#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ARF4	378	genome.wustl.edu	37	3	57557144	57557144	+	3'UTR	SNP	G	G	A	rs201857922		TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr3:57557144G>A	ENST00000303436.6	-	0	1605				ARF4_ENST00000496292.1_3'UTR|ARF4_ENST00000489843.1_3'UTR	NM_001660.3	NP_001651.1	P18085	ARF4_HUMAN	ADP-ribosylation factor 4						activation of phospholipase D activity (GO:0031584)|brain development (GO:0007420)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein transport (GO:0015031)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to axon injury (GO:0048678)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	epidermal growth factor receptor binding (GO:0005154)|GTP binding (GO:0005525)			large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0449)|Kidney(284;0.0561)		TGAAGAAAATGTATTCATCGA	0.274																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			M36341	CCDS2884.1	3p21.2-p21.1	2007-03-19			ENSG00000168374	ENSG00000168374		"""ADP-ribosylation factors"""	655	protein-coding gene	gene with protein product		601177	"""ADP-ribosylation factor 2"""	ARF2		2107548	Standard	NM_001660		Approved		uc003dix.4	P18085	OTTHUMG00000158601	ENST00000303436.6:c.*795C>T	3.37:g.57557144G>A			B2R7J7|P21371	RNA	SNP	-	NULL	ENST00000303436.6	37	NULL	CCDS2884.1	3																																																																																			ARF4	-	-	ENSG00000168374		0.274	ARF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF4	HGNC	protein_coding	OTTHUMT00000351443.1	17	0.00	0	G	NM_001660		57557144	57557144	-1	no_errors	ENST00000489843	ensembl	human	known	69_37n	rna	16	23.81	5	SNP	0.056	A
ARFGEF2	10564	genome.wustl.edu	37	20	47589751	47589751	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr20:47589751G>A	ENST00000371917.4	+	12	1595	c.1595G>A	c.(1594-1596)cGc>cAc	p.R532H		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	532					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			ATTTTTGAGCGCCTTGTAAAT	0.373																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)	dbGAP											0													96.0	92.0	93.0					20																	47589751		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1595G>A	20.37:g.47589751G>A	ENSP00000360985:p.Arg532His		Q5TFT9|Q9NTS1	Missense_Mutation	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.R532H	ENST00000371917.4	37	c.1595	CCDS13411.1	20	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005143	0.93287	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.65732	-0.17	5.5	5.5	0.81552	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83041	0.5168	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.84928	0.0858	10	0.52906	T	0.07	.	19.425	0.94737	0.0:0.0:1.0:0.0	.	532	Q9Y6D5	BIG2_HUMAN	H	532	ENSP00000360985:R532H	ENSP00000360985:R532H	R	+	2	0	ARFGEF2	47023158	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.869000	0.99810	2.584000	0.87258	0.563000	0.77884	CGC	ARFGEF2	-	superfamily_ARM-type_fold	ENSG00000124198		0.373	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	75	0.00	0	G	NM_006420		47589751	47589751	+1	no_errors	ENST00000371917	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	1.000	A
ARPC5L	81873	genome.wustl.edu	37	9	127631656	127631658	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr9:127631656_127631658delGGC	ENST00000353214.2	+	3	1339_1341	c.87_89delGGC	c.(85-90)gaggcg>gag	p.A35del	ARPC5L_ENST00000259477.6_In_Frame_Del_p.A35del			Q9BPX5	ARP5L_HUMAN	actin related protein 2/3 complex, subunit 5-like	35					regulation of actin filament polymerization (GO:0030833)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)				large_intestine(2)|lung(1)	3						AGCAGGAGGAggcggcggcggcg	0.714																																						dbGAP											0										36,2486		5,26,1230						3.9	1.0			7	68,4732		8,52,2340	no	coding	ARPC5L	NM_030978.1		13,78,3570	A1A1,A1R,RR		1.4167,1.4274,1.4204				104,7218				-	-	-	SO:0001651	inframe_deletion	0			AF087842	CCDS6859.1	9q34.11	2011-07-06			ENSG00000136950	ENSG00000136950		"""Actin related protein 2/3 complex subunits"""	23366	protein-coding gene	gene with protein product							Standard	NM_030978		Approved	MGC3038, ARC16-2	uc004bpa.4	Q9BPX5	OTTHUMG00000020660	ENST00000353214.2:c.87_89delGGC	9.37:g.127631665_127631667delGGC	ENSP00000345361:p.Ala35del		Q7Z523	In_Frame_Del	DEL	pfam_ARP2/3_p16_Arc,superfamily_ARP2/3_p16_Arc	p.A33in_frame_del	ENST00000353214.2	37	c.87_89	CCDS6859.1	9																																																																																			ARPC5L	-	pfam_ARP2/3_p16_Arc,superfamily_ARP2/3_p16_Arc	ENSG00000136950		0.714	ARPC5L-002	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	ARPC5L	HGNC	protein_coding	OTTHUMT00000054041.1	16	0.00	0	GGC	NM_030978		127631656	127631658	+1	no_errors	ENST00000259477	ensembl	human	known	69_37n	in_frame_del	2	50.00	2	DEL	1.000:1.000:1.000	-
ATP2A1	487	genome.wustl.edu	37	16	28914702	28914703	+	Frame_Shift_Del	DEL	CA	CA	-	rs371827833		TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr16:28914702_28914703delCA	ENST00000357084.3	+	21	3188_3189	c.2921_2922delCA	c.(2920-2922)tcafs	p.S974fs	ATP2A1_ENST00000395503.4_Frame_Shift_Del_p.S974fs|ATP2A1_ENST00000536376.1_Frame_Shift_Del_p.S849fs	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	974					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CTCAAGATCTCACTGCCAGTCA	0.609																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2921_2922delCA	16.37:g.28914702_28914703delCA	ENSP00000349595:p.Ser974fs		A8K5J9|B3KY17|O14984	Frame_Shift_Del	DEL	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.L975fs	ENST00000357084.3	37	c.2921_2922	CCDS10643.1	16																																																																																			ATP2A1	-	pfam_ATPase_P-typ_cation-transptr_C	ENSG00000196296		0.609	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2	64	0.00	0	CA	NM_004320		28914702	28914703	+1	no_errors	ENST00000357084	ensembl	human	known	69_37n	frame_shift_del	31	63.53	54	DEL	0.999:0.077	-
ATP5A1	498	genome.wustl.edu	37	18	43667372	43667372	+	Missense_Mutation	SNP	T	T	C	rs77926733		TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr18:43667372T>C	ENST00000398752.6	-	7	1007	c.886A>G	c.(886-888)Atg>Gtg	p.M296V	ATP5A1_ENST00000593152.2_Missense_Mutation_p.M246V|ATP5A1_ENST00000282050.2_Missense_Mutation_p.M296V|ATP5A1_ENST00000590665.1_Missense_Mutation_p.M274V	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	296					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						TACTCTCCCATGGAACAGCCA	0.418																																						dbGAP											0													62.0	64.0	63.0					18																	43667372		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.886A>G	18.37:g.43667372T>C	ENSP00000381736:p.Met296Val		A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1/A1-cplx_a/bsu_N,tigrfam_ATPase_F1-cplx_asu	p.M296V	ENST00000398752.6	37	c.886	CCDS11927.1	18	.	.	.	.	.	.	.	.	.	.	T	16.17	3.048143	0.55110	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	T;T	0.78481	-1.18;-1.18	4.68	4.68	0.58851	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.77685	0.4167	M	0.69823	2.125	0.58432	D	0.999999	B	0.20459	0.045	B	0.25759	0.063	T	0.77094	-0.2715	10	0.66056	D	0.02	-22.0222	14.1589	0.65434	0.0:0.0:0.0:1.0	.	296	P25705	ATPA_HUMAN	V	296;296;246	ENSP00000282050:M296V;ENSP00000381736:M296V	ENSP00000282050:M296V	M	-	1	0	ATP5A1	41921370	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.953000	0.87836	1.749000	0.51849	0.460000	0.39030	ATG	ATP5A1	-	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,tigrfam_ATPase_F1-cplx_asu	ENSG00000152234		0.418	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5A1	HGNC	protein_coding	OTTHUMT00000255884.1	44	0.00	0	T	NM_004046		43667372	43667372	-1	no_errors	ENST00000282050	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	C
LSP1	4046	genome.wustl.edu	37	11	1910628	1910628	+	Intron	SNP	C	C	T	rs577250190	byFrequency	TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr11:1910628C>T	ENST00000311604.3	+	10	1208				LSP1_ENST00000485341.1_Intron|LSP1_ENST00000406638.2_Intron|LSP1_ENST00000405957.2_Intron|LSP1_ENST00000381775.1_Intron|C11orf89_ENST00000391480.1_Missense_Mutation_p.R396Q	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1						cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		CCTGGAGGTCCGGGAGGCGGG	0.736													c|||	2	0.000399361	0.0	0.0	5008	,	,		12349	0.0		0.002	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.1017+1822C>T	11.37:g.1910628C>T			B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	NULL	p.R396Q	ENST00000311604.3	37	c.1187	CCDS31334.1	11	.	.	.	.	.	.	.	.	.	.	.	17.43	3.388363	0.61956	.	.	ENSG00000184682	ENST00000391480	.	.	.	3.41	3.41	0.39046	.	.	.	.	.	T	0.70351	0.3214	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71751	-0.4498	5	0.40728	T	0.16	-4.209	14.9842	0.71332	0.0:1.0:0.0:0.0	.	.	.	.	Q	396	.	ENSP00000375311:R396Q	R	-	2	0	C11orf89	1867204	0.016000	0.18221	1.000000	0.80357	0.384000	0.30261	1.216000	0.32443	1.917000	0.55516	0.454000	0.30748	CGG	C11orf89	-	NULL	ENSG00000184682		0.736	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf89	HGNC	protein_coding	OTTHUMT00000034045.3	11	0.00	0	C	NM_002339		1910628	1910628	-1	no_errors	ENST00000391480	ensembl	human	known	69_37n	missense	0	100.00	9	SNP	0.997	T
CATIP	375307	genome.wustl.edu	37	2	219232516	219232516	+	Silent	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr2:219232516C>T	ENST00000289388.3	+	10	1022	c.993C>T	c.(991-993)ttC>ttT	p.F331F	AC021016.6_ENST00000441749.1_RNA|C2orf62_ENST00000481940.1_3'UTR	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		331					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTCCGACTTCCTGCTCTTCC	0.701																																						dbGAP											0													26.0	28.0	27.0					2																	219232516		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000289388.3:c.993C>T	2.37:g.219232516C>T				Silent	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.F331	ENST00000289388.3	37	c.993	CCDS2414.1	2																																																																																			C2orf62	-	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	ENSG00000158428		0.701	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf62	HGNC	protein_coding	OTTHUMT00000256771.1	68	0.00	0	C			219232516	219232516	+1	no_errors	ENST00000289388	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	0.999	T
CALD1	800	genome.wustl.edu	37	7	134618585	134618585	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr7:134618585G>T	ENST00000361675.2	+	5	1294	c.1065G>T	c.(1063-1065)gaG>gaT	p.E355D	CALD1_ENST00000361901.2_Intron|CALD1_ENST00000361388.2_Intron|CALD1_ENST00000495522.1_Intron|CALD1_ENST00000424922.1_Intron|CALD1_ENST00000393118.2_Intron|CALD1_ENST00000543443.1_Intron|CALD1_ENST00000417172.1_Intron|CALD1_ENST00000422748.1_Intron			Q05682	CALD1_HUMAN	caldesmon 1	355	3 X 14 AA tandem repeats of E-E-E-K-R-A- A-E-E-R-Q-R-I-K.				cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						cagcagaggagaggcagagga	0.527																																						dbGAP											0													126.0	144.0	138.0					7																	134618585		2200	4297	6497	-	-	-	SO:0001583	missense	0			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.1065G>T	7.37:g.134618585G>T	ENSP00000354826:p.Glu355Asp		A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.E355D	ENST00000361675.2	37	c.1065	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	G	5.535	0.283537	0.10458	.	.	ENSG00000122786	ENST00000361675	T	0.43294	0.95	3.57	0.282	0.15692	.	0.549201	0.14572	U	0.311377	T	0.29256	0.0728	L	0.44542	1.39	0.09310	N	0.999998	B	0.25441	0.126	B	0.28916	0.096	T	0.17961	-1.0352	9	.	.	.	.	3.9111	0.09204	0.3724:0.1923:0.4353:0.0	.	355	Q05682	CALD1_HUMAN	D	355	ENSP00000354826:E355D	.	E	+	3	2	CALD1	134269125	0.071000	0.21146	0.173000	0.22940	0.385000	0.30292	0.324000	0.19610	0.469000	0.27268	0.462000	0.41574	GAG	CALD1	-	pfam_Caldesmon_LSP	ENSG00000122786		0.527	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	45	0.00	0	G	NM_033138		134618585	134618585	+1	no_errors	ENST00000361675	ensembl	human	novel	69_37n	missense	14	41.67	10	SNP	0.003	T
CHFR	55743	genome.wustl.edu	37	12	133418072	133418072	+	3'UTR	SNP	G	G	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr12:133418072G>A	ENST00000432561.2	-	0	2136				CHFR_ENST00000450056.2_3'UTR|CHFR_ENST00000443047.2_3'UTR|CHFR_ENST00000537522.1_3'UTR|CHFR_ENST00000315585.7_3'UTR|CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000266880.7_3'UTR|CHFR_ENST00000541341.1_Intron			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase						mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TGACGTGCTTGTCTCTGTATT	0.512																																						dbGAP											0													90.0	78.0	82.0					12																	133418072		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.*68C>T	12.37:g.133418072G>A			A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	RNA	SNP	-	NULL	ENST00000432561.2	37	NULL	CCDS53849.1	12																																																																																			CHFR	-	-	ENSG00000072609		0.512	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CHFR	HGNC	protein_coding	OTTHUMT00000397130.2	21	0.00	0	G			133418072	133418072	-1	no_errors	ENST00000535527	ensembl	human	known	69_37n	rna	17	34.62	9	SNP	0.000	A
CNPY3	10695	genome.wustl.edu	37	6	42897357	42897358	+	In_Frame_Ins	INS	-	-	TGC	rs570105218	byFrequency	TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr6:42897357_42897358insTGC	ENST00000372836.4	+	1	420_421	c.49_50insTGC	c.(49-51)ttg>tTGCtg	p.17_17L>LL	CNPY3_ENST00000394142.3_In_Frame_Ins_p.17_17L>LL	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	17					innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.L25delL(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			GCTTCTTCCCTtgctgctgctg	0.693																																						dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)																																								-	-	-	SO:0001652	inframe_insertion	0			U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.74_76dupTGC	6.37:g.42897364_42897366dupTGC	ENSP00000361926:p.Leu25dup		O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	In_Frame_Ins	INS	pfam_DUF3456	p.21in_frame_insL	ENST00000372836.4	37	c.49_50	CCDS4875.1	6																																																																																			CNPY3	-	NULL	ENSG00000137161		0.693	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY3	HGNC	protein_coding	OTTHUMT00000040564.1	48	0.00	0	-	NM_006586		42897357	42897358	+1	no_errors	ENST00000372836	ensembl	human	known	69_37n	in_frame_ins	41	21.15	11	INS	0.004:0.122	TGC
COL8A1	1295	genome.wustl.edu	37	3	99513184	99513184	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr3:99513184G>A	ENST00000261037.3	+	5	819	c.439G>A	c.(439-441)Gga>Aga	p.G147R	COL8A1_ENST00000273342.4_Missense_Mutation_p.G147R	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	147	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						TGGAATTAAAGGAAAACCAGG	0.587																																						dbGAP											0													37.0	40.0	39.0					3																	99513184		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.439G>A	3.37:g.99513184G>A	ENSP00000261037:p.Gly147Arg		D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.G147R	ENST00000261037.3	37	c.439	CCDS2934.1	3	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236231	0.58886	.	.	ENSG00000144810	ENST00000261037;ENST00000273342	D;D	0.99186	-5.53;-5.53	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.99426	0.9797	M	0.91090	3.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98701	1.0700	10	0.87932	D	0	.	16.849	0.85988	0.0:0.0:1.0:0.0	.	148;147	E7EPK9;P27658	.;CO8A1_HUMAN	R	147	ENSP00000261037:G147R;ENSP00000273342:G147R	ENSP00000261037:G147R	G	+	1	0	COL8A1	100995874	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.583000	0.87209	0.655000	0.94253	GGA	COL8A1	-	pfam_Collagen	ENSG00000144810		0.587	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL8A1	HGNC	protein_coding	OTTHUMT00000309001.1	33	0.00	0	G	NM_001850		99513184	99513184	+1	no_errors	ENST00000261037	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	A
CUX1	1523	genome.wustl.edu	37	7	101833121	101833121	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr7:101833121C>T	ENST00000292535.7	+	12	1084	c.1046C>T	c.(1045-1047)gCt>gTt	p.A349V	CUX1_ENST00000437600.4_Missense_Mutation_p.A358V|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000556210.1_Missense_Mutation_p.A349V|CUX1_ENST00000393824.3_Missense_Mutation_p.A321V|CUX1_ENST00000546411.2_Missense_Mutation_p.A349V|CUX1_ENST00000547394.2_Missense_Mutation_p.A344V|CUX1_ENST00000360264.3_Missense_Mutation_p.A360V|CUX1_ENST00000550008.2_Missense_Mutation_p.A349V|CUX1_ENST00000425244.2_Missense_Mutation_p.A314V|CUX1_ENST00000549414.2_Missense_Mutation_p.A349V|CUX1_ENST00000292538.4_Missense_Mutation_p.A360V	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	349					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AAAGGCCAGGCTGACTATGAA	0.522																																						dbGAP											0													110.0	106.0	108.0					7																	101833121		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.1046C>T	7.37:g.101833121C>T	ENSP00000292535:p.Ala349Val		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.A360V	ENST00000292535.7	37	c.1079	CCDS5721.1	7	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830372	0.91036	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.60797	1.46;1.46;0.16;1.45;1.47;0.16;0.17;0.17;0.2;0.2	4.94	4.94	0.65067	.	0.130609	0.52532	D	0.000077	T	0.51890	0.1701	N	0.19112	0.55	0.52099	D	0.999945	P;P;P;P;P;P;D	0.54207	0.859;0.941;0.953;0.928;0.949;0.932;0.965	B;P;B;P;P;P;P	0.50659	0.37;0.531;0.388;0.58;0.492;0.578;0.647	T	0.47142	-0.9140	10	0.23891	T	0.37	-16.0684	16.7159	0.85397	0.0:1.0:0.0:0.0	.	321;349;314;344;358;360;360	B4DZZ2;P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;.;CASP_HUMAN;.	V	360;344;360;314;358;349;349;349;349;349	ENSP00000292538:A360V;ENSP00000449371:A344V;ENSP00000353401:A360V;ENSP00000409745:A314V;ENSP00000414091:A358V;ENSP00000292535:A349V;ENSP00000446630:A349V;ENSP00000447373:A349V;ENSP00000450125:A349V;ENSP00000451558:A349V	ENSP00000292535:A349V	A	+	2	0	CUX1	101619841	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.624000	0.67764	2.429000	0.82318	0.561000	0.74099	GCT	CUX1	-	superfamily_LemA-like_dom	ENSG00000257923		0.522	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347535.1	24	0.00	0	C	NM_001913		101833121	101833121	+1	no_errors	ENST00000360264	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	T
WASH3P	374666	genome.wustl.edu	37	15	102516922	102516922	+	RNA	SNP	A	A	C			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr15:102516922A>C	ENST00000557932.1	+	0	1679				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						AGAGAAGGGCAGTCAGCAGGG	0.562																																						dbGAP											0																																										-	-	-			0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516922A>C				RNA	SNP	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			DDX11L9	-	-	ENSG00000248472		0.562	WASH3P-001	KNOWN	basic	processed_transcript	DDX11L9	HGNC	pseudogene	OTTHUMT00000417608.1	9	0.00	0	A	NM_199163		102516922	102516922	-1	no_errors	ENST00000559159	ensembl	human	known	69_37n	rna	1	80.00	4	SNP	0.002	C
DNAJB8	165721	genome.wustl.edu	37	3	128182816	128182816	+	De_novo_Start_InFrame	SNP	G	G	A	rs16847447	byFrequency	TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr3:128182816G>A	ENST00000469083.1	-	0	1830				DNAJB8-AS1_ENST00000471626.1_RNA|DNAJB8_ENST00000319153.3_De_novo_Start_InFrame			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8						chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		CACGAGGGCCGTCGGTAAACT	0.567													A|||	444	0.0886581	0.0772	0.0807	5008	,	,		15139	0.0218		0.1491	False		,,,				2504	0.1166					dbGAP											0																																										-	-	-			0				CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690		3.37:g.128182816G>A			B3KWV7	RNA	SNP	-	NULL	ENST00000469083.1	37	NULL	CCDS3048.1	3																																																																																			DNAJB8-AS1	-	-	ENSG00000242049		0.567	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJB8-AS1	HGNC	protein_coding	OTTHUMT00000356933.1	41	0.00	0	G	NM_153330		128182816	128182816	+1	no_errors	ENST00000471626	ensembl	human	known	69_37n	rna	23	14.29	4	SNP	0.000	A
RP1-274L7.1	0	genome.wustl.edu	37	X	129630202	129630202	+	lincRNA	SNP	T	T	C			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chrX:129630202T>C	ENST00000458525.1	-	0	1015				FAM45B_ENST00000592932.1_RNA																							ATGCTGAAAATCTGACTGTGT	0.413																																						dbGAP											0													10.0	10.0	10.0					X																	129630202		2002	4086	6088	-	-	-			0																															X.37:g.129630202T>C				RNA	SNP	-	NULL	ENST00000458525.1	37	NULL		X																																																																																			FAM45B	-	-	ENSG00000221930		0.413	RP1-274L7.1-001	KNOWN	basic	lincRNA	FAM45B	HGNC	lincRNA	OTTHUMT00000058271.1	28	0.00	0	T			129630202	129630202	+1	no_errors	ENST00000592932	ensembl	human	known	69_37n	rna	2	75.00	6	SNP	1.000	C
FAM127A	8933	genome.wustl.edu	37	X	134167432	134167432	+	3'UTR	SNP	G	G	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chrX:134167432G>A	ENST00000257013.7	+	0	1100				FAM127A_ENST00000464369.1_3'UTR	NM_001078171.1	NP_001071639.1	O15255	CXX1_HUMAN	family with sequence similarity 127, member A							plasma membrane (GO:0005886)				endometrium(3)|urinary_tract(1)	4	Acute lymphoblastic leukemia(192;0.000127)					TGCCCATAACGCAGTATTCTG	0.473																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			Y13374	CCDS43997.1	Xq26	2014-05-16	2006-11-16	2006-11-16	ENSG00000134590	ENSG00000134590			2569	protein-coding gene	gene with protein product		300213	"""CAAX box 1"""	CXX1		9403077, 15716091, 16093683	Standard	NM_001078171		Approved	Mart8, Mar8, MAR8C	uc004eyd.3	A6ZKI3	OTTHUMG00000022465	ENST00000257013.7:c.*677G>A	X.37:g.134167432G>A			Q6IBF1	RNA	SNP	-	NULL	ENST00000257013.7	37	NULL	CCDS43997.1	X																																																																																			FAM127A	-	-	ENSG00000134590		0.473	FAM127A-002	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM127A	HGNC	protein_coding	OTTHUMT00000058391.2	67	0.00	0	G	NM_001078171		134167432	134167432	+1	no_errors	ENST00000464369	ensembl	human	known	69_37n	rna	13	31.58	6	SNP	0.000	A
FAT2	2196	genome.wustl.edu	37	5	150920247	150920247	+	Missense_Mutation	SNP	G	G	A	rs201177490		TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr5:150920247G>A	ENST00000261800.5	-	10	8932	c.8920C>T	c.(8920-8922)Cgc>Tgc	p.R2974C		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2974	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTATGCTCGCGGTCCAGGGTC	0.527																																						dbGAP											0													106.0	88.0	94.0					5																	150920247		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8920C>T	5.37:g.150920247G>A	ENSP00000261800:p.Arg2974Cys		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R2974C	ENST00000261800.5	37	c.8920	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845847	0.71603	.	.	ENSG00000086570	ENST00000261800	T	0.01745	4.66	5.26	5.26	0.73747	Cadherin (4);Cadherin-like (1);	0.000000	0.56097	D	0.000033	T	0.16342	0.0393	H	0.96175	3.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01541	-1.1329	10	0.46703	T	0.11	.	13.0097	0.58724	0.0:0.0:0.7286:0.2714	.	2974	Q9NYQ8	FAT2_HUMAN	C	2974	ENSP00000261800:R2974C	ENSP00000261800:R2974C	R	-	1	0	FAT2	150900440	1.000000	0.71417	0.999000	0.59377	0.877000	0.50540	2.953000	0.49105	2.471000	0.83476	0.563000	0.77884	CGC	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.527	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	90	0.00	0	G	NM_001447		150920247	150920247	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	missense	38	28.30	15	SNP	1.000	A
FCRL5	83416	genome.wustl.edu	37	1	157514865	157514865	+	Silent	SNP	C	C	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr1:157514865C>A	ENST00000361835.3	-	4	472	c.315G>T	c.(313-315)ctG>ctT	p.L105L	FCRL5_ENST00000368190.3_Silent_p.L105L|FCRL5_ENST00000368189.3_Silent_p.L105L|FCRL5_ENST00000356953.4_Silent_p.L105L|FCRL5_ENST00000368191.3_Silent_p.L20L	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	105					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CTTGCAGGATCAGCGAAGCTA	0.383																																						dbGAP											0													46.0	48.0	47.0					1																	157514865		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.315G>T	1.37:g.157514865C>A			A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L105	ENST00000361835.3	37	c.315	CCDS1165.1	1																																																																																			FCRL5	-	NULL	ENSG00000143297		0.383	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	45	0.00	0	C	NM_031281		157514865	157514865	-1	no_errors	ENST00000356953	ensembl	human	known	69_37n	silent	55	19.12	13	SNP	0.959	A
GNG2	54331	genome.wustl.edu	37	14	52433435	52433435	+	3'UTR	SNP	G	G	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr14:52433435G>T	ENST00000335281.4	+	0	652				GNG2_ENST00000556766.1_3'UTR|GNG2_ENST00000553432.1_3'UTR|GNG2_ENST00000557376.1_3'UTR|RP11-463J10.3_ENST00000553603.1_RNA|GNG2_ENST00000554736.1_3'UTR|GNG2_ENST00000556752.1_3'UTR|GNG2_ENST00000553299.1_3'UTR|GNG2_ENST00000555472.1_3'UTR	NM_001243774.1	NP_001230703.1	P59768	GBG2_HUMAN	guanine nucleotide binding protein (G protein), gamma 2						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|platelet activation (GO:0030168)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|signal transducer activity (GO:0004871)			lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	all_epithelial(31;0.0659)|Breast(41;0.0684)				Halothane(DB01159)	AGAGCCTCCGGGCTCCTGGGA	0.507																																						dbGAP											0													46.0	52.0	50.0					14																	52433435		2201	4299	6500	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK001024	CCDS32082.1	14q21	2008-07-28				ENSG00000186469			4404	protein-coding gene	gene with protein product		606981				10833460	Standard	NM_053064		Approved		uc001wzj.3	P59768		ENST00000335281.4:c.*30G>T	14.37:g.52433435G>T			Q5JPE2|Q6P9A9	RNA	SNP	-	NULL	ENST00000335281.4	37	NULL	CCDS32082.1	14																																																																																			GNG2	-	-	ENSG00000186469		0.507	GNG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GNG2	HGNC	protein_coding	OTTHUMT00000411585.1	42	0.00	0	G			52433435	52433435	+1	no_errors	ENST00000553299	ensembl	human	known	69_37n	rna	25	13.79	4	SNP	1.000	T
HIVEP1	3096	genome.wustl.edu	37	6	12123074	12123074	+	Missense_Mutation	SNP	G	G	T	rs369544097	byFrequency	TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr6:12123074G>T	ENST00000379388.2	+	4	3378	c.3046G>T	c.(3046-3048)Gct>Tct	p.A1016S	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1016					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CTACAGAGTCGCTGGGTCCTC	0.498																																						dbGAP											0													97.0	102.0	100.0					6																	12123074		1912	4138	6050	-	-	-	SO:0001583	missense	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.3046G>T	6.37:g.12123074G>T	ENSP00000368698:p.Ala1016Ser		B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1016S	ENST00000379388.2	37	c.3046	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862457	0.32884	.	.	ENSG00000095951	ENST00000379388	T	0.29142	1.58	5.86	5.86	0.93980	.	0.000000	0.36134	N	0.002771	T	0.38401	0.1039	M	0.77616	2.38	0.80722	D	1	D	0.61080	0.989	P	0.53401	0.725	T	0.23368	-1.0190	9	.	.	.	-17.1182	13.8099	0.63256	0.0784:0.0:0.9216:0.0	.	1016	P15822	ZEP1_HUMAN	S	1016	ENSP00000368698:A1016S	.	A	+	1	0	HIVEP1	12231060	0.980000	0.34600	0.060000	0.19600	0.006000	0.05464	3.693000	0.54735	2.775000	0.95449	0.655000	0.94253	GCT	HIVEP1	-	NULL	ENSG00000095951		0.498	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	28	0.00	0	G	NM_002114		12123074	12123074	+1	no_errors	ENST00000379388	ensembl	human	known	69_37n	missense	21	44.74	17	SNP	0.224	T
HMCN1	83872	genome.wustl.edu	37	1	186086699	186086699	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr1:186086699C>A	ENST00000271588.4	+	77	12021	c.11792C>A	c.(11791-11793)aCc>aAc	p.T3931N	HMCN1_ENST00000367492.2_Missense_Mutation_p.T3931N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3931	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATTCACTGGACCAAAAATGGT	0.433																																						dbGAP											0													105.0	101.0	103.0					1																	186086699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11792C>A	1.37:g.186086699C>A	ENSP00000271588:p.Thr3931Asn		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.T3931N	ENST00000271588.4	37	c.11792	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.391156	0.62066	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.78126	-1.15;-1.15	5.65	1.66	0.24008	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.339754	0.37437	N	0.002098	T	0.68613	0.3020	L	0.35487	1.065	0.27408	N	0.954649	P	0.45176	0.852	P	0.49140	0.601	T	0.59257	-0.7488	10	0.28530	T	0.3	.	5.3497	0.16028	0.1286:0.606:0.0:0.2653	.	3931	Q96RW7	HMCN1_HUMAN	N	3931	ENSP00000271588:T3931N;ENSP00000356462:T3931N	ENSP00000271588:T3931N	T	+	2	0	HMCN1	184353322	0.807000	0.29009	0.957000	0.39632	0.995000	0.86356	0.771000	0.26633	0.053000	0.16036	0.655000	0.94253	ACC	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000143341		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	26	0.00	0	C	NM_031935		186086699	186086699	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	0.792	A
KIAA1211	57482	genome.wustl.edu	37	4	57180592	57180592	+	Frame_Shift_Del	DEL	T	T	-	rs386674634		TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr4:57180592delT	ENST00000504228.1	+	6	1029	c.924delT	c.(922-924)cgtfs	p.R308fs	KIAA1211_ENST00000541073.1_Frame_Shift_Del_p.R301fs|KIAA1211_ENST00000264229.6_Frame_Shift_Del_p.R308fs			Q6ZU35	K1211_HUMAN	KIAA1211	308	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GGAGGGAGCGTGAGGAGCGCG	0.736																																						dbGAP											0													5.0	7.0	6.0					4																	57180592		1903	3760	5663	-	-	-	SO:0001589	frameshift_variant	0			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.924delT	4.37:g.57180592delT	ENSP00000423366:p.Arg308fs		Q9NTE2|Q9NTP8|Q9ULK9	Frame_Shift_Del	DEL	NULL	p.E309fs	ENST00000504228.1	37	c.924	CCDS43230.1	4																																																																																			KIAA1211	-	NULL	ENSG00000109265		0.736	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	16	0.00	0	T	NM_020722		57180592	57180592	+1	no_errors	ENST00000504228	ensembl	human	known	69_37n	frame_shift_del	10	21.43	3	DEL	0.000	-
LRFN2	57497	genome.wustl.edu	37	6	40400151	40400151	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr6:40400151delG	ENST00000338305.6	-	2	1244	c.702delC	c.(700-702)cccfs	p.P234fs		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	234						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.P234P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TAAAGGACAAGGGTGGGGCAA	0.597																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											35.0	41.0	39.0					6																	40400151		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.702delC	6.37:g.40400151delG	ENSP00000345985:p.Pro234fs		A5PKU3|Q5SYP9	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L235fs	ENST00000338305.6	37	c.702	CCDS34443.1	6																																																																																			LRFN2	-	NULL	ENSG00000156564		0.597	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1	45	0.00	0	G	XM_166372		40400151	40400151	-1	no_errors	ENST00000338305	ensembl	human	known	69_37n	frame_shift_del	29	37.50	18	DEL	0.042	-
LPA	4018	genome.wustl.edu	37	6	161012001	161012001	+	Silent	SNP	C	C	T	rs530552170	byFrequency	TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr6:161012001C>T	ENST00000316300.5	-	23	3806	c.3762G>A	c.(3760-3762)gcG>gcA	p.A1254A	LPA_ENST00000447678.1_Silent_p.A1254A			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3762	Kringle 11. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CCGTGGACGTCGCAAGGACAC	0.463													C|||	3	0.000599042	0.0023	0.0	5008	,	,		21307	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													104.0	105.0	105.0					6																	161012001		2174	4294	6468	-	-	-	SO:0001819	synonymous_variant	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3762G>A	6.37:g.161012001C>T			Q5VTD7|Q9UD88	Silent	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.A1254	ENST00000316300.5	37	c.3762	CCDS43523.1	6																																																																																			LPA	-	superfamily_Kringle-like	ENSG00000198670		0.463	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	74	0.00	0	C	NM_005577		161012001	161012001	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	silent	13	70.83	34	SNP	0.000	T
MRGPRX4	117196	genome.wustl.edu	37	11	18195222	18195222	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr11:18195222C>T	ENST00000314254.3	+	1	839	c.419C>T	c.(418-420)gCg>gTg	p.A140V	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CACCTGTCAGCGGTCGTGTGT	0.582																																						dbGAP											0													175.0	169.0	171.0					11																	18195222		2199	4293	6492	-	-	-	SO:0001583	missense	0			AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.419C>T	11.37:g.18195222C>T	ENSP00000314042:p.Ala140Val		Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.A140V	ENST00000314254.3	37	c.419	CCDS7831.1	11	.	.	.	.	.	.	.	.	.	.	C	11.02	1.516118	0.27123	.	.	ENSG00000179817	ENST00000314254	T	0.36157	1.27	2.85	-0.539	0.11865	GPCR, rhodopsin-like superfamily (1);	0.087931	0.49305	N	0.000145	T	0.30665	0.0772	M	0.62016	1.91	0.09310	N	1	P	0.42203	0.773	B	0.41723	0.365	T	0.17776	-1.0358	10	0.56958	D	0.05	.	4.7935	0.13261	0.0:0.5917:0.1763:0.232	.	140	Q96LA9	MRGX4_HUMAN	V	140	ENSP00000314042:A140V	ENSP00000314042:A140V	A	+	2	0	MRGPRX4	18151798	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-3.523000	0.00442	-0.227000	0.09884	-0.573000	0.04149	GCG	MRGPRX4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000179817		0.582	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX4	HGNC	protein_coding	OTTHUMT00000389788.1	95	0.00	0	C	NM_054032		18195222	18195222	+1	no_errors	ENST00000314254	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	0.000	T
KMT2A	4297	genome.wustl.edu	37	11	118359386	118359386	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr11:118359386G>T	ENST00000389506.5	+	11	4390	c.4390G>T	c.(4390-4392)Gag>Tag	p.E1464*	KMT2A_ENST00000354520.4_Nonsense_Mutation_p.E1426*|KMT2A_ENST00000534358.1_Nonsense_Mutation_p.E1464*			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1464					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGAGGAGAACGAGCGCCCTCT	0.423																																						dbGAP											0													134.0	121.0	126.0					11																	118359386		2200	4296	6496	-	-	-	SO:0001587	stop_gained	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.4390G>T	11.37:g.118359386G>T	ENSP00000374157:p.Glu1464*		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Nonsense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.E1464*	ENST00000389506.5	37	c.4390	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	G	44	10.842943	0.99477	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313;ENST00000392873	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.8024	0.96513	0.0:0.0:1.0:0.0	.	.	.	.	X	1464;1464;1426;374;176	.	ENSP00000346516:E1426X	E	+	1	0	MLL	117864596	1.000000	0.71417	0.982000	0.44146	0.992000	0.81027	9.416000	0.97383	2.752000	0.94435	0.655000	0.94253	GAG	MLL	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pirsf_MeTrfase_trithorax,pfscan_Znf_PHD-finger	ENSG00000118058		0.423	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	HGNC	protein_coding	OTTHUMT00000399085.2	111	0.00	0	G	NM_005933		118359386	118359386	+1	no_errors	ENST00000389506	ensembl	human	known	69_37n	nonsense	14	82.72	67	SNP	1.000	T
MTOR	2475	genome.wustl.edu	37	1	11174931	11174931	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr1:11174931C>T	ENST00000361445.4	-	52	7179	c.7103G>A	c.(7102-7104)cGa>cAa	p.R2368Q	MTOR_ENST00000376838.1_Missense_Mutation_p.R573Q	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2368	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	AAACTTCTCTCGGGTCATAGC	0.433																																						dbGAP											0													128.0	115.0	120.0					1																	11174931		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7103G>A	1.37:g.11174931C>T	ENSP00000354558:p.Arg2368Gln		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R2368Q	ENST00000361445.4	37	c.7103	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914952	0.92178	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	T;T;T	0.76578	-1.03;-1.03;-1.03	5.71	4.78	0.61160	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.044086	0.85682	D	0.000000	D	0.91955	0.7452	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.94600	0.7795	10	0.87932	D	0	-1.1879	15.6928	0.77469	0.0:0.8627:0.1373:0.0	.	2368	P42345	MTOR_HUMAN	Q	2368;573;24	ENSP00000354558:R2368Q;ENSP00000366034:R573Q;ENSP00000398745:R24Q	ENSP00000354558:R2368Q	R	-	2	0	MTOR	11097518	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.365000	0.79537	1.383000	0.46405	0.563000	0.77884	CGA	MTOR	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000198793		0.433	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	45	0.00	0	C	NM_004958		11174931	11174931	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	T
MYOM2	9172	genome.wustl.edu	37	8	2024279	2024279	+	Silent	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr8:2024279C>T	ENST00000262113.4	+	11	1320	c.1179C>T	c.(1177-1179)gaC>gaT	p.D393D	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	393	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGTGCCACGACGCCAACCGGG	0.602																																						dbGAP											0													47.0	42.0	43.0					8																	2024279		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1179C>T	8.37:g.2024279C>T			Q7Z3Y2	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D393	ENST00000262113.4	37	c.1179	CCDS5957.1	8																																																																																			MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000036448		0.602	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	50	0.00	0	C	NM_003970		2024279	2024279	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	silent	15	31.82	7	SNP	0.970	T
NHS	4810	genome.wustl.edu	37	X	17746847	17746847	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chrX:17746847C>T	ENST00000380060.3	+	7	4576	c.4238C>T	c.(4237-4239)tCt>tTt	p.S1413F	NHS_ENST00000398097.3_Missense_Mutation_p.S1257F	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1434					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					GTGTTCGTGTCTCCAAACAAA	0.418																																						dbGAP											0													93.0	83.0	87.0					X																	17746847		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.4238C>T	X.37:g.17746847C>T	ENSP00000369400:p.Ser1413Phe		B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	NULL	p.S1413F	ENST00000380060.3	37	c.4238	CCDS14181.1	X	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484172	0.84854	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.50813	0.73;0.73	6.06	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.998	D;D;D;D	0.83275	0.961;0.943;0.943;0.996	T	0.71741	-0.4501	10	0.87932	D	0	-8.7044	16.3214	0.82952	0.0:0.8713:0.1287:0.0	.	1434;1255;1257;1413	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	F	1413;1257;1255	ENSP00000369400:S1413F;ENSP00000381170:S1257F	ENSP00000369397:S1255F	S	+	2	0	NHS	17656768	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	7.392000	0.79840	1.285000	0.44548	0.600000	0.82982	TCT	NHS	-	NULL	ENSG00000188158		0.418	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHS	HGNC	protein_coding	OTTHUMT00000059120.1	46	0.00	0	C	NM_198270		17746847	17746847	+1	no_errors	ENST00000380060	ensembl	human	known	69_37n	missense	11	50.00	11	SNP	1.000	T
NLRC4	58484	genome.wustl.edu	37	2	32475166	32475166	+	Silent	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr2:32475166C>T	ENST00000404025.2	-	5	2255	c.1767G>A	c.(1765-1767)ggG>ggA	p.G589G	NLRC4_ENST00000402280.1_Silent_p.G589G|NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000360906.5_Silent_p.G589G			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	589					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CGGGGATGTTCCCTGAGTTGA	0.403																																						dbGAP											0													97.0	98.0	98.0					2																	32475166		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1767G>A	2.37:g.32475166C>T			A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Silent	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_NACHT_NTPase,pfscan_CARD	p.G589	ENST00000404025.2	37	c.1767	CCDS33174.1	2																																																																																			NLRC4	-	NULL	ENSG00000091106		0.403	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	48	0.00	0	C	NM_021209		32475166	32475166	-1	no_errors	ENST00000360906	ensembl	human	known	69_37n	silent	31	20.51	8	SNP	0.983	T
NSD1	64324	genome.wustl.edu	37	5	176638368	176638368	+	Nonsense_Mutation	SNP	G	G	T	rs138673583		TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr5:176638368G>T	ENST00000439151.2	+	5	3013	c.2968G>T	c.(2968-2970)Gag>Tag	p.E990*	NSD1_ENST00000361032.4_Nonsense_Mutation_p.E887*|NSD1_ENST00000354179.4_Nonsense_Mutation_p.E721*|NSD1_ENST00000347982.4_Nonsense_Mutation_p.E721*	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	990					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ATTATCTGGCGAGTTGTCTGC	0.527			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												dbGAP		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													95.0	92.0	93.0					5																	176638368		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.2968G>T	5.37:g.176638368G>T	ENSP00000395929:p.Glu990*		Q96PD8|Q96RN7	Nonsense_Mutation	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.E990*	ENST00000439151.2	37	c.2968	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274995	0.80580	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	4.51	3.63	0.41609	.	0.215951	0.32488	N	0.006032	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9945	0.24774	0.2038:0.0:0.7962:0.0	.	.	.	.	X	721;990;721;887	.	.	E	+	1	0	NSD1	176570974	1.000000	0.71417	0.660000	0.29694	0.019000	0.09904	4.405000	0.59741	1.245000	0.43885	0.563000	0.77884	GAG	NSD1	-	NULL	ENSG00000165671		0.527	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	15	0.00	0	G	NM_172349		176638368	176638368	+1	no_errors	ENST00000439151	ensembl	human	known	69_37n	nonsense	6	53.85	7	SNP	0.104	T
OR10K2	391107	genome.wustl.edu	37	1	158390002	158390002	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr1:158390002C>A	ENST00000314902.2	-	1	654	c.655G>T	c.(655-657)Gtt>Ttt	p.V219F		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					AGGATGTGAACATAGGACACC	0.443																																						dbGAP											0													152.0	141.0	145.0					1																	158390002		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.655G>T	1.37:g.158390002C>A	ENSP00000324251:p.Val219Phe			Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V219F	ENST00000314902.2	37	c.655	CCDS30896.1	1	.	.	.	.	.	.	.	.	.	.	c	6.407	0.443281	0.12164	.	.	ENSG00000180708	ENST00000314902	T	0.00265	8.39	4.24	-0.998	0.10212	GPCR, rhodopsin-like superfamily (1);	0.450087	0.18600	N	0.136481	T	0.00073	0.0002	L	0.48174	1.505	0.09310	N	1	P	0.44690	0.841	B	0.43575	0.424	T	0.10109	-1.0644	10	0.34782	T	0.22	.	9.7087	0.40231	0.0:0.5001:0.0:0.4999	.	219	Q6IF99	O10K2_HUMAN	F	219	ENSP00000324251:V219F	ENSP00000324251:V219F	V	-	1	0	OR10K2	156656626	0.000000	0.05858	0.012000	0.15200	0.048000	0.14542	-1.816000	0.01720	-0.282000	0.09128	0.461000	0.40582	GTT	OR10K2	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000180708		0.443	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K2	HGNC	protein_coding	OTTHUMT00000051854.1	61	0.00	0	C	NM_001004476		158390002	158390002	-1	no_errors	ENST00000314902	ensembl	human	known	69_37n	missense	60	16.67	12	SNP	0.165	A
PBK	55872	genome.wustl.edu	37	8	27685656	27685656	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr8:27685656A>G	ENST00000301905.4	-	3	581	c.118T>C	c.(118-120)Ttt>Ctt	p.F40L	PBK_ENST00000522944.1_Missense_Mutation_p.F40L	NM_018492.2	NP_060962.2	Q96KB5	TOPK_HUMAN	PDZ binding kinase	40	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|large_intestine(2)|lung(1)	4		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|KIRC - Kidney renal clear cell carcinoma(542;0.101)|Kidney(114;0.121)|Colorectal(74;0.141)		CCAGTACCAAAGCCAAGCTTC	0.308																																						dbGAP											0													63.0	69.0	67.0					8																	27685656		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB027249	CCDS6063.1, CCDS64858.1	8p21.2	2009-08-06			ENSG00000168078	ENSG00000168078			18282	protein-coding gene	gene with protein product	"""T-LAK cell-originated protein kinase"", ""cancer/testis antigen 84"""	611210				10781613, 10779557	Standard	NM_018492		Approved	TOPK, FLJ14385, Nori-3, SPK, CT84	uc003xgi.3	Q96KB5	OTTHUMG00000102113	ENST00000301905.4:c.118T>C	8.37:g.27685656A>G	ENSP00000301905:p.Phe40Leu		B4DX68|D3DST2|Q9NPD9|Q9NYL7|Q9NZK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F40L	ENST00000301905.4	37	c.118	CCDS6063.1	8	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799618	0.70567	.	.	ENSG00000168078	ENST00000301905;ENST00000522944	T;T	0.64803	-0.12;-0.12	5.82	5.82	0.92795	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.192621	0.64402	D	0.000020	T	0.51550	0.1681	L	0.41632	1.29	0.45403	D	0.998389	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.47302	-0.9128	10	0.11794	T	0.64	-9.1156	14.1353	0.65284	1.0:0.0:0.0:0.0	.	40;40	B4DX68;Q96KB5	.;TOPK_HUMAN	L	40	ENSP00000301905:F40L;ENSP00000428489:F40L	ENSP00000301905:F40L	F	-	1	0	PBK	27741575	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.714000	0.74692	2.228000	0.72767	0.533000	0.62120	TTT	PBK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000168078		0.308	PBK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBK	HGNC	protein_coding	OTTHUMT00000219952.2	43	0.00	0	A	NM_018492		27685656	27685656	-1	no_errors	ENST00000301905	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	1.000	G
POU4F3	5459	genome.wustl.edu	37	5	145719176	145719176	+	Silent	SNP	G	G	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr5:145719176G>A	ENST00000230732.4	+	2	275	c.186G>A	c.(184-186)gcG>gcA	p.A62A	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	62					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A62A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCTGGCGGCGGTGGATATCG	0.602																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											87.0	87.0	87.0					5																	145719176		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.186G>A	5.37:g.145719176G>A			O60557|Q2M3F8	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,prints_POU,pfscan_Homeodomain,pfscan_POU_specific	p.A62	ENST00000230732.4	37	c.186	CCDS4281.1	5																																																																																			POU4F3	-	NULL	ENSG00000091010		0.602	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F3	HGNC	protein_coding	OTTHUMT00000251887.2	71	0.00	0	G	NM_002700		145719176	145719176	+1	no_errors	ENST00000230732	ensembl	human	known	69_37n	silent	40	11.11	5	SNP	0.998	A
RNF114	55905	genome.wustl.edu	37	20	48552965	48552965	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr20:48552965C>G	ENST00000244061.2	+	1	18	c.16C>G	c.(16-18)Cgg>Ggg	p.R6G		NM_018683.3	NP_061153.1	Q9Y508	RN114_HUMAN	ring finger protein 114	6					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5						GGCGCAACAGCGGGACTGCGG	0.741																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF265215	CCDS33482.1	20q13	2013-01-09	2008-06-16	2008-06-16	ENSG00000124226	ENSG00000124226		"""RING-type (C3HC4) zinc fingers"""	13094	protein-coding gene	gene with protein product		612451	"""zinc finger protein 313"""	ZNF313		18364390	Standard	NM_018683		Approved	PSORS12	uc002xux.3	Q9Y508	OTTHUMG00000032709	ENST00000244061.2:c.16C>G	20.37:g.48552965C>G	ENSP00000244061:p.Arg6Gly		B2RDQ9|B4DWY5|E1P627|Q6N0B0	Missense_Mutation	SNP	pfam_Di19_RING_finger_144,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R6G	ENST00000244061.2	37	c.16	CCDS33482.1	20	.	.	.	.	.	.	.	.	.	.	C	12.49	1.953327	0.34471	.	.	ENSG00000124226	ENST00000449816;ENST00000244061	T	0.80824	-1.42	4.5	-0.187	0.13268	.	1.342220	0.04780	N	0.429717	T	0.62356	0.2421	N	0.03608	-0.345	0.09310	N	1	B;B	0.17038	0.02;0.003	B;B	0.17098	0.017;0.005	T	0.53215	-0.8470	10	0.52906	T	0.07	0.0029	8.9892	0.36012	0.2598:0.3376:0.4026:0.0	.	6;6	Q9Y508-2;Q9Y508	.;RN114_HUMAN	G	6	ENSP00000244061:R6G	ENSP00000244061:R6G	R	+	1	2	RNF114	47986372	0.017000	0.18338	0.000000	0.03702	0.059000	0.15707	0.359000	0.20233	-0.069000	0.12931	-0.314000	0.08810	CGG	RNF114	-	NULL	ENSG00000124226		0.741	RNF114-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	RNF114	HGNC	protein_coding	OTTHUMT00000079663.1	8	0.00	0	C	NM_018683		48552965	48552965	+1	no_errors	ENST00000244061	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	0.000	G
SLC1A2	6506	genome.wustl.edu	37	11	35282449	35282449	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr11:35282449C>T	ENST00000278379.3	-	11	1999	c.1717G>A	c.(1717-1719)Gag>Aag	p.E573K	SLC1A2_ENST00000479543.1_5'UTR|SLC1A2_ENST00000395750.1_Missense_Mutation_p.E564K|SLC1A2_ENST00000395753.1_Missense_Mutation_p.E564K	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	573					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			CCTTATTTCTCACGTTTCCAA	0.388																																					NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)	dbGAP											0													129.0	116.0	120.0					11																	35282449		2202	4298	6500	-	-	-	SO:0001583	missense	0			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.1717G>A	11.37:g.35282449C>T	ENSP00000278379:p.Glu573Lys		B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.E573K	ENST00000278379.3	37	c.1717	CCDS31459.1	11	.	.	.	.	.	.	.	.	.	.	C	19.94	3.920460	0.73098	.	.	ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753	T;T;T	0.57595	0.39;0.41;0.41	5.98	5.98	0.97165	.	0.188668	0.64402	D	0.000020	T	0.49864	0.1582	L	0.40543	1.245	0.80722	D	1	B	0.20780	0.048	B	0.18263	0.021	T	0.40942	-0.9536	10	0.62326	D	0.03	-6.352	20.4553	0.99141	0.0:1.0:0.0:0.0	.	573	P43004	EAA2_HUMAN	K	573;564;564	ENSP00000278379:E573K;ENSP00000379099:E564K;ENSP00000379102:E564K	ENSP00000278379:E573K	E	-	1	0	SLC1A2	35239025	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	7.241000	0.78201	2.839000	0.97877	0.650000	0.86243	GAG	SLC1A2	-	NULL	ENSG00000110436		0.388	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	SLC1A2	HGNC	protein_coding	OTTHUMT00000258181.1	102	0.00	0	C	NM_004171		35282449	35282449	-1	no_errors	ENST00000278379	ensembl	human	known	69_37n	missense	64	15.79	12	SNP	1.000	T
SP6	80320	genome.wustl.edu	37	17	45925439	45925439	+	Silent	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr17:45925439C>T	ENST00000536300.1	-	2	688	c.357G>A	c.(355-357)tcG>tcA	p.S119S	SP6_ENST00000342234.2_Silent_p.S119S	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	119					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						GGTCCCACCACGAGCCATCCT	0.672																																						dbGAP											0													28.0	26.0	27.0					17																	45925439		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.357G>A	17.37:g.45925439C>T			B3KXS4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S119	ENST00000536300.1	37	c.357	CCDS11520.1	17																																																																																			SP6	-	NULL	ENSG00000189120		0.672	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SP6	HGNC	protein_coding	OTTHUMT00000441395.1	46	0.00	0	C	NM_199262		45925439	45925439	-1	no_errors	ENST00000342234	ensembl	human	known	69_37n	silent	53	10.17	6	SNP	0.704	T
SPTAN1	6709	genome.wustl.edu	37	9	131347092	131347092	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr9:131347092A>G	ENST00000372731.4	+	18	2640	c.2530A>G	c.(2530-2532)Aca>Gca	p.T844A	SPTAN1_ENST00000372739.3_Missense_Mutation_p.T844A|SPTAN1_ENST00000358161.5_Missense_Mutation_p.T844A	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	844					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CAAAGCAGTTACACAGAAGGG	0.493																																					NSCLC(120;833 1744 2558 35612 37579)	dbGAP											0													151.0	112.0	125.0					9																	131347092		2203	4300	6503	-	-	-	SO:0001583	missense	0			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2530A>G	9.37:g.131347092A>G	ENSP00000361816:p.Thr844Ala		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF-hand,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_Ca-bd,prints_Spectrin_alpha_SH3,prints_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain	p.T844A	ENST00000372731.4	37	c.2530	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	A	15.53	2.862119	0.51482	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.51325	0.71;0.71;0.71	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.55593	0.1930	L	0.35593	1.075	0.58432	D	0.999994	P;D;B;P;B	0.63046	0.818;0.992;0.021;0.499;0.423	B;D;B;B;B	0.76071	0.339;0.987;0.007;0.277;0.417	T	0.49818	-0.8899	10	0.21014	T	0.42	.	14.3241	0.66507	1.0:0.0:0.0:0.0	.	844;844;844;844;844	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	A	844	ENSP00000350882:T844A;ENSP00000361816:T844A;ENSP00000361824:T844A	ENSP00000350882:T844A	T	+	1	0	SPTAN1	130386913	1.000000	0.71417	0.531000	0.27976	0.993000	0.82548	8.890000	0.92477	1.982000	0.57802	0.459000	0.35465	ACA	SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000197694		0.493	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	99	0.00	0	A	NM_003127		131347092	131347092	+1	no_errors	ENST00000358161	ensembl	human	known	69_37n	missense	64	25.58	22	SNP	0.997	G
TENC1	23371	genome.wustl.edu	37	12	53448060	53448060	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr12:53448060C>A	ENST00000314250.6	+	7	647	c.357C>A	c.(355-357)ttC>ttA	p.F119L	TENC1_ENST00000379902.3_5'UTR|RP11-983P16.4_ENST00000546793.1_RNA|TENC1_ENST00000546602.1_Missense_Mutation_p.F119L|TENC1_ENST00000552570.1_Missense_Mutation_p.F119L|TENC1_ENST00000549700.1_Missense_Mutation_p.F119L|RP11-983P16.4_ENST00000551890.1_RNA|TENC1_ENST00000451358.1_Missense_Mutation_p.F119L|TENC1_ENST00000314276.3_Missense_Mutation_p.F129L|RP11-983P16.4_ENST00000550601.1_RNA	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	119					cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						CCAGGAGCTTCAGCCTGGACC	0.677																																						dbGAP											0													35.0	36.0	36.0					12																	53448060		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.357C>A	12.37:g.53448060C>A	ENSP00000319684:p.Phe119Leu		A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.F129L	ENST00000314250.6	37	c.387	CCDS8843.1	12	.	.	.	.	.	.	.	.	.	.	C	24.9	4.580116	0.86645	.	.	ENSG00000111077	ENST00000314276;ENST00000314250;ENST00000451358;ENST00000443113;ENST00000546602;ENST00000552570;ENST00000549700	D;D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.35;-3.35;-3.36	4.78	3.88	0.44766	.	0.225552	0.38548	N	0.001652	D	0.90988	0.7166	N	0.16368	0.405	0.48632	D	0.999685	D;B;D;D	0.64830	0.99;0.008;0.994;0.969	P;B;D;D	0.63488	0.824;0.018;0.915;0.914	D	0.86827	0.2008	10	0.13470	T	0.59	-4.4585	10.8791	0.46927	0.0:0.9063:0.0:0.0936	.	119;119;129;96	Q63HR2;F8W661;Q63HR2-4;Q6ZMJ1	TENC1_HUMAN;.;.;.	L	129;119;119;119;119;119;119	ENSP00000319756:F129L;ENSP00000319684:F119L;ENSP00000393362:F119L;ENSP00000449363:F119L;ENSP00000447021:F119L;ENSP00000449361:F119L	ENSP00000319684:F119L	F	+	3	2	TENC1	51734327	0.998000	0.40836	1.000000	0.80357	0.980000	0.70556	0.612000	0.24283	1.149000	0.42402	0.561000	0.74099	TTC	TENC1	-	NULL	ENSG00000111077		0.677	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TENC1	HGNC	protein_coding	OTTHUMT00000405779.1	47	0.00	0	C	NM_170754		53448060	53448060	+1	no_errors	ENST00000314276	ensembl	human	known	69_37n	missense	20	53.49	23	SNP	1.000	A
THEM5	284486	genome.wustl.edu	37	1	151819760	151819760	+	3'UTR	SNP	G	G	C			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr1:151819760G>C	ENST00000368817.5	-	0	962				AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5						cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			gcaggcaggggaggcaggagg	0.697																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.*87C>G	1.37:g.151819760G>C			Q5T1C3	Missense_Mutation	SNP	pfam_Thioestr_supf	p.P207A	ENST00000368817.5	37	c.619	CCDS1005.1	1	.	.	.	.	.	.	.	.	.	.	-	4.616	0.114514	0.08831	.	.	ENSG00000196407	ENST00000453881	.	.	.	.	.	.	.	.	.	.	.	T	0.09818	0.0241	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.34825	-0.9813	3	.	.	.	-10.6178	5.3027	0.15788	1.0E-4:0.0:0.9999:0.0	.	.	.	.	A	207	.	.	P	-	1	0	THEM5	150086384	0.147000	0.22687	0.000000	0.03702	0.000000	0.00434	-0.317000	0.08060	-0.000000	0.14550	0.000000	0.15137	CCC	THEM5	-	NULL	ENSG00000196407		0.697	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	HGNC	protein_coding	OTTHUMT00000036678.2	29	0.00	0	G	NM_182578		151819760	151819760	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453881	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	0.057	C
TLN1	7094	genome.wustl.edu	37	9	35708476	35708476	+	Silent	SNP	T	T	G			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr9:35708476T>G	ENST00000314888.9	-	34	4685	c.4332A>C	c.(4330-4332)gcA>gcC	p.A1444A	TLN1_ENST00000540444.1_Silent_p.A1444A|TLN1_ENST00000464379.1_5'Flank	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1444	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAACCAGATATGCAGCCTGGG	0.507																																						dbGAP											0													56.0	56.0	56.0					9																	35708476		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4332A>C	9.37:g.35708476T>G			A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Silent	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.A1444	ENST00000314888.9	37	c.4332	CCDS35009.1	9																																																																																			TLN1	-	NULL	ENSG00000137076		0.507	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	30	0.00	0	T	NM_006289		35708476	35708476	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	silent	25	37.50	15	SNP	0.912	G
TNK1	8711	genome.wustl.edu	37	17	7288067	7288067	+	Silent	SNP	G	G	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr17:7288067G>T	ENST00000576812.1	+	7	1500	c.1131G>T	c.(1129-1131)ctG>ctT	p.L377L	TNK1_ENST00000570896.1_Silent_p.L377L|TNK1_ENST00000311668.2_Silent_p.L377L	NM_001251902.1	NP_001238831.1			tyrosine kinase, non-receptor, 1											central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(2)|pancreas(1)	16		Prostate(122;0.157)				AGGGGCTGCTGCAAGAGGTGG	0.637																																						dbGAP											0													7.0	9.0	8.0					17																	7288067		1908	4112	6020	-	-	-	SO:0001819	synonymous_variant	0			U43408	CCDS45602.1, CCDS58510.1	17p13.1	2005-09-22				ENSG00000174292			11940	protein-coding gene	gene with protein product		608076				8632913	Standard	NM_003985		Approved		uc002ggi.4	Q13470		ENST00000576812.1:c.1131G>T	17.37:g.7288067G>T				Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L377	ENST00000576812.1	37	c.1131	CCDS58510.1	17																																																																																			TNK1	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000174292		0.637	TNK1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TNK1	HGNC	protein_coding	OTTHUMT00000440832.2	79	0.00	0	G	NM_003985		7288067	7288067	+1	no_errors	ENST00000576812	ensembl	human	known	69_37n	silent	31	11.43	4	SNP	0.341	T
TP53I13	90313	genome.wustl.edu	37	17	27899465	27899465	+	Silent	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr17:27899465C>T	ENST00000301057.7	+	6	934	c.819C>T	c.(817-819)aaC>aaT	p.N273N	RP11-68I3.2_ENST00000581474.1_RNA|RP11-68I3.4_ENST00000579050.1_RNA	NM_138349.2	NP_612358.3	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	273						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(3;0.236)		AGGTGCCCAACGGGCAAGGCA	0.701																																						dbGAP											0													23.0	26.0	25.0					17																	27899465		1933	4061	5994	-	-	-	SO:0001819	synonymous_variant	0			AK075341	CCDS42289.1	17q11.2	2006-01-16				ENSG00000167543			25102	protein-coding gene	gene with protein product						14767535	Standard	NM_138349		Approved	DSCP1	uc002hee.3	Q8NBR0		ENST00000301057.7:c.819C>T	17.37:g.27899465C>T			Q7L5U3	Silent	SNP	NULL	p.N273	ENST00000301057.7	37	c.819	CCDS42289.1	17																																																																																			TP53I13	-	NULL	ENSG00000167543		0.701	TP53I13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53I13	HGNC	protein_coding	OTTHUMT00000447804.2	30	0.00	0	C	NM_138349		27899465	27899465	+1	no_errors	ENST00000301057	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	0.389	T
TUT1	64852	genome.wustl.edu	37	11	62343518	62343518	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr11:62343518C>T	ENST00000476907.1	-	9	2364	c.1673G>A	c.(1672-1674)cGg>cAg	p.R558Q	EEF1G_ENST00000532986.1_5'Flank|EEF1G_ENST00000329251.4_5'Flank|TUT1_ENST00000308436.7_Missense_Mutation_p.R596Q|MIR3654_ENST00000496634.2_Intron|EEF1G_ENST00000378019.3_5'Flank			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	558					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CCCAGCCACCCGGCTGGTCAC	0.637																																						dbGAP											0													22.0	26.0	25.0					11																	62343518		2196	4290	6486	-	-	-	SO:0001583	missense	0			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.1673G>A	11.37:g.62343518C>T	ENSP00000419607:p.Arg558Gln		A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R596Q	ENST00000476907.1	37	c.1787		11	.	.	.	.	.	.	.	.	.	.	C	34	5.313681	0.95655	.	.	ENSG00000149016	ENST00000308436;ENST00000476907	T;T	0.55052	0.54;0.54	5.52	5.52	0.82312	.	0.063316	0.64402	D	0.000003	T	0.56746	0.2006	L	0.34521	1.04	0.48511	D	0.999662	D;D	0.69078	0.985;0.997	B;P	0.54590	0.35;0.756	T	0.58183	-0.7681	10	0.54805	T	0.06	-4.8084	16.9363	0.86203	0.0:1.0:0.0:0.0	.	558;596	Q9H6E5;F5H0R1	STPAP_HUMAN;.	Q	596;558	ENSP00000308000:R596Q;ENSP00000419607:R558Q	ENSP00000308000:R596Q	R	-	2	0	TUT1	62100094	0.933000	0.31639	1.000000	0.80357	0.995000	0.86356	1.817000	0.39002	2.594000	0.87642	0.655000	0.94253	CGG	TUT1	-	NULL	ENSG00000149016		0.637	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	HGNC	protein_coding	OTTHUMT00000351319.2	37	0.00	0	C	NM_022830		62343518	62343518	-1	no_errors	ENST00000308436	ensembl	human	known	69_37n	missense	15	54.55	18	SNP	1.000	T
UGT3A2	167127	genome.wustl.edu	37	5	36049459	36049460	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr5:36049459_36049460insA	ENST00000282507.3	-	4	475_476	c.374_375insT	c.(373-375)ttafs	p.L125fs	UGT3A2_ENST00000513300.1_Frame_Shift_Ins_p.L91fs|UGT3A2_ENST00000545528.1_Intron|UGT3A2_ENST00000504954.1_Intron	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	125					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCTTTCTATTTAAAAAATGACT	0.322																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.375dupT	5.37:g.36049465_36049465dupA	ENSP00000282507:p.Leu125fs		B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Frame_Shift_Ins	INS	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L125fs	ENST00000282507.3	37	c.375_374	CCDS3914.1	5																																																																																			UGT3A2	-	pfam_UDP_glucos_trans	ENSG00000168671		0.322	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A2	HGNC	protein_coding	OTTHUMT00000253771.2	47	0.00	0	-	NM_174914		36049459	36049460	-1	no_errors	ENST00000282507	ensembl	human	known	69_37n	frame_shift_ins	21	36.36	12	INS	0.005:0.013	A
UHRF1	29128	genome.wustl.edu	37	19	4962030	4962031	+	RNA	DEL	GG	GG	-	rs373827728		TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	GG	GG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr19:4962030_4962031delGG	ENST00000592666.1	+	0	4173_4174							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TATTTTTAAAGGGTTTTTTTCA	0.312																																						dbGAP											0																																										-	-	-			0			AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4962030_4962031delGG			A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	DEL	-	NULL	ENST00000592666.1	37	NULL		19																																																																																			UHRF1	-	-	ENSG00000034063		0.312	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	HGNC	processed_transcript	OTTHUMT00000450444.1	9	0.00	0	GG	NM_001048201		4962030	4962031	+1	no_errors	ENST00000262952	ensembl	human	known	69_37n	rna	2	66.67	4	DEL	0.000:0.000	-
UQCRC2	7385	genome.wustl.edu	37	16	21979966	21979966	+	Silent	SNP	G	G	A	rs575935732		TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr16:21979966G>A	ENST00000268379.4	+	8	1394	c.630G>A	c.(628-630)caG>caA	p.Q210Q	UQCRC2_ENST00000561553.1_Silent_p.Q210Q	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	210					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		ACTTCGTTCAGAACCATTTCA	0.338																																					Colon(123;450 1645 12841 25393 45623)	dbGAP											0													198.0	182.0	187.0					16																	21979966		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.630G>A	16.37:g.21979966G>A			B3KSN4|Q9BQ05	Silent	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.Q210	ENST00000268379.4	37	c.630	CCDS10601.1	16																																																																																			UQCRC2	-	pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	ENSG00000140740		0.338	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC2	HGNC	protein_coding	OTTHUMT00000254466.1	111	0.00	0	G	NM_003366		21979966	21979966	+1	no_errors	ENST00000268379	ensembl	human	known	69_37n	silent	137	11.61	18	SNP	1.000	A
USP24	23358	genome.wustl.edu	37	1	55591335	55591335	+	Splice_Site	SNP	C	C	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr1:55591335C>A	ENST00000294383.6	-	33	3731		c.e33+1		USP24_ENST00000407756.1_Splice_Site	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24						ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TATTTACATACCTTGCAAGCT	0.368																																						dbGAP											0													85.0	78.0	80.0					1																	55591335		1861	4097	5958	-	-	-	SO:0001630	splice_region_variant	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.3731+1G>T	1.37:g.55591335C>A			Q6ZSY2|Q8N2Y4|Q9NXD1	Splice_Site	SNP	-	e33+1	ENST00000294383.6	37	c.3731+1	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997991	0.74818	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.058	0.93074	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP24	55363923	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	7.445000	0.80570	2.574000	0.86865	0.467000	0.42956	.	USP24	-	-	ENSG00000162402		0.368	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	41	0.00	0	C		Intron	55591335	55591335	-1	no_errors	ENST00000294383	ensembl	human	known	69_37n	splice_site	27	10.00	3	SNP	1.000	A
VWDE	221806	genome.wustl.edu	37	7	12428917	12428917	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr7:12428917G>T	ENST00000275358.3	-	3	499	c.311C>A	c.(310-312)cCt>cAt	p.P104H		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	104						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						GATCTCCCCAGGAGATGGCAG	0.438																																						dbGAP											0													70.0	65.0	67.0					7																	12428917		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.311C>A	7.37:g.12428917G>T	ENSP00000275358:p.Pro104His		B7ZM77|Q96SQ3	Missense_Mutation	SNP	pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.P104H	ENST00000275358.3	37	c.311	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	G	18.33	3.601134	0.66332	.	.	ENSG00000146530	ENST00000275358;ENST00000541006	T	0.64803	-0.12	4.44	3.56	0.40772	.	0.236449	0.44285	D	0.000470	T	0.75162	0.3812	M	0.71296	2.17	0.31835	N	0.624204	D	0.89917	1.0	D	0.67725	0.953	T	0.80289	-0.1445	10	0.72032	D	0.01	.	12.6835	0.56934	0.0808:0.0:0.9192:0.0	.	104	Q8N2E2	VWDE_HUMAN	H	104	ENSP00000275358:P104H	ENSP00000275358:P104H	P	-	2	0	VWDE	12395442	1.000000	0.71417	0.931000	0.37212	0.993000	0.82548	6.053000	0.71089	1.219000	0.43474	0.563000	0.77884	CCT	VWDE	-	NULL	ENSG00000146530		0.438	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	43	0.00	0	G	XM_371878		12428917	12428917	-1	no_errors	ENST00000452576	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	1.000	T
WSCD2	9671	genome.wustl.edu	37	12	108603944	108603944	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr12:108603944G>A	ENST00000332082.4	+	5	1362	c.544G>A	c.(544-546)Ggc>Agc	p.G182S	WSCD2_ENST00000547525.1_Missense_Mutation_p.G182S|WSCD2_ENST00000261400.3_Missense_Mutation_p.G182S|WSCD2_ENST00000549903.1_Missense_Mutation_p.G182S			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	182	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						GTGCTACTGCGGCCACAAGAT	0.667																																						dbGAP											0													33.0	38.0	36.0					12																	108603944		2196	4285	6481	-	-	-	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.544G>A	12.37:g.108603944G>A	ENSP00000331933:p.Gly182Ser		B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.G182S	ENST00000332082.4	37	c.544	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.466174	0.96257	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000551638;ENST00000332082;ENST00000549903	T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15	5.22	5.22	0.72569	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.67878	0.2940	M	0.88570	2.965	0.80722	D	1	B	0.30542	0.284	B	0.33846	0.171	T	0.72100	-0.4392	10	0.56958	D	0.05	-39.4008	17.3431	0.87303	0.0:0.0:1.0:0.0	.	182	Q2TBF2	WSCD2_HUMAN	S	182;182;29;182;182	ENSP00000448047:G182S;ENSP00000261400:G182S;ENSP00000446744:G29S;ENSP00000331933:G182S;ENSP00000447272:G182S	ENSP00000261400:G182S	G	+	1	0	WSCD2	107128074	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	9.024000	0.93689	2.436000	0.82500	0.555000	0.69702	GGC	WSCD2	-	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	ENSG00000075035		0.667	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	41	0.00	0	G	NM_014653		108603944	108603944	+1	no_errors	ENST00000261400	ensembl	human	known	69_37n	missense	20	56.52	26	SNP	1.000	A
ZMYM4	9202	genome.wustl.edu	37	1	35852683	35852683	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr1:35852683C>A	ENST00000314607.6	+	12	1996	c.1916C>A	c.(1915-1917)aCa>aAa	p.T639K	ZMYM4_ENST00000373297.2_Missense_Mutation_p.T550K	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	639					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGCATCCCCACAGGTTCCACA	0.493																																						dbGAP											0													79.0	68.0	72.0					1																	35852683		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1916C>A	1.37:g.35852683C>A	ENSP00000322915:p.Thr639Lys		A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH	p.T639K	ENST00000314607.6	37	c.1916	CCDS389.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.69|13.69	2.313335|2.313335	0.40996|0.40996	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|T;T	.|0.21543	.|2.0;2.02	5.66|5.66	4.74|4.74	0.60224|0.60224	.|.	.|0.369213	.|0.27941	.|N	.|0.017224	T|T	0.12220|0.12220	0.0297|0.0297	N|N	0.14661|0.14661	0.345|0.345	0.33212|0.33212	D|D	0.553533|0.553533	.|B	.|0.06786	.|0.001	.|B	.|0.08055	.|0.003	T|T	0.11108|0.11108	-1.0601|-1.0601	5|10	.|0.06099	.|T	.|0.92	-4.9464|-4.9464	16.3632|16.3632	0.83280|0.83280	0.0:0.8547:0.1453:0.0|0.0:0.8547:0.1453:0.0	.|.	.|639	.|Q5VZL5	.|ZMYM4_HUMAN	Q|K	298|639;550	.|ENSP00000322915:T639K;ENSP00000362394:T550K	.|ENSP00000322915:T639K	H|T	+|+	3|2	2|0	ZMYM4|ZMYM4	35625270|35625270	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.216000|4.216000	0.58540|0.58540	1.355000|1.355000	0.45865|0.45865	0.655000|0.655000	0.94253|0.94253	CAC|ACA	ZMYM4	-	NULL	ENSG00000146463		0.493	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	HGNC	protein_coding	OTTHUMT00000012207.3	63	0.00	0	C	NM_005095		35852683	35852683	+1	no_errors	ENST00000314607	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	A
ZNF300P1	134466	genome.wustl.edu	37	5	150311299	150311299	+	RNA	SNP	C	C	T			TCGA-E9-A54Y-01A-11D-A25Q-09	TCGA-E9-A54Y-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fafdb0f0-8793-4fa5-aad9-7edb0fe378a3	dd45289a-3543-448a-ad91-b35d282448f5	g.chr5:150311299C>T	ENST00000520773.1	-	0	2022									zinc finger protein 300 pseudogene 1 (functional)																		AAGGATTTTCCACATTCAACA	0.353																																						dbGAP											0																																										-	-	-			0			AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150311299C>T				RNA	SNP	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			ZNF300P1	-	-	ENSG00000197083		0.353	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	HGNC	pseudogene	OTTHUMT00000374771.1	55	0.00	0	C	NR_026867		150311299	150311299	-1	no_errors	ENST00000520773	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	1.000	T
