_37n	nonsense	55	15.38	10	SNP	1.000	A
TSR2	90121	genome.wustl.edu	37	X	54467208	54467208	+	Missense_Mutation	SNP	G	G	A	rs140822042		TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chrX:54467208G>A	ENST00000375151.4	+	2	188	c.167G>A	c.(166-168)cGc>cAc	p.R56H		NM_058163.1	NP_477511.1	Q969E8	TSR2_HUMAN	TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)	56					rRNA processing (GO:0006364)					breast(1)|endometrium(3)|lung(2)	6						TACTTCATGCGCAATGGTGAG	0.607																																						dbGAP											0													47.0	41.0	43.0					X																	54467208		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007699	CCDS14358.1	Xp11.22	2008-10-01			ENSG00000158526	ENSG00000158526			25455	protein-coding gene	gene with protein product	"""WGG motif containing 1"""					9417904	Standard	NM_058163		Approved	DT1P1A10, RP1-112K5.2, WGG1	uc004dte.3	Q969E8	OTTHUMG00000021628	ENST00000375151.4:c.167G>A	X.37:g.54467208G>A	ENSP00000364293:p.Arg56His			Missense_Mutation	SNP	pfam_Pre-rRNA_process_TSR2	p.R56H	ENST00000375151.4	37	c.167	CCDS14358.1	X	.	.	.	.	.	.	.	.	.	.	G	14.71	2.615394	0.46631	.	.	ENSG00000158526	ENST00000375151	.	.	.	4.74	2.41	0.29592	.	0.382601	0.28895	N	0.013785	T	0.19685	0.0473	N	0.16656	0.425	0.23533	N	0.997473	P	0.47350	0.894	P	0.46543	0.52	T	0.04413	-1.0953	9	0.42905	T	0.14	-20.1815	5.1902	0.15205	0.1658:0.2021:0.6321:0.0	.	56	Q969E8	TSR2_HUMAN	H	56	.	ENSP00000364293:R56H	R	+	2	0	TSR2	54483933	0.788000	0.28762	0.999000	0.59377	0.980000	0.70556	0.455000	0.21843	0.869000	0.35703	0.513000	0.50165	CGC	TSR2	-	pfam_Pre-rRNA_process_TSR2	ENSG00000158526		0.607	TSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR2	HGNC	protein_coding	OTTHUMT00000056802.1	19	0.00	0	G	NM_058163		54467208	54467208	+1	no_errors	ENST00000375151	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.917	A
TTN	7273	genome.wustl.edu	37	2	179471857	179471857	+	Silent	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr2:179471857G>A	ENST00000591111.1	-	228	48773	c.48549C>T	c.(48547-48549)atC>atT	p.I16183I	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Silent_p.I8951I|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Silent_p.I15256I|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.I8759I|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Silent_p.I8884I|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.I17824I			Q8WZ42	TITIN_HUMAN	titin	16183	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAGACCTGTGATGTCACATT	0.413																																						dbGAP											0													241.0	232.0	235.0					2																	179471857		1897	4135	6032	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48549C>T	2.37:g.179471857G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.I15256	ENST00000591111.1	37	c.45768		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	77	0.00	0	G	NM_133378		179471857	179471857	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	52	32.47	25	SNP	1.000	A
UBE2L6	9246	genome.wustl.edu	37	11	57322087	57322087	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr11:57322087G>C	ENST00000287156.4	-	3	328	c.133C>G	c.(133-135)Ccc>Gcc	p.P45A	UBE2L6_ENST00000340573.4_5'UTR	NM_004223.4	NP_004214.1	O14933	UB2L6_HUMAN	ubiquitin-conjugating enzyme E2L 6	45					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|ovary(1)	5						AGGTGGTAGGGAGGTTGGTCC	0.552																																						dbGAP											0													111.0	107.0	109.0					11																	57322087		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF031141, AK093462, BC032491	CCDS7960.1, CCDS7961.1	11q12.1	2008-02-01			ENSG00000156587	ENSG00000156587		"""Ubiquitin-conjugating enzymes E2"""	12490	protein-coding gene	gene with protein product		603890				9153201	Standard	NM_004223		Approved	UBCH8	uc001nkn.2	O14933	OTTHUMG00000167047	ENST00000287156.4:c.133C>G	11.37:g.57322087G>C	ENSP00000287156:p.Pro45Ala		A6NDM6|A8MY53|Q8N5D8|Q9UEZ0	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P45A	ENST00000287156.4	37	c.133	CCDS7960.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.231781	0.95207	.	.	ENSG00000156587	ENST00000287156;ENST00000526659	T;T	0.75260	-0.92;-0.92	6.06	6.06	0.98353	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.56097	D	0.000025	D	0.86381	0.5919	M	0.73319	2.225	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	D	0.86007	0.1498	10	0.62326	D	0.03	.	19.3923	0.94587	0.0:0.0:1.0:0.0	.	45	O14933	UB2L6_HUMAN	A	45;52	ENSP00000287156:P45A;ENSP00000434348:P52A	ENSP00000287156:P45A	P	-	1	0	UBE2L6	57078663	1.000000	0.71417	0.978000	0.43139	0.988000	0.76386	9.776000	0.99001	2.882000	0.98803	0.655000	0.94253	CCC	UBE2L6	-	pfam_UBQ-conjugat_E2,pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000156587		0.552	UBE2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2L6	HGNC	protein_coding	OTTHUMT00000392657.1	25	0.00	0	G	NM_004223		57322087	57322087	-1	no_errors	ENST00000287156	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	1.000	C
VIPR2	7434	genome.wustl.edu	37	7	158829459	158829459	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr7:158829459G>T	ENST00000262178.2	-	7	917	c.732C>A	c.(730-732)taC>taA	p.Y244*	VIPR2_ENST00000402066.1_Nonsense_Mutation_p.Y385*|VIPR2_ENST00000377633.3_Nonsense_Mutation_p.Y228*	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	244					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CGATCAGGAGGTAGGCCAGGA	0.572																																					Pancreas(154;1876 1931 2329 17914 20079)	dbGAP											0													53.0	44.0	47.0					7																	158829459		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.732C>A	7.37:g.158829459G>T	ENSP00000262178:p.Tyr244*		Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Nonsense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_VIP_rcpt_2,prints_GPCR_2_secretin-like,prints_GPCR_2_VIP_rcpt	p.Y244*	ENST00000262178.2	37	c.732	CCDS5950.1	7	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095516	0.56075	.	.	ENSG00000106018	ENST00000262178;ENST00000377633;ENST00000402066	.	.	.	4.68	-7.8	0.01214	.	0.000000	0.48286	D	0.000193	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0405	0.89317	0.2273:0.0:0.7727:0.0	.	.	.	.	X	244;228;385	.	.	Y	-	3	2	VIPR2	158522220	0.415000	0.25416	0.682000	0.30024	0.091000	0.18340	-0.226000	0.09139	-1.658000	0.01490	-0.367000	0.07326	TAC	VIPR2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_VIP_rcpt_2,prints_GPCR_2_secretin-like	ENSG00000106018		0.572	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPR2	HGNC	protein_coding	OTTHUMT00000322675.1	19	0.00	0	G	NM_003382		158829459	158829459	-1	no_errors	ENST00000262178	ensembl	human	known	69_37n	nonsense	16	36.00	9	SNP	0.965	T
ZBTB12	221527	genome.wustl.edu	37	6	31868782	31868782	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr6:31868782C>A	ENST00000375527.2	-	2	476	c.301G>T	c.(301-303)Gtc>Ttc	p.V101F	C2_ENST00000469372.1_Intron|C2_ENST00000452323.2_5'UTR	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	101					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						AGGTAGTTGACGATGTCCCTA	0.577																																						dbGAP											0													83.0	77.0	79.0					6																	31868782		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.301G>T	6.37:g.31868782C>A	ENSP00000364677:p.Val101Phe		B0UY00|Q5JQ98	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V101F	ENST00000375527.2	37	c.301	CCDS4727.1	6	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732175	0.89390	.	.	ENSG00000204366	ENST00000375527	T	0.68903	-0.36	4.26	4.26	0.50523	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.076982	0.52532	U	0.000076	T	0.71986	0.3405	L	0.49778	1.585	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76231	-0.3035	10	0.66056	D	0.02	.	15.4368	0.75152	0.0:1.0:0.0:0.0	.	101	Q9Y330	ZBT12_HUMAN	F	101	ENSP00000364677:V101F	ENSP00000364677:V101F	V	-	1	0	ZBTB12	31976761	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.893000	0.63199	1.913000	0.55393	0.530000	0.56133	GTC	ZBTB12	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000204366		0.577	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB12	HGNC	protein_coding	OTTHUMT00000076315.2	21	0.00	0	C	NM_181842		31868782	31868782	-1	no_errors	ENST00000375527	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	A
ZFP69	339559	genome.wustl.edu	37	1	40960790	40960790	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr1:40960790T>A	ENST00000372706.1	+	6	1646	c.640T>A	c.(640-642)Ttg>Atg	p.L214M	ZFP69_ENST00000372705.3_Missense_Mutation_p.L214M|RP11-656D10.3_ENST00000450713.1_RNA			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACAAGCCATCTTGACCCATAA	0.358																																						dbGAP											0													76.0	76.0	76.0					1																	40960790		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.640T>A	1.37:g.40960790T>A	ENSP00000361791:p.Leu214Met		Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Retrov_capsid_C,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L214M	ENST00000372706.1	37	c.640	CCDS30686.1	1	.	.	.	.	.	.	.	.	.	.	T	7.375	0.627559	0.14257	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.05139	3.49;3.49	4.44	0.736	0.18307	.	0.488841	0.15322	N	0.268491	T	0.04318	0.0119	L	0.29908	0.895	0.18873	N	0.999983	B	0.18968	0.032	B	0.17979	0.02	T	0.37842	-0.9688	10	0.48119	T	0.1	-0.0173	3.1795	0.06579	0.1764:0.3044:0.0:0.5192	.	214	Q49AA0	ZN642_HUMAN	M	214	ENSP00000361791:L214M;ENSP00000361790:L214M	ENSP00000361790:L214M	L	+	1	2	ZNF642	40733377	0.000000	0.05858	0.131000	0.22000	0.917000	0.54804	-0.400000	0.07241	0.109000	0.17891	0.460000	0.39030	TTG	ZNF642	-	NULL	ENSG00000187815		0.358	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF642	HGNC	protein_coding	OTTHUMT00000019082.1	44	0.00	0	T	NM_198494		40960790	40960790	+1	no_errors	ENST00000372705	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.705	A
ZNF662	389114	genome.wustl.edu	37	3	42955921	42955921	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr3:42955921G>A	ENST00000541208.1	+	5	725	c.356G>A	c.(355-357)gGa>gAa	p.G119E	KRBOX1_ENST00000426937.1_Intron|ZNF662_ENST00000422021.1_Intron|ZNF662_ENST00000440367.2_Missense_Mutation_p.G119E|ZNF662_ENST00000328199.6_Missense_Mutation_p.G145E			Q6ZS27	ZN662_HUMAN	zinc finger protein 662	119					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.217)		CAGTGGTGTGGATCCCAGGAA	0.453																																						dbGAP											0													80.0	84.0	83.0					3																	42955921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127779	CCDS2708.1, CCDS46807.1	3p22.1	2013-01-08			ENSG00000182983	ENSG00000182983		"""Zinc fingers, C2H2-type"", ""-"""	31930	protein-coding gene	gene with protein product							Standard	NM_207404		Approved	FLJ45880	uc003cmk.2	Q6ZS27	OTTHUMG00000133041	ENST00000541208.1:c.356G>A	3.37:g.42955921G>A	ENSP00000446208:p.Gly119Glu		A1A4T9|F8W7S8|Q6ZNF8|Q6ZQW8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G145E	ENST00000541208.1	37	c.434	CCDS2708.1	3	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.127631	0.00342	.	.	ENSG00000182983	ENST00000440367;ENST00000328199;ENST00000541208	T;T;T	0.60672	0.17;0.17;0.17	2.93	-0.274	0.12910	.	.	.	.	.	T	0.40015	0.1100	L	0.40543	1.245	0.09310	N	1	P;B	0.36909	0.573;0.437	B;B	0.36092	0.217;0.108	T	0.20140	-1.0284	9	0.19590	T	0.45	.	3.913	0.09211	0.2471:0.0:0.564:0.1889	.	145;119	F8W7S8;Q6ZS27	.;ZN662_HUMAN	E	119;145;119	ENSP00000405047:G119E;ENSP00000329264:G145E;ENSP00000446208:G119E	ENSP00000329264:G145E	G	+	2	0	ZNF662	42930925	0.000000	0.05858	0.068000	0.19968	0.064000	0.16182	-0.111000	0.10807	0.134000	0.18681	0.555000	0.69702	GGA	ZNF662	-	NULL	ENSG00000182983		0.453	ZNF662-201	KNOWN	basic|CCDS	protein_coding	ZNF662	HGNC	protein_coding	OTTHUMT00000256646.4	45	0.00	0	G	NM_207404		42955921	42955921	+1	no_errors	ENST00000328199	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	0.000	A
ZNF99	7652	genome.wustl.edu	37	19	22939510	22939510	+	IGR	SNP	C	C	T	rs371015923|rs74170737	byFrequency	TCGA-E9-A22E-01A-11D-A159-09	TCGA-E9-A22E-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a1d7dafc-a755-44a6-b45b-dc6aae309d3e	126314e2-cbf4-40e6-9277-05857e870852	g.chr19:22939510C>T	ENST00000596209.1	-	0	2686				CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Silent_p.P887P	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CACATTTGTACGGTTTCTCCC	0.353																																						dbGAP											0													36.0	48.0	44.0					19																	22939510		1869	4215	6084	-	-	-	SO:0001628	intergenic_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4			19.37:g.22939510C>T			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P887	ENST00000596209.1	37	c.2661	CCDS59369.1	19																																																																																			ZNF99	-	pfscan_Znf_C2H2	ENSG00000213973		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	50	0.00	0	C	XM_065124		22939510	22939510	-1	no_errors	ENST00000397104	ensembl	human	known	69_37n	silent	49	15.52	9	SNP	0.077	T
