#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACN9	57001	genome.wustl.edu	37	7	96810329	96810329	+	Silent	SNP	T	T	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr7:96810329T>C	ENST00000432641.2	+	2	1314	c.180T>C	c.(178-180)taT>taC	p.Y60Y	ACN9_ENST00000360382.4_3'UTR|ACN9_ENST00000479853.1_3'UTR	NM_020186.2	NP_064571.1			ACN9 homolog (S. cerevisiae)											large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(3)	10	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)					TTTAGGTGTATGCAACAGCGT	0.328																																						dbGAP											0													63.0	62.0	62.0					7																	96810329		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028409	CCDS5648.1	7q22.1	2006-02-09			ENSG00000196636	ENSG00000196636			21752	protein-coding gene	gene with protein product		615773					Standard	NM_020186		Approved	DC11	uc003uoo.4	Q9NRP4	OTTHUMG00000154064	ENST00000432641.2:c.180T>C	7.37:g.96810329T>C				Silent	SNP	pfam_Complex1_LYR	p.Y60	ENST00000432641.2	37	c.180	CCDS5648.1	7																																																																																			ACN9	-	pfam_Complex1_LYR	ENSG00000196636		0.328	ACN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACN9	HGNC	protein_coding	OTTHUMT00000333685.3	97	0.00	0	T	NM_020186		96810329	96810329	+1	no_errors	ENST00000432641	ensembl	human	known	69_37n	silent	57	20.83	15	SNP	0.995	C
ADORA1	134	genome.wustl.edu	37	1	203134377	203134377	+	Intron	SNP	C	C	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:203134377C>A	ENST00000367236.4	+	3	1262				ADORA1_ENST00000472535.1_Intron|ADORA1_ENST00000337894.4_Intron|ADORA1_ENST00000309502.3_Intron|ADORA1_ENST00000367235.1_3'UTR	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor						activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	ACTCTGCCCTCCTCTCCCCCA	0.657																																						dbGAP											0													29.0	34.0	32.0					1																	203134377		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.342-12C>A	1.37:g.203134377C>A			A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	RNA	SNP	-	NULL	ENST00000367236.4	37	NULL	CCDS1434.1	1																																																																																			ADORA1	-	-	ENSG00000163485		0.657	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA1	HGNC	protein_coding	OTTHUMT00000100273.1	79	0.00	0	C	NM_000674		203134377	203134377	+1	no_errors	ENST00000464019	ensembl	human	known	69_37n	rna	51	35.44	28	SNP	0.137	A
AKAP17A	8227	genome.wustl.edu	37	X	1719552	1719552	+	Splice_Site	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chrX:1719552G>A	ENST00000313871.3	+	5	1349	c.1153G>A	c.(1153-1155)Gct>Act	p.A385T		NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	385					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						TTCCCCGCAGGCTGTGAAGCT	0.672																																						dbGAP											0													17.0	15.0	15.0					X																	1719552		2001	3891	5892	-	-	-	SO:0001630	splice_region_variant	0			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1153-1G>A	X.37:g.1719552G>A			Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	NULL	p.A385T	ENST00000313871.3	37	c.1153	CCDS14116.1	X	.	.	.	.	.	.	.	.	.	.	g	8.976	0.974207	0.18736	.	.	ENSG00000197976	ENST00000313871	T	0.17528	2.27	1.02	1.02	0.19986	.	0.764164	0.11051	U	0.605039	T	0.10508	0.0257	.	.	.	0.21861	N	0.9995	P	0.41041	0.736	B	0.35607	0.206	T	0.23368	-1.0190	8	.	.	.	.	7.485	0.27427	0.1621:0.0:0.8379:0.0	.	385	Q02040	AK17A_HUMAN	T	385	ENSP00000324827:A385T	.	A	+	1	0	AKAP17A	1679552	0.999000	0.42202	0.049000	0.19019	0.108000	0.19459	1.941000	0.40233	0.527000	0.28560	0.360000	0.22052	GCT	AKAP17A	-	NULL	ENSG00000197976		0.672	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP17A	HGNC	protein_coding	OTTHUMT00000055609.2	36	0.00	0	G	NM_005088	Missense_Mutation	1719552	1719552	+1	no_errors	ENST00000313871	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	0.325	A
ARID1B	57492	genome.wustl.edu	37	6	157502127	157502127	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr6:157502127G>A	ENST00000350026.5	+	11	3122	c.3121G>A	c.(3121-3123)Ggg>Agg	p.G1041R	ARID1B_ENST00000478761.2_3'UTR|ARID1B_ENST00000275248.4_Missense_Mutation_p.G1036R|ARID1B_ENST00000367148.1_Missense_Mutation_p.G1094R|ARID1B_ENST00000346085.5_Missense_Mutation_p.G1054R	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1041					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CACCACTACTGGGGAGAAGAT	0.547																																						dbGAP											0													64.0	53.0	57.0					6																	157502127		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3121G>A	6.37:g.157502127G>A	ENSP00000055163:p.Gly1041Arg		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.G1094R	ENST00000350026.5	37	c.3280	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045142	0.75846	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000414678;ENST00000319584;ENST00000400790	T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03	5.55	5.55	0.83447	ARID/BRIGHT DNA-binding domain (2);	0.110486	0.64402	D	0.000007	T	0.51550	0.1681	L	0.44542	1.39	0.47659	D	0.999486	D;D;D;D	0.76494	0.999;0.997;0.998;0.998	D;D;D;D	0.72075	0.976;0.916;0.962;0.962	T	0.51020	-0.8758	10	0.56958	D	0.05	.	19.5145	0.95157	0.0:0.0:1.0:0.0	.	291;1041;1054;1036	Q8NFD5-4;Q8NFD5;Q8NFD5-2;G3XAA0	.;ARI1B_HUMAN;.;.	R	1054;1041;1094;1036;511;563;516;108	ENSP00000344546:G1054R;ENSP00000055163:G1041R;ENSP00000356116:G1094R;ENSP00000275248:G1036R;ENSP00000412835:G563R;ENSP00000313006:G516R;ENSP00000383596:G108R	ENSP00000275248:G1036R	G	+	1	0	ARID1B	157543819	1.000000	0.71417	0.988000	0.46212	0.990000	0.78478	6.114000	0.71560	2.608000	0.88229	0.650000	0.86243	GGG	ARID1B	-	superfamily_ARID/BRIGHT_DNA-bd	ENSG00000049618		0.547	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	66	0.00	0	G	NM_020732		157502127	157502127	+1	no_errors	ENST00000367148	ensembl	human	known	69_37n	missense	55	12.70	8	SNP	0.994	A
ARID4B	51742	genome.wustl.edu	37	1	235345091	235345091	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:235345091G>C	ENST00000264183.3	-	20	3640	c.3143C>G	c.(3142-3144)tCa>tGa	p.S1048*	ARID4B_ENST00000349213.3_Nonsense_Mutation_p.S962*|ARID4B_ENST00000366603.2_Nonsense_Mutation_p.S1048*|ARID4B_ENST00000494543.1_5'UTR	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	1048					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CAGTGGTTCTGATACTGTTAC	0.483																																						dbGAP											0													102.0	88.0	93.0					1																	235345091		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.3143C>G	1.37:g.235345091G>C	ENSP00000264183:p.Ser1048*		A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Nonsense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S1048*	ENST00000264183.3	37	c.3143	CCDS31061.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.112299|5.112299	0.94339|0.94339	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183	.|.	.|.	.|.	4.92|4.92	4.92|4.92	0.64577|0.64577	.|.	.|0.253773	.|0.28093	.|N	.|0.016636	T|.	0.63943|.	0.2554|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.72740|.	-0.4202|.	3|.	.|0.48119	.|T	.|0.1	-7.8027|-7.8027	11.75|11.75	0.51843|0.51843	0.0804:0.0:0.9196:0.0|0.0804:0.0:0.9196:0.0	.|.	.|.	.|.	.|.	E|X	448|1048;962;1048;1048	.|.	.|ENSP00000264183:S1048X	Q|S	-|-	1|2	0|0	ARID4B|ARID4B	233411714|233411714	1.000000|1.000000	0.71417|0.71417	0.430000|0.430000	0.26722|0.26722	0.983000|0.983000	0.72400|0.72400	6.637000|6.637000	0.74304|0.74304	2.560000|2.560000	0.86352|0.86352	0.585000|0.585000	0.79938|0.79938	CAG|TCA	ARID4B	-	NULL	ENSG00000054267		0.483	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3	110	0.00	0	G	NM_016374		235345091	235345091	-1	no_errors	ENST00000264183	ensembl	human	known	69_37n	nonsense	67	11.84	9	SNP	0.992	C
GPR75-ASB3	100302652	genome.wustl.edu	37	2	53897501	53897501	+	3'UTR	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr2:53897501G>A	ENST00000263634.3	-	0	1830				GPR75-ASB3_ENST00000406687.1_3'UTR|GPR75-ASB3_ENST00000394717.2_3'UTR|ASB3_ENST00000406625.2_3'UTR|GPR75-ASB3_ENST00000482829.1_5'UTR|GPR75-ASB3_ENST00000352846.3_3'UTR	NM_016115.4	NP_057199.1			GPR75-ASB3 readthrough																		CTGAACTACTGGCCCCCCAAA	0.294																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS54361.1	2p16	2013-01-23			ENSG00000115239	ENSG00000115239			40043	other	readthrough							Standard	NM_001164165		Approved				OTTHUMG00000129279	ENST00000263634.3:c.*139C>T	2.37:g.53897501G>A				RNA	SNP	-	NULL	ENST00000263634.3	37	NULL	CCDS1846.1	2																																																																																			ASB3	-	-	ENSG00000115239		0.294	GPR75-ASB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB3	HGNC	protein_coding	OTTHUMT00000251402.3	44	0.00	0	G			53897501	53897501	-1	no_errors	ENST00000482829	ensembl	human	known	69_37n	rna	36	28.00	14	SNP	0.000	A
BTD	686	genome.wustl.edu	37	3	15686715	15686715	+	Missense_Mutation	SNP	G	G	A	rs397514419		TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr3:15686715G>A	ENST00000303498.5	+	4	1461	c.1352G>A	c.(1351-1353)gGc>gAc	p.G451D	BTD_ENST00000437172.1_Missense_Mutation_p.G453D|BTD_ENST00000383778.4_Missense_Mutation_p.G431D|BTD_ENST00000449107.1_Missense_Mutation_p.G453D	NM_000060.2|NM_001281723.1	NP_000051.1|NP_001268652.1	P43251	BTD_HUMAN	biotinidase	451			G -> D (in BTD deficiency; partial). {ECO:0000269|PubMed:9654207}.		biotin metabolic process (GO:0006768)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	biotin carboxylase activity (GO:0004075)|biotinidase activity (GO:0047708)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	18						ACAGTACATGGCACTTACTAC	0.512																																						dbGAP											0			GRCh37	CM980258	BTD	M							108.0	106.0	107.0					3																	15686715		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF018631	CCDS2628.1, CCDS63563.1, CCDS63564.1, CCDS63565.1	3p25	2007-03-26			ENSG00000169814	ENSG00000169814	3.5.1.12		1122	protein-coding gene	gene with protein product		609019				8001986	Standard	NM_001281723		Approved		uc003cah.3	P43251	OTTHUMG00000129861	ENST00000303498.5:c.1352G>A	3.37:g.15686715G>A	ENSP00000306477:p.Gly451Asp		A6NHF2|B2R865|B4DFX1|B4DLJ9|B7Z7C9|F8W1Q3|Q96EM9	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.G451D	ENST00000303498.5	37	c.1352	CCDS2628.1	3	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945200	0.53079	.	.	ENSG00000169814	ENST00000449107;ENST00000303498;ENST00000437172;ENST00000383778	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.95484	0.8533	M	0.73430	2.235	0.80722	D	1	P;P;P	0.49783	0.928;0.928;0.928	P;P;P	0.49140	0.601;0.601;0.601	D	0.94371	0.7596	10	0.33940	T	0.23	-27.1606	19.5597	0.95367	0.0:0.0:1.0:0.0	.	453;453;451	A6NHF2;B4DLJ9;P43251	.;.;BTD_HUMAN	D	453;451;453;431	ENSP00000388212:G453D;ENSP00000306477:G451D;ENSP00000400995:G453D;ENSP00000373288:G431D	ENSP00000306477:G451D	G	+	2	0	BTD	15661719	1.000000	0.71417	0.995000	0.50966	0.525000	0.34531	9.790000	0.99075	2.641000	0.89580	0.561000	0.74099	GGC	BTD	-	pirsf_Biotinidase_euk	ENSG00000169814		0.512	BTD-001	KNOWN	basic|CCDS	protein_coding	BTD	HGNC	protein_coding	OTTHUMT00000252103.2	63	0.00	0	G	NM_000060		15686715	15686715	+1	no_errors	ENST00000303498	ensembl	human	known	69_37n	missense	24	41.46	17	SNP	1.000	A
CAPN11	11131	genome.wustl.edu	37	6	44144994	44144994	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr6:44144994A>C	ENST00000398776.1	+	12	1291	c.1253A>C	c.(1252-1254)aAc>aCc	p.N418T	CAPN11_ENST00000542245.1_Missense_Mutation_p.N418T	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	418	Domain III.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCTGGACCAACCCCCAGTTT	0.612																																						dbGAP											0													22.0	26.0	25.0					6																	44144994		2153	4258	6411	-	-	-	SO:0001583	missense	0			AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1253A>C	6.37:g.44144994A>C	ENSP00000381758:p.Asn418Thr		B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.N418T	ENST00000398776.1	37	c.1253	CCDS47436.1	6	.	.	.	.	.	.	.	.	.	.	A	25.0	4.594320	0.86953	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	D;D	0.99214	-5.57;-5.57	4.79	4.79	0.61399	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.257433	0.27836	N	0.017649	D	0.99539	0.9835	H	0.94183	3.505	0.49687	D	0.999815	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.993	D	0.98202	1.0468	10	0.87932	D	0	.	13.6418	0.62255	1.0:0.0:0.0:0.0	.	72;418	B4DT90;Q9UMQ6	.;CAN11_HUMAN	T	418	ENSP00000381758:N418T;ENSP00000441078:N418T	ENSP00000381758:N418T	N	+	2	0	CAPN11	44252972	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.078000	0.94023	2.008000	0.58898	0.459000	0.35465	AAC	CAPN11	-	pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Calpain_III,prints_Calpain_cysteine_protease	ENSG00000137225		0.612	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPN11	HGNC	protein_coding	OTTHUMT00000040714.3	45	0.00	0	A			44144994	44144994	+1	no_errors	ENST00000398776	ensembl	human	known	69_37n	missense	28	28.21	11	SNP	1.000	C
CCND2	894	genome.wustl.edu	37	12	4388007	4388007	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr12:4388007C>T	ENST00000261254.3	+	3	762	c.493C>T	c.(493-495)Cgc>Tgc	p.R165C	RP11-264F23.3_ENST00000539135.1_RNA|CCND2_ENST00000541542.1_3'UTR	NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	165					cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			GCACATCTTGCGCAAGCTGCC	0.577			T	IGL@	"""NHL,CLL"""																																	dbGAP		Dom	yes		12	12p13	894	cyclin D2		L	0													80.0	77.0	78.0					12																	4388007		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.493C>T	12.37:g.4388007C>T	ENSP00000261254:p.Arg165Cys		A8K531|Q13955|Q5U035	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.R165C	ENST00000261254.3	37	c.493	CCDS8524.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.67|14.67	2.604212|2.604212	0.46423|0.46423	.|.	.|.	ENSG00000118971|ENSG00000118971	ENST00000536537|ENST00000261254	.|T	.|0.24151	.|1.87	4.79|4.79	4.79|4.79	0.61399|0.61399	.|Cyclin, C-terminal (1);Cyclin-like (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.28928|0.28928	0.0718|0.0718	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	.|B	.|0.25667	.|0.131	.|B	.|0.25405	.|0.06	T|T	0.12941|0.12941	-1.0528|-1.0528	5|10	.|0.72032	.|D	.|0.01	.|.	11.6636|11.6636	0.51361|0.51361	0.3019:0.6981:0.0:0.0|0.3019:0.6981:0.0:0.0	.|.	.|165	.|P30279	.|CCND2_HUMAN	V|C	80|165	.|ENSP00000261254:R165C	.|ENSP00000261254:R165C	A|R	+|+	2|1	0|0	CCND2|CCND2	4258268|4258268	0.990000|0.990000	0.36364|0.36364	0.947000|0.947000	0.38551|0.38551	0.898000|0.898000	0.52572|0.52572	2.944000|2.944000	0.49034|0.49034	2.198000|2.198000	0.70561|0.70561	0.561000|0.561000	0.74099|0.74099	GCG|CGC	CCND2	-	pfam_Cyclin_C,superfamily_Cyclin-like,pirsf_Cyclin_A/B/D/E	ENSG00000118971		0.577	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCND2	HGNC	protein_coding	OTTHUMT00000398287.1	74	0.00	0	C	NM_001759		4388007	4388007	+1	no_errors	ENST00000261254	ensembl	human	known	69_37n	missense	65	12.16	9	SNP	0.981	T
CCPG1	9236	genome.wustl.edu	37	15	55664161	55664161	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr15:55664161C>T	ENST00000310958.6	-	6	834	c.536G>A	c.(535-537)cGt>cAt	p.R179H	MIR628_ENST00000385229.1_RNA|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000569205.1_Missense_Mutation_p.R179H|CCPG1_ENST00000425574.3_Missense_Mutation_p.R179H|CCPG1_ENST00000442196.3_Missense_Mutation_p.R179H	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	179	Interaction with MCF2L and SRC. {ECO:0000250}.|Poly-Arg.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		CTTCCTAGCACGGCGTCGTCT	0.428																																						dbGAP											0													86.0	81.0	82.0					15																	55664161		1859	4100	5959	-	-	-	SO:0001583	missense	0			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.536G>A	15.37:g.55664161C>T	ENSP00000311656:p.Arg179His		A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	NULL	p.R179H	ENST00000310958.6	37	c.536	CCDS42039.1	15	.	.	.	.	.	.	.	.	.	.	C	22.3	4.278081	0.80692	.	.	ENSG00000256061	ENST00000310958;ENST00000442196;ENST00000425574	T;T;T	0.42131	3.32;3.33;0.98	5.74	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.66005	0.2746	M	0.79805	2.47	0.53688	D	0.999978	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.71310	-0.4631	10	0.72032	D	0.01	.	14.0184	0.64539	0.0:0.9276:0.0:0.0724	.	179;179;179;35	A8K9T0;Q9ULG6-3;Q9ULG6;Q9ULG6-2	.;.;CCPG1_HUMAN;.	H	179	ENSP00000311656:R179H;ENSP00000403400:R179H;ENSP00000415128:R179H	ENSP00000311656:R179H	R	-	2	0	DYX1C1	53451453	1.000000	0.71417	0.772000	0.31596	0.651000	0.38670	5.503000	0.66962	1.432000	0.47375	0.655000	0.94253	CGT	CCPG1	-	NULL	ENSG00000260916		0.428	CCPG1-001	KNOWN	basic|CCDS	protein_coding	CCPG1	HGNC	protein_coding	OTTHUMT00000419850.1	39	0.00	0	C	NM_004748		55664161	55664161	-1	no_errors	ENST00000310958	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.956	T
CHD6	84181	genome.wustl.edu	37	20	40049229	40049229	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr20:40049229C>T	ENST00000373233.3	-	31	6223	c.6046G>A	c.(6046-6048)Gaa>Aaa	p.E2016K		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2016					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TCACTTCCTTCAAGAGGATAT	0.398																																						dbGAP											0													122.0	112.0	115.0					20																	40049229		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6046G>A	20.37:g.40049229C>T	ENSP00000362330:p.Glu2016Lys		Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E2016K	ENST00000373233.3	37	c.6046	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	C	14.74	2.626628	0.46840	.	.	ENSG00000124177	ENST00000373233	D	0.85861	-2.04	6.07	4.14	0.48551	.	0.414789	0.23272	N	0.050017	T	0.74718	0.3753	L	0.41236	1.265	0.80722	D	1	P	0.39665	0.682	B	0.27380	0.079	T	0.74771	-0.3552	10	0.38643	T	0.18	-15.7287	11.5098	0.50486	0.0:0.8601:0.0:0.1399	.	2016	Q8TD26	CHD6_HUMAN	K	2016	ENSP00000362330:E2016K	ENSP00000362330:E2016K	E	-	1	0	CHD6	39482643	0.302000	0.24454	0.900000	0.35374	0.788000	0.44548	0.997000	0.29731	1.584000	0.49913	0.655000	0.94253	GAA	CHD6	-	NULL	ENSG00000124177		0.398	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	69	0.00	0	C			40049229	40049229	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.820	T
CLDN18	51208	genome.wustl.edu	37	3	137748728	137748728	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr3:137748728G>A	ENST00000183605.5	+	4	819	c.593G>A	c.(592-594)gGc>gAc	p.G198D	CLDN18_ENST00000343735.4_Missense_Mutation_p.G198D	NM_016369.3	NP_057453.1	P56856	CLD18_HUMAN	claudin 18	198					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						GCCTGCCGGGGCCTGGCACCA	0.522																																						dbGAP											0													54.0	54.0	54.0					3																	137748728		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000183605.5:c.593G>A	3.37:g.137748728G>A	ENSP00000183605:p.Gly198Asp		A5PL21|Q96PH4	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin18,prints_Claudin	p.G198D	ENST00000183605.5	37	c.593	CCDS3095.1	3	.	.	.	.	.	.	.	.	.	.	G	23.3	4.393588	0.83011	.	.	ENSG00000066405	ENST00000343735;ENST00000183605;ENST00000536138	D;D	0.85484	-1.96;-1.99	5.16	5.16	0.70880	.	0.247869	0.27941	N	0.017226	D	0.86096	0.5851	L	0.32530	0.975	0.58432	D	0.999999	D;D;D	0.61080	0.981;0.981;0.989	P;P;P	0.61592	0.764;0.764;0.891	T	0.80797	-0.1222	10	0.07990	T	0.79	.	19.0004	0.92830	0.0:0.0:1.0:0.0	.	187;198;198	B4DNX6;P56856;P56856-2	.;CLD18_HUMAN;.	D	198;198;187	ENSP00000340939:G198D;ENSP00000183605:G198D	ENSP00000183605:G198D	G	+	2	0	CLDN18	139231418	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.317000	0.72862	2.560000	0.86352	0.655000	0.94253	GGC	CLDN18	-	prints_Claudin18	ENSG00000066405		0.522	CLDN18-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLDN18	HGNC	protein_coding	OTTHUMT00000357199.2	111	0.00	0	G	NM_001002026		137748728	137748728	+1	no_errors	ENST00000183605	ensembl	human	known	69_37n	missense	110	34.52	58	SNP	1.000	A
CRAT	1384	genome.wustl.edu	37	9	131873438	131873438	+	5'Flank	SNP	C	C	T	rs527820874	byFrequency	TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr9:131873438C>T	ENST00000318080.2	-	0	0				PPP2R4_ENST00000358994.4_Intron|PPP2R4_ENST00000393370.2_5'Flank|CRAT_ENST00000464290.1_5'UTR|PPP2R4_ENST00000347048.4_5'Flank|PPP2R4_ENST00000452489.2_5'Flank|PPP2R4_ENST00000355007.3_5'Flank|CRAT_ENST00000393384.3_5'Flank|PPP2R4_ENST00000357197.4_5'Flank|PPP2R4_ENST00000337738.1_5'Flank|PPP2R4_ENST00000348141.5_5'Flank	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase						carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	TCAGTACCACCCACAAAGATG	0.522													C|||	2	0.000399361	0.0	0.0	5008	,	,		10966	0.002		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343		9.37:g.131873438C>T	Exception_encountered		Q5T952|Q9BW16	RNA	SNP	-	NULL	ENST00000318080.2	37	NULL	CCDS6919.1	9																																																																																			CRAT	-	-	ENSG00000095321		0.522	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	HGNC	protein_coding	OTTHUMT00000253700.1	40	0.00	0	C			131873438	131873438	-1	no_errors	ENST00000464290	ensembl	human	known	69_37n	rna	21	25.00	7	SNP	0.001	T
CRIM1	51232	genome.wustl.edu	37	2	36764583	36764583	+	Silent	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr2:36764583C>T	ENST00000280527.2	+	14	2884	c.2517C>T	c.(2515-2517)caC>caT	p.H839H	AC007401.2_ENST00000406220.1_Intron	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	839	VWFC 6. {ECO:0000255|PROSITE- ProRule:PRU00220}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GCTGCACCCACTGCTACTGCC	0.582																																						dbGAP											0													97.0	85.0	89.0					2																	36764583		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.2517C>T	2.37:g.36764583C>T			Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Silent	SNP	pfam_VWF_C,pfam_Prot_inh_I15_antistasin-like,superfamily_Prot_inh_I14/15_hirudin/antisn,smart_IGFBP-like,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	p.H839	ENST00000280527.2	37	c.2517	CCDS1783.1	2																																																																																			CRIM1	-	pfam_VWF_C,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	ENSG00000150938		0.582	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIM1	HGNC	protein_coding	OTTHUMT00000216878.2	84	0.00	0	C	NM_016441		36764583	36764583	+1	no_errors	ENST00000280527	ensembl	human	known	69_37n	silent	42	28.81	17	SNP	1.000	T
DDX59	83479	genome.wustl.edu	37	1	200635772	200635772	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:200635772G>A	ENST00000331314.6	-	2	310	c.97C>T	c.(97-99)Cag>Tag	p.Q33*	DDX59_ENST00000367348.3_Nonsense_Mutation_p.Q33*|DDX59_ENST00000447706.2_Nonsense_Mutation_p.Q33*|RP11-92G12.3_ENST00000568695.1_lincRNA	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	33						cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						TTGTCCAACTGAAGGTCTTCT	0.448																																						dbGAP											0													183.0	176.0	178.0					1																	200635772		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.97C>T	1.37:g.200635772G>A	ENSP00000330460:p.Gln33*		Q6PJL2|Q8IVW3|Q9H0W3	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Znf_HIT,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q33*	ENST00000331314.6	37	c.97	CCDS30964.1	1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169586	0.57584	.	.	ENSG00000118197	ENST00000447706;ENST00000367348;ENST00000331314;ENST00000436897	.	.	.	5.06	0.347	0.16022	.	1.532230	0.03257	N	0.182668	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-0.041	4.7768	0.13184	0.2557:0.3328:0.4115:0.0	.	.	.	.	X	33	.	ENSP00000330460:Q33X	Q	-	1	0	DDX59	198902395	0.000000	0.05858	0.000000	0.03702	0.278000	0.26855	0.893000	0.28336	0.170000	0.19704	-0.314000	0.08810	CAG	DDX59	-	NULL	ENSG00000118197		0.448	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX59	HGNC	protein_coding	OTTHUMT00000086883.2	55	0.00	0	G	NM_001031725.4		200635772	200635772	-1	no_errors	ENST00000331314	ensembl	human	known	69_37n	nonsense	37	41.27	26	SNP	0.000	A
DECR2	26063	genome.wustl.edu	37	16	461418	461418	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr16:461418G>A	ENST00000219481.5	+	8	857	c.719G>A	c.(718-720)gGg>gAg	p.G240E	DECR2_ENST00000461947.1_Intron|DECR2_ENST00000424398.2_Missense_Mutation_p.G228E	NM_020664.3	NP_065715.1	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2, peroxisomal	240					unsaturated fatty acid biosynthetic process (GO:0006636)	peroxisomal membrane (GO:0005778)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)	9		Hepatocellular(16;0.00015)				CAGAGGCTGGGGAACAAGACC	0.687																																						dbGAP											0													58.0	58.0	58.0					16																	461418		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ293009	CCDS10409.1	16p13.3	2011-09-14			ENSG00000242612	ENSG00000242612	1.3.1.34	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2754	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 17C, member 1"""	615839				11514237, 19027726	Standard	NM_020664		Approved	PDCR, SDR17C1	uc002chb.3	Q9NUI1	OTTHUMG00000047846	ENST00000219481.5:c.719G>A	16.37:g.461418G>A	ENSP00000219481:p.Gly240Glu		Q6ZRS7|Q96ET0	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR	p.G240E	ENST00000219481.5	37	c.719	CCDS10409.1	16	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918368	0.73098	.	.	ENSG00000242612	ENST00000219481;ENST00000424398	T;T	0.29655	1.56;1.56	5.33	5.33	0.75918	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.71375	0.3332	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82794	-0.0281	10	0.87932	D	0	.	18.0055	0.89208	0.0:0.0:1.0:0.0	.	240	Q9NUI1	DECR2_HUMAN	E	240;228	ENSP00000219481:G240E;ENSP00000400374:G228E	ENSP00000219481:G240E	G	+	2	0	DECR2	401419	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.647000	0.98478	2.506000	0.84524	0.555000	0.69702	GGG	DECR2	-	smart_PKS/FAS_KR,prints_Glc/ribitol_DH	ENSG00000242612		0.687	DECR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DECR2	HGNC	protein_coding	OTTHUMT00000109069.4	91	0.00	0	G	NM_020664		461418	461418	+1	no_errors	ENST00000219481	ensembl	human	known	69_37n	missense	70	20.45	18	SNP	1.000	A
DGCR14	8220	genome.wustl.edu	37	22	19121835	19121835	+	Silent	SNP	C	C	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr22:19121835C>A	ENST00000252137.6	-	10	1348	c.1305G>T	c.(1303-1305)ctG>ctT	p.L435L		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	435					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					TGGGGGTCTGCAGCCCACTGG	0.687																																						dbGAP											0													66.0	61.0	63.0					22																	19121835		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.1305G>T	22.37:g.19121835C>A			Q49AH7|Q9BTZ4	Silent	SNP	pfam_Nuclear_protein_DGCR14	p.L435	ENST00000252137.6	37	c.1305	CCDS13756.1	22																																																																																			DGCR14	-	NULL	ENSG00000100056		0.687	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR14	HGNC	protein_coding	OTTHUMT00000316432.2	183	0.00	0	C			19121835	19121835	-1	no_errors	ENST00000252137	ensembl	human	known	69_37n	silent	149	11.31	19	SNP	0.527	A
DHX15	1665	genome.wustl.edu	37	4	24531273	24531273	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr4:24531273G>C	ENST00000336812.4	-	13	2377	c.2221C>G	c.(2221-2223)Cta>Gta	p.L741V	DHX15_ENST00000508032.1_5'UTR	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	741					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				TTTGTTGTTAGAACAAACTCA	0.373																																						dbGAP											0													152.0	139.0	143.0					4																	24531273		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.2221C>G	4.37:g.24531273G>C	ENSP00000336741:p.Leu741Val		Q9NQT7	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L741V	ENST00000336812.4	37	c.2221	CCDS33966.1	4	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047419	0.55110	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	T	0.03004	4.08	5.97	4.26	0.50523	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.14830	0.0358	M	0.88775	2.98	0.80722	D	1	P;P;P	0.39424	0.673;0.673;0.622	P;P;B	0.48454	0.578;0.578;0.442	T	0.00223	-1.1903	10	0.72032	D	0.01	-12.5076	12.7143	0.57107	0.1331:0.0:0.8669:0.0	.	741;730;730	O43143;B4E0S6;F5H6K0	DHX15_HUMAN;.;.	V	741;730	ENSP00000336741:L741V	ENSP00000336741:L741V	L	-	1	2	DHX15	24140371	1.000000	0.71417	0.958000	0.39756	0.971000	0.66376	6.347000	0.73004	0.867000	0.35654	-0.157000	0.13467	CTA	DHX15	-	pfam_DUF1605	ENSG00000109606		0.373	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX15	HGNC	protein_coding	OTTHUMT00000360143.1	113	0.00	0	G	NM_001358		24531273	24531273	-1	no_errors	ENST00000336812	ensembl	human	known	69_37n	missense	63	26.74	23	SNP	0.999	C
DMBT1	1755	genome.wustl.edu	37	10	124377576	124377576	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr10:124377576C>G	ENST00000338354.3	+	38	4654	c.4548C>G	c.(4546-4548)gaC>gaG	p.D1516E	DMBT1_ENST00000344338.3_Missense_Mutation_p.D1506E|DMBT1_ENST00000368955.3_Missense_Mutation_p.D1506E|DMBT1_ENST00000359586.6_Missense_Mutation_p.D367E|DMBT1_ENST00000330163.4_Missense_Mutation_p.D888E|DMBT1_ENST00000368909.3_Missense_Mutation_p.D1516E|DMBT1_ENST00000368956.2_Missense_Mutation_p.D888E			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1516	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATGGAGGTGACAGGTGTCGAG	0.557																																					Ovarian(182;93 2026 18125 22222 38972)	dbGAP											0													368.0	363.0	365.0					10																	124377576		2029	4210	6239	-	-	-	SO:0001583	missense	0				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.4548C>G	10.37:g.124377576C>G	ENSP00000342210:p.Asp1516Glu		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_Srcr_rcpt,pfam_CUB,pfam_Zona_pellucida_Endoglin/CD105,superfamily_Srcr_rcpt-rel,superfamily_CUB,smart_Srcr_rcpt-rel,smart_CUB,smart_Zona_pellucida_Endoglin/CD105,pfscan_CUB,pfscan_Srcr_rcpt,pfscan_Zona_pellucida_Endoglin/CD105,prints_Srcr_rcpt	p.D1645E	ENST00000338354.3	37	c.4935		10	.	.	.	.	.	.	.	.	.	.	C	8.295	0.818703	0.16607	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61	4.03	-0.224	0.13115	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	191.155000	0.00496	U	0.000144	T	0.51736	0.1692	L	0.58669	1.825	0.09310	N	1	B;P;D;P;P;D	0.76494	0.187;0.822;0.998;0.956;0.628;0.999	B;P;D;P;B;D	0.77004	0.116;0.652;0.979;0.771;0.163;0.989	T	0.36040	-0.9764	10	0.51188	T	0.08	.	8.6588	0.34079	0.0:0.4915:0.0:0.5085	.	367;765;1645;888;1506;1516	F8WEF7;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;DMBT1_HUMAN	E	1516;1645;1516;1516;1516;1516;888;1506;888;888;1516;1506;888;367	ENSP00000342210:D1516E;ENSP00000343175:D1506E;ENSP00000327747:D888E;ENSP00000357905:D1516E;ENSP00000357951:D1506E;ENSP00000357952:D888E;ENSP00000352593:D367E	ENSP00000331522:D888E	D	+	3	2	DMBT1	124367566	0.000000	0.05858	0.001000	0.08648	0.165000	0.22458	0.512000	0.22755	-0.012000	0.14223	0.479000	0.44913	GAC	DMBT1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000187908		0.557	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	423	0.24	1	C	NM_004406		124377576	124377576	+1	no_errors	ENST00000368915	ensembl	human	known	69_37n	missense	237	32.67	115	SNP	0.001	G
DUSP27	92235	genome.wustl.edu	37	1	167097532	167097532	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:167097532C>T	ENST00000361200.2	+	6	3330	c.3164C>T	c.(3163-3165)cCa>cTa	p.P1055L	DUSP27_ENST00000443333.1_Missense_Mutation_p.P1055L|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.P1055L			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1055					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GAAGAGTCCCCAGAACCACAG	0.562																																						dbGAP											0													32.0	37.0	35.0					1																	167097532		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3164C>T	1.37:g.167097532C>T	ENSP00000354483:p.Pro1055Leu		A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.P1055L	ENST00000361200.2	37	c.3164	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075277	0.36662	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03468	3.92;3.92;3.92	5.42	4.49	0.54785	.	0.132770	0.34906	N	0.003585	T	0.03348	0.0097	M	0.63428	1.95	0.49213	D	0.999761	P	0.50272	0.933	B	0.42386	0.386	T	0.37596	-0.9699	10	0.87932	D	0	-11.4749	15.2164	0.73270	0.1419:0.8581:0.0:0.0	.	1055	Q5VZP5	DUS27_HUMAN	L	1055	ENSP00000354483:P1055L;ENSP00000271385:P1055L;ENSP00000404874:P1055L	ENSP00000271385:P1055L	P	+	2	0	DUSP27	165364156	0.938000	0.31826	0.828000	0.32881	0.021000	0.10359	2.147000	0.42226	1.221000	0.43506	0.643000	0.83706	CCA	DUSP27	-	NULL	ENSG00000198842		0.562	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	34	0.00	0	C	NM_001080426		167097532	167097532	+1	no_errors	ENST00000271385	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	0.994	T
ERGIC3	51614	genome.wustl.edu	37	20	34144963	34144963	+	Splice_Site	SNP	A	A	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr20:34144963A>T	ENST00000348547.2	+	12	1093		c.e12-1		ERGIC3_ENST00000447986.1_Splice_Site|ERGIC3_ENST00000279052.6_Splice_Site|ERGIC3_ENST00000357394.4_Splice_Site	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3						vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			TCCTTCTACCAGGTCCTTCAC	0.642																																						dbGAP											0													104.0	98.0	100.0					20																	34144963		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.1017-1A>T	20.37:g.34144963A>T			Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Splice_Site	SNP	-	e13-2	ENST00000348547.2	37	c.1062-2	CCDS13257.1	20	.	.	.	.	.	.	.	.	.	.	A	15.91	2.973134	0.53614	.	.	ENSG00000125991	ENST00000348547;ENST00000357394;ENST00000447986;ENST00000279052;ENST00000416206;ENST00000442139;ENST00000451605	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.005	0.64459	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERGIC3	33608377	1.000000	0.71417	0.970000	0.41538	0.475000	0.33008	8.437000	0.90302	1.946000	0.56461	0.519000	0.50382	.	ERGIC3	-	-	ENSG00000125991		0.642	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC3	HGNC	protein_coding	OTTHUMT00000078880.2	76	0	0	A	NM_015966	Intron	34144963	34144963	+1	no_errors	ENST00000447986	ensembl	human	known	69_37n	splice_site	53	35.71	30	SNP	1.000	T
AC026369.1	0	genome.wustl.edu	37	12	148078	148078	+	IGR	SNP	G	G	A	rs8181620		TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr12:148078G>A	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							cacaattgccgtgctccttgg	0.537																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.148078G>A				RNA	SNP	-	NULL	ENST00000594563.1	37	NULL		12																																																																																			FAM138D	-	-	ENSG00000206114		0.537	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	FAM138D	HGNC	protein_coding		12	0.00	0	G			148078	148078	-1	no_errors	ENST00000320165	ensembl	human	known	69_37n	rna	9	40.00	6	SNP	0.000	A
ESPL1	9700	genome.wustl.edu	37	12	53683238	53683238	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr12:53683238G>T	ENST00000257934.4	+	22	5064	c.4973G>T	c.(4972-4974)gGg>gTg	p.G1658V	ESPL1_ENST00000552462.1_Missense_Mutation_p.G1658V	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1658					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CAGCTGCAGGGGCTGAGCCTT	0.592																																					Colon(53;1069 1201 2587 5382)	dbGAP											0													71.0	71.0	71.0					12																	53683238		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.4973G>T	12.37:g.53683238G>T	ENSP00000257934:p.Gly1658Val			Missense_Mutation	SNP	pfam_Peptidase_C50	p.G1658V	ENST00000257934.4	37	c.4973	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	G	6.524	0.464862	0.12402	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.12147	2.71;2.71	5.26	1.37	0.22104	.	0.981801	0.08391	N	0.952950	T	0.07503	0.0189	N	0.14661	0.345	0.09310	N	1	B	0.28128	0.201	B	0.26770	0.073	T	0.42085	-0.9472	10	0.30078	T	0.28	.	4.7565	0.13086	0.2499:0.1601:0.59:0.0	.	1658	Q14674	ESPL1_HUMAN	V	1658;1333;1658	ENSP00000257934:G1658V;ENSP00000449831:G1658V	ENSP00000257934:G1658V	G	+	2	0	ESPL1	51969505	0.009000	0.17119	0.013000	0.15412	0.486000	0.33341	-0.041000	0.12084	0.079000	0.16929	0.563000	0.77884	GGG	ESPL1	-	NULL	ENSG00000135476		0.592	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	55	0.00	0	G	NM_012291		53683238	53683238	+1	no_errors	ENST00000257934	ensembl	human	known	69_37n	missense	61	18.67	14	SNP	0.002	T
PRR36	80164	genome.wustl.edu	37	19	7936062	7936062	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr19:7936062C>T	ENST00000539422.1	-	5	2230	c.2068G>A	c.(2068-2070)Gcg>Acg	p.A690T	CTD-3193O13.11_ENST00000597156.1_lincRNA|CTD-3193O13.9_ENST00000593356.1_Intron	NM_001190467.1	NP_001177396.1																					GAAGATAGCGCCTGCAGAGGG	0.607																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000539422.1:c.2068G>A	19.37:g.7936062C>T	ENSP00000438970:p.Ala690Thr			Missense_Mutation	SNP	NULL	p.A690T	ENST00000539422.1	37	c.2068		19	.	.	.	.	.	.	.	.	.	.	c	6.174	0.400303	0.11696	.	.	ENSG00000183248	ENST00000539422	.	.	.	2.12	1.02	0.19986	.	.	.	.	.	T	0.20618	0.0496	N	0.19112	0.55	0.18873	N	0.999986	.	.	.	.	.	.	T	0.25572	-1.0128	6	0.23891	T	0.37	.	4.8888	0.13717	0.0:0.7951:0.0:0.2049	.	.	.	.	T	690	.	ENSP00000438970:A690T	A	-	1	0	AC010336.1	7842062	0.216000	0.23585	0.019000	0.16419	0.032000	0.12392	0.000000	0.12993	0.024000	0.15214	0.205000	0.17691	GCG	AC010336.1	-	NULL	ENSG00000183248		0.607	CTD-3193O13.9-201	KNOWN	basic|appris_principal	protein_coding	FLJ22184	Clone_based_ensembl_gene	protein_coding		113	0.88	1	C			7936062	7936062	-1	no_errors	ENST00000539422	ensembl	human	known	69_37n	missense	54	20.59	14	SNP	0.015	T
FLNB	2317	genome.wustl.edu	37	3	58140519	58140519	+	Splice_Site	SNP	T	T	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr3:58140519T>C	ENST00000295956.4	+	40	6801	c.6636T>C	c.(6634-6636)gcT>gcC	p.A2212A	FLNB_ENST00000429972.2_Splice_Site_p.A2201A|FLNB_ENST00000493452.1_Splice_Site_p.A2019A|FLNB_ENST00000419752.2_Splice_Site_p.A2032A|FLNB_ENST00000358537.3_Splice_Site_p.A2188A|FLNB_ENST00000348383.5_Splice_Site_p.A2171A|FLNB_ENST00000357272.4_3'UTR|FLNB_ENST00000490882.1_Splice_Site_p.A2243A	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	2212	Interaction with FLNA 1.|Interaction with INPPL1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TGCTCTCAGCTGAGTTCAGCA	0.537																																						dbGAP											0													73.0	68.0	70.0					3																	58140519		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.6635-1T>C	3.37:g.58140519T>C			B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.A2212	ENST00000295956.4	37	c.6636	CCDS2885.1	3																																																																																			FLNB	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000136068		0.537	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	79	0.00	0	T	NM_001457	Silent	58140519	58140519	+1	no_errors	ENST00000295956	ensembl	human	known	69_37n	silent	37	33.93	19	SNP	0.029	C
FOXM1	2305	genome.wustl.edu	37	12	2977776	2977776	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr12:2977776C>G	ENST00000359843.3	-	4	867	c.799G>C	c.(799-801)Gag>Cag	p.E267Q	FOXM1_ENST00000342628.2_Missense_Mutation_p.E267Q|FOXM1_ENST00000537018.1_5'UTR|FOXM1_ENST00000361953.3_Missense_Mutation_p.E267Q	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	267					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			AAGTGGTCCTCAATCCACGTA	0.498																																						dbGAP											0													263.0	207.0	226.0					12																	2977776		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.799G>C	12.37:g.2977776C>G	ENSP00000352901:p.Glu267Gln		O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.E267Q	ENST00000359843.3	37	c.799	CCDS8515.1	12	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065862	0.76187	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.95447	-3.71;-3.71;-3.71	5.66	5.66	0.87406	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.045192	0.85682	D	0.000000	D	0.96343	0.8807	L	0.33293	1	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;0.998;1.0	D;D;D;D;D	0.97110	0.997;0.994;1.0;0.994;0.996	D	0.96993	0.9723	10	0.72032	D	0.01	.	18.7398	0.91769	0.0:1.0:0.0:0.0	.	266;267;267;267;267	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	Q	267	ENSP00000342307:E267Q;ENSP00000354492:E267Q;ENSP00000352901:E267Q	ENSP00000342307:E267Q	E	-	1	0	FOXM1	2848037	1.000000	0.71417	0.963000	0.40424	0.335000	0.28730	7.487000	0.81328	2.656000	0.90262	0.655000	0.94253	GAG	FOXM1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000111206		0.498	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	HGNC	protein_coding	OTTHUMT00000398272.1	105	0.00	0	C	NM_021953		2977776	2977776	-1	no_errors	ENST00000342628	ensembl	human	known	69_37n	missense	44	50.56	45	SNP	1.000	G
FSIP2	401024	genome.wustl.edu	37	2	186669694	186669694	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr2:186669694A>G	ENST00000424728.1	+	17	15661	c.15661A>G	c.(15661-15663)Agt>Ggt	p.S5221G	FSIP2_ENST00000343098.5_Missense_Mutation_p.S5310G			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5221										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						CTCATTCCTCAGTAAATTAGC	0.308																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.15661A>G	2.37:g.186669694A>G	ENSP00000401306:p.Ser5221Gly		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.S5310G	ENST00000424728.1	37	c.15928		2	.	.	.	.	.	.	.	.	.	.	A	7.317	0.616231	0.14129	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.53857	0.6;0.61	5.16	3.98	0.46160	.	.	.	.	.	T	0.38374	0.1038	N	0.19112	0.55	0.20403	N	0.99991	.	.	.	.	.	.	T	0.23797	-1.0178	7	0.32370	T	0.25	.	7.8555	0.29480	0.9059:0.0:0.0941:0.0	.	.	.	.	G	5310;5221	ENSP00000344403:S5310G;ENSP00000401306:S5221G	ENSP00000344403:S5310G	S	+	1	0	FSIP2	186377939	0.994000	0.37717	0.967000	0.41034	0.162000	0.22319	1.425000	0.34859	0.940000	0.37473	0.477000	0.44152	AGT	FSIP2	-	NULL	ENSG00000188738		0.308	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	30	0.00	0	A	NM_173651		186669694	186669694	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.982	G
FSTL4	23105	genome.wustl.edu	37	5	132569175	132569175	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:132569175C>T	ENST00000265342.7	-	8	1198	c.949G>A	c.(949-951)Ggc>Agc	p.G317S	FSTL4_ENST00000507112.1_5'UTR	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	317	Ig-like 1.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTGTAATTGCCCATGTGGATG	0.527																																						dbGAP											0													187.0	163.0	171.0					5																	132569175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.949G>A	5.37:g.132569175C>T	ENSP00000265342:p.Gly317Ser		Q8TBU0|Q9UPU1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_HAND_2,pfscan_Ig-like	p.G317S	ENST00000265342.7	37	c.949	CCDS34238.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.408078	0.96051	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	D	0.87103	-2.21	5.19	5.19	0.71726	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.95962	0.8685	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97458	1.0032	10	0.87932	D	0	-38.1746	17.7044	0.88304	0.0:1.0:0.0:0.0	.	317	Q6MZW2	FSTL4_HUMAN	S	317;148	ENSP00000265342:G317S	ENSP00000265342:G317S	G	-	1	0	FSTL4	132597074	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.431000	0.82371	0.467000	0.42956	GGC	FSTL4	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000053108		0.527	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	HGNC	protein_coding	OTTHUMT00000370212.1	203	0.00	0	C	XM_048786		132569175	132569175	-1	no_errors	ENST00000265342	ensembl	human	known	69_37n	missense	117	11.36	15	SNP	1.000	T
GTF2F1	2962	genome.wustl.edu	37	19	6380394	6380394	+	Silent	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr19:6380394C>G	ENST00000394456.5	-	13	1916	c.1452G>C	c.(1450-1452)ctG>ctC	p.L484L	GTF2F1_ENST00000429701.2_Silent_p.L399L|PSPN_ENST00000597721.1_5'Flank	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	484					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						GCTCGCTGCTCAGCCCTGTCT	0.557																																						dbGAP											0													219.0	205.0	210.0					19																	6380394		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.1452G>C	19.37:g.6380394C>G			B2RCS0|Q9BWN0	Silent	SNP	pfam_TFIIF-alpha,superfamily_TFIIF_interaction	p.L484	ENST00000394456.5	37	c.1452	CCDS12165.1	19																																																																																			GTF2F1	-	pfam_TFIIF-alpha	ENSG00000125651		0.557	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F1	HGNC	protein_coding	OTTHUMT00000398033.1	226	0.00	0	C	NM_002096		6380394	6380394	-1	no_errors	ENST00000394456	ensembl	human	known	69_37n	silent	108	34.94	58	SNP	1.000	G
GTF2IRD2B	389524	genome.wustl.edu	37	7	74536691	74536691	+	Splice_Site	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr7:74536691G>A	ENST00000312575.7	+	4	413		c.e4-1		GTF2IRD2B_ENST00000430511.2_Splice_Site|GTF2IRD2B_ENST00000356115.5_Splice_Site	NM_001003795.2	NP_001003795.1	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|ovary(2)|prostate(1)	4						TCCATTTGCAGGCGTTGCAGA	0.478																																						dbGAP											0													18.0	21.0	20.0					7																	74536691		2131	4214	6345	-	-	-	SO:0001630	splice_region_variant	0			AY312850	CCDS34659.1	7q11.23	2014-05-06			ENSG00000174428	ENSG00000174428			33125	protein-coding gene	gene with protein product		608900				15100712	Standard	XM_005277580		Approved		uc003ubt.3	Q6EKJ0	OTTHUMG00000181534	ENST00000312575.7:c.239-1G>A	7.37:g.74536691G>A			B2RNE9|Q69GU6|Q8N979|Q9H739	Splice_Site	SNP	-	e3-1	ENST00000312575.7	37	c.239-1	CCDS34659.1	7	.	.	.	.	.	.	.	.	.	.	g	12.68	2.011080	0.35511	.	.	ENSG00000174428	ENST00000356115;ENST00000430511;ENST00000312575	.	.	.	4.0	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3588	0.60644	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GTF2IRD2B	74174627	1.000000	0.71417	0.894000	0.35097	0.113000	0.19764	4.686000	0.61700	2.235000	0.73313	0.585000	0.79938	.	GTF2IRD2B	-	-	ENSG00000174428		0.478	GTF2IRD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2IRD2B	HGNC	protein_coding	OTTHUMT00000342728.1	62	0.00	0	G	NM_001003795	Intron	74536691	74536691	+1	no_errors	ENST00000312575	ensembl	human	known	69_37n	splice_site	61	14.08	10	SNP	0.979	A
H1FX-AS1	339942	genome.wustl.edu	37	3	129044155	129044155	+	RNA	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr3:129044155C>G	ENST00000383461.2	+	0	1687				H1FX-AS1_ENST00000502789.2_RNA|H1FX-AS1_ENST00000537780.1_RNA|H1FX-AS1_ENST00000433902.2_RNA			Q4G0G2	H1AS1_HUMAN	H1FX antisense RNA 1																		TGAACAGGCACTGACGTCAGA	0.562																																						dbGAP											0																																										-	-	-			0			AK091470		3q21.3	2012-10-12	2012-08-15	2011-08-16	ENSG00000206417	ENSG00000206417		"""Long non-coding RNAs"""	27953	non-coding RNA	RNA, long non-coding			"""chromosome 3 open reading frame 47"", ""H1FX antisense RNA 1 (non-protein coding)"""	C3orf47		14702039	Standard	NR_026991		Approved	FLJ34151	uc011bkv.1	Q4G0G2	OTTHUMG00000159459		3.37:g.129044155C>G				RNA	SNP	-	NULL	ENST00000383461.2	37	NULL		3																																																																																			H1FX-AS1	-	-	ENSG00000206417		0.562	H1FX-AS1-001	KNOWN	basic	antisense	H1FX-AS1	HGNC	antisense	OTTHUMT00000355523.2	84	0.00	0	C	NR_026991		129044155	129044155	+1	no_errors	ENST00000383461	ensembl	human	known	69_37n	rna	73	23.96	23	SNP	0.986	G
HMGN2P46	283651	genome.wustl.edu	37	15	45848871	45848871	+	lincRNA	SNP	A	A	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr15:45848871A>C	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							CCTGCCCAAAATACCATGATT	0.373																																						dbGAP											0																																										-	-	-			0																															15.37:g.45848871A>C				RNA	SNP	-	NULL	ENST00000557965.1	37	NULL		15																																																																																			HMGN2P46	-	-	ENSG00000179362		0.373	RP11-96O20.2-001	KNOWN	basic	lincRNA	HMGN2P46	HGNC	lincRNA	OTTHUMT00000416553.1	19	0.00	0	A			45848871	45848871	+1	no_errors	ENST00000409454	ensembl	human	known	69_37n	rna	6	45.45	5	SNP	0.659	C
HDGFRP3	50810	genome.wustl.edu	37	15	83826264	83826264	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr15:83826264C>A	ENST00000299633.4	-	4	965	c.362G>T	c.(361-363)aGc>aTc	p.S121I		NM_016073.3	NP_057157.1	Q9Y3E1	HDGR3_HUMAN		121					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						TTCCTCACTGCTTGCATCTGC	0.363																																						dbGAP											0													132.0	112.0	119.0					15																	83826264		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000299633.4:c.362G>T	15.37:g.83826264C>A	ENSP00000299633:p.Ser121Ile			Missense_Mutation	SNP	pfam_PWWP,smart_PWWP,pfscan_PWWP	p.S121I	ENST00000299633.4	37	c.362	CCDS32314.1	15	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136533	0.77662	.	.	ENSG00000166503	ENST00000299633	T	0.73047	-0.71	5.35	4.43	0.53597	.	0.095649	0.85682	D	0.000000	T	0.67859	0.2938	M	0.73962	2.25	0.42169	D	0.991635	P	0.42908	0.793	B	0.34590	0.186	T	0.71115	-0.4686	10	0.36615	T	0.2	.	15.6713	0.77279	0.1384:0.8616:0.0:0.0	.	121	Q9Y3E1	HDGR3_HUMAN	I	121	ENSP00000299633:S121I	ENSP00000299633:S121I	S	-	2	0	AC024270.1	81617268	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	7.058000	0.76676	1.374000	0.46228	-0.181000	0.13052	AGC	RP11-382A20.3	-	NULL	ENSG00000166503		0.363	HDGFRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDGFRP3	Clone_based_vega_gene	protein_coding	OTTHUMT00000419898.1	250	0.00	0	C			83826264	83826264	-1	no_errors	ENST00000299633	ensembl	human	known	69_37n	missense	107	35.54	59	SNP	1.000	A
HOXD13	3239	genome.wustl.edu	37	2	176958331	176958331	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr2:176958331G>A	ENST00000392539.3	+	1	713	c.713G>A	c.(712-714)tGg>tAg	p.W238*		NM_000523.3	NP_000514.2	P35453	HXD13_HUMAN	homeobox D13	238					anterior/posterior pattern specification (GO:0009952)|branch elongation of an epithelium (GO:0060602)|embryonic digit morphogenesis (GO:0042733)|embryonic hindgut morphogenesis (GO:0048619)|male genitalia development (GO:0030539)|morphogenesis of an epithelial fold (GO:0060571)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0526)|READ - Rectum adenocarcinoma(9;0.0678)		GCTAACGGGTGGAACAGCCAG	0.592			T	NUP98	AML*																																	dbGAP		Dom	yes		2	2q31-q32	3239	homeo box D13		L	0													40.0	44.0	43.0					2																	176958331		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF005219	CCDS2264.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128714	ENSG00000128714		"""Homeoboxes / ANTP class : HOXL subclass"""	5136	protein-coding gene	gene with protein product		142989	"""homeo box D13"""	HOX4I, SPD		2574852, 1973146	Standard	NM_000523		Approved		uc002ukf.1	P35453	OTTHUMG00000132431	ENST00000392539.3:c.713G>A	2.37:g.176958331G>A	ENSP00000376322:p.Trp238*			Nonsense_Mutation	SNP	pfam_Homeodomain,pfam_HoxA13_N,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.W238*	ENST00000392539.3	37	c.713	CCDS2264.2	2	.	.	.	.	.	.	.	.	.	.	G	36	5.776329	0.96922	.	.	ENSG00000128714	ENST00000392539	.	.	.	4.71	4.71	0.59529	.	0.000000	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4346	0.87548	0.0:0.0:1.0:0.0	.	.	.	.	X	238	.	ENSP00000376322:W238X	W	+	2	0	HOXD13	176666577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.187000	0.94912	2.439000	0.82584	0.563000	0.77884	TGG	HOXD13	-	NULL	ENSG00000128714		0.592	HOXD13-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HOXD13	HGNC	protein_coding	OTTHUMT00000359256.1	81	0.00	0	G			176958331	176958331	+1	no_errors	ENST00000392539	ensembl	human	putative	69_37n	nonsense	49	30.00	21	SNP	1.000	A
HTT	3064	genome.wustl.edu	37	4	3237310	3237310	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr4:3237310T>C	ENST00000355072.5	+	63	8735	c.8590T>C	c.(8590-8592)Tct>Cct	p.S2864P		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2864					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GGTGATGCTGTCTGGAAGTGA	0.577																																						dbGAP											0													43.0	47.0	46.0					4																	3237310		2126	4234	6360	-	-	-	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8590T>C	4.37:g.3237310T>C	ENSP00000347184:p.Ser2864Pro		Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.S2864P	ENST00000355072.5	37	c.8590	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	T	15.39	2.820287	0.50633	.	.	ENSG00000197386	ENST00000355072	T	0.69685	-0.42	4.51	3.29	0.37713	.	0.000000	0.85682	D	0.000000	T	0.77110	0.4082	M	0.65975	2.015	0.58432	D	0.999992	D	0.71674	0.998	D	0.77557	0.99	T	0.76597	-0.2901	10	0.56958	D	0.05	.	9.8587	0.41101	0.1533:0.0:0.0:0.8467	.	2864	P42858	HD_HUMAN	P	2864	ENSP00000347184:S2864P	ENSP00000347184:S2864P	S	+	1	0	HTT	3207108	1.000000	0.71417	0.977000	0.42913	0.321000	0.28281	5.748000	0.68697	0.828000	0.34709	0.379000	0.24179	TCT	HTT	-	NULL	ENSG00000197386		0.577	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	114	0.00	0	T	NM_002111		3237310	3237310	+1	no_errors	ENST00000355072	ensembl	human	known	69_37n	missense	39	29.09	16	SNP	1.000	C
IL1RAPL1	11141	genome.wustl.edu	37	X	29414526	29414526	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chrX:29414526C>G	ENST00000378993.1	+	4	1187	c.514C>G	c.(514-516)Ctg>Gtg	p.L172V	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.L172V	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	172	Ig-like C2-type 2.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						GGATTTTCTACTGCCAACCAG	0.383																																						dbGAP											0													113.0	108.0	110.0					X																	29414526		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.514C>G	X.37:g.29414526C>G	ENSP00000368278:p.Leu172Val		A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom,pfscan_Ig-like	p.L172V	ENST00000378993.1	37	c.514	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	C	9.369	1.069987	0.20147	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.77098	-1.07;-1.07	5.26	1.97	0.26223	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.626926	0.15335	N	0.267832	T	0.54498	0.1862	N	0.14661	0.345	0.09310	N	0.999996	B	0.09022	0.002	B	0.15052	0.012	T	0.31833	-0.9929	9	.	.	.	.	3.1663	0.06536	0.3284:0.335:0.0:0.3366	.	172	Q9NZN1	IRPL1_HUMAN	V	172	ENSP00000368278:L172V;ENSP00000305200:L172V	.	L	+	1	2	IL1RAPL1	29324447	0.992000	0.36948	0.996000	0.52242	0.978000	0.69477	1.525000	0.35953	0.506000	0.28125	0.513000	0.50165	CTG	IL1RAPL1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000169306		0.383	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	57	0.00	0	C	NM_014271		29414526	29414526	+1	no_errors	ENST00000302196	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	0.402	G
KIAA1191	57179	genome.wustl.edu	37	5	175782695	175782695	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:175782695C>T	ENST00000298569.4	-	4	619	c.86G>A	c.(85-87)cGg>cAg	p.R29Q	RP11-843P14.1_ENST00000512934.1_RNA|RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000393728.2_Intron|KIAA1191_ENST00000393725.2_Missense_Mutation_p.R10Q|KIAA1191_ENST00000533553.1_Intron|KIAA1191_ENST00000510164.1_Missense_Mutation_p.R29Q	NM_020444.3	NP_065177.2	Q96A73	P33MX_HUMAN	KIAA1191	29						cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		GCTGACTGCCCGGCGGTATAT	0.582																																						dbGAP											0													79.0	71.0	74.0					5																	175782695		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC010448	CCDS4399.1, CCDS43402.1, CCDS75373.1	5q35.2	2008-02-05			ENSG00000122203	ENSG00000122203			29209	protein-coding gene	gene with protein product						10574461, 10565538	Standard	XM_005265941		Approved	FLJ21022	uc003mdy.3	Q96A73	OTTHUMG00000130656	ENST00000298569.4:c.86G>A	5.37:g.175782695C>T	ENSP00000298569:p.Arg29Gln		B2RD69|B8K1S6|Q6IA24|Q8NDU3|Q9BRE5|Q9H7D5|Q9ULM9	Missense_Mutation	SNP	NULL	p.R29Q	ENST00000298569.4	37	c.86	CCDS4399.1	5	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606928	0.87157	.	.	ENSG00000122203	ENST00000298569;ENST00000393725;ENST00000510164;ENST00000506983;ENST00000503082;ENST00000504688	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	M	0.73962	2.25	0.80722	D	1	P	0.47545	0.897	B	0.39935	0.314	T	0.71080	-0.4696	9	0.87932	D	0	-19.9	18.472	0.90778	0.0:1.0:0.0:0.0	.	29	Q96A73	K1191_HUMAN	Q	29;10;29;10;10;10	.	ENSP00000298569:R29Q	R	-	2	0	KIAA1191	175715301	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.497000	0.66924	2.438000	0.82558	0.591000	0.81541	CGG	KIAA1191	-	NULL	ENSG00000122203		0.582	KIAA1191-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1191	HGNC	protein_coding	OTTHUMT00000253146.2	54	0.00	0	C	NM_020444		175782695	175782695	-1	no_errors	ENST00000298569	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	1.000	T
LENG1	79165	genome.wustl.edu	37	19	54663414	54663414	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr19:54663414T>G	ENST00000222224.3	-	1	206	c.20A>C	c.(19-21)aAg>aCg	p.K7T		NM_024316.1	NP_077292.1	Q96BZ8	LENG1_HUMAN	leukocyte receptor cluster (LRC) member 1	7										breast(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	8	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GTGCCAGCTCTTCTTGGGCAA	0.632											OREG0003639	type=REGULATORY REGION|Gene=LENG1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													39.0	31.0	34.0					19																	54663414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF211966	CCDS12881.1	19q13.4	2008-02-05			ENSG00000105617	ENSG00000105617			15502	protein-coding gene	gene with protein product						10941842	Standard	NM_024316		Approved		uc002qdm.3	Q96BZ8	OTTHUMG00000066486	ENST00000222224.3:c.20A>C	19.37:g.54663414T>G	ENSP00000222224:p.Lys7Thr	1002	Q9HCU7	Missense_Mutation	SNP	NULL	p.K7T	ENST00000222224.3	37	c.20	CCDS12881.1	19	.	.	.	.	.	.	.	.	.	.	T	31	5.068657	0.93950	.	.	ENSG00000105617	ENST00000222224	T	0.70399	-0.48	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	D	0.87720	0.6248	H	0.94385	3.53	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.90934	0.4792	10	0.87932	D	0	-42.9834	13.5269	0.61601	0.0:0.0:0.0:1.0	.	7	Q96BZ8	LENG1_HUMAN	T	7	ENSP00000222224:K7T	ENSP00000222224:K7T	K	-	2	0	LENG1	59355226	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.803000	0.75180	2.099000	0.63709	0.529000	0.55759	AAG	LENG1	-	NULL	ENSG00000105617		0.632	LENG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG1	HGNC	protein_coding	OTTHUMT00000142159.1	75	0.00	0	T	NM_024316		54663414	54663414	-1	no_errors	ENST00000222224	ensembl	human	known	69_37n	missense	70	25.53	24	SNP	1.000	G
MAPK9	5601	genome.wustl.edu	37	5	179663439	179663439	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:179663439G>C	ENST00000452135.2	-	12	1518	c.1220C>G	c.(1219-1221)tCa>tGa	p.S407*	MAPK9_ENST00000347470.4_Nonsense_Mutation_p.S322*|MAPK9_ENST00000455781.1_Nonsense_Mutation_p.S407*|MAPK9_ENST00000343111.6_3'UTR|MAPK9_ENST00000393360.3_3'UTR			P45984	MK09_HUMAN	mitogen-activated protein kinase 9	407					cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTCTGTGTCTGAGGCCAGCGT	0.493																																						dbGAP											0													114.0	97.0	102.0					5																	179663439		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.1220C>G	5.37:g.179663439G>C	ENSP00000394560:p.Ser407*		A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_JNK	p.S407*	ENST00000452135.2	37	c.1220	CCDS4453.1	5	.	.	.	.	.	.	.	.	.	.	G	38	7.000736	0.97994	.	.	ENSG00000050748	ENST00000452135;ENST00000455781;ENST00000347470	.	.	.	5.71	4.84	0.62591	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.7428	14.7951	0.69870	0.0692:0.0:0.9308:0.0	.	.	.	.	X	407;407;322	.	ENSP00000321410:S322X	S	-	2	0	MAPK9	179596045	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.731000	0.98807	1.415000	0.47037	0.561000	0.74099	TCA	MAPK9	-	NULL	ENSG00000050748		0.493	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK9	HGNC	protein_coding	OTTHUMT00000253530.3	74	0.00	0	G			179663439	179663439	-1	no_errors	ENST00000452135	ensembl	human	known	69_37n	nonsense	52	38.10	32	SNP	1.000	C
MARK4	57787	genome.wustl.edu	37	19	45801476	45801476	+	Intron	SNP	G	G	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr19:45801476G>T	ENST00000262891.4	+	15	2208				MARK4_ENST00000300843.4_Missense_Mutation_p.K651N	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4						microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AGGGATCCAAGATCAGTAAGT	0.607																																						dbGAP											0													134.0	109.0	117.0					19																	45801476		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1877+264G>T	19.37:g.45801476G>T			Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_UBA/transl_elong_EF1B_N,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K651N	ENST00000262891.4	37	c.1953	CCDS56097.1	19	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790471	0.50102	.	.	ENSG00000007047	ENST00000300843	T	0.71934	-0.61	4.98	2.83	0.33086	.	.	.	.	.	T	0.66107	0.2756	N	0.08118	0	0.24330	N	0.995007	D	0.76494	0.999	D	0.78314	0.991	T	0.54879	-0.8227	9	0.72032	D	0.01	.	6.6778	0.23103	0.3031:0.0:0.6969:0.0	.	651	Q96L34-2	.	N	651	ENSP00000300843:K651N	ENSP00000300843:K651N	K	+	3	2	MARK4	50493316	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.871000	0.39539	0.483000	0.27608	0.460000	0.39030	AAG	MARK4	-	NULL	ENSG00000007047		0.607	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK4	HGNC	protein_coding	OTTHUMT00000457537.1	93	0.00	0	G	NM_031417		45801476	45801476	+1	no_errors	ENST00000300843	ensembl	human	known	69_37n	missense	67	27.17	25	SNP	1.000	T
MED13	9969	genome.wustl.edu	37	17	60072577	60072577	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr17:60072577T>G	ENST00000397786.2	-	10	2193	c.2117A>C	c.(2116-2118)gAa>gCa	p.E706A		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	706					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AAAAAGGAATTCCTCATCTCC	0.353																																						dbGAP											0													213.0	184.0	193.0					17																	60072577		1833	4076	5909	-	-	-	SO:0001583	missense	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.2117A>C	17.37:g.60072577T>G	ENSP00000380888:p.Glu706Ala		B2RU05|O60334	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.E706A	ENST00000397786.2	37	c.2117	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	T	18.58	3.654022	0.67472	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.75367	-0.93	5.32	5.32	0.75619	.	0.046389	0.85682	D	0.000000	T	0.72045	0.3412	L	0.50333	1.59	0.54753	D	0.99998	D	0.53151	0.958	B	0.44224	0.444	T	0.75522	-0.3288	10	0.52906	T	0.07	-9.3226	15.5679	0.76309	0.0:0.0:0.0:1.0	.	706	Q9UHV7	MED13_HUMAN	A	706;705	ENSP00000380888:E706A	ENSP00000262436:E705A	E	-	2	0	MED13	57427359	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.098000	0.76974	2.139000	0.66308	0.455000	0.32223	GAA	MED13	-	NULL	ENSG00000108510		0.353	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1	58	0.00	0	T	NM_005121		60072577	60072577	-1	no_errors	ENST00000397786	ensembl	human	known	69_37n	missense	54	15.62	10	SNP	1.000	G
MMEL1	79258	genome.wustl.edu	37	1	2560819	2560821	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:2560819_2560821delCAG	ENST00000378412.3	-	2	264_266	c.103_105delCTG	c.(103-105)ctgdel	p.L35del	MMEL1_ENST00000288709.6_In_Frame_Del_p.L26del|MMEL1_ENST00000502556.1_In_Frame_Del_p.L35del|MMEL1_ENST00000511099.1_5'Flank			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	35						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		CAGCGGTCACcagcagcagcagc	0.739																																						dbGAP											0										2,190,3148		0,0,2,18,154,1496						-0.2	0.9			12	5,359,6192		1,0,3,61,237,2976	no	codingComplex	MMEL1	NM_033467.3		1,0,5,79,391,4472	A1A1,A1A2,A1R,A2A2,A2R,RR		5.5522,5.7485,5.6184				7,549,9340				-	-	-	SO:0001651	inframe_deletion	0			AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.103_105delCTG	1.37:g.2560828_2560830delCAG	ENSP00000367668:p.Leu35del		B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	In_Frame_Del	DEL	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.L35in_frame_del	ENST00000378412.3	37	c.105_103	CCDS30569.2	1																																																																																			MMEL1	-	NULL	ENSG00000142606		0.739	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMEL1	HGNC	protein_coding	OTTHUMT00000002395.2	12	0.00	0	CAG	NM_033467		2560819	2560821	-1	no_errors	ENST00000378412	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	0.932:0.974:0.981	-
MPL	4352	genome.wustl.edu	37	1	43806060	43806060	+	Missense_Mutation	SNP	G	G	T	rs200023952		TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:43806060G>T	ENST00000372470.3	+	6	898	c.856G>T	c.(856-858)Gca>Tca	p.A286S	MPL_ENST00000413998.2_Missense_Mutation_p.A286S	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	286					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	GACTTTAGTGGCACTTGGACT	0.453			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														NSCLC(52;534 1204 10016 41452 44427)	dbGAP	yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	L	0													190.0	173.0	179.0					1																	43806060		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.856G>T	1.37:g.43806060G>T	ENSP00000361548:p.Ala286Ser		Q5JUZ0	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A286S	ENST00000372470.3	37	c.856	CCDS483.1	1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.185615	0.38609	.	.	ENSG00000117400	ENST00000372468;ENST00000372470;ENST00000413998	T;T	0.80909	-1.43;-1.16	5.79	3.9	0.45041	.	0.655088	0.16202	N	0.224864	T	0.72260	0.3438	L	0.43152	1.355	0.23776	N	0.996879	B;B;B	0.27229	0.104;0.126;0.172	B;B;B	0.22386	0.039;0.034;0.039	T	0.62599	-0.6820	10	0.51188	T	0.08	-1.7227	9.5155	0.39102	0.152:0.0:0.848:0.0	.	279;286;286	Q308M1;P40238;Q5JUY5	.;TPOR_HUMAN;.	S	286	ENSP00000361548:A286S;ENSP00000414004:A286S	ENSP00000361546:A286S	A	+	1	0	MPL	43578647	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	2.956000	0.49129	0.772000	0.33382	0.591000	0.81541	GCA	MPL	-	superfamily_Fibronectin_type3	ENSG00000117400		0.453	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPL	HGNC	protein_coding	OTTHUMT00000019522.1	121	0.00	0	G	NM_005373		43806060	43806060	+1	no_errors	ENST00000372470	ensembl	human	known	69_37n	missense	101	10.62	12	SNP	1.000	T
MRPL28	10573	genome.wustl.edu	37	16	418609	418609	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr16:418609C>A	ENST00000199706.8	-	4	503	c.468G>T	c.(466-468)aaG>aaT	p.K156N	MRPL28_ENST00000389675.2_Missense_Mutation_p.K156N|MRPL28_ENST00000429738.1_Intron	NM_006428.4	NP_006419.2	Q13084	RM28_HUMAN	mitochondrial ribosomal protein L28	156					translation (GO:0006412)	cytoplasm (GO:0005737)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)	5		Hepatocellular(16;0.000105)|Lung NSC(18;0.0324)|all_lung(18;0.064)				CCATCCCAAACTTGGAGCACA	0.677																																						dbGAP											0													60.0	65.0	63.0					16																	418609		2203	4299	6502	-	-	-	SO:0001583	missense	0			U19796	CCDS32349.1	16p13.12	2012-09-26	2002-11-13		ENSG00000086504	ENSG00000086504		"""Mitochondrial ribosomal proteins / large subunits"""	14484	protein-coding gene	gene with protein product		604853	"""melanoma-associated antigen recognised by cytotoxic T lymphocytes"""	MAAT1		11551941, 19753307	Standard	NM_006428		Approved	p15	uc002cgs.2	Q13084	OTTHUMG00000047994	ENST00000199706.8:c.468G>T	16.37:g.418609C>A	ENSP00000199706:p.Lys156Asn		B2RCM4|D3DU46|Q4TT39|Q96S26|Q9BQD8|Q9BR04	Missense_Mutation	SNP	NULL	p.K156N	ENST00000199706.8	37	c.468	CCDS32349.1	16	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052225	0.36181	.	.	ENSG00000086504	ENST00000397735;ENST00000199706;ENST00000397734;ENST00000389675;ENST00000441883;ENST00000447696;ENST00000450882	T;T;T;T;T	0.33654	1.83;1.83;1.83;1.42;1.4	3.64	2.65	0.31530	.	0.000000	0.85682	D	0.000000	T	0.54498	0.1862	M	0.80847	2.515	0.52099	D	0.999941	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71414	0.973;0.973;0.973	T	0.51647	-0.8679	10	0.40728	T	0.16	-32.1218	7.1547	0.25630	0.0:0.7823:0.0:0.2177	.	156;156;156	A2IDC6;Q13084;Q4TT38	.;RM28_HUMAN;.	N	156	ENSP00000199706:K156N;ENSP00000374326:K156N;ENSP00000398684:K156N;ENSP00000390399:K156N;ENSP00000395305:K156N	ENSP00000199706:K156N	K	-	3	2	MRPL28	358610	1.000000	0.71417	0.998000	0.56505	0.252000	0.25951	0.782000	0.26788	0.666000	0.31087	0.563000	0.77884	AAG	MRPL28	-	NULL	ENSG00000086504		0.677	MRPL28-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL28	HGNC	protein_coding	OTTHUMT00000139285.2	186	0.00	0	C			418609	418609	-1	no_errors	ENST00000199706	ensembl	human	known	69_37n	missense	156	23.53	48	SNP	1.000	A
MSH3	4437	genome.wustl.edu	37	5	79950579	79950579	+	Silent	SNP	C	C	T	rs564921007	byFrequency	TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:79950579C>T	ENST00000265081.6	+	1	113	c.33C>T	c.(31-33)ctC>ctT	p.L11L	DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000505337.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	11					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CGGGCGGCCTCGCTGCCTCCA	0.697								Mismatch excision repair (MMR)					.|||	2	0.000399361	0.0	0.0	5008	,	,		6922	0.0		0.0	False		,,,				2504	0.002				Melanoma(88;1010 1399 13793 26548 36275)	dbGAP											0													23.0	22.0	22.0					5																	79950579		2196	4293	6489	-	-	-	SO:0001819	synonymous_variant	0			U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.33C>T	5.37:g.79950579C>T			A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.L11	ENST00000265081.6	37	c.33	CCDS34195.1	5																																																																																			MSH3	-	NULL	ENSG00000113318		0.697	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	HGNC	protein_coding	OTTHUMT00000369471.1	68	0.00	0	C	NM_002439		79950579	79950579	+1	no_errors	ENST00000265081	ensembl	human	known	69_37n	silent	40	38.46	25	SNP	0.000	T
MUC17	140453	genome.wustl.edu	37	7	100684489	100684489	+	Silent	SNP	C	C	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr7:100684489C>A	ENST00000306151.4	+	3	9856	c.9792C>A	c.(9790-9792)ccC>ccA	p.P3264P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3264	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CATCTCCTCCCACTGCTGAAG	0.512																																						dbGAP											0													308.0	313.0	312.0					7																	100684489		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9792C>A	7.37:g.100684489C>A			O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.P3264	ENST00000306151.4	37	c.9792	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	152	0.65	1	C	NM_001040105		100684489	100684489	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	silent	88	31.78	41	SNP	0.000	A
MYO15A	51168	genome.wustl.edu	37	17	18023342	18023342	+	Missense_Mutation	SNP	G	G	C	rs373107474		TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr17:18023342G>C	ENST00000205890.5	+	2	1566	c.1228G>C	c.(1228-1230)Gtg>Ctg	p.V410L		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	410					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TTCGGCCTTTGTGTACCCCTG	0.657																																						dbGAP											0													56.0	65.0	62.0					17																	18023342		2035	4179	6214	-	-	-	SO:0001583	missense	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1228G>C	17.37:g.18023342G>C	ENSP00000205890:p.Val410Leu		B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.V410L	ENST00000205890.5	37	c.1228	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.854937	0.00558	.	.	ENSG00000091536	ENST00000205890	T	0.21361	2.01	5.14	-0.488	0.12056	.	.	.	.	.	T	0.06050	0.0157	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39563	-0.9608	9	0.02654	T	1	.	4.064	0.09851	0.4035:0.1736:0.4229:0.0	.	410	Q9UKN7	MYO15_HUMAN	L	410	ENSP00000205890:V410L	ENSP00000205890:V410L	V	+	1	0	MYO15A	17964067	0.000000	0.05858	0.019000	0.16419	0.227000	0.25037	0.545000	0.23268	-0.004000	0.14419	0.511000	0.50034	GTG	MYO15A	-	NULL	ENSG00000091536		0.657	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	111	0.00	0	G	NM_016239		18023342	18023342	+1	no_errors	ENST00000205890	ensembl	human	known	69_37n	missense	74	22.11	21	SNP	0.001	C
MYCBPAP	84073	genome.wustl.edu	37	17	48603371	48603371	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr17:48603371G>C	ENST00000323776.5	+	14	2203	c.2041G>C	c.(2041-2043)Gcc>Ccc	p.A681P	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.A644P	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			CACAGAGAAGGCCTCTGTGAA	0.627																																						dbGAP											0													99.0	74.0	82.0					17																	48603371		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.2041G>C	17.37:g.48603371G>C	ENSP00000323184:p.Ala681Pro			Missense_Mutation	SNP	NULL	p.A681P	ENST00000323776.5	37	c.2041	CCDS32680.2	17	.	.	.	.	.	.	.	.	.	.	G	2.622	-0.288237	0.05605	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.25912	1.77;1.78	5.45	-10.9	0.00192	.	1.827870	0.02239	N	0.065610	T	0.14227	0.0344	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18085	-1.0348	10	0.30854	T	0.27	3.3721	7.5472	0.27775	0.5877:0.1757:0.119:0.1176	.	644	Q8TBZ2	MYBPP_HUMAN	P	681;644	ENSP00000323184:A681P;ENSP00000397209:A644P	ENSP00000323184:A681P	A	+	1	0	MYCBPAP	45958370	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.870000	0.00721	-4.998000	0.00024	-2.928000	0.00088	GCC	MYCBPAP	-	NULL	ENSG00000136449		0.627	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYCBPAP	HGNC	protein_coding	OTTHUMT00000347814.1	74	0.00	0	G	NM_032133		48603371	48603371	+1	no_errors	ENST00000323776	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	0.000	C
NOC3L	64318	genome.wustl.edu	37	10	96117087	96117087	+	Splice_Site	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr10:96117087C>T	ENST00000371361.3	-	4	452	c.352G>A	c.(352-354)Gag>Aag	p.E118K	NOC3L_ENST00000371350.1_Splice_Site_p.E118K|NOC3L_ENST00000463649.1_5'UTR	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	118					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				TGAACAGGCTCACTGCAGGGG	0.363																																						dbGAP											0													70.0	64.0	66.0					10																	96117087		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.351-1G>A	10.37:g.96117087C>T			Q9H5M6|Q9H9D8	Missense_Mutation	SNP	pfam_CCAAT-binding_factor,pfam_NOC3p,superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3	p.E118K	ENST00000371361.3	37	c.352	CCDS7433.1	10	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193406	0.38707	.	.	ENSG00000173145	ENST00000371361;ENST00000371350	T;T	0.11930	2.73;2.73	5.16	5.16	0.70880	.	0.165528	0.52532	D	0.000065	T	0.10423	0.0255	N	0.19112	0.55	0.58432	D	0.999998	B	0.23442	0.085	B	0.15052	0.012	T	0.20806	-1.0264	10	0.17369	T	0.5	-0.4131	19.0227	0.92921	0.0:1.0:0.0:0.0	.	118	Q8WTT2	NOC3L_HUMAN	K	118	ENSP00000360412:E118K;ENSP00000360401:E118K	ENSP00000360401:E118K	E	-	1	0	NOC3L	96107077	1.000000	0.71417	0.994000	0.49952	0.132000	0.20833	5.627000	0.67784	2.559000	0.86315	0.655000	0.94253	GAG	NOC3L	-	pirsf_Nucleolar_cplx-assoc_3	ENSG00000173145		0.363	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOC3L	HGNC	protein_coding	OTTHUMT00000049466.1	36	0.00	0	C	NM_022451	Missense_Mutation	96117087	96117087	-1	no_errors	ENST00000371350	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	T
NOTCH4	4855	genome.wustl.edu	37	6	32183149	32183149	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr6:32183149C>G	ENST00000375023.3	-	12	2013	c.1875G>C	c.(1873-1875)gaG>gaC	p.E625D	NOTCH4_ENST00000465528.1_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	625	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						ACAGGGGAACCTCACAGAGCT	0.552																																						dbGAP											0													73.0	56.0	62.0					6																	32183149		1510	2708	4218	-	-	-	SO:0001583	missense	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1875G>C	6.37:g.32183149C>G	ENSP00000364163:p.Glu625Asp		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.E625D	ENST00000375023.3	37	c.1875	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977944	0.34942	.	.	ENSG00000204301	ENST00000375023	D	0.94897	-3.55	4.23	2.38	0.29361	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.154220	0.30085	N	0.010442	D	0.86531	0.5955	M	0.64997	1.995	0.80722	D	1	B	0.17465	0.022	B	0.14578	0.011	T	0.82384	-0.0484	10	0.51188	T	0.08	.	5.7351	0.18061	0.0:0.692:0.1987:0.1094	.	625	Q99466	NOTC4_HUMAN	D	625	ENSP00000364163:E625D	ENSP00000364163:E625D	E	-	3	2	NOTCH4	32291127	0.021000	0.18746	0.899000	0.35326	0.874000	0.50279	-0.524000	0.06222	0.509000	0.28195	0.561000	0.74099	GAG	NOTCH4	-	smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Notch,pfscan_EG-like_dom	ENSG00000204301		0.552	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	108	0.00	0	C			32183149	32183149	-1	no_errors	ENST00000375023	ensembl	human	known	69_37n	missense	59	31.40	27	SNP	0.881	G
NSUN5	55695	genome.wustl.edu	37	7	72717463	72717463	+	3'UTR	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr7:72717463C>G	ENST00000252594.6	-	0	1435				NSUN5_ENST00000310326.8_Missense_Mutation_p.E449Q|NSUN5_ENST00000438747.2_Missense_Mutation_p.K450N|NSUN5_ENST00000428206.1_3'UTR			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5						rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				GCTGTCTCTTCTTTCTCTTTG	0.577																																						dbGAP											0													91.0	94.0	93.0					7																	72717463		2203	4296	6499	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.*130G>C	7.37:g.72717463C>G			B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.K450N	ENST00000252594.6	37	c.1350	CCDS5547.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	15.16|15.16	2.751989|2.751989	0.49362|0.49362	.|.	.|.	ENSG00000130305|ENSG00000130305	ENST00000310326|ENST00000438747	T|T	0.11930|0.12879	2.73|2.64	3.76|3.76	2.87|2.87	0.33458|0.33458	.|.	.|0.291814	.|0.36703	.|N	.|0.002447	T|T	0.14874|0.14874	0.0359|0.0359	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|P	0.19583|0.51351	0.037|0.944	B|P	0.17098|0.49853	0.017|0.624	T|T	0.07809|0.07809	-1.0753|-1.0753	8|9	0.28530|0.28530	T|T	0.3|0.3	.|.	7.2701|7.2701	0.26252|0.26252	0.0:0.8755:0.0:0.1245|0.0:0.8755:0.0:0.1245	.|.	449|450	B4DP79|Q96P11-2	.|.	Q|N	449|450	ENSP00000309126:E449Q|ENSP00000388464:K450N	ENSP00000309126:E449Q|ENSP00000388464:K450N	E|K	-|-	1|3	0|2	NSUN5|NSUN5	72355399|72355399	0.239000|0.239000	0.23836|0.23836	0.154000|0.154000	0.22540|0.22540	0.569000|0.569000	0.35902|0.35902	0.885000|0.885000	0.28227|0.28227	0.932000|0.932000	0.37266|0.37266	0.281000|0.281000	0.19383|0.19383	GAA|AAG	NSUN5	-	NULL	ENSG00000130305		0.577	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NSUN5	HGNC	protein_coding	OTTHUMT00000252113.1	197	0.00	0	C	NM_148956		72717463	72717463	-1	no_errors	ENST00000438747	ensembl	human	known	69_37n	missense	205	10.48	24	SNP	0.245	G
OBSCN	84033	genome.wustl.edu	37	1	228473949	228473949	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:228473949G>C	ENST00000422127.1	+	34	9219	c.9175G>C	c.(9175-9177)Ggc>Cgc	p.G3059R	OBSCN_ENST00000570156.2_Missense_Mutation_p.G3488R|OBSCN_ENST00000366709.4_Missense_Mutation_p.G178R|OBSCN_ENST00000359599.6_Missense_Mutation_p.G1906R|OBSCN_ENST00000284548.11_Missense_Mutation_p.G3059R|OBSCN_ENST00000366707.4_Missense_Mutation_p.G178R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3059	Ig-like 30.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCAGCCCGGGGGCTACCACGT	0.662																																						dbGAP											0													28.0	35.0	33.0					1																	228473949		2084	4215	6299	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9175G>C	1.37:g.228473949G>C	ENSP00000409493:p.Gly3059Arg		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.G3059R	ENST00000422127.1	37	c.9175	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782030	0.90282	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.67	5.67	0.87782	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.335206	0.29424	N	0.012196	T	0.73745	0.3626	L	0.38953	1.18	0.47584	D	0.999464	D;D	0.76494	0.999;0.998	D;D	0.75020	0.985;0.982	T	0.66368	-0.5941	10	0.15066	T	0.55	.	18.751	0.91814	0.0:0.0:1.0:0.0	.	3059;3059	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	R	3059;3059;178;178;1906	ENSP00000284548:G3059R;ENSP00000409493:G3059R;ENSP00000355668:G178R;ENSP00000355670:G178R;ENSP00000352613:G1906R	ENSP00000284548:G3059R	G	+	1	0	OBSCN	226540572	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	6.296000	0.72751	2.666000	0.90696	0.561000	0.74099	GGC	OBSCN	-	smart_Ig_sub,smart_Ig_sub2	ENSG00000154358		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		65	0.00	0	G	NM_052843		228473949	228473949	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	35	28.57	14	SNP	1.000	C
OBSCN	84033	genome.wustl.edu	37	1	228525020	228525020	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:228525020C>T	ENST00000422127.1	+	66	16780	c.16736C>T	c.(16735-16737)tCa>tTa	p.S5579L	OBSCN_ENST00000570156.2_Missense_Mutation_p.S6536L|OBSCN_ENST00000366709.4_Missense_Mutation_p.S2698L|OBSCN_ENST00000284548.11_Missense_Mutation_p.S5579L|OBSCN_ENST00000366707.4_Missense_Mutation_p.S3213L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5579					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CATGGCCGATCACGGCCATCC	0.647																																						dbGAP											0													23.0	30.0	28.0					1																	228525020		2063	4182	6245	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16736C>T	1.37:g.228525020C>T	ENSP00000409493:p.Ser5579Leu		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.S5579L	ENST00000422127.1	37	c.16736	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119610	0.77323	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.27890	1.64;1.64;1.64;1.64	4.37	4.37	0.52481	.	0.000000	0.64402	D	0.000003	T	0.48519	0.1504	L	0.45581	1.43	0.52099	D	0.999946	D;D	0.89917	1.0;1.0	D;D	0.76575	0.972;0.988	T	0.37384	-0.9708	10	0.35671	T	0.21	.	17.4671	0.87635	0.0:1.0:0.0:0.0	.	5579;5579	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	L	5579;5579;3213;2698	ENSP00000284548:S5579L;ENSP00000409493:S5579L;ENSP00000355668:S3213L;ENSP00000355670:S2698L	ENSP00000284548:S5579L	S	+	2	0	OBSCN	226591643	1.000000	0.71417	0.206000	0.23566	0.031000	0.12232	7.069000	0.76755	2.437000	0.82529	0.655000	0.94253	TCA	OBSCN	-	NULL	ENSG00000154358		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		90	0.00	0	C	NM_052843		228525020	228525020	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	65	22.62	19	SNP	0.981	T
OPRL1	4987	genome.wustl.edu	37	20	62729633	62729633	+	Silent	SNP	C	C	T	rs145287059		TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr20:62729633C>T	ENST00000349451.3	+	6	1006	c.594C>T	c.(592-594)atC>atT	p.I198I	OPRL1_ENST00000355631.4_Silent_p.I198I|OPRL1_ENST00000336866.2_Silent_p.I198I	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	198					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)	p.I198I(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					CTGCAGAGATCGAGTGCCTGG	0.637																																						dbGAP											1	Substitution - coding silent(1)	skin(1)											163.0	133.0	143.0					20																	62729633		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.594C>T	20.37:g.62729633C>T			Q8TD34|Q8WYH9|Q9H4K4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_X_opioid_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Somatstn_rcpt,prints_Neuropept_W_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.I198	ENST00000349451.3	37	c.594	CCDS13556.1	20																																																																																			OPRL1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_X_opioid_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000125510		0.637	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OPRL1	HGNC	protein_coding	OTTHUMT00000080295.1	129	0.77	1	C	NM_182647		62729633	62729633	+1	no_errors	ENST00000336866	ensembl	human	known	69_37n	silent	126	17.65	27	SNP	0.960	T
OR13C9	286362	genome.wustl.edu	37	9	107380401	107380402	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr9:107380401_107380402insA	ENST00000259362.1	-	1	83_84	c.84_85insT	c.(82-87)tttgtgfs	p.V29fs		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						AAGATTAGCACAAAAAAGAGTA	0.396																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.85dupT	9.37:g.107380407_107380407dupA	ENSP00000259362:p.Val29fs		Q6IFL2	Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V28fs	ENST00000259362.1	37	c.85_84	CCDS35093.1	9																																																																																			OR13C9	-	prints_7TM_GPCR_Rhodpsn	ENSG00000136839		0.396	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C9	HGNC	protein_coding	OTTHUMT00000053490.1	73	0.00	0	-			107380401	107380402	-1	no_errors	ENST00000259362	ensembl	human	known	69_37n	frame_shift_ins	68	16.05	13	INS	0.245:0.267	A
PCDH19	57526	genome.wustl.edu	37	X	99551591	99551591	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chrX:99551591C>G	ENST00000373034.4	-	6	4806	c.3131G>C	c.(3130-3132)tGc>tCc	p.C1044S	PCDH19_ENST00000420881.2_Missense_Mutation_p.C996S|PCDH19_ENST00000255531.7_Missense_Mutation_p.C997S|PCDH19_ENST00000464981.1_5'Flank	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1044					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CTTGGGGCTGCAGATGGTCAC	0.592																																						dbGAP											0													59.0	61.0	61.0					X																	99551591		2140	4237	6377	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3131G>C	X.37:g.99551591C>G	ENSP00000362125:p.Cys1044Ser		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.C1044S	ENST00000373034.4	37	c.3131	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	C	11.30	1.599355	0.28534	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.51325	0.71;0.79;0.71	5.73	5.73	0.89815	.	0.049787	0.85682	D	0.000000	T	0.31796	0.0808	N	0.12182	0.205	0.53688	D	0.999977	B;B;B	0.14438	0.01;0.004;0.003	B;B;B	0.06405	0.002;0.001;0.001	T	0.08806	-1.0704	10	0.45353	T	0.12	.	14.273	0.66162	0.0:0.9247:0.0:0.0753	.	1044;997;996	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	S	996;1044;997	ENSP00000400327:C996S;ENSP00000362125:C1044S;ENSP00000255531:C997S	ENSP00000255531:C997S	C	-	2	0	PCDH19	99438247	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.454000	0.60068	2.413000	0.81919	0.600000	0.82982	TGC	PCDH19	-	NULL	ENSG00000165194		0.592	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	94	0.00	0	C	NM_020766		99551591	99551591	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	1.000	G
PCDHA13	56136	genome.wustl.edu	37	5	140263090	140263090	+	Silent	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:140263090C>T	ENST00000289272.2	+	1	1237	c.1237C>T	c.(1237-1239)Ctg>Ttg	p.L413L	PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000409494.1_Silent_p.L413L|PCDHA11_ENST00000398640.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	413	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACAGCGCCCTGGACCGCGA	0.632																																					Melanoma(147;1739 1852 5500 27947 37288)	dbGAP											0													139.0	137.0	137.0					5																	140263090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1237C>T	5.37:g.140263090C>T			O75277	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L413	ENST00000289272.2	37	c.1237	CCDS4240.1	5																																																																																			PCDHA13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000239389		0.632	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	174	0.00	0	C	NM_018904		140263090	140263090	+1	no_errors	ENST00000289272	ensembl	human	known	69_37n	silent	82	41.84	59	SNP	0.233	T
PCDHGA4	56111	genome.wustl.edu	37	5	140736720	140736720	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:140736720G>T	ENST00000571252.1	+	1	1953	c.1953G>T	c.(1951-1953)caG>caT	p.Q651H	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	651	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCATGGCCAGCCCCCTCTCT	0.657																																						dbGAP											0													23.0	29.0	27.0					5																	140736720		2191	4284	6475	-	-	-	SO:0001583	missense	0			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1953G>T	5.37:g.140736720G>T	ENSP00000458570:p.Gln651His		Q9Y5D3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q651H	ENST00000571252.1	37	c.1953	CCDS58979.1	5																																																																																			PCDHGA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000262576		0.657	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	152	0.00	0	G	NM_018917		140736720	140736720	+1	no_errors	ENST00000571252	ensembl	human	known	69_37n	missense	100	25.37	34	SNP	1.000	T
PCLO	27445	genome.wustl.edu	37	7	82764263	82764263	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr7:82764263G>C	ENST00000333891.9	-	3	2940	c.2603C>G	c.(2602-2604)gCc>gGc	p.A868G	PCLO_ENST00000423517.2_Missense_Mutation_p.A868G	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CATTGGCTTGGCATCTGGTTT	0.527																																						dbGAP											0													180.0	182.0	182.0					7																	82764263		1989	4163	6152	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2603C>G	7.37:g.82764263G>C	ENSP00000334319:p.Ala868Gly			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.A868G	ENST00000333891.9	37	c.2603	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548516	0.27652	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.18174	2.23;2.24	6.07	4.23	0.50019	.	.	.	.	.	T	0.16041	0.0386	L	0.44542	1.39	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.10450	0.005;0.005	T	0.02751	-1.1115	9	0.87932	D	0	.	10.2233	0.43209	0.0672:0.2567:0.6761:0.0	.	868;868	Q9Y6V0-5;Q9Y6V0-6	.;.	G	814;868;868	ENSP00000334319:A868G;ENSP00000388393:A868G	ENSP00000334319:A868G	A	-	2	0	PCLO	82602199	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.575000	0.46025	0.852000	0.35287	0.655000	0.94253	GCC	PCLO	-	NULL	ENSG00000186472		0.527	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	232	0.00	0	G	NM_014510		82764263	82764263	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	206	13.03	31	SNP	1.000	C
PDE1B	5153	genome.wustl.edu	37	12	54955245	54955245	+	Intron	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr12:54955245G>C	ENST00000243052.3	+	3	549				PDE1B_ENST00000538346.1_Intron|PDE1B_ENST00000550620.1_5'UTR|PDE1B_ENST00000394277.3_3'UTR	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTGGTCAGTTGCTCAGTTCTA	0.612																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.114-5513G>C	12.37:g.54955245G>C			Q92825|Q96KP3	RNA	SNP	-	NULL	ENST00000243052.3	37	NULL	CCDS8882.1	12																																																																																			PDE1B	-	-	ENSG00000123360		0.612	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	HGNC	protein_coding	OTTHUMT00000406203.1	68	0.00	0	G			54955245	54955245	+1	no_errors	ENST00000394277	ensembl	human	known	69_37n	rna	29	27.50	11	SNP	0.000	C
PDZD7	79955	genome.wustl.edu	37	10	102778804	102778804	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr10:102778804C>G	ENST00000370215.3	-	8	1324	c.1099G>C	c.(1099-1101)Gac>Cac	p.D367H		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	367						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		ATGGCTGTGTCCGCCCGCCCC	0.736											OREG0020453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													4.0	6.0	5.0					10																	102778804		2000	3975	5975	-	-	-	SO:0001583	missense	0			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.1099G>C	10.37:g.102778804C>G	ENSP00000359234:p.Asp367His	1369	D5FJ77|Q8N321	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D367H	ENST00000370215.3	37	c.1099	CCDS31269.1	10	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641163	0.47153	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.11821	2.74	5.21	4.31	0.51392	.	0.607861	0.17004	N	0.190788	T	0.22742	0.0549	L	0.41236	1.265	0.40161	D	0.977065	B;D	0.53151	0.142;0.958	B;P	0.56474	0.03;0.799	T	0.01409	-1.1362	10	0.31617	T	0.26	.	14.0145	0.64517	0.0:0.9264:0.0:0.0736	.	367;367	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	H	367	ENSP00000359234:D367H	ENSP00000359234:D367H	D	-	1	0	PDZD7	102768794	1.000000	0.71417	0.125000	0.21846	0.745000	0.42441	6.809000	0.75211	1.198000	0.43158	0.561000	0.74099	GAC	PDZD7	-	NULL	ENSG00000186862		0.736	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD7	HGNC	protein_coding	OTTHUMT00000049883.1	28	0.00	0	C	NM_024895		102778804	102778804	-1	no_errors	ENST00000370215	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.998	G
PEX1	5189	genome.wustl.edu	37	7	92122351	92122351	+	Silent	SNP	G	G	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr7:92122351G>T	ENST00000248633.4	-	20	3218	c.3123C>A	c.(3121-3123)tcC>tcA	p.S1041S	AC007566.10_ENST00000427458.1_RNA|PEX1_ENST00000428214.1_Silent_p.S984S|PEX1_ENST00000438045.1_Silent_p.S719S|AC007566.10_ENST00000441539.1_RNA	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1041					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CTCCAGTAAAGGAGTCAGTTA	0.448																																						dbGAP											0													133.0	128.0	130.0					7																	92122351		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3123C>A	7.37:g.92122351G>T			A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Silent	SNP	pfam_ATPase_AAA_core,pfam_Peroxisome_synth_fac_1_a/b,pfam_PEX-1N,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase	p.S1041	ENST00000248633.4	37	c.3123	CCDS5627.1	7																																																																																			PEX1	-	NULL	ENSG00000127980		0.448	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX1	HGNC	protein_coding	OTTHUMT00000254066.3	31	0.00	0	G	NM_000466		92122351	92122351	-1	no_errors	ENST00000248633	ensembl	human	known	69_37n	silent	33	34.62	18	SNP	0.702	T
PHRF1	57661	genome.wustl.edu	37	11	611789	611789	+	3'UTR	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr11:611789C>T	ENST00000264555.5	+	0	5090				PHRF1_ENST00000413872.2_3'UTR|PHRF1_ENST00000416188.2_3'UTR|PHRF1_ENST00000533464.1_3'UTR	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1						mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GCCAGGCAATCACGGGCTATG	0.706																																						dbGAP											0													15.0	19.0	18.0					11																	611789		1922	4108	6030	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.*12C>T	11.37:g.611789C>T			A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	RNA	SNP	-	NULL	ENST00000264555.5	37	NULL		11																																																																																			PHRF1	-	-	ENSG00000070047		0.706	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	HGNC	protein_coding	OTTHUMT00000382133.1	82	0.00	0	C	NM_020901		611789	611789	+1	no_errors	ENST00000525848	ensembl	human	putative	69_37n	rna	61	26.51	22	SNP	0.000	T
PINK1	65018	genome.wustl.edu	37	1	20964358	20964358	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:20964358G>T	ENST00000321556.4	+	2	505	c.411G>T	c.(409-411)aaG>aaT	p.K137N		NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	137					activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGAAAAGCAAGCCGGGGCCTG	0.557																																					Esophageal Squamous(145;853 1803 8146 34412 35011)	dbGAP											0													66.0	74.0	72.0					1																	20964358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.411G>T	1.37:g.20964358G>T	ENSP00000364204:p.Lys137Asn		Q8N6T9|Q8NBU3|Q96DE4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K137N	ENST00000321556.4	37	c.411	CCDS211.1	1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461309	0.43736	.	.	ENSG00000158828	ENST00000321556	T	0.76839	-1.05	5.34	3.44	0.39384	.	0.264714	0.42821	D	0.000646	T	0.77877	0.4196	L	0.59436	1.845	0.38541	D	0.94922	D	0.59767	0.986	P	0.53266	0.722	T	0.77993	-0.2378	10	0.42905	T	0.14	-5.841	7.3576	0.26727	0.1947:0.0:0.8053:0.0	.	137	Q9BXM7	PINK1_HUMAN	N	137	ENSP00000364204:K137N	ENSP00000364204:K137N	K	+	3	2	PINK1	20836945	0.999000	0.42202	0.991000	0.47740	0.059000	0.15707	1.978000	0.40598	1.381000	0.46364	0.555000	0.69702	AAG	PINK1	-	NULL	ENSG00000158828		0.557	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PINK1	HGNC	protein_coding	OTTHUMT00000007954.1	71	0.00	0	G	NM_032409		20964358	20964358	+1	no_errors	ENST00000321556	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.977	T
PLCG2	5336	genome.wustl.edu	37	16	81914540	81914540	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr16:81914540C>A	ENST00000359376.3	+	8	888	c.674C>A	c.(673-675)tCg>tAg	p.S225*		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	225					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						AAAAAGGATTCGTCCGTGTTC	0.507																																						dbGAP											0													128.0	126.0	127.0					16																	81914540		1956	4139	6095	-	-	-	SO:0001587	stop_gained	0				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.674C>A	16.37:g.81914540C>A	ENSP00000352336:p.Ser225*		D3DUL3|Q3ZTS2|Q59H45|Q969T5	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_Ca-dep,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pirsf_PLC-gamma,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.S225*	ENST00000359376.3	37	c.674	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	C	39	7.305020	0.98200	.	.	ENSG00000197943	ENST00000359376	.	.	.	5.48	5.48	0.80851	.	0.111739	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2671	0.82593	0.0:1.0:0.0:0.0	.	.	.	.	X	225	.	ENSP00000352336:S225X	S	+	2	0	PLCG2	80472041	1.000000	0.71417	0.919000	0.36401	0.969000	0.65631	5.818000	0.69236	2.571000	0.86741	0.491000	0.48974	TCG	PLCG2	-	pirsf_PLC-gamma	ENSG00000197943		0.507	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	HGNC	protein_coding	OTTHUMT00000432429.1	99	0.00	0	C			81914540	81914540	+1	no_errors	ENST00000359376	ensembl	human	known	69_37n	nonsense	107	18.32	24	SNP	0.988	A
PPIL2	23759	genome.wustl.edu	37	22	22024612	22024612	+	Intron	SNP	T	T	G	rs527821877		TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr22:22024612T>G	ENST00000335025.8	+	3	173				PPIL2_ENST00000492445.2_Intron|PPIL2_ENST00000456792.2_Intron|PPIL2_ENST00000398831.3_Intron|PPIL2_ENST00000406385.1_Intron|PPIL2_ENST00000412327.1_Intron					peptidylprolyl isomerase (cyclophilin)-like 2											endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					AAGACTACAATAACAAGAGCA	0.274																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.83-243T>G	22.37:g.22024612T>G				Missense_Mutation	SNP	NULL	p.I36R	ENST00000335025.8	37	c.107	CCDS13793.1	22																																																																																			PPIL2	-	NULL	ENSG00000100023		0.274	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL2	HGNC	protein_coding	OTTHUMT00000075028.4	46	0.00	0	T			22024612	22024612	+1	no_errors	ENST00000417788	ensembl	human	known	69_37n	missense	49	27.94	19	SNP	0.009	G
PRELP	5549	genome.wustl.edu	37	1	203453039	203453039	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:203453039G>A	ENST00000343110.2	+	2	854	c.727G>A	c.(727-729)Gcc>Acc	p.A243T		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	243					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			GGTCCCCACCGCCATTCACCA	0.532																																						dbGAP											0													152.0	149.0	150.0					1																	203453039		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.727G>A	1.37:g.203453039G>A	ENSP00000343924:p.Ala243Thr		Q6FG38	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.A243T	ENST00000343110.2	37	c.727	CCDS1438.1	1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461040	0.26248	.	.	ENSG00000188783	ENST00000343110	T	0.04317	3.65	4.77	3.84	0.44239	.	0.198980	0.43579	D	0.000560	T	0.02929	0.0087	N	0.20530	0.585	0.34548	D	0.710993	B	0.33883	0.43	B	0.24155	0.051	T	0.50189	-0.8857	10	0.29301	T	0.29	-8.4347	8.8921	0.35441	0.0:0.1638:0.6667:0.1695	.	243	P51888	PRELP_HUMAN	T	243	ENSP00000343924:A243T	ENSP00000343924:A243T	A	+	1	0	PRELP	201719662	0.157000	0.22836	0.640000	0.29408	0.677000	0.39632	2.884000	0.48562	0.982000	0.38575	0.462000	0.41574	GCC	PRELP	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000188783		0.532	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRELP	HGNC	protein_coding	OTTHUMT00000087474.1	54	0.00	0	G	NM_002725		203453039	203453039	+1	no_errors	ENST00000343110	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	0.890	A
PRLHR	2834	genome.wustl.edu	37	10	120354540	120354540	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr10:120354540C>G	ENST00000369169.1	-	1	216	c.217G>C	c.(217-219)Gtg>Ctg	p.V73L	PRLHR_ENST00000239032.2_Missense_Mutation_p.V73L			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	73					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		ACCAGCCCCACGACCACCACG	0.667																																						dbGAP											0													87.0	80.0	82.0					10																	120354540		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.217G>C	10.37:g.120354540C>G	ENSP00000358167:p.Val73Leu		O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Prolrel_pep_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.V73L	ENST00000369169.1	37	c.217	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326464	0.41197	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.36520	1.25;1.25	4.97	4.03	0.46877	.	0.210157	0.40554	N	0.001069	T	0.14527	0.0351	N	0.08118	0	0.44432	D	0.997353	B	0.26002	0.139	B	0.24974	0.057	T	0.14172	-1.0482	10	0.10636	T	0.68	.	5.3693	0.16131	0.1643:0.6432:0.0:0.1925	.	73	P49683	PRLHR_HUMAN	L	73	ENSP00000239032:V73L;ENSP00000358167:V73L	ENSP00000239032:V73L	V	-	1	0	PRLHR	120344530	0.935000	0.31712	1.000000	0.80357	0.998000	0.95712	1.648000	0.37271	2.578000	0.87016	0.655000	0.94253	GTG	PRLHR	-	pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn	ENSG00000119973		0.667	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	HGNC	protein_coding	OTTHUMT00000050610.1	132	0.00	0	C	NM_004248		120354540	120354540	-1	no_errors	ENST00000239032	ensembl	human	known	69_37n	missense	85	33.07	42	SNP	1.000	G
PRSS55	203074	genome.wustl.edu	37	8	10386925	10386925	+	Intron	SNP	G	G	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr8:10386925G>T	ENST00000328655.3	+	2	194				PRSS51_ENST00000523024.1_RNA|PRSS55_ENST00000522210.1_Intron	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						tatccacttggaagCCTGCTC	0.542																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.155-92G>T	8.37:g.10386925G>T			E5RJX5	Nonsense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.E2*	ENST00000328655.3	37	c.4	CCDS5976.1	8																																																																																			PRSS55	-	NULL	ENSG00000184647		0.542	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS55	HGNC	protein_coding	OTTHUMT00000251493.3	45	0.00	0	G	NM_198464		10386925	10386925	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000518641	ensembl	human	known	69_37n	nonsense	16	57.89	22	SNP	0.000	T
PRUNE2	158471	genome.wustl.edu	37	9	79325845	79325845	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr9:79325845C>T	ENST00000376718.3	-	8	1468	c.1345G>A	c.(1345-1347)Gac>Aac	p.D449N	PRUNE2_ENST00000428286.1_Missense_Mutation_p.D90N	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	449					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						ACGGGGCTGTCGTCACTGAGG	0.602																																						dbGAP											0													45.0	41.0	43.0					9																	79325845		1568	3582	5150	-	-	-	SO:0001583	missense	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.1345G>A	9.37:g.79325845C>T	ENSP00000365908:p.Asp449Asn		B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.D90N	ENST00000376718.3	37	c.268	CCDS47982.1	9	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601795	0.87055	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.71461	-0.44;-0.57	5.88	5.88	0.94601	.	0.000000	0.56097	D	0.000038	T	0.80171	0.4574	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80888	-0.1181	10	0.87932	D	0	-21.2034	20.2228	0.98330	0.0:1.0:0.0:0.0	.	449	Q8WUY3	PRUN2_HUMAN	N	449;90;448	ENSP00000365908:D449N;ENSP00000397425:D90N	ENSP00000365908:D449N	D	-	1	0	PRUNE2	78515665	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	6.998000	0.76277	2.789000	0.95967	0.655000	0.94253	GAC	PRUNE2	-	NULL	ENSG00000106772		0.602	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	95	0.00	0	C	NM_138818		79325845	79325845	-1	no_errors	ENST00000428286	ensembl	human	known	69_37n	missense	67	11.84	9	SNP	1.000	T
PTGER2	5732	genome.wustl.edu	37	14	52782109	52782109	+	Splice_Site	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr14:52782109G>A	ENST00000245457.5	+	1	997	c.843G>A	c.(841-843)acG>acA	p.T281T	PTGER2_ENST00000557436.1_Splice_Site_p.T26T	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	281					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TGCCTTTCACGGTAAGTCACT	0.582																																						dbGAP											0													38.0	42.0	41.0					14																	52782109		2202	4297	6499	-	-	-	SO:0001630	splice_region_variant	0				CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.843+1G>A	14.37:g.52782109G>A			D3DSC0|Q52LG8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP2_rcpt,prints_Prostanoid_rcpt,prints_7TM_GPCR_Rhodpsn	p.T281	ENST00000245457.5	37	c.843	CCDS9708.1	14																																																																																			PTGER2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP2_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000125384		0.582	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGER2	HGNC	protein_coding	OTTHUMT00000276890.1	52	0.00	0	G		Silent	52782109	52782109	+1	no_errors	ENST00000245457	ensembl	human	known	69_37n	silent	30	36.17	17	SNP	0.882	A
PTPRN2	5799	genome.wustl.edu	37	7	158282452	158282452	+	Silent	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr7:158282452G>A	ENST00000389418.4	-	2	147	c.138C>T	c.(136-138)tgC>tgT	p.C46C	PTPRN2_ENST00000404321.2_Silent_p.C69C|PTPRN2_ENST00000389413.3_Silent_p.C46C|PTPRN2_ENST00000389416.4_Intron|PTPRN2_ENST00000409483.1_Silent_p.C46C	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	46					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CGGACGCTCCGCAGAGGCCCT	0.721																																						dbGAP											0													19.0	18.0	18.0					7																	158282452		2169	4272	6441	-	-	-	SO:0001819	synonymous_variant	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.138C>T	7.37:g.158282452G>A			E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.C69	ENST00000389418.4	37	c.207	CCDS5947.1	7																																																																																			PTPRN2	-	NULL	ENSG00000155093		0.721	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	27	0.00	0	G			158282452	158282452	-1	no_errors	ENST00000404321	ensembl	human	known	69_37n	silent	13	40.91	9	SNP	0.487	A
RBM19	9904	genome.wustl.edu	37	12	114383699	114383700	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr12:114383699_114383700CC>AG	ENST00000545145.2	-	13	1637_1638	c.1559_1560GG>CT	c.(1558-1560)gGG>gCT	p.G520A	RBM19_ENST00000392561.3_Missense_Mutation_p.G520A|RBM19_ENST00000261741.5_Missense_Mutation_p.G520A	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	520					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CGGCATTCGGCCCCATGAATAG	0.55																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1559_1560delinsAG	12.37:g.114383699_114383700delinsAG	ENSP00000442053:p.Gly520Ala		A8K5X9|Q9BPY6|Q9UFN5	Silent|Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.G520|p.G520A	ENST00000545145.2	37	c.1560|c.1559	CCDS9172.1	12																																																																																			RBM19	-	NULL	ENSG00000122965		0.550	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	101|102	0.00	0	C	NM_016196		114383699|114383700	114383699|114383700	-1	no_errors	ENST00000261741	ensembl	human	known	69_37n	silent|missense	62|63	27.91|27.59	24	SNP	0.995|1.000	A|G
RBM22	55696	genome.wustl.edu	37	5	150080199	150080199	+	Intron	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:150080199C>T	ENST00000199814.4	-	2	176				RBM22_ENST00000447771.2_Intron|RBM22_ENST00000540000.1_Intron	NM_018047.2	NP_060517.1	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22						cellular response to drug (GO:0035690)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of RNA splicing (GO:0033120)|protein import into nucleus, translocation (GO:0000060)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|snRNA binding (GO:0017069)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(1)	17		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACGACCCGATCGCGGGAGGGG	0.647											OREG0016939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL136933	CCDS34278.1	5q33.1	2013-02-12			ENSG00000086589	ENSG00000086589		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	25503	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 47"""	612430				20013661, 19133299	Standard	NM_018047		Approved	FLJ10290, ZC3H16, fSAP47, Cwc2	uc031slu.1	Q9NW64	OTTHUMG00000163589	ENST00000199814.4:c.55-140G>A	5.37:g.150080199C>T		1730	A6NDM5|B4DLI9|O95607	Missense_Mutation	SNP	NULL	p.R91Q	ENST00000199814.4	37	c.272	CCDS34278.1	5	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723236	0.30503	.	.	ENSG00000086589	ENST00000521464	.	.	.	5.0	4.13	0.48395	.	.	.	.	.	T	0.63663	0.2530	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61724	-0.7004	4	.	.	.	.	12.6477	0.56744	0.0:0.8335:0.1665:0.0	.	.	.	.	Q	91	.	.	R	-	2	0	RBM22	150060392	0.000000	0.05858	0.907000	0.35723	0.486000	0.33341	-0.033000	0.12246	1.119000	0.41883	-0.258000	0.10820	CGA	RBM22	-	NULL	ENSG00000086589		0.647	RBM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM22	HGNC	protein_coding	OTTHUMT00000374431.2	11	0.00	0	C	NM_018047		150080199	150080199	-1	no_stop_codon	ENST00000521464	ensembl	human	putative	69_37n	missense	9	35.71	5	SNP	0.711	T
RNF213	57674	genome.wustl.edu	37	17	78311419	78311419	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr17:78311419A>G	ENST00000582970.1	+	24	4704	c.4561A>G	c.(4561-4563)Act>Gct	p.T1521A	RNF213_ENST00000336301.6_5'Flank|RNF213_ENST00000508628.2_Missense_Mutation_p.T1570A	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1521					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ATGGCTGAAGACTGTGAATGA	0.567																																						dbGAP											0													54.0	49.0	50.0					17																	78311419		692	1591	2283	-	-	-	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.4561A>G	17.37:g.78311419A>G	ENSP00000464087:p.Thr1521Ala		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.T1521A	ENST00000582970.1	37	c.4561	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	A	11.63	1.696887	0.30142	.	.	ENSG00000173821	ENST00000508628;ENST00000411702	.	.	.	4.96	3.86	0.44501	.	.	.	.	.	T	0.61009	0.2313	L	0.48642	1.525	0.80722	D	1	.	.	.	.	.	.	T	0.61797	-0.6989	6	0.66056	D	0.02	.	11.797	0.52106	0.8527:0.1473:0.0:0.0	.	.	.	.	A	1521;1570	.	ENSP00000396478:T1570A	T	+	1	0	RNF213	75926014	1.000000	0.71417	0.324000	0.25361	0.674000	0.39518	6.206000	0.72154	0.725000	0.32318	0.459000	0.35465	ACT	RNF213	-	NULL	ENSG00000173821		0.567	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	42	0.00	0	A	NM_020914		78311419	78311419	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.997	G
RPS6KA6	27330	genome.wustl.edu	37	X	83352800	83352800	+	Silent	SNP	A	A	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chrX:83352800A>T	ENST00000262752.2	-	19	1840	c.1833T>A	c.(1831-1833)ctT>ctA	p.L611L	RPS6KA6_ENST00000495332.1_5'UTR|RPS6KA6_ENST00000543399.1_Silent_p.L611L	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	611	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L611L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TTGTGTAAAAAAGGACTCCTA	0.308																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											129.0	125.0	126.0					X																	83352800		2203	4294	6497	-	-	-	SO:0001819	synonymous_variant	0			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1833T>A	X.37:g.83352800A>T			B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	p.L611	ENST00000262752.2	37	c.1833	CCDS14451.1	X																																																																																			RPS6KA6	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000072133		0.308	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	HGNC	protein_coding	OTTHUMT00000057372.1	122	0.00	0	A	NM_014496		83352800	83352800	-1	no_errors	ENST00000262752	ensembl	human	known	69_37n	silent	87	20.18	22	SNP	0.995	T
RRBP1	6238	genome.wustl.edu	37	20	17639638	17639638	+	Silent	SNP	G	G	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr20:17639638G>T	ENST00000377813.1	-	3	1818	c.1515C>A	c.(1513-1515)gcC>gcA	p.A505A	RRBP1_ENST00000246043.4_Silent_p.A505A|RRBP1_ENST00000360807.4_Intron|RRBP1_ENST00000377807.2_Intron|RRBP1_ENST00000455029.2_Intron			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	505	41 X 10 AA approximate tandem repeats of [TN]-Q-[GSA]-[KRQT]-K-[ATGSV]-[ED]- [GTAS]-[ATIS]-[PQTAS].				osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						CCTGGTTCTGGGCTCCCTCGG	0.587																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.1515C>A	20.37:g.17639638G>T			A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.A505	ENST00000377813.1	37	c.1515		20																																																																																			RRBP1	-	NULL	ENSG00000125844		0.587	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	314	0.00	0	G	NM_001042576		17639638	17639638	-1	no_errors	ENST00000246043	ensembl	human	known	69_37n	silent	279	21.19	75	SNP	0.000	T
SENP1	29843	genome.wustl.edu	37	12	48439119	48439119	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr12:48439119G>A	ENST00000004980.5	-	18	2399	c.1921C>T	c.(1921-1923)Cga>Tga	p.R641*	SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000551330.1_Nonsense_Mutation_p.R641*|SENP1_ENST00000549518.1_Nonsense_Mutation_p.R641*|SENP1_ENST00000448372.1_Nonsense_Mutation_p.R640*|SENP1_ENST00000549595.1_Nonsense_Mutation_p.R640*			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	641					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				AAGAGTTTTCGGTGGAGGATC	0.502																																						dbGAP											0													113.0	116.0	115.0					12																	48439119		1962	4165	6127	-	-	-	SO:0001587	stop_gained	0			AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.1921C>T	12.37:g.48439119G>A	ENSP00000004980:p.Arg641*		A8K7P5|Q86XC8	Nonsense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.R641*	ENST00000004980.5	37	c.1921	CCDS44868.2	12	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406971	0.83230	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518	.	.	.	5.74	2.52	0.30459	.	0.158649	0.47093	D	0.000255	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.2339	14.1775	0.65552	0.0:0.0:0.5561:0.4439	.	.	.	.	X	641;640;641;640;641	.	ENSP00000004980:R641X	R	-	1	2	SENP1	46725386	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.234000	0.51320	0.603000	0.29913	0.655000	0.94253	CGA	SENP1	-	NULL	ENSG00000079387		0.502	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP1	HGNC	protein_coding	OTTHUMT00000406471.1	110	0.00	0	G	NM_014554		48439119	48439119	-1	no_errors	ENST00000004980	ensembl	human	known	69_37n	nonsense	79	16.84	16	SNP	1.000	A
SEPT8	23176	genome.wustl.edu	37	5	132109742	132109742	+	Intron	SNP	G	G	A	rs30527	byFrequency	TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:132109742G>A	ENST00000378719.2	-	1	268				SEPT8_ENST00000378706.1_Intron|SEPT8_ENST00000448933.1_Intron|SEPT8_ENST00000458488.2_Intron|SEPT8_ENST00000378699.2_Intron|SEPT8_ENST00000378721.4_Intron|SEPT8_ENST00000296873.7_Intron|SEPT8_ENST00000378701.1_Intron	NM_001098811.1	NP_001092281.1	Q92599	SEPT8_HUMAN	septin 8						cell cycle (GO:0007049)	septin complex (GO:0031105)	GTP binding (GO:0005525)		SEPT8/AFF4(2)	kidney(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCTACTGGCCGTTTTTACAAG	0.557													G|||	2440	0.48722	0.8873	0.3156	5008	,	,		20305	0.7292		0.1451	False		,,,				2504	0.1708					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF179995	CCDS43358.1, CCDS43359.1, CCDS43360.1, CCDS47262.1, CCDS75298.1	5q31	2013-01-21			ENSG00000164402	ENSG00000164402		"""Septins"""	16511	protein-coding gene	gene with protein product		608418				9039502, 9149945	Standard	NM_001098812		Approved	KIAA0202, SEP2	uc003kxr.2	Q92599	OTTHUMG00000059735	ENST00000378719.2:c.30+3057C>T	5.37:g.132109742G>A			A6NC65|A6NKP6|F6W7K9|Q8IX36|Q8IX37|Q9BVB3	RNA	SNP	-	NULL	ENST00000378719.2	37	NULL	CCDS43358.1	5																																																																																			SEPT8	-	-	ENSG00000164402		0.557	SEPT8-002	KNOWN	basic|CCDS	protein_coding	SEPT8	HGNC	protein_coding	OTTHUMT00000132827.2	57	0.00	0	G	XM_034872		132109742	132109742	-1	no_errors	ENST00000492490	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.059	A
SIN3A	25942	genome.wustl.edu	37	15	75664516	75664516	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr15:75664516C>T	ENST00000394947.3	-	21	3940	c.3626G>A	c.(3625-3627)aGa>aAa	p.R1209K	RP11-817O13.8_ENST00000563278.1_lincRNA|SIN3A_ENST00000394949.4_Missense_Mutation_p.R1209K|SIN3A_ENST00000360439.4_Missense_Mutation_p.R1209K	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						GGCCTGGAATCTCTGATGTAG	0.473																																						dbGAP											0													133.0	128.0	130.0					15																	75664516		2197	4294	6491	-	-	-	SO:0001583	missense	0			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.3626G>A	15.37:g.75664516C>T	ENSP00000378402:p.Arg1209Lys			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.R1209K	ENST00000394947.3	37	c.3626	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692771	0.48202	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.44881	0.91;0.91;0.91	5.17	5.17	0.71159	.	0.047559	0.85682	D	0.000000	T	0.37945	0.1022	L	0.45422	1.42	0.80722	D	1	B	0.29988	0.264	B	0.29942	0.109	T	0.13415	-1.0510	10	0.23891	T	0.37	-17.1438	17.6426	0.88140	0.0:1.0:0.0:0.0	.	1209	Q96ST3	SIN3A_HUMAN	K	1209	ENSP00000378402:R1209K;ENSP00000378403:R1209K;ENSP00000353622:R1209K	ENSP00000353622:R1209K	R	-	2	0	SIN3A	73451569	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.742000	0.85008	2.415000	0.81967	0.484000	0.47621	AGA	SIN3A	-	NULL	ENSG00000169375		0.473	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	HGNC	protein_coding	OTTHUMT00000286469.1	57	0.00	0	C	NM_015477		75664516	75664516	-1	no_errors	ENST00000360439	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	1.000	T
SLC13A5	284111	genome.wustl.edu	37	17	6594168	6594168	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr17:6594168A>G	ENST00000433363.2	-	10	1600	c.1367T>C	c.(1366-1368)gTt>gCt	p.V456A	SLC13A5_ENST00000381074.4_Missense_Mutation_p.V413A|SLC13A5_ENST00000573648.1_Missense_Mutation_p.V456A|SLC13A5_ENST00000293800.6_Missense_Mutation_p.V439A	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	456					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						GAACACGGCAACGAGCAAGGA	0.607																																						dbGAP											0													231.0	200.0	210.0					17																	6594168		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.1367T>C	17.37:g.6594168A>G	ENSP00000406220:p.Val456Ala		B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.V456A	ENST00000433363.2	37	c.1367	CCDS11079.1	17	.	.	.	.	.	.	.	.	.	.	A	13.49	2.253666	0.39797	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T	0.03413	3.94;3.94	4.8	3.72	0.42706	.	0.349076	0.31484	N	0.007579	T	0.08403	0.0209	L	0.45698	1.435	0.22096	N	0.999368	P;P;B;B	0.40032	0.582;0.699;0.365;0.438	P;P;P;P	0.52481	0.7;0.492;0.524;0.472	T	0.07214	-1.0784	10	0.49607	T	0.09	.	8.8372	0.35119	0.9089:0.0:0.0911:0.0	.	456;413;439;456	B7ZLB4;F8W7N2;B3KXR0;Q86YT5	.;.;.;S13A5_HUMAN	A	456;456;413	ENSP00000406220:V456A;ENSP00000370464:V413A	ENSP00000293800:V456A	V	-	2	0	SLC13A5	6534892	0.301000	0.24444	0.026000	0.17262	0.175000	0.22909	4.572000	0.60886	0.791000	0.33826	0.533000	0.62120	GTT	SLC13A5	-	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	ENSG00000141485		0.607	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A5	HGNC	protein_coding	OTTHUMT00000219853.2	103	0.00	0	A	NM_177550		6594168	6594168	-1	no_errors	ENST00000433363	ensembl	human	known	69_37n	missense	48	29.41	20	SNP	0.585	G
SLC18A3	6572	genome.wustl.edu	37	10	50819842	50819842	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr10:50819842delC	ENST00000374115.3	+	1	1496	c.1056delC	c.(1054-1056)tacfs	p.Y352fs	CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000337653.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	352					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						CGGCGCGCTACCCACACCTGC	0.701																																						dbGAP											0													54.0	55.0	55.0					10																	50819842		2202	4296	6498	-	-	-	SO:0001589	frameshift_variant	0			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1056delC	10.37:g.50819842delC	ENSP00000363229:p.Tyr352fs		B2R7S1	Frame_Shift_Del	DEL	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P353fs	ENST00000374115.3	37	c.1056	CCDS7231.1	10																																																																																			SLC18A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000187714		0.701	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A3	HGNC	protein_coding	OTTHUMT00000047995.1	109	0.00	0	C	NM_003055		50819842	50819842	+1	no_errors	ENST00000374115	ensembl	human	known	69_37n	frame_shift_del	42	33.33	21	DEL	1.000	-
SLC35F1	222553	genome.wustl.edu	37	6	118635248	118635248	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr6:118635248T>A	ENST00000360388.4	+	8	1261	c.1060T>A	c.(1060-1062)Tcc>Acc	p.S354T		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	354					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		GGTGCTCTACTCCTCCACCTC	0.498																																						dbGAP											0													187.0	162.0	170.0					6																	118635248		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.1060T>A	6.37:g.118635248T>A	ENSP00000353557:p.Ser354Thr		E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Missense_Mutation	SNP	pfam_DUF914_euk,pfam_DMT	p.S354T	ENST00000360388.4	37	c.1060	CCDS34524.1	6	.	.	.	.	.	.	.	.	.	.	T	14.87	2.663322	0.47572	.	.	ENSG00000196376	ENST00000360388	.	.	.	5.71	5.71	0.89125	.	0.193544	0.46442	D	0.000284	T	0.53029	0.1771	L	0.46670	1.46	0.45733	D	0.99863	B	0.32862	0.387	P	0.44921	0.464	T	0.53878	-0.8376	9	0.23302	T	0.38	-9.8455	15.9822	0.80121	0.0:0.0:0.0:1.0	.	354	Q5T1Q4	S35F1_HUMAN	T	354	.	ENSP00000353557:S354T	S	+	1	0	SLC35F1	118741941	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.097000	0.64542	2.186000	0.69663	0.533000	0.62120	TCC	SLC35F1	-	pfam_DUF914_euk,pfam_DMT	ENSG00000196376		0.498	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F1	HGNC	protein_coding	OTTHUMT00000041991.2	144	0.00	0	T	XM_167044		118635248	118635248	+1	no_errors	ENST00000360388	ensembl	human	known	69_37n	missense	117	11.85	16	SNP	1.000	A
SLC50A1	55974	genome.wustl.edu	37	1	155109407	155109407	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:155109407C>G	ENST00000368404.4	+	3	324	c.262C>G	c.(262-264)Ctg>Gtg	p.L88V	SLC50A1_ENST00000303343.8_Missense_Mutation_p.L88V|SLC50A1_ENST00000368401.5_Intron|SLC50A1_ENST00000484157.1_Intron|SLC50A1_ENST00000368405.3_Intron	NM_018845.3	NP_061333.2	Q9BRV3	SWET1_HUMAN	solute carrier family 50 (sugar efflux transporter), member 1	88	MtN3/slv 1.				carbohydrate transport (GO:0008643)|DNA recombination (GO:0006310)|glucoside transport (GO:0042946)|positive regulation of gene expression, epigenetic (GO:0045815)	endomembrane system (GO:0012505)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucoside transmembrane transporter activity (GO:0042947)			endometrium(1)|lung(1)|ovary(1)|skin(1)	4						CTTGGCATATCTGCATTACTG	0.562																																						dbGAP											0													119.0	111.0	114.0					1																	155109407		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126023, AF126024	CCDS1093.1, CCDS44238.1, CCDS44239.1, CCDS72929.1, CCDS72930.1	1q22	2013-07-17	2013-07-17	2010-11-30	ENSG00000169241	ENSG00000169241		"""Solute carriers"""	30657	protein-coding gene	gene with protein product	"""stromal cell protein"""	613683	"""recombination activating gene 1 activating protein 1"""	RAG1AP1		21107422	Standard	NM_018845		Approved	SCP, RP11-540D14.5, slv, RZPDo834D038D, HsSWEET1, SWEET1	uc001fhj.4	Q9BRV3	OTTHUMG00000035333	ENST00000368404.4:c.262C>G	1.37:g.155109407C>G	ENSP00000357389:p.Leu88Val		Q5SR64|Q6IAK6|Q96DC5|Q9UHQ2|Q9UHQ3	Missense_Mutation	SNP	pfam_SWEET_sugar_transpr	p.L88V	ENST00000368404.4	37	c.262	CCDS1093.1	1	.	.	.	.	.	.	.	.	.	.	C	10.09	1.255589	0.22965	.	.	ENSG00000169241	ENST00000303343;ENST00000368404	.	.	.	4.99	4.07	0.47477	.	0.496858	0.20707	N	0.087172	T	0.32823	0.0842	L	0.53249	1.67	0.80722	D	1	B;B	0.21821	0.061;0.003	B;B	0.21151	0.033;0.013	T	0.20371	-1.0277	9	0.32370	T	0.25	-1.8291	8.7657	0.34702	0.1708:0.6641:0.1651:0.0	.	88;88	Q9BRV3-3;Q9BRV3	.;SWET1_HUMAN	V	88	.	ENSP00000306146:L88V	L	+	1	2	SLC50A1	153376031	0.260000	0.24053	0.991000	0.47740	0.409000	0.31022	0.534000	0.23098	1.212000	0.43366	0.655000	0.94253	CTG	SLC50A1	-	pfam_SWEET_sugar_transpr	ENSG00000169241		0.562	SLC50A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC50A1	HGNC	protein_coding	OTTHUMT00000085505.1	77	0.00	0	C	NM_018845		155109407	155109407	+1	no_errors	ENST00000368404	ensembl	human	known	69_37n	missense	64	13.51	10	SNP	0.990	G
SSBP4	170463	genome.wustl.edu	37	19	18538177	18538177	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr19:18538177T>G	ENST00000270061.7	+	2	370	c.76T>G	c.(76-78)Tat>Gat	p.Y26D	SSBP4_ENST00000598159.2_3'UTR|SSBP4_ENST00000348495.6_Missense_Mutation_p.Y26D	NM_032627.4	NP_116016.1	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4	26	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.					nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|skin(1)	4						GCTGTACGTTTATGAGTACCT	0.642																																						dbGAP											0													60.0	52.0	55.0					19																	18538177		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12378.1, CCDS32960.1	19p13.1	2008-02-05				ENSG00000130511			15676	protein-coding gene	gene with protein product		607391				12079286	Standard	NM_032627		Approved		uc002niy.3	Q9BWG4		ENST00000270061.7:c.76T>G	19.37:g.18538177T>G	ENSP00000270061:p.Tyr26Asp		Q9BWW5	Missense_Mutation	SNP	pfam_SSDP_ss-bd,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_SSDP_DNA-bd	p.Y26D	ENST00000270061.7	37	c.76	CCDS12378.1	19	.	.	.	.	.	.	.	.	.	.	T	16.00	2.997194	0.54147	.	.	ENSG00000130511	ENST00000270061;ENST00000348495	.	.	.	3.8	2.73	0.32206	LisH dimerisation motif (2);	0.000000	0.56097	U	0.000034	T	0.69450	0.3112	M	0.72894	2.215	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.67760	-0.5587	9	0.87932	D	0	-7.6218	5.9803	0.19403	0.231:0.0:0.0:0.769	.	26;26	Q9BWW5;Q9BWG4	.;SSBP4_HUMAN	D	26	.	ENSP00000270061:Y26D	Y	+	1	0	SSBP4	18399177	0.996000	0.38824	0.071000	0.20095	0.076000	0.17211	3.563000	0.53784	0.473000	0.27368	0.459000	0.35465	TAT	SSBP4	-	smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_SSDP_DNA-bd	ENSG00000130511		0.642	SSBP4-002	KNOWN	basic|CCDS	protein_coding	SSBP4	HGNC	protein_coding	OTTHUMT00000466348.3	87	0.00	0	T	NM_032627		18538177	18538177	+1	no_errors	ENST00000270061	ensembl	human	known	69_37n	missense	65	26.14	23	SNP	0.733	G
TMEM132E	124842	genome.wustl.edu	37	17	32953382	32953382	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr17:32953382G>T	ENST00000321639.5	+	2	632	c.304G>T	c.(304-306)Gtg>Ttg	p.V102L		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	102						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		CACCAGCCAGGTGGTGGCGCG	0.672																																						dbGAP											0													28.0	26.0	26.0					17																	32953382		2203	4300	6503	-	-	-	SO:0001583	missense	0			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.304G>T	17.37:g.32953382G>T	ENSP00000316532:p.Val102Leu		Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.V102L	ENST00000321639.5	37	c.304	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	g	13.08	2.129102	0.37533	.	.	ENSG00000181291	ENST00000321639	T	0.13657	2.57	4.9	4.9	0.64082	.	0.197145	0.43416	D	0.000561	T	0.17109	0.0411	L	0.58302	1.8	0.27326	N	0.956896	P	0.37500	0.597	B	0.34722	0.188	T	0.08700	-1.0709	10	0.49607	T	0.09	-14.9218	17.0753	0.86584	0.0:0.0:1.0:0.0	.	102	Q6IEE7	T132E_HUMAN	L	102	ENSP00000316532:V102L	ENSP00000316532:V102L	V	+	1	0	TMEM132E	29977495	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.092000	0.50207	2.251000	0.74343	0.543000	0.68304	GTG	TMEM132E	-	NULL	ENSG00000181291		0.672	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	210	0.00	0	G	NM_207313		32953382	32953382	+1	no_errors	ENST00000321639	ensembl	human	known	69_37n	missense	132	24.14	42	SNP	1.000	T
TMPRSS11D	9407	genome.wustl.edu	37	4	68708316	68708316	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr4:68708316A>C	ENST00000283916.6	-	4	375	c.277T>G	c.(277-279)Tta>Gta	p.L93V	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11D_ENST00000509584.1_5'UTR|TMPRSS11D_ENST00000545541.1_De_novo_Start_OutOfFrame	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	93	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						TGATTTCTTAAATTTGATTCT	0.348																																						dbGAP											0													81.0	84.0	83.0					4																	68708316		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.277T>G	4.37:g.68708316A>C	ENSP00000283916:p.Leu93Val		Q08AF6	Missense_Mutation	SNP	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,pfam_SEA,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_SEA,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_SEA,pfscan_Peptidase_S1_S6	p.L93V	ENST00000283916.6	37	c.277	CCDS3518.1	4	.	.	.	.	.	.	.	.	.	.	A	16.07	3.019422	0.54576	.	.	ENSG00000153802	ENST00000283916	T	0.38077	1.16	5.3	1.67	0.24075	SEA (3);	0.000000	0.45361	D	0.000377	T	0.52725	0.1752	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.48833	-0.9000	10	0.52906	T	0.07	.	6.2836	0.21021	0.715:0.0:0.285:0.0	.	93	O60235	TM11D_HUMAN	V	93	ENSP00000283916:L93V	ENSP00000283916:L93V	L	-	1	2	TMPRSS11D	68390911	1.000000	0.71417	0.811000	0.32455	0.796000	0.44982	1.322000	0.33689	0.436000	0.26393	0.533000	0.62120	TTA	TMPRSS11D	-	pirsf_Pept_S1A_HAT/DESC1,pfam_SEA,smart_SEA,pfscan_SEA	ENSG00000153802		0.348	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11D	HGNC	protein_coding	OTTHUMT00000251430.3	36	0.00	0	A	NM_004262		68708316	68708316	-1	no_errors	ENST00000283916	ensembl	human	known	69_37n	missense	8	63.64	14	SNP	0.868	C
TP53	7157	genome.wustl.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000413465.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	GRCh37	CM083194|CM951225	TP53	M							97.0	87.0	90.0					17																	7578271		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H193R	ENST00000269305.4	37	c.578	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	75	0.00	0	T	NM_000546		7578271	7578271	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	26	46.94	23	SNP	0.998	C
TP53BP2	7159	genome.wustl.edu	37	1	223983917	223983917	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr1:223983917G>C	ENST00000343537.7	-	13	2615	c.2324C>G	c.(2323-2325)tCa>tGa	p.S775*	TP53BP2_ENST00000391879.2_Nonsense_Mutation_p.S8*|TP53BP2_ENST00000391878.2_Nonsense_Mutation_p.S646*|TP53BP2_ENST00000498843.1_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	769					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GGATGGGTATGATGGGACAGA	0.478																																						dbGAP											0													154.0	161.0	159.0					1																	223983917		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2324C>G	1.37:g.223983917G>C	ENSP00000341957:p.Ser775*		B4DG66|Q12892|Q86X75|Q96KQ3	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.S775*	ENST00000343537.7	37	c.2324	CCDS44319.1	1	.	.	.	.	.	.	.	.	.	.	G	41	8.687640	0.98914	.	.	ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879	.	.	.	5.47	5.47	0.80525	.	0.386217	0.29369	N	0.012357	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	17.5195	0.87783	0.0:0.0:1.0:0.0	.	.	.	.	X	646;775;8	.	ENSP00000341957:S775X	S	-	2	0	TP53BP2	222050540	0.808000	0.29022	0.010000	0.14722	0.994000	0.84299	4.632000	0.61311	2.593000	0.87608	0.655000	0.94253	TCA	TP53BP2	-	NULL	ENSG00000143514		0.478	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	HGNC	protein_coding	OTTHUMT00000090985.3	54	0.00	0	G	NM_001031685, NM_005426		223983917	223983917	-1	no_errors	ENST00000343537	ensembl	human	known	69_37n	nonsense	39	23.53	12	SNP	0.552	C
TSPAN6	7105	genome.wustl.edu	37	X	99890580	99890580	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chrX:99890580C>T	ENST00000373020.4	-	2	362	c.251G>A	c.(250-252)cGa>cAa	p.R84Q	TSPAN6_ENST00000496771.1_5'UTR	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6	84					negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						TGCAGAAGCTCGGCAGGTAGC	0.398																																						dbGAP											0													43.0	36.0	38.0					X																	99890580		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.251G>A	X.37:g.99890580C>T	ENSP00000362111:p.Arg84Gln		Q54A42|Q6IAN9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.R84Q	ENST00000373020.4	37	c.251	CCDS14470.1	X	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392134	0.83011	.	.	ENSG00000000003	ENST00000373020;ENST00000431386	T	0.80909	-1.43	5.58	5.58	0.84498	Tetraspanin, conserved site (1);	0.231004	0.45126	D	0.000383	T	0.81197	0.4772	M	0.78916	2.43	0.80722	D	1	B	0.26400	0.148	B	0.24541	0.054	T	0.77968	-0.2388	9	.	.	.	.	17.3234	0.87241	0.0:1.0:0.0:0.0	.	84	O43657	TSN6_HUMAN	Q	84;66	ENSP00000362111:R84Q	.	R	-	2	0	TSPAN6	99777236	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.686000	0.61700	2.359000	0.80004	0.523000	0.50628	CGA	TSPAN6	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000000003		0.398	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN6	HGNC	protein_coding	OTTHUMT00000057483.1	53	0.00	0	C			99890580	99890580	-1	no_errors	ENST00000373020	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179398054	179398054	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr2:179398054C>G	ENST00000591111.1	-	308	98589	c.98365G>C	c.(98365-98367)Gac>Cac	p.D32789H	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D25490H|TTN_ENST00000460472.2_Missense_Mutation_p.D25365H|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D25557H|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D34430H|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D31862H|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590040.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32789	Ig-like 145.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAACCCGTGTCTTCAGGCAAA	0.493																																						dbGAP											0													76.0	74.0	75.0					2																	179398054		1992	4172	6164	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98365G>C	2.37:g.179398054C>G	ENSP00000465570:p.Asp32789His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D31862H	ENST00000591111.1	37	c.95584		2	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624469	0.66901	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.67	5.67	0.87782	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.91472	0.7308	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92330	0.5873	9	0.87932	D	0	.	19.3646	0.94456	0.0:1.0:0.0:0.0	.	25365;25490;25557;32789	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	31862;25365;25557;25490;25362	ENSP00000343764:D31862H;ENSP00000434586:D25365H;ENSP00000340554:D25557H;ENSP00000352154:D25490H	ENSP00000340554:D25557H	D	-	1	0	TTN	179106300	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.794000	0.85869	2.688000	0.91661	0.555000	0.69702	GAC	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.493	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	73	0.00	0	C	NM_133378		179398054	179398054	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	69	10.39	8	SNP	1.000	G
USP54	159195	genome.wustl.edu	37	10	75289313	75289313	+	Intron	DEL	A	A	-			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr10:75289313delA	ENST00000339859.4	-	14	2161				USP54_ENST00000428547.1_Intron|RNU6-883P_ENST00000384597.1_RNA|USP54_ENST00000497106.1_Intron|USP54_ENST00000319786.7_Frame_Shift_Del_p.S729fs|USP54_ENST00000394811.2_Intron|USP54_ENST00000408019.1_Intron			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54						ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					TAGGAAGTTGAAAGAGCACAT	0.428											OREG0020266	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(195;880 2046 8854 25025 38456)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.2060+124T>-	10.37:g.75289313delA		1159	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Frame_Shift_Del	DEL	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.S729fs	ENST00000339859.4	37	c.2185	CCDS7329.2	10																																																																																			USP54	-	NULL	ENSG00000166348		0.428	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP54	HGNC	protein_coding	OTTHUMT00000316563.2	16	0.00	0	A	NM_152586		75289313	75289313	-1	no_errors	ENST00000319786	ensembl	human	known	69_37n	frame_shift_del	11	31.25	5	DEL	0.000	-
WDR11	55717	genome.wustl.edu	37	10	122668442	122668442	+	3'UTR	SNP	A	A	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr10:122668442A>C	ENST00000263461.6	+	0	4138				WDR11_ENST00000604509.1_3'UTR	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GTGAATGCTTAAGATTTTGAA	0.338																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.*217A>C	10.37:g.122668442A>C			A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	SNP	-	NULL	ENST00000263461.6	37	NULL	CCDS7619.1	10																																																																																			WDR11	-	-	ENSG00000120008		0.338	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	56	0.00	0	A			122668442	122668442	+1	no_errors	ENST00000497136	ensembl	human	known	69_37n	rna	53	17.19	11	SNP	0.000	C
XPO1	7514	genome.wustl.edu	37	2	61721114	61721114	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr2:61721114G>C	ENST00000401558.2	-	12	1887	c.1160C>G	c.(1159-1161)tCt>tGt	p.S387C	XPO1_ENST00000406957.1_Missense_Mutation_p.S387C|XPO1_ENST00000404992.2_Missense_Mutation_p.S387C	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	387	Interaction with Ran and nuclear export complex formation.|Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			GGCAGATGTAGAGAATGGACT	0.398			Mis		CLL																																	dbGAP	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													152.0	157.0	155.0					2																	61721114		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.1160C>G	2.37:g.61721114G>C	ENSP00000384863:p.Ser387Cys		A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.S387C	ENST00000401558.2	37	c.1160	CCDS33205.1	2	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279225	0.80692	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	.	.	.	6.08	6.08	0.98989	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52757	0.1754	L	0.48642	1.525	0.58432	D	0.999999	P	0.43542	0.81	B	0.34652	0.187	T	0.57533	-0.7795	9	0.56958	D	0.05	-16.4549	20.6721	0.99693	0.0:0.0:1.0:0.0	.	387	O14980	XPO1_HUMAN	C	387	.	ENSP00000384863:S387C	S	-	2	0	XPO1	61574618	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.870000	0.87175	2.894000	0.99253	0.591000	0.81541	TCT	XPO1	-	superfamily_ARM-type_fold	ENSG00000082898		0.398	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3	28	0.00	0	G	NM_003400		61721114	61721114	-1	no_errors	ENST00000401558	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	1.000	C
ZAN	7455	genome.wustl.edu	37	7	100365628	100365628	+	RNA	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr7:100365628C>T	ENST00000348028.3	+	0	5200				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCTCTGTGGGCTGTGTGGTGA	0.592																																						dbGAP											0													43.0	49.0	47.0					7																	100365628		2086	4209	6295	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100365628C>T			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.L1679	ENST00000348028.3	37	c.5035		7																																																																																			ZAN	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000146839		0.592	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	76	0.00	0	C	NM_003386		100365628	100365628	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	silent	48	35.14	26	SNP	0.973	T
ZDHHC11	79844	genome.wustl.edu	37	5	711731	711731	+	Intron	SNP	C	C	T			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr5:711731C>T	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GTGCCGTGCTCCCATTTCCCA	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-732G>A	5.37:g.711731C>T			Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-	ENSG00000206077		0.517	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		56	0.00	0	C	NM_024786		711731	711731	-1	no_errors	ENST00000522356	ensembl	human	known	69_37n	rna	36	26.53	13	SNP	0.031	T
ZNF208	7757	genome.wustl.edu	37	19	22155501	22155501	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr19:22155501A>C	ENST00000397126.4	-	4	2483	c.2335T>G	c.(2335-2337)Tgt>Ggt	p.C779G	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	779					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CATTCTTCACATTTGTAGGGT	0.363																																						dbGAP											0													38.0	43.0	41.0					19																	22155501		2064	4225	6289	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2335T>G	19.37:g.22155501A>C	ENSP00000380315:p.Cys779Gly			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C779G	ENST00000397126.4	37	c.2335	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	A	10.25	1.299421	0.23650	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	D	0.85258	-1.96	2.28	2.28	0.28536	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.90652	0.7068	.	.	.	0.34263	D	0.680085	D	0.76494	0.999	D	0.97110	1.0	D	0.91661	0.5342	8	0.87932	D	0	.	8.9508	0.35788	1.0:0.0:0.0:0.0	.	679	O43345	ZN208_HUMAN	G	779;679	ENSP00000380315:C779G	ENSP00000380315:C779G	C	-	1	0	ZNF208	21947341	0.993000	0.37304	0.368000	0.25939	0.177000	0.22998	4.640000	0.61368	0.705000	0.31890	0.232000	0.17820	TGT	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	26	0.00	0	A	NM_007153		22155501	22155501	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.770	C
ZNF536	9745	genome.wustl.edu	37	19	30934788	30934788	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A5FL-01A-11D-A27P-09	TCGA-E9-A5FL-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	20b0e3b8-7fc9-414a-848a-602614fa2727	8a6dbb92-338b-4fa8-bb83-803f333ea743	g.chr19:30934788A>C	ENST00000355537.3	+	2	466	c.319A>C	c.(319-321)Aac>Cac	p.N107H		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	107					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCAGTTCCTCAACGGGCAGAA	0.657																																						dbGAP											0													49.0	41.0	43.0					19																	30934788		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.319A>C	19.37:g.30934788A>C	ENSP00000347730:p.Asn107His		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N107H	ENST00000355537.3	37	c.319	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	A	16.24	3.067623	0.55539	.	.	ENSG00000198597	ENST00000355537	T	0.09723	2.95	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.20047	0.0482	N	0.19112	0.55	0.46798	D	0.999206	D;D	0.76494	0.999;0.999	D;D	0.91635	0.993;0.999	T	0.05801	-1.0863	10	0.38643	T	0.18	-41.2905	15.9146	0.79503	1.0:0.0:0.0:0.0	.	107;107	A7E228;O15090	.;ZN536_HUMAN	H	107	ENSP00000347730:N107H	ENSP00000347730:N107H	N	+	1	0	ZNF536	35626628	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.568000	0.82369	2.172000	0.68678	0.379000	0.24179	AAC	ZNF536	-	NULL	ENSG00000198597		0.657	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	102	0.00	0	A	NM_014717		30934788	30934788	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	missense	72	26.53	26	SNP	1.000	C
